>Feature sequence001 712 884 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1484 993 gene locus_tag LOCUS_00010 gene queD 1484 993 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264135.1 protein_id gnl|my_center|LOCUS_00010 1786 3174 gene locus_tag LOCUS_00020 1786 3174 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887075.1 protein_id gnl|my_center|LOCUS_00020 3877 3982 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4047 4709 gene locus_tag LOCUS_00030 4047 4709 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921300.1 protein_id gnl|my_center|LOCUS_00030 4969 8451 gene locus_tag LOCUS_00040 4969 8451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 8590 10128 gene locus_tag LOCUS_00050 8590 10128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 9989 10108 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10212 13892 gene locus_tag LOCUS_00060 10212 13892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 13638 13720 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13978 14889 gene locus_tag LOCUS_00070 13978 14889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 14990 15766 gene locus_tag LOCUS_00080 14990 15766 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324393.1 protein_id gnl|my_center|LOCUS_00080 16720 15812 gene locus_tag LOCUS_00090 16720 15812 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922316.1 protein_id gnl|my_center|LOCUS_00090 16973 17947 gene locus_tag LOCUS_00100 16973 17947 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_00100 18842 17985 gene locus_tag LOCUS_00110 18842 17985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 19119 19310 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20680 19502 gene locus_tag LOCUS_00120 20680 19502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 21870 20803 gene locus_tag LOCUS_00130 21870 20803 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326673.1 protein_id gnl|my_center|LOCUS_00130 22832 22967 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23126 23743 gene locus_tag LOCUS_00140 23126 23743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 24043 24435 gene locus_tag LOCUS_00150 24043 24435 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329772.1 protein_id gnl|my_center|LOCUS_00150 24878 24468 gene locus_tag LOCUS_00160 24878 24468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 27716 24930 gene locus_tag LOCUS_00170 27716 24930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 25953 26000 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28654 27941 gene locus_tag LOCUS_00180 28654 27941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 32842 28676 gene locus_tag LOCUS_00190 32842 28676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 31005 31099 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34945 32933 gene locus_tag LOCUS_00200 34945 32933 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532602.1 protein_id gnl|my_center|LOCUS_00200 35327 35881 gene locus_tag LOCUS_00210 35327 35881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 37081 36014 gene locus_tag LOCUS_00220 gene waaF 37081 36014 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_00220 37473 37078 gene locus_tag LOCUS_00230 37473 37078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 37534 37642 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37929 38107 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39085 40263 gene locus_tag LOCUS_00240 39085 40263 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061087.1 protein_id gnl|my_center|LOCUS_00240 42984 40270 gene locus_tag LOCUS_00250 42984 40270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 43184 43287 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43899 43324 gene locus_tag LOCUS_00260 43899 43324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 44084 44283 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45155 44355 gene locus_tag LOCUS_00270 gene larB 45155 44355 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335257.1 protein_id gnl|my_center|LOCUS_00270 46348 45395 gene locus_tag LOCUS_00280 gene galM 46348 45395 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399304.1 protein_id gnl|my_center|LOCUS_00280 46475 46753 gene locus_tag LOCUS_00290 46475 46753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 47540 46779 gene locus_tag LOCUS_00300 47540 46779 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_00300 50416 47657 gene locus_tag LOCUS_00310 50416 47657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 50857 51645 gene locus_tag LOCUS_00320 50857 51645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 52049 51702 gene locus_tag LOCUS_00330 52049 51702 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_00330 52932 52081 gene locus_tag LOCUS_00340 52932 52081 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121000.1 protein_id gnl|my_center|LOCUS_00340 52997 53149 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 53911 53270 gene locus_tag LOCUS_00350 gene eda 53911 53270 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_00350 54188 55930 gene locus_tag LOCUS_00360 54188 55930 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121786.1 protein_id gnl|my_center|LOCUS_00360 56509 55940 gene locus_tag LOCUS_00370 gene hpt 56509 55940 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_00370 57589 56648 gene locus_tag LOCUS_00380 57589 56648 CDS product DNA integrity scanning protein DisA nucleotide-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615923.1 protein_id gnl|my_center|LOCUS_00380 58648 57776 gene locus_tag LOCUS_00390 58648 57776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 60041 58911 gene locus_tag LOCUS_00400 60041 58911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 60482 75724 gene locus_tag LOCUS_00410 60482 75724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 62915 63004 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 67954 68076 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 77377 77595 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 77646 78755 gene locus_tag LOCUS_00420 77646 78755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 78633 78697 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 78787 81057 gene locus_tag LOCUS_00430 78787 81057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 83842 81275 gene locus_tag LOCUS_00440 83842 81275 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_00440 84787 83852 gene locus_tag LOCUS_00450 84787 83852 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921630.1 protein_id gnl|my_center|LOCUS_00450 85499 84915 gene locus_tag LOCUS_00460 85499 84915 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921949.1 protein_id gnl|my_center|LOCUS_00460 85866 85516 gene locus_tag LOCUS_00470 gene nirD 85866 85516 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327329.1 protein_id gnl|my_center|LOCUS_00470 86915 86088 gene locus_tag LOCUS_00480 86915 86088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 86977 87114 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 88548 87358 gene locus_tag LOCUS_00490 88548 87358 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703804.1 protein_id gnl|my_center|LOCUS_00490 89358 88693 gene locus_tag LOCUS_00500 89358 88693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 89459 89612 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 89872 90024 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 90313 90512 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 90879 91062 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 91874 91101 gene locus_tag LOCUS_00510 91874 91101 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_00510 92361 92435 gene locus_tag LOCUS_t00010 92361 92435 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 92549 93361 gene locus_tag LOCUS_00520 92549 93361 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119041.1 protein_id gnl|my_center|LOCUS_00520 93416 94330 gene locus_tag LOCUS_00530 93416 94330 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_00530 94977 94381 gene locus_tag LOCUS_00540 94977 94381 CDS product putative metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943559.1 protein_id gnl|my_center|LOCUS_00540 95894 94983 gene locus_tag LOCUS_00550 95894 94983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 96831 96220 gene locus_tag LOCUS_00560 96831 96220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 97210 96863 gene locus_tag LOCUS_00570 97210 96863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 97256 97353 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 98676 97948 gene locus_tag LOCUS_00580 98676 97948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 98850 100637 gene locus_tag LOCUS_00590 98850 100637 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_00590 100778 101419 gene locus_tag LOCUS_00600 100778 101419 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583746.1 protein_id gnl|my_center|LOCUS_00600 105086 101427 gene locus_tag LOCUS_00610 105086 101427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 105843 106574 gene locus_tag LOCUS_00620 105843 106574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326821.1 protein_id gnl|my_center|LOCUS_00620 106792 108534 gene locus_tag LOCUS_00630 106792 108534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 108999 108664 gene locus_tag LOCUS_00640 108999 108664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 109274 109410 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 110569 109577 gene locus_tag LOCUS_00650 gene hemB 110569 109577 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921457.1 protein_id gnl|my_center|LOCUS_00650 110739 111083 gene locus_tag LOCUS_00660 110739 111083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 113160 111223 gene locus_tag LOCUS_00670 113160 111223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 114280 113285 gene locus_tag LOCUS_00680 114280 113285 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389971.1 protein_id gnl|my_center|LOCUS_00680 114300 114491 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 115053 115234 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 116351 115407 gene locus_tag LOCUS_00690 116351 115407 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 protein_id gnl|my_center|LOCUS_00690 116725 117783 gene locus_tag LOCUS_00700 116725 117783 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922223.1 protein_id gnl|my_center|LOCUS_00700 118585 118199 gene locus_tag LOCUS_00710 118585 118199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 118607 118748 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 119047 119157 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 120666 121091 gene locus_tag LOCUS_00720 120666 121091 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941051.1 protein_id gnl|my_center|LOCUS_00720 121430 121696 gene locus_tag LOCUS_00730 121430 121696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 121806 123542 gene locus_tag LOCUS_00740 121806 123542 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118026.1 protein_id gnl|my_center|LOCUS_00740 122953 123050 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 124703 123546 gene locus_tag LOCUS_00750 124703 123546 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767199.1 protein_id gnl|my_center|LOCUS_00750 124715 124861 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 126448 125675 gene locus_tag LOCUS_00760 126448 125675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 127285 126662 gene locus_tag LOCUS_00770 127285 126662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 >Feature sequence002 275 473 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2057 2815 gene locus_tag LOCUS_00780 2057 2815 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249618.1 protein_id gnl|my_center|LOCUS_00780 3067 3774 gene locus_tag LOCUS_00790 3067 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 3747 4595 gene locus_tag LOCUS_00800 3747 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 5557 5664 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5679 7229 gene locus_tag LOCUS_00810 5679 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 7303 7464 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7910 8003 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8409 8482 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8602 9000 gene locus_tag LOCUS_00820 8602 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 8997 9383 gene locus_tag LOCUS_00830 8997 9383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 9414 11015 gene locus_tag LOCUS_00840 9414 11015 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_00840 11489 11211 gene locus_tag LOCUS_00850 11489 11211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 13000 11561 gene locus_tag LOCUS_00860 13000 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 13996 13097 gene locus_tag LOCUS_00870 13996 13097 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121957.1 protein_id gnl|my_center|LOCUS_00870 14211 14406 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15986 14604 gene locus_tag LOCUS_00880 15986 14604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 16887 18416 gene locus_tag LOCUS_00890 16887 18416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 18800 18513 gene locus_tag LOCUS_00900 18800 18513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 19160 18993 gene locus_tag LOCUS_00910 19160 18993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 20616 19888 gene locus_tag LOCUS_00920 20616 19888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 21288 21415 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22265 21642 gene locus_tag LOCUS_00930 22265 21642 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119018.1 protein_id gnl|my_center|LOCUS_00930 23053 22280 gene locus_tag LOCUS_00940 gene ubiE 23053 22280 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328112.1 protein_id gnl|my_center|LOCUS_00940 23125 24117 gene locus_tag LOCUS_00950 23125 24117 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399225.1 protein_id gnl|my_center|LOCUS_00950 24733 24068 gene locus_tag LOCUS_00960 gene cmk 24733 24068 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094752.1 protein_id gnl|my_center|LOCUS_00960 25940 24864 gene locus_tag LOCUS_00970 25940 24864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 27714 25828 gene locus_tag LOCUS_00980 27714 25828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 25962 26045 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27746 27841 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28528 29346 gene locus_tag LOCUS_00990 28528 29346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 30681 29446 gene locus_tag LOCUS_01000 30681 29446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 33606 30895 gene locus_tag LOCUS_01010 33606 30895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 33802 33954 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34902 35041 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35276 35085 gene locus_tag LOCUS_01020 35276 35085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 37572 35281 gene locus_tag LOCUS_01030 37572 35281 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922366.1 protein_id gnl|my_center|LOCUS_01030 37629 37784 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40429 37832 gene locus_tag LOCUS_01040 40429 37832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 38666 38770 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40913 41713 gene locus_tag LOCUS_01050 40913 41713 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333044.1 protein_id gnl|my_center|LOCUS_01050 43011 41863 gene locus_tag LOCUS_01060 gene queA 43011 41863 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_01060 43293 44192 gene locus_tag LOCUS_01070 43293 44192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 44728 44249 gene locus_tag LOCUS_01080 44728 44249 CDS product MJ0936 family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870450.1 protein_id gnl|my_center|LOCUS_01080 46157 44850 gene locus_tag LOCUS_01090 46157 44850 CDS product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703671.1 protein_id gnl|my_center|LOCUS_01090 47515 47699 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47715 48758 gene locus_tag LOCUS_01100 47715 48758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 49294 50412 gene locus_tag LOCUS_01110 49294 50412 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_01110 50469 52175 gene locus_tag LOCUS_01120 50469 52175 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_01120 52289 53539 gene locus_tag LOCUS_01130 52289 53539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 53728 54729 gene locus_tag LOCUS_01140 53728 54729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 54777 55829 gene locus_tag LOCUS_01150 54777 55829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 55832 57052 gene locus_tag LOCUS_01160 55832 57052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 57058 58578 gene locus_tag LOCUS_01170 57058 58578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 58731 60641 gene locus_tag LOCUS_01180 58731 60641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 60698 66109 gene locus_tag LOCUS_01190 60698 66109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 66505 67665 gene locus_tag LOCUS_01200 66505 67665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 67762 67894 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 68084 68992 gene locus_tag LOCUS_01210 68084 68992 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921310.1 protein_id gnl|my_center|LOCUS_01210 69934 69011 gene locus_tag LOCUS_01220 69934 69011 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140301.1 protein_id gnl|my_center|LOCUS_01220 71509 69986 gene locus_tag LOCUS_01230 71509 69986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 73677 71638 gene locus_tag LOCUS_01240 73677 71638 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669835.1 protein_id gnl|my_center|LOCUS_01240 75583 73922 gene locus_tag LOCUS_01250 75583 73922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 78244 75842 gene locus_tag LOCUS_01260 78244 75842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 78350 78544 gene locus_tag LOCUS_01270 78350 78544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 79146 80258 gene locus_tag LOCUS_01280 79146 80258 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615452.1 protein_id gnl|my_center|LOCUS_01280 80953 80366 gene locus_tag LOCUS_01290 80953 80366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 81589 81014 gene locus_tag LOCUS_01300 81589 81014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 81603 81734 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 84029 82104 gene locus_tag LOCUS_01310 gene dxs 84029 82104 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325559.1 protein_id gnl|my_center|LOCUS_01310 85148 84258 gene locus_tag LOCUS_01320 85148 84258 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_01320 85925 86022 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 86028 86639 gene locus_tag LOCUS_01330 86028 86639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 86759 87487 gene locus_tag LOCUS_01340 86759 87487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 88908 87505 gene locus_tag LOCUS_01350 88908 87505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 89597 89340 gene locus_tag LOCUS_01360 gene glnB 89597 89340 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073353.1 protein_id gnl|my_center|LOCUS_01360 89678 89782 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 90130 89942 gene locus_tag LOCUS_01370 90130 89942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 90242 90381 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 92148 92795 gene locus_tag LOCUS_01380 92148 92795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 93442 92930 gene locus_tag LOCUS_01390 93442 92930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 94762 93488 gene locus_tag LOCUS_01400 94762 93488 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329509.1 protein_id gnl|my_center|LOCUS_01400 95123 95878 gene locus_tag LOCUS_01410 95123 95878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 96338 96168 gene locus_tag LOCUS_01420 96338 96168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 96627 97445 gene locus_tag LOCUS_01430 96627 97445 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815039.1 protein_id gnl|my_center|LOCUS_01430 97651 98457 gene locus_tag LOCUS_01440 97651 98457 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332037.1 protein_id gnl|my_center|LOCUS_01440 98515 99699 gene locus_tag LOCUS_01450 98515 99699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 99911 99750 gene locus_tag LOCUS_01460 99911 99750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 101060 100110 gene locus_tag LOCUS_01470 101060 100110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 102397 101093 gene locus_tag LOCUS_01480 102397 101093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 101157 101249 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 103010 102429 gene locus_tag LOCUS_01490 103010 102429 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105333325.1 protein_id gnl|my_center|LOCUS_01490 104206 103121 gene locus_tag LOCUS_01500 104206 103121 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 protein_id gnl|my_center|LOCUS_01500 104237 104355 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 106217 104598 gene locus_tag LOCUS_01510 106217 104598 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123879.1 protein_id gnl|my_center|LOCUS_01510 107188 107748 gene locus_tag LOCUS_01520 107188 107748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 107948 109153 gene locus_tag LOCUS_01530 107948 109153 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922567.1 protein_id gnl|my_center|LOCUS_01530 108755 108866 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 109345 110760 gene locus_tag LOCUS_01540 109345 110760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 110619 110706 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 110780 111181 gene locus_tag LOCUS_01550 110780 111181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 111342 111692 gene locus_tag LOCUS_01560 111342 111692 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420010.1 protein_id gnl|my_center|LOCUS_01560 111718 111880 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 112083 112221 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 112283 112777 gene locus_tag LOCUS_01570 gene recR 112283 112777 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327785.1 protein_id gnl|my_center|LOCUS_01570 113097 114527 gene locus_tag LOCUS_01580 gene rpoN 113097 114527 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435015.1 protein_id gnl|my_center|LOCUS_01580 115974 114613 gene locus_tag LOCUS_01590 115974 114613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 116316 116487 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence003 948 112 gene locus_tag LOCUS_01600 948 112 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 protein_id gnl|my_center|LOCUS_01600 1034 1161 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2295 1369 gene locus_tag LOCUS_01610 2295 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 2394 2523 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3134 2550 gene locus_tag LOCUS_01620 gene pnuC 3134 2550 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400615.1 protein_id gnl|my_center|LOCUS_01620 4395 3148 gene locus_tag LOCUS_01630 4395 3148 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_01630 5563 4493 gene locus_tag LOCUS_01640 5563 4493 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722159.1 protein_id gnl|my_center|LOCUS_01640 6948 5608 gene locus_tag LOCUS_01650 6948 5608 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_01650 7128 8237 gene locus_tag LOCUS_01660 7128 8237 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 protein_id gnl|my_center|LOCUS_01660 8302 9339 gene locus_tag LOCUS_01670 8302 9339 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267821.1 protein_id gnl|my_center|LOCUS_01670 9524 10813 gene locus_tag LOCUS_01680 9524 10813 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_01680 11035 12963 gene locus_tag LOCUS_01690 11035 12963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 12807 12865 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12869 13438 gene locus_tag LOCUS_01700 12869 13438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 13759 13892 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14010 15494 gene locus_tag LOCUS_01710 14010 15494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 15351 15441 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15491 16267 gene locus_tag LOCUS_01720 15491 16267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 16303 17643 gene locus_tag LOCUS_01730 16303 17643 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121673.1 protein_id gnl|my_center|LOCUS_01730 19130 17745 gene locus_tag LOCUS_01740 19130 17745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 17777 17851 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20160 19273 gene locus_tag LOCUS_01750 20160 19273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 20387 21442 gene locus_tag LOCUS_01760 20387 21442 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120960.1 protein_id gnl|my_center|LOCUS_01760 22263 21457 gene locus_tag LOCUS_01770 22263 21457 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_01770 23062 24033 gene locus_tag LOCUS_01780 23062 24033 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121074.1 protein_id gnl|my_center|LOCUS_01780 25137 24043 gene locus_tag LOCUS_01790 25137 24043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 26469 25204 gene locus_tag LOCUS_01800 26469 25204 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_01800 28073 26514 gene locus_tag LOCUS_01810 28073 26514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 28149 28279 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29072 29275 gene locus_tag LOCUS_01820 29072 29275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 29424 33752 gene locus_tag LOCUS_01830 29424 33752 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921311.1 protein_id gnl|my_center|LOCUS_01830 34267 33755 gene locus_tag LOCUS_01840 34267 33755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 34988 34311 gene locus_tag LOCUS_01850 34988 34311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 34353 34414 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36928 35066 gene locus_tag LOCUS_01860 36928 35066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 38344 37022 gene locus_tag LOCUS_01870 38344 37022 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118102.1 protein_id gnl|my_center|LOCUS_01870 38622 40073 gene locus_tag LOCUS_01880 gene cls 38622 40073 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122347.1 protein_id gnl|my_center|LOCUS_01880 41854 40085 gene locus_tag LOCUS_01890 41854 40085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 42473 42565 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42676 46278 gene locus_tag LOCUS_01900 42676 46278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 47325 46684 gene locus_tag LOCUS_01910 47325 46684 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325064.1 protein_id gnl|my_center|LOCUS_01910 47871 47539 gene locus_tag LOCUS_01920 47871 47539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118471.1 protein_id gnl|my_center|LOCUS_01920 48291 49337 gene locus_tag LOCUS_01930 48291 49337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 49424 50473 gene locus_tag LOCUS_01940 gene purM 49424 50473 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922559.1 protein_id gnl|my_center|LOCUS_01940 50531 51373 gene locus_tag LOCUS_01950 50531 51373 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333289.1 protein_id gnl|my_center|LOCUS_01950 51548 54622 gene locus_tag LOCUS_01960 51548 54622 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615465.1 protein_id gnl|my_center|LOCUS_01960 54619 56073 gene locus_tag LOCUS_01970 54619 56073 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922839.1 protein_id gnl|my_center|LOCUS_01970 56168 59188 gene locus_tag LOCUS_01980 56168 59188 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813379.1 protein_id gnl|my_center|LOCUS_01980 59763 59290 gene locus_tag LOCUS_01990 59763 59290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 64384 59840 gene locus_tag LOCUS_02000 64384 59840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 59873 60010 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 64467 65450 gene locus_tag LOCUS_02010 64467 65450 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559357.1 protein_id gnl|my_center|LOCUS_02010 65488 66411 gene locus_tag LOCUS_02020 65488 66411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022102.1 protein_id gnl|my_center|LOCUS_02020 66498 68132 gene locus_tag LOCUS_02030 66498 68132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 67751 67816 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 68020 68259 gene locus_tag LOCUS_02040 68020 68259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 68478 69536 gene locus_tag LOCUS_02050 68478 69536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02050 69433 69486 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 69500 69754 gene locus_tag LOCUS_02060 69500 69754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02060 70032 70103 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 70490 70972 gene locus_tag LOCUS_02070 70490 70972 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330832.1 protein_id gnl|my_center|LOCUS_02070 71025 71780 gene locus_tag LOCUS_02080 71025 71780 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142832.1 protein_id gnl|my_center|LOCUS_02080 71829 72527 gene locus_tag LOCUS_02090 gene yhhW 71829 72527 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639816.1 protein_id gnl|my_center|LOCUS_02090 72709 74358 gene locus_tag LOCUS_02100 gene pgi 72709 74358 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888377.1 protein_id gnl|my_center|LOCUS_02100 75578 74400 gene locus_tag LOCUS_02110 75578 74400 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921425.1 protein_id gnl|my_center|LOCUS_02110 76549 75689 gene locus_tag LOCUS_02120 76549 75689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 77300 76482 gene locus_tag LOCUS_02130 77300 76482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 76568 76647 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 78598 78758 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 79039 79199 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 79240 80691 gene locus_tag LOCUS_02140 79240 80691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 80701 81225 gene locus_tag LOCUS_02150 80701 81225 CDS product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122795.1 protein_id gnl|my_center|LOCUS_02150 81412 81188 gene locus_tag LOCUS_02160 81412 81188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 81470 81566 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 82482 84026 gene locus_tag LOCUS_02170 82482 84026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 82815 82956 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 84206 85633 gene locus_tag LOCUS_02180 84206 85633 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121030.1 protein_id gnl|my_center|LOCUS_02180 85801 88128 gene locus_tag LOCUS_02190 85801 88128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 88510 88142 gene locus_tag LOCUS_02200 88510 88142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 88680 89558 gene locus_tag LOCUS_02210 88680 89558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 89655 91277 gene locus_tag LOCUS_02220 89655 91277 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616258.1 protein_id gnl|my_center|LOCUS_02220 91632 91297 gene locus_tag LOCUS_02230 91632 91297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 92194 91625 gene locus_tag LOCUS_02240 92194 91625 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145388845.1 protein_id gnl|my_center|LOCUS_02240 92454 92191 gene locus_tag LOCUS_02250 92454 92191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 93668 92409 gene locus_tag LOCUS_02260 93668 92409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 94177 94292 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 95385 94363 gene locus_tag LOCUS_02270 95385 94363 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119992.1 protein_id gnl|my_center|LOCUS_02270 95735 96772 gene locus_tag LOCUS_02280 gene aroF 95735 96772 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121242.1 protein_id gnl|my_center|LOCUS_02280 >Feature sequence004 64 1002 gene locus_tag LOCUS_02290 64 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 1090 1241 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2609 1377 gene locus_tag LOCUS_02300 2609 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 3952 2609 gene locus_tag LOCUS_02310 3952 2609 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121673.1 protein_id gnl|my_center|LOCUS_02310 6534 4021 gene locus_tag LOCUS_02320 6534 4021 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_02320 4040 4172 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7093 7314 gene locus_tag LOCUS_02330 7093 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 7548 10139 gene locus_tag LOCUS_02340 7548 10139 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615806.1 protein_id gnl|my_center|LOCUS_02340 10136 10993 gene locus_tag LOCUS_02350 10136 10993 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260625.1 protein_id gnl|my_center|LOCUS_02350 11107 12291 gene locus_tag LOCUS_02360 11107 12291 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327063.1 protein_id gnl|my_center|LOCUS_02360 12288 13280 gene locus_tag LOCUS_02370 12288 13280 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922127.1 protein_id gnl|my_center|LOCUS_02370 13307 13413 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13428 15509 gene locus_tag LOCUS_02380 13428 15509 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121743.1 protein_id gnl|my_center|LOCUS_02380 15506 19264 gene locus_tag LOCUS_02390 15506 19264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121744.1 protein_id gnl|my_center|LOCUS_02390 19261 21654 gene locus_tag LOCUS_02400 19261 21654 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 protein_id gnl|my_center|LOCUS_02400 21656 22642 gene locus_tag LOCUS_02410 21656 22642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061227.1 protein_id gnl|my_center|LOCUS_02410 22972 25518 gene locus_tag LOCUS_02420 22972 25518 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118122.1 protein_id gnl|my_center|LOCUS_02420 25598 27034 gene locus_tag LOCUS_02430 25598 27034 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_02430 28472 27054 gene locus_tag LOCUS_02440 28472 27054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 28750 28932 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29691 30023 gene locus_tag LOCUS_02450 29691 30023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 33638 31020 gene locus_tag LOCUS_02460 33638 31020 CDS product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260401.1 protein_id gnl|my_center|LOCUS_02460 31042 31218 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34350 33685 gene locus_tag LOCUS_02470 34350 33685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 34373 34492 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38487 36430 gene locus_tag LOCUS_02480 38487 36430 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140584.1 protein_id gnl|my_center|LOCUS_02480 39048 40805 gene locus_tag LOCUS_02490 gene ggt 39048 40805 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703698.1 protein_id gnl|my_center|LOCUS_02490 42162 41044 gene locus_tag LOCUS_02500 42162 41044 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_02500 42740 45103 gene locus_tag LOCUS_02510 42740 45103 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921574.1 protein_id gnl|my_center|LOCUS_02510 46183 46369 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46899 48014 gene locus_tag LOCUS_02520 46899 48014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 48086 48254 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48563 48742 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49045 49198 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51587 50187 gene locus_tag LOCUS_02530 51587 50187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 52503 52533 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 54232 55200 gene locus_tag LOCUS_02540 54232 55200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 55227 56288 gene locus_tag LOCUS_02550 55227 56288 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333030.1 protein_id gnl|my_center|LOCUS_02550 56428 57462 gene locus_tag LOCUS_02560 56428 57462 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_02560 57516 57695 gene locus_tag LOCUS_02570 57516 57695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 59326 57902 gene locus_tag LOCUS_02580 59326 57902 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099258810.1 protein_id gnl|my_center|LOCUS_02580 59777 59379 gene locus_tag LOCUS_02590 59777 59379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 59818 59942 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 63120 60853 gene locus_tag LOCUS_02600 63120 60853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 65272 63395 gene locus_tag LOCUS_02610 65272 63395 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_02610 67094 65703 gene locus_tag LOCUS_02620 67094 65703 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_02620 69544 67112 gene locus_tag LOCUS_02630 69544 67112 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921574.1 protein_id gnl|my_center|LOCUS_02630 71308 69707 gene locus_tag LOCUS_02640 71308 69707 CDS product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816830.1 protein_id gnl|my_center|LOCUS_02640 72646 71318 gene locus_tag LOCUS_02650 72646 71318 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_02650 74915 72699 gene locus_tag LOCUS_02660 74915 72699 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816832.1 protein_id gnl|my_center|LOCUS_02660 77590 75083 gene locus_tag LOCUS_02670 77590 75083 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616124.1 protein_id gnl|my_center|LOCUS_02670 78876 77593 gene locus_tag LOCUS_02680 78876 77593 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123786.1 protein_id gnl|my_center|LOCUS_02680 79205 80494 gene locus_tag LOCUS_02690 79205 80494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921591.1 protein_id gnl|my_center|LOCUS_02690 80639 81979 gene locus_tag LOCUS_02700 80639 81979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 82463 82592 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 83226 84098 gene locus_tag LOCUS_02710 83226 84098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 84402 84139 gene locus_tag LOCUS_02720 84402 84139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 87943 84410 gene locus_tag LOCUS_02730 87943 84410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 84436 84569 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 88073 90907 gene locus_tag LOCUS_02740 88073 90907 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 protein_id gnl|my_center|LOCUS_02740 90974 92842 gene locus_tag LOCUS_02750 90974 92842 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_02750 94132 93065 gene locus_tag LOCUS_02760 gene arsB 94132 93065 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462028.1 protein_id gnl|my_center|LOCUS_02760 94594 94217 gene locus_tag LOCUS_02770 94594 94217 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948550.1 protein_id gnl|my_center|LOCUS_02770 95082 96875 gene locus_tag LOCUS_02780 95082 96875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 96673 96796 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence005 799 20 gene locus_tag LOCUS_02790 799 20 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326458.1 protein_id gnl|my_center|LOCUS_02790 1079 879 gene locus_tag LOCUS_02800 1079 879 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326457.1 protein_id gnl|my_center|LOCUS_02800 1467 1129 gene locus_tag LOCUS_02810 1467 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 1664 1801 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2693 2859 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3661 3314 gene locus_tag LOCUS_02820 3661 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 3771 3862 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5863 3980 gene locus_tag LOCUS_02830 5863 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 6712 6026 gene locus_tag LOCUS_02840 6712 6026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 7171 6731 gene locus_tag LOCUS_02850 7171 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 8579 7212 gene locus_tag LOCUS_02860 gene fliI 8579 7212 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_02860 9360 8743 gene locus_tag LOCUS_02870 9360 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 9542 10432 gene locus_tag LOCUS_02880 gene ubiA 9542 10432 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119017.1 protein_id gnl|my_center|LOCUS_02880 10630 11760 gene locus_tag LOCUS_02890 gene mqnE 10630 11760 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339462.1 protein_id gnl|my_center|LOCUS_02890 12832 11894 gene locus_tag LOCUS_02900 12832 11894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 13709 12927 gene locus_tag LOCUS_02910 gene uppS 13709 12927 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328291.1 protein_id gnl|my_center|LOCUS_02910 14071 13880 gene locus_tag LOCUS_02920 14071 13880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 15778 14378 gene locus_tag LOCUS_02930 15778 14378 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339839.1 protein_id gnl|my_center|LOCUS_02930 16032 16207 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16603 16772 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17079 17229 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17429 17556 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17919 18035 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18430 19788 gene locus_tag LOCUS_02940 gene der 18430 19788 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330049.1 protein_id gnl|my_center|LOCUS_02940 20563 19865 gene locus_tag LOCUS_02950 20563 19865 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120859.1 protein_id gnl|my_center|LOCUS_02950 21521 21132 gene locus_tag LOCUS_02960 21521 21132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 22457 21588 gene locus_tag LOCUS_02970 22457 21588 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118509.1 protein_id gnl|my_center|LOCUS_02970 24155 22734 gene locus_tag LOCUS_02980 gene lpdA 24155 22734 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_02980 24266 24434 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25855 24527 gene locus_tag LOCUS_02990 25855 24527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 26323 28410 gene locus_tag LOCUS_03000 26323 28410 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921986.1 protein_id gnl|my_center|LOCUS_03000 28455 29804 gene locus_tag LOCUS_03010 28455 29804 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120991.1 protein_id gnl|my_center|LOCUS_03010 30635 29856 gene locus_tag LOCUS_03020 30635 29856 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922035.1 protein_id gnl|my_center|LOCUS_03020 30869 30953 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31706 31866 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32088 32277 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32530 33321 gene locus_tag LOCUS_03030 32530 33321 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972950.1 protein_id gnl|my_center|LOCUS_03030 33732 34019 gene locus_tag LOCUS_03040 33732 34019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 34804 34079 gene locus_tag LOCUS_03050 34804 34079 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105300.1 protein_id gnl|my_center|LOCUS_03050 34950 35156 gene locus_tag LOCUS_03060 34950 35156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 36400 35282 gene locus_tag LOCUS_03070 36400 35282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 36413 36507 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36998 37163 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38143 37196 gene locus_tag LOCUS_03080 38143 37196 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325730.1 protein_id gnl|my_center|LOCUS_03080 38460 39116 gene locus_tag LOCUS_03090 38460 39116 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082246.1 protein_id gnl|my_center|LOCUS_03090 39518 41305 gene locus_tag LOCUS_03100 39518 41305 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326414.1 protein_id gnl|my_center|LOCUS_03100 41544 42239 gene locus_tag LOCUS_03110 41544 42239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 42286 43311 gene locus_tag LOCUS_03120 gene trpD 42286 43311 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966438.1 protein_id gnl|my_center|LOCUS_03120 44213 43377 gene locus_tag LOCUS_03130 44213 43377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 45752 44847 gene locus_tag LOCUS_03140 45752 44847 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120018.1 protein_id gnl|my_center|LOCUS_03140 45980 45771 gene locus_tag LOCUS_03150 gene thiS 45980 45771 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049507.1 protein_id gnl|my_center|LOCUS_03150 47398 46058 gene locus_tag LOCUS_03160 gene trkA 47398 46058 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327001.1 protein_id gnl|my_center|LOCUS_03160 47591 48235 gene locus_tag LOCUS_03170 47591 48235 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_03170 49177 48413 gene locus_tag LOCUS_03180 49177 48413 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329364.1 protein_id gnl|my_center|LOCUS_03180 51495 49705 gene locus_tag LOCUS_03190 51495 49705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 51868 54132 gene locus_tag LOCUS_03200 51868 54132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 54277 54981 gene locus_tag LOCUS_03210 54277 54981 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922323.1 protein_id gnl|my_center|LOCUS_03210 55090 55256 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 55347 56621 gene locus_tag LOCUS_03220 55347 56621 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039292.1 protein_id gnl|my_center|LOCUS_03220 56872 58158 gene locus_tag LOCUS_03230 56872 58158 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327153.1 protein_id gnl|my_center|LOCUS_03230 58186 58596 gene locus_tag LOCUS_03240 58186 58596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325780.1 protein_id gnl|my_center|LOCUS_03240 60504 58867 gene locus_tag LOCUS_03250 60504 58867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 62220 60979 gene locus_tag LOCUS_03260 62220 60979 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120393.1 protein_id gnl|my_center|LOCUS_03260 62260 62396 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 63052 62645 gene locus_tag LOCUS_03270 63052 62645 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324235.1 protein_id gnl|my_center|LOCUS_03270 64315 63296 gene locus_tag LOCUS_03280 64315 63296 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118349.1 protein_id gnl|my_center|LOCUS_03280 64937 64455 gene locus_tag LOCUS_03290 64937 64455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 65221 66096 gene locus_tag LOCUS_03300 65221 66096 CDS product excisionase family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335835.1 protein_id gnl|my_center|LOCUS_03300 67103 67273 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 67314 67652 gene locus_tag LOCUS_03310 67314 67652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 67676 67787 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 67845 69593 gene locus_tag LOCUS_03320 gene polX 67845 69593 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615613.1 protein_id gnl|my_center|LOCUS_03320 69667 70305 gene locus_tag LOCUS_03330 69667 70305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 70384 70677 gene locus_tag LOCUS_03340 70384 70677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 70799 73156 gene locus_tag LOCUS_03350 gene priA 70799 73156 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922147.1 protein_id gnl|my_center|LOCUS_03350 73592 75022 gene locus_tag LOCUS_03360 73592 75022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 74866 74996 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 75429 75527 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 75616 76557 gene locus_tag LOCUS_03370 75616 76557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 77113 78666 gene locus_tag LOCUS_03380 77113 78666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 79044 78826 gene locus_tag LOCUS_03390 79044 78826 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327487.1 protein_id gnl|my_center|LOCUS_03390 79468 79052 gene locus_tag LOCUS_03400 79468 79052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 81302 79629 gene locus_tag LOCUS_03410 81302 79629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 >Feature sequence006 123 255 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 296 895 gene locus_tag LOCUS_03420 296 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 960 1092 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1818 1144 gene locus_tag LOCUS_03430 1818 1144 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_03430 2038 2282 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2742 3041 gene locus_tag LOCUS_03440 2742 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 3252 5132 gene locus_tag LOCUS_03450 3252 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 5672 7240 gene locus_tag LOCUS_03460 5672 7240 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810537.1 protein_id gnl|my_center|LOCUS_03460 7820 7901 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7917 9209 gene locus_tag LOCUS_03470 7917 9209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 9529 9317 gene locus_tag LOCUS_03480 9529 9317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 9923 11539 gene locus_tag LOCUS_03490 9923 11539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 11647 12846 gene locus_tag LOCUS_03500 11647 12846 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121149.1 protein_id gnl|my_center|LOCUS_03500 12848 15301 gene locus_tag LOCUS_03510 12848 15301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 14905 15030 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15497 16603 gene locus_tag LOCUS_03520 15497 16603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 16713 16844 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17035 18525 gene locus_tag LOCUS_03530 17035 18525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 18736 18930 gene locus_tag LOCUS_03540 18736 18930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 18920 19486 gene locus_tag LOCUS_03550 gene cyaB 18920 19486 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877237.1 protein_id gnl|my_center|LOCUS_03550 19536 20048 gene locus_tag LOCUS_03560 gene mcsA 19536 20048 CDS product protein-arginine kinase activator protein McsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966297.1 protein_id gnl|my_center|LOCUS_03560 20062 20400 gene locus_tag LOCUS_03570 20062 20400 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326321.1 protein_id gnl|my_center|LOCUS_03570 21309 20416 gene locus_tag LOCUS_03580 21309 20416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 21417 22256 gene locus_tag LOCUS_03590 21417 22256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 22270 22953 gene locus_tag LOCUS_03600 22270 22953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 23921 22989 gene locus_tag LOCUS_03610 23921 22989 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841461.1 protein_id gnl|my_center|LOCUS_03610 25091 24231 gene locus_tag LOCUS_03620 25091 24231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 25985 25113 gene locus_tag LOCUS_03630 25985 25113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 27643 26114 gene locus_tag LOCUS_03640 27643 26114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 27795 27904 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29579 28152 gene locus_tag LOCUS_03650 29579 28152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 28523 28637 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30143 29592 gene locus_tag LOCUS_03660 30143 29592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 30167 30386 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32078 30963 gene locus_tag LOCUS_03670 32078 30963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 32159 32341 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32736 32823 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33394 33011 gene locus_tag LOCUS_03680 33394 33011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 33798 33484 gene locus_tag LOCUS_03690 33798 33484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 34693 33959 gene locus_tag LOCUS_03700 34693 33959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 34789 34948 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35355 35499 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35734 35875 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38410 36029 gene locus_tag LOCUS_03710 38410 36029 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615954.1 protein_id gnl|my_center|LOCUS_03710 38632 39225 gene locus_tag LOCUS_03720 gene hisB 38632 39225 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325657.1 protein_id gnl|my_center|LOCUS_03720 40215 39277 gene locus_tag LOCUS_03730 40215 39277 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325399.1 protein_id gnl|my_center|LOCUS_03730 42007 40520 gene locus_tag LOCUS_03740 42007 40520 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_03740 43231 42245 gene locus_tag LOCUS_03750 43231 42245 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_03750 43504 45024 gene locus_tag LOCUS_03760 43504 45024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 46201 45101 gene locus_tag LOCUS_03770 46201 45101 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_03770 46441 47871 gene locus_tag LOCUS_03780 46441 47871 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669743.1 protein_id gnl|my_center|LOCUS_03780 47607 47704 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48358 47981 gene locus_tag LOCUS_03790 48358 47981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 48808 51552 gene locus_tag LOCUS_03800 48808 51552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 51638 52930 gene locus_tag LOCUS_03810 51638 52930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 53400 53104 gene locus_tag LOCUS_03820 53400 53104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 53893 53979 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 54464 55336 gene locus_tag LOCUS_03830 54464 55336 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033982.1 protein_id gnl|my_center|LOCUS_03830 56668 55361 gene locus_tag LOCUS_03840 56668 55361 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922280.1 protein_id gnl|my_center|LOCUS_03840 58047 56842 gene locus_tag LOCUS_03850 58047 56842 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122076.1 protein_id gnl|my_center|LOCUS_03850 58676 58143 gene locus_tag LOCUS_03860 58676 58143 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530095.1 protein_id gnl|my_center|LOCUS_03860 58883 59629 gene locus_tag LOCUS_03870 58883 59629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123337.1 protein_id gnl|my_center|LOCUS_03870 60322 59705 gene locus_tag LOCUS_03880 60322 59705 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922085.1 protein_id gnl|my_center|LOCUS_03880 60484 61203 gene locus_tag LOCUS_03890 60484 61203 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969922.1 protein_id gnl|my_center|LOCUS_03890 62395 61430 gene locus_tag LOCUS_03900 62395 61430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 63036 62395 gene locus_tag LOCUS_03910 63036 62395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 63755 65737 gene locus_tag LOCUS_03920 63755 65737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 63795 63955 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 66983 66516 gene locus_tag LOCUS_03930 66983 66516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 67430 69301 gene locus_tag LOCUS_03940 67430 69301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 69007 69056 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 69383 70624 gene locus_tag LOCUS_03950 69383 70624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 70958 71088 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 71448 71693 gene locus_tag LOCUS_03960 71448 71693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 74736 71659 gene locus_tag LOCUS_03970 74736 71659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 73939 73984 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 76082 76191 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 76496 76628 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 76687 78069 gene locus_tag LOCUS_03980 76687 78069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 77884 77994 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 78030 78875 gene locus_tag LOCUS_03990 78030 78875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 >Feature sequence007 384 593 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1949 681 gene locus_tag LOCUS_04000 1949 681 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922632.1 protein_id gnl|my_center|LOCUS_04000 3977 1983 gene locus_tag LOCUS_04010 gene asnB 3977 1983 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124141.1 protein_id gnl|my_center|LOCUS_04010 3270 3333 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5147 4065 gene locus_tag LOCUS_04020 5147 4065 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329097.1 protein_id gnl|my_center|LOCUS_04020 5477 5277 gene locus_tag LOCUS_04030 5477 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 6889 5474 gene locus_tag LOCUS_04040 6889 5474 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124139.1 protein_id gnl|my_center|LOCUS_04040 5585 5709 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7413 6886 gene locus_tag LOCUS_04050 7413 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124138.1 protein_id gnl|my_center|LOCUS_04050 7627 8070 gene locus_tag LOCUS_04060 7627 8070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 9808 8084 gene locus_tag LOCUS_04070 9808 8084 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948830.1 protein_id gnl|my_center|LOCUS_04070 10181 10822 gene locus_tag LOCUS_04080 10181 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04080 10583 10638 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10765 11418 gene locus_tag LOCUS_04090 10765 11418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04090 11730 13169 gene locus_tag LOCUS_04100 11730 13169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 12985 13093 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13153 15090 gene locus_tag LOCUS_04110 13153 15090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 16358 15099 gene locus_tag LOCUS_04120 16358 15099 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118010.1 protein_id gnl|my_center|LOCUS_04120 16611 16408 gene locus_tag LOCUS_04130 16611 16408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 17142 16651 gene locus_tag LOCUS_04140 17142 16651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 17339 17121 gene locus_tag LOCUS_04150 17339 17121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 17782 17336 gene locus_tag LOCUS_04160 17782 17336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 18106 17840 gene locus_tag LOCUS_04170 18106 17840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 18627 18172 gene locus_tag LOCUS_04180 18627 18172 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335921.1 protein_id gnl|my_center|LOCUS_04180 19840 18764 gene locus_tag LOCUS_04190 19840 18764 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081611101.1 protein_id gnl|my_center|LOCUS_04190 20506 19901 gene locus_tag LOCUS_04200 20506 19901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 20518 20642 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20801 20953 gene locus_tag LOCUS_04210 20801 20953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 22616 21225 gene locus_tag LOCUS_04220 22616 21225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 23177 22728 gene locus_tag LOCUS_04230 23177 22728 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095815.1 protein_id gnl|my_center|LOCUS_04230 24703 23357 gene locus_tag LOCUS_04240 24703 23357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_04240 25501 24878 gene locus_tag LOCUS_04250 25501 24878 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930126.1 protein_id gnl|my_center|LOCUS_04250 26739 25498 gene locus_tag LOCUS_04260 26739 25498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 27252 26821 gene locus_tag LOCUS_04270 27252 26821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 27327 27432 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28109 28208 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29463 28723 gene locus_tag LOCUS_04280 29463 28723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04280 29593 29746 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32976 30748 gene locus_tag LOCUS_04290 32976 30748 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117877.1 protein_id gnl|my_center|LOCUS_04290 33782 32973 gene locus_tag LOCUS_04300 33782 32973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 33825 33973 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35736 34840 gene locus_tag LOCUS_04310 35736 34840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 36704 35754 gene locus_tag LOCUS_04320 36704 35754 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324929.1 protein_id gnl|my_center|LOCUS_04320 36967 37104 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39432 37819 gene locus_tag LOCUS_04330 39432 37819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 39824 39945 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40542 40644 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43521 41929 gene locus_tag LOCUS_04340 43521 41929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 44065 45804 gene locus_tag LOCUS_04350 44065 45804 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332180.1 protein_id gnl|my_center|LOCUS_04350 45696 45779 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46359 45820 gene locus_tag LOCUS_04360 46359 45820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 46888 48615 gene locus_tag LOCUS_04370 46888 48615 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122637.1 protein_id gnl|my_center|LOCUS_04370 49224 48673 gene locus_tag LOCUS_04380 49224 48673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 49790 49416 gene locus_tag LOCUS_04390 49790 49416 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705627.1 protein_id gnl|my_center|LOCUS_04390 52131 49909 gene locus_tag LOCUS_04400 52131 49909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 52748 52248 gene locus_tag LOCUS_04410 52748 52248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 53304 52789 gene locus_tag LOCUS_04420 53304 52789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 53782 53900 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 54356 53970 gene locus_tag LOCUS_04430 54356 53970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 54404 54545 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 56608 55787 gene locus_tag LOCUS_04440 56608 55787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 56921 59614 gene locus_tag LOCUS_04450 56921 59614 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922351.1 protein_id gnl|my_center|LOCUS_04450 60571 60748 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 61314 61451 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 61793 61911 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 62415 62534 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 63537 62584 gene locus_tag LOCUS_04460 63537 62584 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263043.1 protein_id gnl|my_center|LOCUS_04460 64340 63924 gene locus_tag LOCUS_04470 64340 63924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 64709 65314 gene locus_tag LOCUS_04480 gene rpoE 64709 65314 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 protein_id gnl|my_center|LOCUS_04480 65318 66802 gene locus_tag LOCUS_04490 65318 66802 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922532.1 protein_id gnl|my_center|LOCUS_04490 67002 66811 gene locus_tag LOCUS_04500 67002 66811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 67913 67017 gene locus_tag LOCUS_04510 67913 67017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 70985 69282 gene locus_tag LOCUS_04520 70985 69282 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339980.1 protein_id gnl|my_center|LOCUS_04520 69653 69744 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 72171 71032 gene locus_tag LOCUS_04530 72171 71032 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_04530 72213 72378 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 74903 72621 gene locus_tag LOCUS_04540 74903 72621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 77204 74961 gene locus_tag LOCUS_04550 77204 74961 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816832.1 protein_id gnl|my_center|LOCUS_04550 77497 77754 gene locus_tag LOCUS_04560 77497 77754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 >Feature sequence008 3451 38 gene locus_tag LOCUS_04570 3451 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 796 953 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4258 6414 gene locus_tag LOCUS_04580 4258 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 6672 8264 gene locus_tag LOCUS_04590 6672 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 8621 9580 gene locus_tag LOCUS_04600 8621 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 9661 11472 gene locus_tag LOCUS_04610 9661 11472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 11541 13277 gene locus_tag LOCUS_04620 11541 13277 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 protein_id gnl|my_center|LOCUS_04620 13322 15898 gene locus_tag LOCUS_04630 13322 15898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 15739 15842 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18922 16103 gene locus_tag LOCUS_04640 18922 16103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 18937 19058 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22652 20643 gene locus_tag LOCUS_04650 22652 20643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 22871 23770 gene locus_tag LOCUS_04660 22871 23770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 23869 23958 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26070 24043 gene locus_tag LOCUS_04670 26070 24043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 24571 24671 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27369 26224 gene locus_tag LOCUS_04680 27369 26224 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122039.1 protein_id gnl|my_center|LOCUS_04680 28485 27514 gene locus_tag LOCUS_04690 28485 27514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 28673 28736 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29565 29386 gene locus_tag LOCUS_04700 29565 29386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 30896 29562 gene locus_tag LOCUS_04710 30896 29562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04710 31942 30920 gene locus_tag LOCUS_04720 31942 30920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04720 32847 32011 gene locus_tag LOCUS_04730 32847 32011 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615371.1 protein_id gnl|my_center|LOCUS_04730 33378 32851 gene locus_tag LOCUS_04740 33378 32851 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339097.1 protein_id gnl|my_center|LOCUS_04740 34739 33357 gene locus_tag LOCUS_04750 gene ccoG 34739 33357 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120871.1 protein_id gnl|my_center|LOCUS_04750 34911 35135 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35830 35225 gene locus_tag LOCUS_04760 35830 35225 CDS product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120870.1 protein_id gnl|my_center|LOCUS_04760 36000 35827 gene locus_tag LOCUS_04770 36000 35827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 38318 35997 gene locus_tag LOCUS_04780 gene ccoN 38318 35997 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615370.1 protein_id gnl|my_center|LOCUS_04780 40327 38972 gene locus_tag LOCUS_04790 40327 38972 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037198060.1 protein_id gnl|my_center|LOCUS_04790 40697 40350 gene locus_tag LOCUS_04800 40697 40350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 42795 40732 gene locus_tag LOCUS_04810 42795 40732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 43018 42815 gene locus_tag LOCUS_04820 43018 42815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 43569 43979 gene locus_tag LOCUS_04830 43569 43979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 44188 45447 gene locus_tag LOCUS_04840 44188 45447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 45517 45627 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45704 47326 gene locus_tag LOCUS_04850 45704 47326 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368539.1 protein_id gnl|my_center|LOCUS_04850 45953 46038 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47323 48840 gene locus_tag LOCUS_04860 47323 48840 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_04860 47900 47999 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49155 50150 gene locus_tag LOCUS_04870 49155 50150 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932202.1 protein_id gnl|my_center|LOCUS_04870 50172 50810 gene locus_tag LOCUS_04880 50172 50810 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123161.1 protein_id gnl|my_center|LOCUS_04880 51728 51024 gene locus_tag LOCUS_04890 51728 51024 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922405.1 protein_id gnl|my_center|LOCUS_04890 52561 51725 gene locus_tag LOCUS_04900 52561 51725 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123166.1 protein_id gnl|my_center|LOCUS_04900 53414 52980 gene locus_tag LOCUS_04910 53414 52980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327803.1 protein_id gnl|my_center|LOCUS_04910 53731 54840 gene locus_tag LOCUS_04920 53731 54840 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 protein_id gnl|my_center|LOCUS_04920 54981 56600 gene locus_tag LOCUS_04930 54981 56600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 56504 57463 gene locus_tag LOCUS_04940 56504 57463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04940 56559 56582 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 57819 59183 gene locus_tag LOCUS_04950 57819 59183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 59278 59682 gene locus_tag LOCUS_04960 59278 59682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04960 59603 59788 gene locus_tag LOCUS_04970 59603 59788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 59807 60136 gene locus_tag LOCUS_04980 59807 60136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04980 60543 60667 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 60676 62013 gene locus_tag LOCUS_04990 gene atpD 60676 62013 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442644.1 protein_id gnl|my_center|LOCUS_04990 61082 61209 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 62010 62402 gene locus_tag LOCUS_05000 62010 62402 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120166.1 protein_id gnl|my_center|LOCUS_05000 62399 62713 gene locus_tag LOCUS_05010 62399 62713 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120167.1 protein_id gnl|my_center|LOCUS_05010 62849 63187 gene locus_tag LOCUS_05020 62849 63187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 63187 63969 gene locus_tag LOCUS_05030 63187 63969 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328512.1 protein_id gnl|my_center|LOCUS_05030 63956 64408 gene locus_tag LOCUS_05040 63956 64408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 64546 65301 gene locus_tag LOCUS_05050 64546 65301 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120169.1 protein_id gnl|my_center|LOCUS_05050 65369 66955 gene locus_tag LOCUS_05060 65369 66955 CDS product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921807.1 protein_id gnl|my_center|LOCUS_05060 66959 67870 gene locus_tag LOCUS_05070 66959 67870 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340302.1 protein_id gnl|my_center|LOCUS_05070 68907 70748 gene locus_tag LOCUS_05080 68907 70748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 70745 71401 gene locus_tag LOCUS_05090 70745 71401 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_05090 71657 71944 gene locus_tag LOCUS_05100 71657 71944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 72328 72450 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 72640 73122 gene locus_tag LOCUS_05110 72640 73122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 73680 73237 gene locus_tag LOCUS_05120 73680 73237 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257301.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence009 174 323 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 778 950 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1009 2034 gene locus_tag LOCUS_05130 gene fabF 1009 2034 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460499.1 protein_id gnl|my_center|LOCUS_05130 2651 2778 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3170 3397 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4152 4568 gene locus_tag LOCUS_05140 4152 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 4760 4808 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5011 5790 gene locus_tag LOCUS_05150 gene rlmB 5011 5790 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095638.1 protein_id gnl|my_center|LOCUS_05150 6203 6562 gene locus_tag LOCUS_05160 6203 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 7116 6652 gene locus_tag LOCUS_05170 7116 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 7146 7327 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10086 10308 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10476 11429 gene locus_tag LOCUS_05180 10476 11429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 11677 12372 gene locus_tag LOCUS_05190 11677 12372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 12762 14018 gene locus_tag LOCUS_05200 12762 14018 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121715.1 protein_id gnl|my_center|LOCUS_05200 15176 15351 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15537 15740 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15769 16236 gene locus_tag LOCUS_05210 15769 16236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 16426 16523 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17933 16548 gene locus_tag LOCUS_05220 gene asnS 17933 16548 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337912.1 protein_id gnl|my_center|LOCUS_05220 18755 17967 gene locus_tag LOCUS_05230 18755 17967 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396453.1 protein_id gnl|my_center|LOCUS_05230 19231 18950 gene locus_tag LOCUS_05240 19231 18950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 20829 19228 gene locus_tag LOCUS_05250 20829 19228 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327900.1 protein_id gnl|my_center|LOCUS_05250 20879 20972 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22276 21389 gene locus_tag LOCUS_05260 22276 21389 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327663.1 protein_id gnl|my_center|LOCUS_05260 23295 22444 gene locus_tag LOCUS_05270 gene accD 23295 22444 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327662.1 protein_id gnl|my_center|LOCUS_05270 23950 23396 gene locus_tag LOCUS_05280 23950 23396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 24725 24048 gene locus_tag LOCUS_05290 gene rpe 24725 24048 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118429.1 protein_id gnl|my_center|LOCUS_05290 26133 24817 gene locus_tag LOCUS_05300 26133 24817 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_05300 28449 26278 gene locus_tag LOCUS_05310 28449 26278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 29027 28701 gene locus_tag LOCUS_05320 29027 28701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 29430 29140 gene locus_tag LOCUS_05330 29430 29140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 29447 29542 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29834 31579 gene locus_tag LOCUS_05340 29834 31579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 31388 31557 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31584 32171 gene locus_tag LOCUS_05350 31584 32171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 32574 32703 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33345 32908 gene locus_tag LOCUS_05360 33345 32908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 34991 33342 gene locus_tag LOCUS_05370 34991 33342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 36275 35241 gene locus_tag LOCUS_05380 36275 35241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 36707 37792 gene locus_tag LOCUS_05390 36707 37792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 39291 37822 gene locus_tag LOCUS_05400 39291 37822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 40000 39323 gene locus_tag LOCUS_05410 40000 39323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 40956 39997 gene locus_tag LOCUS_05420 40956 39997 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118555.1 protein_id gnl|my_center|LOCUS_05420 41354 40953 gene locus_tag LOCUS_05430 41354 40953 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548044.1 protein_id gnl|my_center|LOCUS_05430 41592 41852 gene locus_tag LOCUS_05440 41592 41852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 42836 41874 gene locus_tag LOCUS_05450 42836 41874 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118333.1 protein_id gnl|my_center|LOCUS_05450 44638 42833 gene locus_tag LOCUS_05460 44638 42833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 47028 44638 gene locus_tag LOCUS_05470 47028 44638 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815631.1 protein_id gnl|my_center|LOCUS_05470 47325 48341 gene locus_tag LOCUS_05480 47325 48341 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002185292.1 protein_id gnl|my_center|LOCUS_05480 50423 48963 gene locus_tag LOCUS_05490 50423 48963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 51583 50630 gene locus_tag LOCUS_05500 51583 50630 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986893.1 protein_id gnl|my_center|LOCUS_05500 51747 51607 gene locus_tag LOCUS_05510 51747 51607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 52449 51946 gene locus_tag LOCUS_05520 52449 51946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 53248 52394 gene locus_tag LOCUS_05530 53248 52394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 52461 52544 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 53444 53724 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 54517 54641 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 55256 55708 gene locus_tag LOCUS_05540 55256 55708 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686664.1 protein_id gnl|my_center|LOCUS_05540 55785 56741 gene locus_tag LOCUS_05550 55785 56741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 57247 58164 gene locus_tag LOCUS_05560 57247 58164 CDS product DUF1571 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 protein_id gnl|my_center|LOCUS_05560 58447 58564 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58808 58599 gene locus_tag LOCUS_05570 58808 58599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 59539 59671 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 59672 60766 gene locus_tag LOCUS_05580 59672 60766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 60825 60867 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 62073 60895 gene locus_tag LOCUS_05590 62073 60895 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_05590 62512 64731 gene locus_tag LOCUS_05600 62512 64731 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118530.1 protein_id gnl|my_center|LOCUS_05600 65029 64784 gene locus_tag LOCUS_05610 65029 64784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 66383 65265 gene locus_tag LOCUS_05620 66383 65265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 66652 66386 gene locus_tag LOCUS_05630 66652 66386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 67966 66803 gene locus_tag LOCUS_05640 67966 66803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 69336 68662 gene locus_tag LOCUS_05650 69336 68662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 69890 69333 gene locus_tag LOCUS_05660 69890 69333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 70006 70152 gene locus_tag LOCUS_05670 70006 70152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 >Feature sequence010 133 386 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2490 1234 gene locus_tag LOCUS_05680 2490 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 1309 1417 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4511 2559 gene locus_tag LOCUS_05690 4511 2559 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165441912.1 protein_id gnl|my_center|LOCUS_05690 5123 5194 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5469 5614 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8098 5864 gene locus_tag LOCUS_05700 8098 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 8380 8509 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9870 9406 gene locus_tag LOCUS_05710 9870 9406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 10023 10985 gene locus_tag LOCUS_05720 10023 10985 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123205.1 protein_id gnl|my_center|LOCUS_05720 11443 12843 gene locus_tag LOCUS_05730 11443 12843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 12821 13045 gene locus_tag LOCUS_05740 12821 13045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 13085 13402 gene locus_tag LOCUS_05750 13085 13402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 13615 16152 gene locus_tag LOCUS_05760 13615 16152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 15957 16045 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16076 16906 gene locus_tag LOCUS_05770 16076 16906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 18190 16985 gene locus_tag LOCUS_05780 18190 16985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 19188 18187 gene locus_tag LOCUS_05790 19188 18187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 18192 18231 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25656 19555 gene locus_tag LOCUS_05800 25656 19555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 27041 25656 gene locus_tag LOCUS_05810 27041 25656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 27681 27310 gene locus_tag LOCUS_05820 27681 27310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05820 27946 27707 gene locus_tag LOCUS_05830 27946 27707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05830 28208 27981 gene locus_tag LOCUS_05840 28208 27981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 28421 28230 gene locus_tag LOCUS_05850 28421 28230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 28817 31228 gene locus_tag LOCUS_05860 28817 31228 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819019.1 protein_id gnl|my_center|LOCUS_05860 31255 32349 gene locus_tag LOCUS_05870 31255 32349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 32356 33798 gene locus_tag LOCUS_05880 32356 33798 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387312.1 protein_id gnl|my_center|LOCUS_05880 34431 36086 gene locus_tag LOCUS_05890 34431 36086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 36457 36642 gene locus_tag LOCUS_05900 36457 36642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 36654 37733 gene locus_tag LOCUS_05910 36654 37733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 38107 38203 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39694 38534 gene locus_tag LOCUS_05920 39694 38534 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_05920 43101 39691 gene locus_tag LOCUS_05930 43101 39691 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930290.1 protein_id gnl|my_center|LOCUS_05930 43724 43098 gene locus_tag LOCUS_05940 43724 43098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 45195 43717 gene locus_tag LOCUS_05950 45195 43717 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_05950 46443 45427 gene locus_tag LOCUS_05960 46443 45427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 47735 46518 gene locus_tag LOCUS_05970 47735 46518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 48807 48103 gene locus_tag LOCUS_05980 48807 48103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 48900 49009 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49715 51196 gene locus_tag LOCUS_05990 49715 51196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 52591 51236 gene locus_tag LOCUS_06000 52591 51236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 53293 53204 gene locus_tag LOCUS_t00020 53293 53204 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 55068 53644 gene locus_tag LOCUS_06010 55068 53644 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_06010 55184 58231 gene locus_tag LOCUS_06020 55184 58231 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447205.1 protein_id gnl|my_center|LOCUS_06020 58566 59078 gene locus_tag LOCUS_06030 58566 59078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 59486 60013 gene locus_tag LOCUS_06040 59486 60013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 60861 61670 gene locus_tag LOCUS_06050 60861 61670 CDS product DUF1571 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 protein_id gnl|my_center|LOCUS_06050 62566 61775 gene locus_tag LOCUS_06060 62566 61775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 63184 62840 gene locus_tag LOCUS_06070 63184 62840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 64898 63222 gene locus_tag LOCUS_06080 64898 63222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 63231 63366 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 65423 65085 gene locus_tag LOCUS_06090 65423 65085 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442716.1 protein_id gnl|my_center|LOCUS_06090 65850 68192 gene locus_tag LOCUS_06100 65850 68192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 68556 68305 gene locus_tag LOCUS_06110 68556 68305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 68883 69878 gene locus_tag LOCUS_06120 68883 69878 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_06120 >Feature sequence011 1083 241 gene locus_tag LOCUS_06130 1083 241 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 protein_id gnl|my_center|LOCUS_06130 1487 2359 gene locus_tag LOCUS_06140 1487 2359 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922721.1 protein_id gnl|my_center|LOCUS_06140 2469 3161 gene locus_tag LOCUS_06150 2469 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 3281 3907 gene locus_tag LOCUS_06160 3281 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 4608 3922 gene locus_tag LOCUS_06170 4608 3922 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922761.1 protein_id gnl|my_center|LOCUS_06170 4827 5822 gene locus_tag LOCUS_06180 4827 5822 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442722.1 protein_id gnl|my_center|LOCUS_06180 5883 7064 gene locus_tag LOCUS_06190 5883 7064 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_06190 7235 8626 gene locus_tag LOCUS_06200 7235 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 9069 10184 gene locus_tag LOCUS_06210 9069 10184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06210 10185 11417 gene locus_tag LOCUS_06220 10185 11417 CDS product phosphonoacetaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202931.1 protein_id gnl|my_center|LOCUS_06220 12996 11791 gene locus_tag LOCUS_06230 12996 11791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 14385 13156 gene locus_tag LOCUS_06240 14385 13156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 14524 15813 gene locus_tag LOCUS_06250 14524 15813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122044.1 protein_id gnl|my_center|LOCUS_06250 16060 16860 gene locus_tag LOCUS_06260 16060 16860 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971334.1 protein_id gnl|my_center|LOCUS_06260 16911 18398 gene locus_tag LOCUS_06270 16911 18398 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118024.1 protein_id gnl|my_center|LOCUS_06270 18674 19966 gene locus_tag LOCUS_06280 18674 19966 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 protein_id gnl|my_center|LOCUS_06280 20210 21190 gene locus_tag LOCUS_06290 20210 21190 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_06290 21485 22933 gene locus_tag LOCUS_06300 21485 22933 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146578646.1 protein_id gnl|my_center|LOCUS_06300 21807 21898 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24658 23300 gene locus_tag LOCUS_06310 24658 23300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 27213 24652 gene locus_tag LOCUS_06320 27213 24652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 24865 24931 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28432 27452 gene locus_tag LOCUS_06330 28432 27452 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339822.1 protein_id gnl|my_center|LOCUS_06330 28599 28713 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29278 28805 gene locus_tag LOCUS_06340 29278 28805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 29280 29364 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29467 29691 gene locus_tag LOCUS_06350 29467 29691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 30052 30173 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30762 32681 gene locus_tag LOCUS_06360 gene dnaK 30762 32681 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326035.1 protein_id gnl|my_center|LOCUS_06360 32777 32898 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33044 33156 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34459 34623 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35457 35621 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35631 36326 gene locus_tag LOCUS_06370 35631 36326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 37557 36457 gene locus_tag LOCUS_06380 37557 36457 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074078.1 protein_id gnl|my_center|LOCUS_06380 38216 37554 gene locus_tag LOCUS_06390 gene modB 38216 37554 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_06390 39013 38216 gene locus_tag LOCUS_06400 gene modA 39013 38216 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258350.1 protein_id gnl|my_center|LOCUS_06400 39180 41096 gene locus_tag LOCUS_06410 39180 41096 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122293.1 protein_id gnl|my_center|LOCUS_06410 41292 42602 gene locus_tag LOCUS_06420 41292 42602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121732.1 protein_id gnl|my_center|LOCUS_06420 42743 43255 gene locus_tag LOCUS_06430 42743 43255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 43680 44927 gene locus_tag LOCUS_06440 43680 44927 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111143.1 protein_id gnl|my_center|LOCUS_06440 44998 45189 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45953 46099 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46691 46759 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47706 46915 gene locus_tag LOCUS_06450 gene panB 47706 46915 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545863.1 protein_id gnl|my_center|LOCUS_06450 48965 48114 gene locus_tag LOCUS_06460 gene ilvE 48965 48114 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_06460 49324 49389 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 50080 50314 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52481 53017 gene locus_tag LOCUS_06470 52481 53017 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391683.1 protein_id gnl|my_center|LOCUS_06470 53139 54188 gene locus_tag LOCUS_06480 53139 54188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 54402 55490 gene locus_tag LOCUS_06490 54402 55490 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329092.1 protein_id gnl|my_center|LOCUS_06490 55714 56808 gene locus_tag LOCUS_06500 55714 56808 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329092.1 protein_id gnl|my_center|LOCUS_06500 56956 57029 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 57293 57045 gene locus_tag LOCUS_06510 57293 57045 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764857.1 protein_id gnl|my_center|LOCUS_06510 58021 57380 gene locus_tag LOCUS_06520 58021 57380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 59152 58151 gene locus_tag LOCUS_06530 59152 58151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 59839 59249 gene locus_tag LOCUS_06540 59839 59249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 63072 59803 gene locus_tag LOCUS_06550 63072 59803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 59854 59940 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 63666 65180 gene locus_tag LOCUS_06560 63666 65180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117691.1 protein_id gnl|my_center|LOCUS_06560 65287 66978 gene locus_tag LOCUS_06570 65287 66978 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_06570 67338 67517 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 67579 67803 gene locus_tag LOCUS_06580 67579 67803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence012 583 735 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 759 1067 gene locus_tag LOCUS_06590 759 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 1171 1944 gene locus_tag LOCUS_06600 1171 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 2161 2787 gene locus_tag LOCUS_06610 2161 2787 CDS product DUF4303 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071853.1 protein_id gnl|my_center|LOCUS_06610 3032 3562 gene locus_tag LOCUS_06620 3032 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 3771 4052 gene locus_tag LOCUS_06630 3771 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 4183 6474 gene locus_tag LOCUS_06640 4183 6474 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117947.1 protein_id gnl|my_center|LOCUS_06640 7280 6555 gene locus_tag LOCUS_06650 7280 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 7361 7505 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7929 7564 gene locus_tag LOCUS_06660 7929 7564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 9367 8330 gene locus_tag LOCUS_06670 9367 8330 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_06670 10334 9564 gene locus_tag LOCUS_06680 10334 9564 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121328.1 protein_id gnl|my_center|LOCUS_06680 10582 11424 gene locus_tag LOCUS_06690 10582 11424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06690 11275 11335 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11429 13375 gene locus_tag LOCUS_06700 11429 13375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 13427 13573 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13678 15093 gene locus_tag LOCUS_06710 13678 15093 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_06710 15717 16370 gene locus_tag LOCUS_06720 15717 16370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 16409 17188 gene locus_tag LOCUS_06730 16409 17188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 17193 17555 gene locus_tag LOCUS_06740 17193 17555 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121435.1 protein_id gnl|my_center|LOCUS_06740 17795 19759 gene locus_tag LOCUS_06750 gene argS 17795 19759 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120594.1 protein_id gnl|my_center|LOCUS_06750 20391 21275 gene locus_tag LOCUS_06760 20391 21275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06760 20407 20457 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22000 21230 gene locus_tag LOCUS_06770 22000 21230 CDS product HisA/HisF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870208.1 protein_id gnl|my_center|LOCUS_06770 24056 22134 gene locus_tag LOCUS_06780 24056 22134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 25586 24489 gene locus_tag LOCUS_06790 25586 24489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 25630 25754 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26555 26809 gene locus_tag LOCUS_06800 gene rpmA 26555 26809 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327901.1 protein_id gnl|my_center|LOCUS_06800 27077 27568 gene locus_tag LOCUS_06810 27077 27568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 27875 27992 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29089 29147 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30108 29305 gene locus_tag LOCUS_06820 30108 29305 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121390.1 protein_id gnl|my_center|LOCUS_06820 32200 30188 gene locus_tag LOCUS_06830 32200 30188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 32430 32933 gene locus_tag LOCUS_06840 32430 32933 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 protein_id gnl|my_center|LOCUS_06840 33527 32919 gene locus_tag LOCUS_06850 33527 32919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 34164 33805 gene locus_tag LOCUS_06860 34164 33805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 35444 34239 gene locus_tag LOCUS_06870 35444 34239 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123857.1 protein_id gnl|my_center|LOCUS_06870 37273 35564 gene locus_tag LOCUS_06880 37273 35564 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328372.1 protein_id gnl|my_center|LOCUS_06880 38220 37330 gene locus_tag LOCUS_06890 gene coxB 38220 37330 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404828.1 protein_id gnl|my_center|LOCUS_06890 39217 38372 gene locus_tag LOCUS_06900 39217 38372 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_06900 39644 39285 gene locus_tag LOCUS_06910 39644 39285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 41016 39793 gene locus_tag LOCUS_06920 41016 39793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922553.1 protein_id gnl|my_center|LOCUS_06920 42440 41064 gene locus_tag LOCUS_06930 42440 41064 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123851.1 protein_id gnl|my_center|LOCUS_06930 43923 42505 gene locus_tag LOCUS_06940 gene nrfD 43923 42505 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_06940 46150 43982 gene locus_tag LOCUS_06950 46150 43982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 45186 45304 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47511 46162 gene locus_tag LOCUS_06960 47511 46162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 46196 46286 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48312 47629 gene locus_tag LOCUS_06970 48312 47629 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123848.1 protein_id gnl|my_center|LOCUS_06970 48806 50203 gene locus_tag LOCUS_06980 48806 50203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 50370 51812 gene locus_tag LOCUS_06990 50370 51812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 51119 51213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51857 51943 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52602 52749 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52869 53558 gene locus_tag LOCUS_07000 gene bshB1 52869 53558 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333027.1 protein_id gnl|my_center|LOCUS_07000 53586 53670 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 54943 53702 gene locus_tag LOCUS_07010 54943 53702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 55656 56009 gene locus_tag LOCUS_07020 55656 56009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 58202 56514 gene locus_tag LOCUS_07030 58202 56514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 >Feature sequence013 782 78 gene locus_tag LOCUS_07040 782 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 933 1179 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1402 1571 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1978 2113 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5594 2295 gene locus_tag LOCUS_07050 5594 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 7393 5612 gene locus_tag LOCUS_07060 7393 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 7863 7390 gene locus_tag LOCUS_07070 7863 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 8360 10558 gene locus_tag LOCUS_07080 8360 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 11071 10577 gene locus_tag LOCUS_07090 11071 10577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 12485 11112 gene locus_tag LOCUS_07100 12485 11112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_07100 12683 15661 gene locus_tag LOCUS_07110 12683 15661 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_07110 17130 15727 gene locus_tag LOCUS_07120 17130 15727 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117864.1 protein_id gnl|my_center|LOCUS_07120 17478 18371 gene locus_tag LOCUS_07130 17478 18371 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_07130 18664 18773 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19016 19172 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19235 21541 gene locus_tag LOCUS_07140 19235 21541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 23458 21596 gene locus_tag LOCUS_07150 23458 21596 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120593.1 protein_id gnl|my_center|LOCUS_07150 24236 23448 gene locus_tag LOCUS_07160 24236 23448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 24401 24523 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24743 26572 gene locus_tag LOCUS_07170 24743 26572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 24955 25070 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26721 27797 gene locus_tag LOCUS_07180 26721 27797 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615590.1 protein_id gnl|my_center|LOCUS_07180 29399 27969 gene locus_tag LOCUS_07190 29399 27969 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921691.1 protein_id gnl|my_center|LOCUS_07190 31034 29568 gene locus_tag LOCUS_07200 31034 29568 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921496.1 protein_id gnl|my_center|LOCUS_07200 32930 31131 gene locus_tag LOCUS_07210 32930 31131 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260568.1 protein_id gnl|my_center|LOCUS_07210 33058 34056 gene locus_tag LOCUS_07220 33058 34056 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118199.1 protein_id gnl|my_center|LOCUS_07220 34197 34751 gene locus_tag LOCUS_07230 gene rpoE 34197 34751 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_07230 34810 35415 gene locus_tag LOCUS_07240 34810 35415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 35416 36063 gene locus_tag LOCUS_07250 35416 36063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 36147 38795 gene locus_tag LOCUS_07260 36147 38795 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146524746.1 protein_id gnl|my_center|LOCUS_07260 38945 40246 gene locus_tag LOCUS_07270 38945 40246 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_07270 40611 41132 gene locus_tag LOCUS_07280 40611 41132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 41334 41945 gene locus_tag LOCUS_07290 41334 41945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 41963 42700 gene locus_tag LOCUS_07300 41963 42700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 42932 43056 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46467 43207 gene locus_tag LOCUS_07310 gene carB 46467 43207 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123580.1 protein_id gnl|my_center|LOCUS_07310 46965 47327 gene locus_tag LOCUS_07320 46965 47327 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119951.1 protein_id gnl|my_center|LOCUS_07320 48093 47344 gene locus_tag LOCUS_07330 48093 47344 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327679.1 protein_id gnl|my_center|LOCUS_07330 49180 48266 gene locus_tag LOCUS_07340 49180 48266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 49181 49289 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 50936 49635 gene locus_tag LOCUS_07350 50936 49635 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326690.1 protein_id gnl|my_center|LOCUS_07350 51534 51046 gene locus_tag LOCUS_07360 51534 51046 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326691.1 protein_id gnl|my_center|LOCUS_07360 52072 51683 gene locus_tag LOCUS_07370 52072 51683 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326692.1 protein_id gnl|my_center|LOCUS_07370 53163 52408 gene locus_tag LOCUS_07380 gene fabG 53163 52408 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_07380 53775 53284 gene locus_tag LOCUS_07390 53775 53284 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326693.1 protein_id gnl|my_center|LOCUS_07390 54049 55221 gene locus_tag LOCUS_07400 54049 55221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 55365 56723 gene locus_tag LOCUS_07410 55365 56723 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118607.1 protein_id gnl|my_center|LOCUS_07410 55451 55561 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 56875 57210 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence014 1593 295 gene locus_tag LOCUS_07420 1593 295 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_07420 2844 1843 gene locus_tag LOCUS_07430 2844 1843 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327421.1 protein_id gnl|my_center|LOCUS_07430 3642 3064 gene locus_tag LOCUS_07440 3642 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 4426 3701 gene locus_tag LOCUS_07450 4426 3701 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336025.1 protein_id gnl|my_center|LOCUS_07450 6212 4545 gene locus_tag LOCUS_07460 6212 4545 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_07460 7225 6293 gene locus_tag LOCUS_07470 7225 6293 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121793.1 protein_id gnl|my_center|LOCUS_07470 8579 7497 gene locus_tag LOCUS_07480 8579 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 8999 9727 gene locus_tag LOCUS_07490 8999 9727 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011945636.1 protein_id gnl|my_center|LOCUS_07490 10148 9831 gene locus_tag LOCUS_07500 10148 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 10500 10210 gene locus_tag LOCUS_07510 10500 10210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 11811 10825 gene locus_tag LOCUS_07520 11811 10825 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048017.1 protein_id gnl|my_center|LOCUS_07520 13815 11947 gene locus_tag LOCUS_07530 13815 11947 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816500.1 protein_id gnl|my_center|LOCUS_07530 14343 13882 gene locus_tag LOCUS_07540 14343 13882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 14541 14698 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16057 15227 gene locus_tag LOCUS_07550 16057 15227 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121937.1 protein_id gnl|my_center|LOCUS_07550 16784 16302 gene locus_tag LOCUS_07560 16784 16302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324288.1 protein_id gnl|my_center|LOCUS_07560 16972 17106 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18101 17898 gene locus_tag LOCUS_07570 18101 17898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 18261 19682 gene locus_tag LOCUS_07580 gene clpX 18261 19682 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324828.1 protein_id gnl|my_center|LOCUS_07580 18746 18866 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20635 19772 gene locus_tag LOCUS_07590 20635 19772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 21027 22580 gene locus_tag LOCUS_07600 21027 22580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119977.1 protein_id gnl|my_center|LOCUS_07600 23201 22602 gene locus_tag LOCUS_07610 23201 22602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 23379 24767 gene locus_tag LOCUS_07620 23379 24767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 24983 25750 gene locus_tag LOCUS_07630 24983 25750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 26744 25923 gene locus_tag LOCUS_07640 gene dapB 26744 25923 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123511.1 protein_id gnl|my_center|LOCUS_07640 28147 26957 gene locus_tag LOCUS_07650 28147 26957 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_07650 29599 28241 gene locus_tag LOCUS_07660 29599 28241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327711.1 protein_id gnl|my_center|LOCUS_07660 29808 29881 gene locus_tag LOCUS_t00030 29808 29881 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 30401 30081 gene locus_tag LOCUS_07670 30401 30081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 30516 30692 gene locus_tag LOCUS_07680 30516 30692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 30810 31091 gene locus_tag LOCUS_07690 30810 31091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 31574 31407 gene locus_tag LOCUS_07700 31574 31407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 31706 32686 gene locus_tag LOCUS_07710 31706 32686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 32727 33026 gene locus_tag LOCUS_07720 32727 33026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 33115 33151 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33212 33565 gene locus_tag LOCUS_07730 33212 33565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 33543 33782 gene locus_tag LOCUS_07740 33543 33782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 33792 33989 gene locus_tag LOCUS_07750 33792 33989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 34028 34246 gene locus_tag LOCUS_07760 gene csrA 34028 34246 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327053.1 protein_id gnl|my_center|LOCUS_07760 34243 35406 gene locus_tag LOCUS_07770 34243 35406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 35438 35722 gene locus_tag LOCUS_07780 35438 35722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 35722 36021 gene locus_tag LOCUS_07790 35722 36021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 36018 36641 gene locus_tag LOCUS_07800 36018 36641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 38584 36686 gene locus_tag LOCUS_07810 38584 36686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 39680 38655 gene locus_tag LOCUS_07820 39680 38655 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939034.1 protein_id gnl|my_center|LOCUS_07820 40399 39959 gene locus_tag LOCUS_07830 40399 39959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 40630 40752 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40974 41164 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41763 41536 gene locus_tag LOCUS_07840 41763 41536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 42106 41840 gene locus_tag LOCUS_07850 42106 41840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 42238 42807 gene locus_tag LOCUS_07860 42238 42807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 42800 43642 gene locus_tag LOCUS_07870 42800 43642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 43772 43927 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44050 44649 gene locus_tag LOCUS_07880 44050 44649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 44925 45015 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45402 47066 gene locus_tag LOCUS_07890 45402 47066 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336918.1 protein_id gnl|my_center|LOCUS_07890 47080 48507 gene locus_tag LOCUS_07900 47080 48507 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523689.1 protein_id gnl|my_center|LOCUS_07900 48507 48701 gene locus_tag LOCUS_07910 48507 48701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 48691 49308 gene locus_tag LOCUS_07920 48691 49308 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385658.1 protein_id gnl|my_center|LOCUS_07920 49415 50779 gene locus_tag LOCUS_07930 49415 50779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 51042 51187 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51189 51500 gene locus_tag LOCUS_07940 51189 51500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 51508 52101 gene locus_tag LOCUS_07950 51508 52101 CDS product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975492.1 protein_id gnl|my_center|LOCUS_07950 52138 52222 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52331 52543 gene locus_tag LOCUS_07960 52331 52543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 52545 53066 gene locus_tag LOCUS_07970 52545 53066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 53069 53503 gene locus_tag LOCUS_07980 53069 53503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 53514 53927 gene locus_tag LOCUS_07990 53514 53927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 53983 54324 gene locus_tag LOCUS_08000 53983 54324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 54390 54845 gene locus_tag LOCUS_08010 54390 54845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 54884 55162 gene locus_tag LOCUS_08020 54884 55162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 55166 57133 gene locus_tag LOCUS_08030 55166 57133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 >Feature sequence015 1974 1309 gene locus_tag LOCUS_08040 1974 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 1990 2159 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2578 2705 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4875 3001 gene locus_tag LOCUS_08050 4875 3001 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946128.1 protein_id gnl|my_center|LOCUS_08050 6141 5131 gene locus_tag LOCUS_08060 6141 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 6158 6326 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8064 6694 gene locus_tag LOCUS_08070 8064 6694 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669743.1 protein_id gnl|my_center|LOCUS_08070 8742 8200 gene locus_tag LOCUS_08080 8742 8200 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_08080 8866 9729 gene locus_tag LOCUS_08090 8866 9729 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117816.1 protein_id gnl|my_center|LOCUS_08090 11362 10034 gene locus_tag LOCUS_08100 11362 10034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 11814 13184 gene locus_tag LOCUS_08110 11814 13184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 13436 13523 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13686 14669 gene locus_tag LOCUS_08120 13686 14669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 14496 14569 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14881 15447 gene locus_tag LOCUS_08130 14881 15447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 17350 15578 gene locus_tag LOCUS_08140 17350 15578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 17600 18106 gene locus_tag LOCUS_08150 17600 18106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 18343 18708 gene locus_tag LOCUS_08160 18343 18708 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121445.1 protein_id gnl|my_center|LOCUS_08160 18783 19985 gene locus_tag LOCUS_08170 18783 19985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 20045 20470 gene locus_tag LOCUS_08180 20045 20470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 22537 20477 gene locus_tag LOCUS_08190 22537 20477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 21571 21662 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22992 24308 gene locus_tag LOCUS_08200 22992 24308 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922561.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08200 24321 24539 gene locus_tag LOCUS_08210 24321 24539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08210 24792 25082 gene locus_tag LOCUS_08220 24792 25082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 25466 25185 gene locus_tag LOCUS_08230 25466 25185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 25838 25767 gene locus_tag LOCUS_t00040 25838 25767 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 26019 26342 gene locus_tag LOCUS_08240 26019 26342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330016.1 protein_id gnl|my_center|LOCUS_08240 27436 26357 gene locus_tag LOCUS_08250 27436 26357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 27870 28352 gene locus_tag LOCUS_08260 27870 28352 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392363.1 protein_id gnl|my_center|LOCUS_08260 28684 28475 gene locus_tag LOCUS_08270 28684 28475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 28793 28947 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29785 29858 gene locus_tag LOCUS_t00050 29785 29858 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 30777 29986 gene locus_tag LOCUS_08280 30777 29986 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188202.1 protein_id gnl|my_center|LOCUS_08280 31062 30988 gene locus_tag LOCUS_t00060 31062 30988 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 31609 33837 gene locus_tag LOCUS_08290 31609 33837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 35067 33895 gene locus_tag LOCUS_08300 35067 33895 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963546.1 protein_id gnl|my_center|LOCUS_08300 36561 35203 gene locus_tag LOCUS_08310 36561 35203 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929181.1 protein_id gnl|my_center|LOCUS_08310 36619 36731 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37958 37236 gene locus_tag LOCUS_08320 37958 37236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 38880 38116 gene locus_tag LOCUS_08330 38880 38116 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922236.1 protein_id gnl|my_center|LOCUS_08330 39221 39757 gene locus_tag LOCUS_08340 39221 39757 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942915.1 protein_id gnl|my_center|LOCUS_08340 40258 39767 gene locus_tag LOCUS_08350 40258 39767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 41512 40373 gene locus_tag LOCUS_08360 41512 40373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 42352 41666 gene locus_tag LOCUS_08370 42352 41666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 42729 43505 gene locus_tag LOCUS_08380 42729 43505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 44745 43678 gene locus_tag LOCUS_08390 44745 43678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 45681 44896 gene locus_tag LOCUS_08400 45681 44896 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_08400 45875 47725 gene locus_tag LOCUS_08410 45875 47725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 47776 48651 gene locus_tag LOCUS_08420 47776 48651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 48715 49179 gene locus_tag LOCUS_08430 48715 49179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 49495 49289 gene locus_tag LOCUS_08440 49495 49289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 49717 51138 gene locus_tag LOCUS_08450 49717 51138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 52312 51200 gene locus_tag LOCUS_08460 52312 51200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922219.1 protein_id gnl|my_center|LOCUS_08460 52591 55668 gene locus_tag LOCUS_08470 52591 55668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 56089 56601 gene locus_tag LOCUS_08480 56089 56601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence016 1497 76 gene locus_tag LOCUS_08490 1497 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 2771 2529 gene locus_tag LOCUS_08500 2771 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 4030 2999 gene locus_tag LOCUS_08510 gene fbaA 4030 2999 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907650.1 protein_id gnl|my_center|LOCUS_08510 5790 4312 gene locus_tag LOCUS_08520 5790 4312 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_08520 6066 7247 gene locus_tag LOCUS_08530 6066 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 7413 7865 gene locus_tag LOCUS_08540 7413 7865 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922010.1 protein_id gnl|my_center|LOCUS_08540 9982 7931 gene locus_tag LOCUS_08550 9982 7931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 10716 10114 gene locus_tag LOCUS_08560 10716 10114 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329277.1 protein_id gnl|my_center|LOCUS_08560 11330 11525 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11831 11951 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11952 13385 gene locus_tag LOCUS_08570 11952 13385 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118376.1 protein_id gnl|my_center|LOCUS_08570 12665 12766 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13801 13397 gene locus_tag LOCUS_08580 13801 13397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 14102 15046 gene locus_tag LOCUS_08590 14102 15046 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_08590 16471 15110 gene locus_tag LOCUS_08600 16471 15110 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118126.1 protein_id gnl|my_center|LOCUS_08600 15264 15366 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17015 16590 gene locus_tag LOCUS_08610 17015 16590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 17574 17008 gene locus_tag LOCUS_08620 17574 17008 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325344.1 protein_id gnl|my_center|LOCUS_08620 18223 19461 gene locus_tag LOCUS_08630 18223 19461 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812397.1 protein_id gnl|my_center|LOCUS_08630 19747 22263 gene locus_tag LOCUS_08640 19747 22263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 22510 22935 gene locus_tag LOCUS_08650 22510 22935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 23157 23582 gene locus_tag LOCUS_08660 23157 23582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 24524 23586 gene locus_tag LOCUS_08670 24524 23586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 24621 24686 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24894 25065 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25402 25211 gene locus_tag LOCUS_08680 25402 25211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 25478 25591 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25849 26110 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26645 26846 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26864 27595 gene locus_tag LOCUS_08690 26864 27595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 27716 28714 gene locus_tag LOCUS_08700 27716 28714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 28761 29492 gene locus_tag LOCUS_08710 28761 29492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 29986 29567 gene locus_tag LOCUS_08720 29986 29567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 30069 30198 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31322 32659 gene locus_tag LOCUS_08730 31322 32659 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_08730 33467 32700 gene locus_tag LOCUS_08740 gene rfbA 33467 32700 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 protein_id gnl|my_center|LOCUS_08740 33477 33595 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33972 33778 gene locus_tag LOCUS_08750 33972 33778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 34126 34264 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35015 34305 gene locus_tag LOCUS_08760 35015 34305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 34432 34482 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35962 35012 gene locus_tag LOCUS_08770 35962 35012 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919030.1 protein_id gnl|my_center|LOCUS_08770 37005 36025 gene locus_tag LOCUS_08780 37005 36025 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_08780 38880 39058 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39398 40543 gene locus_tag LOCUS_08790 39398 40543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 41154 42128 gene locus_tag LOCUS_08800 41154 42128 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_08800 42342 42674 gene locus_tag LOCUS_08810 42342 42674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 43747 43139 gene locus_tag LOCUS_08820 gene rpsD 43747 43139 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846140.1 protein_id gnl|my_center|LOCUS_08820 44131 43805 gene locus_tag LOCUS_08830 44131 43805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 44194 45501 gene locus_tag LOCUS_08840 44194 45501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 45544 45855 gene locus_tag LOCUS_08850 45544 45855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 45962 47122 gene locus_tag LOCUS_08860 45962 47122 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946625.1 protein_id gnl|my_center|LOCUS_08860 47309 47398 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47747 49351 gene locus_tag LOCUS_08870 47747 49351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 49676 49794 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 50949 51086 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52466 53251 gene locus_tag LOCUS_08880 52466 53251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 53975 53601 gene locus_tag LOCUS_08890 53975 53601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence017 442 284 gene locus_tag LOCUS_08900 442 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 578 1318 gene locus_tag LOCUS_08910 578 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 1906 1412 gene locus_tag LOCUS_08920 gene smpB 1906 1412 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615559.1 protein_id gnl|my_center|LOCUS_08920 2111 2208 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2747 2337 gene locus_tag LOCUS_08930 gene nusB 2747 2337 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326965.1 protein_id gnl|my_center|LOCUS_08930 2884 3020 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3917 3636 gene locus_tag LOCUS_08940 3917 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 5115 3961 gene locus_tag LOCUS_08950 5115 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 4008 4120 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5943 5311 gene locus_tag LOCUS_08960 gene coaE 5943 5311 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816768.1 protein_id gnl|my_center|LOCUS_08960 7656 6463 gene locus_tag LOCUS_08970 7656 6463 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122791.1 protein_id gnl|my_center|LOCUS_08970 8298 8449 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8473 11607 gene locus_tag LOCUS_08980 8473 11607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 11633 13084 gene locus_tag LOCUS_08990 11633 13084 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123415.1 protein_id gnl|my_center|LOCUS_08990 15040 13157 gene locus_tag LOCUS_09000 15040 13157 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120669.1 protein_id gnl|my_center|LOCUS_09000 17130 15244 gene locus_tag LOCUS_09010 17130 15244 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120669.1 protein_id gnl|my_center|LOCUS_09010 17558 18508 gene locus_tag LOCUS_09020 gene ytpA 17558 18508 CDS product phospholipase YtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398545.1 protein_id gnl|my_center|LOCUS_09020 21163 18821 gene locus_tag LOCUS_09030 gene atsD 21163 18821 CDS product arylsulfatase AtsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403397.1 protein_id gnl|my_center|LOCUS_09030 21520 21647 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22523 21681 gene locus_tag LOCUS_09040 22523 21681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 22610 22664 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23166 23654 gene locus_tag LOCUS_09050 gene bfr 23166 23654 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_09050 23837 25624 gene locus_tag LOCUS_09060 23837 25624 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332595.1 protein_id gnl|my_center|LOCUS_09060 26055 25639 gene locus_tag LOCUS_09070 26055 25639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 27105 26173 gene locus_tag LOCUS_09080 27105 26173 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_09080 27857 27417 gene locus_tag LOCUS_09090 27857 27417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 27982 28608 gene locus_tag LOCUS_09100 27982 28608 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121917.1 protein_id gnl|my_center|LOCUS_09100 28666 30987 gene locus_tag LOCUS_09110 28666 30987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 31179 32183 gene locus_tag LOCUS_09120 31179 32183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 32369 34816 gene locus_tag LOCUS_09130 32369 34816 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117853.1 protein_id gnl|my_center|LOCUS_09130 34819 35006 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35903 35157 gene locus_tag LOCUS_09140 35903 35157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 36172 36384 gene locus_tag LOCUS_09150 36172 36384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 36381 36590 gene locus_tag LOCUS_09160 36381 36590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 36695 37384 gene locus_tag LOCUS_09170 36695 37384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 37438 38730 gene locus_tag LOCUS_09180 37438 38730 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257067.1 protein_id gnl|my_center|LOCUS_09180 38929 39819 gene locus_tag LOCUS_09190 38929 39819 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118048.1 protein_id gnl|my_center|LOCUS_09190 42317 39924 gene locus_tag LOCUS_09200 42317 39924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 46290 42292 gene locus_tag LOCUS_09210 46290 42292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 42329 42424 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47552 46812 gene locus_tag LOCUS_09220 47552 46812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 47714 47790 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48741 48532 gene locus_tag LOCUS_09230 48741 48532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 48847 49896 gene locus_tag LOCUS_09240 48847 49896 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121766.1 protein_id gnl|my_center|LOCUS_09240 50149 51036 gene locus_tag LOCUS_09250 50149 51036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 51328 52356 gene locus_tag LOCUS_09260 51328 52356 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258178.1 protein_id gnl|my_center|LOCUS_09260 52419 53465 gene locus_tag LOCUS_09270 52419 53465 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence018 930 253 gene locus_tag LOCUS_09280 930 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 2355 1006 gene locus_tag LOCUS_09290 2355 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 2669 3985 gene locus_tag LOCUS_09300 2669 3985 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_09300 5929 4358 gene locus_tag LOCUS_09310 5929 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 6550 7281 gene locus_tag LOCUS_09320 6550 7281 CDS product DUF899 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730220.1 protein_id gnl|my_center|LOCUS_09320 7533 8999 gene locus_tag LOCUS_09330 7533 8999 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921673.1 protein_id gnl|my_center|LOCUS_09330 8996 10090 gene locus_tag LOCUS_09340 gene lpxK 8996 10090 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121336.1 protein_id gnl|my_center|LOCUS_09340 10127 10289 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10790 10323 gene locus_tag LOCUS_09350 10790 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09350 10803 10872 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12201 11146 gene locus_tag LOCUS_09360 12201 11146 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044885.1 protein_id gnl|my_center|LOCUS_09360 14205 12322 gene locus_tag LOCUS_09370 14205 12322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 14695 14336 gene locus_tag LOCUS_09380 14695 14336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 16154 14688 gene locus_tag LOCUS_09390 16154 14688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 14810 14925 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19232 16431 gene locus_tag LOCUS_09400 19232 16431 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258469.1 protein_id gnl|my_center|LOCUS_09400 19523 22759 gene locus_tag LOCUS_09410 19523 22759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 20607 20782 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22996 24465 gene locus_tag LOCUS_09420 22996 24465 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_09420 25250 24483 gene locus_tag LOCUS_09430 25250 24483 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338546.1 protein_id gnl|my_center|LOCUS_09430 25565 26023 gene locus_tag LOCUS_09440 25565 26023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09440 26057 26845 gene locus_tag LOCUS_09450 26057 26845 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122697.1 protein_id gnl|my_center|LOCUS_09450 27774 27007 gene locus_tag LOCUS_09460 27774 27007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 28486 27869 gene locus_tag LOCUS_09470 28486 27869 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922130.1 protein_id gnl|my_center|LOCUS_09470 29606 29767 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30023 30195 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30397 30554 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30723 31883 gene locus_tag LOCUS_09480 30723 31883 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_09480 33510 31987 gene locus_tag LOCUS_09490 33510 31987 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 protein_id gnl|my_center|LOCUS_09490 32587 32720 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34446 33619 gene locus_tag LOCUS_09500 gene trpC 34446 33619 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122620.1 protein_id gnl|my_center|LOCUS_09500 34507 34586 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35238 35367 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35581 35740 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35822 36205 gene locus_tag LOCUS_09510 35822 36205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 36608 37912 gene locus_tag LOCUS_09520 gene lysS 36608 37912 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672011.1 protein_id gnl|my_center|LOCUS_09520 37956 38135 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38540 38238 gene locus_tag LOCUS_09530 38540 38238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 38578 38713 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39129 39288 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40164 39520 gene locus_tag LOCUS_09540 40164 39520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 40166 40309 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40512 40689 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41346 41537 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43357 41834 gene locus_tag LOCUS_09550 43357 41834 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326639.1 protein_id gnl|my_center|LOCUS_09550 43907 43482 gene locus_tag LOCUS_09560 43907 43482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 43963 44124 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45508 45206 gene locus_tag LOCUS_09570 45508 45206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 45739 46113 gene locus_tag LOCUS_09580 45739 46113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 46539 47495 gene locus_tag LOCUS_09590 46539 47495 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922054.1 protein_id gnl|my_center|LOCUS_09590 47650 48615 gene locus_tag LOCUS_09600 47650 48615 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838058.1 protein_id gnl|my_center|LOCUS_09600 48769 50436 gene locus_tag LOCUS_09610 48769 50436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 49664 49804 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 50460 50572 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51165 50692 gene locus_tag LOCUS_09620 51165 50692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 51262 51358 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence019 2008 1025 gene locus_tag LOCUS_09630 2008 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 2142 2245 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3966 3016 gene locus_tag LOCUS_09640 gene uspE 3966 3016 CDS product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211021.1 protein_id gnl|my_center|LOCUS_09640 5302 5507 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5870 5912 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5934 6263 gene locus_tag LOCUS_09650 5934 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09650 6764 6372 gene locus_tag LOCUS_09660 6764 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 7052 8119 gene locus_tag LOCUS_09670 7052 8119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 9066 8206 gene locus_tag LOCUS_09680 9066 8206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 9881 9195 gene locus_tag LOCUS_09690 9881 9195 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328113.1 protein_id gnl|my_center|LOCUS_09690 12990 10699 gene locus_tag LOCUS_09700 12990 10699 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_09700 14597 13104 gene locus_tag LOCUS_09710 gene glpK 14597 13104 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_09710 15839 14715 gene locus_tag LOCUS_09720 15839 14715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 15860 15997 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17251 16508 gene locus_tag LOCUS_09730 17251 16508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 18165 17734 gene locus_tag LOCUS_09740 18165 17734 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922123.1 protein_id gnl|my_center|LOCUS_09740 19068 18325 gene locus_tag LOCUS_09750 gene ispD 19068 18325 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122160.1 protein_id gnl|my_center|LOCUS_09750 20695 19394 gene locus_tag LOCUS_09760 20695 19394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 21020 21955 gene locus_tag LOCUS_09770 21020 21955 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_09770 22477 21986 gene locus_tag LOCUS_09780 22477 21986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 23702 22749 gene locus_tag LOCUS_09790 23702 22749 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324315.1 protein_id gnl|my_center|LOCUS_09790 24861 23965 gene locus_tag LOCUS_09800 24861 23965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 25253 24924 gene locus_tag LOCUS_09810 25253 24924 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333113.1 protein_id gnl|my_center|LOCUS_09810 25590 26261 gene locus_tag LOCUS_09820 25590 26261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 27025 26387 gene locus_tag LOCUS_09830 27025 26387 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_09830 27221 28354 gene locus_tag LOCUS_09840 27221 28354 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922041.1 protein_id gnl|my_center|LOCUS_09840 28422 28934 gene locus_tag LOCUS_09850 28422 28934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 29147 29331 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31342 30314 gene locus_tag LOCUS_09860 31342 30314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 30420 30508 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31651 32688 gene locus_tag LOCUS_09870 31651 32688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013109395.1 protein_id gnl|my_center|LOCUS_09870 33146 33154 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34908 33490 gene locus_tag LOCUS_09880 gene cls 34908 33490 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029629072.1 protein_id gnl|my_center|LOCUS_09880 35222 35875 gene locus_tag LOCUS_09890 35222 35875 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207531.1 protein_id gnl|my_center|LOCUS_09890 36369 35860 gene locus_tag LOCUS_09900 gene rfbC 36369 35860 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036472525.1 protein_id gnl|my_center|LOCUS_09900 36817 36860 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36926 37777 gene locus_tag LOCUS_09910 36926 37777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 37984 38916 gene locus_tag LOCUS_09920 37984 38916 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522631.1 protein_id gnl|my_center|LOCUS_09920 39081 40643 gene locus_tag LOCUS_09930 gene zwf 39081 40643 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_09930 41456 40647 gene locus_tag LOCUS_09940 41456 40647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 42841 41663 gene locus_tag LOCUS_09950 gene metK 42841 41663 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331112.1 protein_id gnl|my_center|LOCUS_09950 44353 43031 gene locus_tag LOCUS_09960 44353 43031 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123393.1 protein_id gnl|my_center|LOCUS_09960 44833 44465 gene locus_tag LOCUS_09970 44833 44465 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_09970 48194 44973 gene locus_tag LOCUS_09980 48194 44973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 48720 50384 gene locus_tag LOCUS_09990 48720 50384 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121094.1 protein_id gnl|my_center|LOCUS_09990 51166 50648 gene locus_tag LOCUS_10000 51166 50648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 51994 51326 gene locus_tag LOCUS_10010 51994 51326 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963914.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence020 694 29 gene locus_tag LOCUS_10020 gene pdeM 694 29 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764871.1 protein_id gnl|my_center|LOCUS_10020 3309 694 gene locus_tag LOCUS_10030 3309 694 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921429.1 protein_id gnl|my_center|LOCUS_10030 4955 3306 gene locus_tag LOCUS_10040 4955 3306 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118433.1 protein_id gnl|my_center|LOCUS_10040 6034 4952 gene locus_tag LOCUS_10050 6034 4952 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268709.1 protein_id gnl|my_center|LOCUS_10050 9598 6266 gene locus_tag LOCUS_10060 9598 6266 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123029.1 protein_id gnl|my_center|LOCUS_10060 11175 9595 gene locus_tag LOCUS_10070 11175 9595 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123028.1 protein_id gnl|my_center|LOCUS_10070 12541 11570 gene locus_tag LOCUS_10080 12541 11570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 13767 12826 gene locus_tag LOCUS_10090 13767 12826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 14893 13769 gene locus_tag LOCUS_10100 gene wecB 14893 13769 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799504.1 protein_id gnl|my_center|LOCUS_10100 16157 14958 gene locus_tag LOCUS_10110 16157 14958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 16911 16150 gene locus_tag LOCUS_10120 16911 16150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 17291 16908 gene locus_tag LOCUS_10130 17291 16908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 17338 17440 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19168 18341 gene locus_tag LOCUS_10140 19168 18341 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_10140 21538 19994 gene locus_tag LOCUS_10150 21538 19994 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671603.1 protein_id gnl|my_center|LOCUS_10150 20504 20613 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24764 21546 gene locus_tag LOCUS_10160 24764 21546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 26772 25054 gene locus_tag LOCUS_10170 26772 25054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 27872 26781 gene locus_tag LOCUS_10180 27872 26781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 28102 28203 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29476 30633 gene locus_tag LOCUS_10190 29476 30633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 30702 31826 gene locus_tag LOCUS_10200 30702 31826 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119032.1 protein_id gnl|my_center|LOCUS_10200 32068 33081 gene locus_tag LOCUS_10210 32068 33081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 33130 34941 gene locus_tag LOCUS_10220 33130 34941 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123986.1 protein_id gnl|my_center|LOCUS_10220 34926 35765 gene locus_tag LOCUS_10230 34926 35765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 36871 36644 gene locus_tag LOCUS_10240 36871 36644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 36845 37894 gene locus_tag LOCUS_10250 36845 37894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 38049 39506 gene locus_tag LOCUS_10260 38049 39506 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_10260 41081 39615 gene locus_tag LOCUS_10270 41081 39615 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_10270 41232 41376 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41551 43914 gene locus_tag LOCUS_10280 gene katG 41551 43914 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615656.1 protein_id gnl|my_center|LOCUS_10280 44339 44184 gene locus_tag LOCUS_10290 44339 44184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 44640 45452 gene locus_tag LOCUS_10300 44640 45452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922454.1 protein_id gnl|my_center|LOCUS_10300 45467 46369 gene locus_tag LOCUS_10310 45467 46369 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921649.1 protein_id gnl|my_center|LOCUS_10310 47752 46541 gene locus_tag LOCUS_10320 47752 46541 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_10320 48529 48636 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48646 49257 gene locus_tag LOCUS_10330 48646 49257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 49345 50715 gene locus_tag LOCUS_10340 49345 50715 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_10340 49550 49603 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51113 50772 gene locus_tag LOCUS_10350 51113 50772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 <52055 51354 gene locus_tag LOCUS_10360 <52055 51354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615454.1:DUF1559 domain-containing protein >Feature sequence021 211 274 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2523 1075 gene locus_tag LOCUS_10370 2523 1075 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_10370 3352 2825 gene locus_tag LOCUS_10380 3352 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 4480 3584 gene locus_tag LOCUS_10390 gene thpD 4480 3584 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063968.1 protein_id gnl|my_center|LOCUS_10390 4937 4554 gene locus_tag LOCUS_10400 4937 4554 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895350.1 protein_id gnl|my_center|LOCUS_10400 6211 4952 gene locus_tag LOCUS_10410 gene ectB 6211 4952 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729399.1 protein_id gnl|my_center|LOCUS_10410 6782 6300 gene locus_tag LOCUS_10420 gene ectA 6782 6300 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729400.1 protein_id gnl|my_center|LOCUS_10420 6951 8483 gene locus_tag LOCUS_10430 6951 8483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 7633 7733 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9182 8571 gene locus_tag LOCUS_10440 9182 8571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 13317 9187 gene locus_tag LOCUS_10450 13317 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 13812 15074 gene locus_tag LOCUS_10460 13812 15074 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_10460 17403 15241 gene locus_tag LOCUS_10470 17403 15241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 20747 17775 gene locus_tag LOCUS_10480 20747 17775 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117787.1 protein_id gnl|my_center|LOCUS_10480 20844 20980 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22461 21127 gene locus_tag LOCUS_10490 22461 21127 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615854.1 protein_id gnl|my_center|LOCUS_10490 22771 24687 gene locus_tag LOCUS_10500 22771 24687 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117783.1 protein_id gnl|my_center|LOCUS_10500 25195 25641 gene locus_tag LOCUS_10510 25195 25641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 26016 26990 gene locus_tag LOCUS_10520 26016 26990 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921814.1 protein_id gnl|my_center|LOCUS_10520 27556 28971 gene locus_tag LOCUS_10530 27556 28971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120217.1 protein_id gnl|my_center|LOCUS_10530 29720 29439 gene locus_tag LOCUS_10540 29720 29439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 30773 30922 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31248 33758 gene locus_tag LOCUS_10550 31248 33758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 33540 33651 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33727 34710 gene locus_tag LOCUS_10560 33727 34710 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124010.1 protein_id gnl|my_center|LOCUS_10560 34707 35159 gene locus_tag LOCUS_10570 34707 35159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 35152 36711 gene locus_tag LOCUS_10580 35152 36711 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124008.1 protein_id gnl|my_center|LOCUS_10580 36758 37126 gene locus_tag LOCUS_10590 36758 37126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 37123 38205 gene locus_tag LOCUS_10600 37123 38205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 38257 39015 gene locus_tag LOCUS_10610 38257 39015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 39881 39987 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40064 40414 gene locus_tag LOCUS_10620 40064 40414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 40450 41151 gene locus_tag LOCUS_10630 40450 41151 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948859.1 protein_id gnl|my_center|LOCUS_10630 41479 41180 gene locus_tag LOCUS_10640 41479 41180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 41955 41629 gene locus_tag LOCUS_10650 41955 41629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 43177 43404 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43480 44226 gene locus_tag LOCUS_10660 43480 44226 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945965.1 protein_id gnl|my_center|LOCUS_10660 45668 44565 gene locus_tag LOCUS_10670 45668 44565 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122037.1 protein_id gnl|my_center|LOCUS_10670 46807 45710 gene locus_tag LOCUS_10680 46807 45710 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922187.1 protein_id gnl|my_center|LOCUS_10680 47520 46852 gene locus_tag LOCUS_10690 47520 46852 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339994.1 protein_id gnl|my_center|LOCUS_10690 47996 49360 gene locus_tag LOCUS_10700 47996 49360 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_10700 49859 51169 gene locus_tag LOCUS_10710 gene mgtE 49859 51169 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002934126.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence022 516 629 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1675 1934 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3272 2271 gene locus_tag LOCUS_10720 3272 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 3965 3393 gene locus_tag LOCUS_10730 3965 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3990 4082 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4381 5760 gene locus_tag LOCUS_10740 4381 5760 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_10740 5753 5980 gene locus_tag LOCUS_10750 5753 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 7121 6123 gene locus_tag LOCUS_10760 7121 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 7292 7525 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8397 7552 gene locus_tag LOCUS_10770 8397 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 9509 8490 gene locus_tag LOCUS_10780 9509 8490 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922725.1 protein_id gnl|my_center|LOCUS_10780 9595 9852 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10111 10254 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10813 10882 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11599 12684 gene locus_tag LOCUS_10790 11599 12684 CDS product transaldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119230.1 protein_id gnl|my_center|LOCUS_10790 12833 13948 gene locus_tag LOCUS_10800 12833 13948 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922132.1 protein_id gnl|my_center|LOCUS_10800 15619 13976 gene locus_tag LOCUS_10810 15619 13976 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118840.1 protein_id gnl|my_center|LOCUS_10810 16340 15630 gene locus_tag LOCUS_10820 16340 15630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 16920 16978 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17183 19753 gene locus_tag LOCUS_10830 17183 19753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 20820 19795 gene locus_tag LOCUS_10840 20820 19795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121407.1 protein_id gnl|my_center|LOCUS_10840 21706 22269 gene locus_tag LOCUS_10850 gene msrA 21706 22269 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_10850 22262 22702 gene locus_tag LOCUS_10860 gene msrB 22262 22702 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 protein_id gnl|my_center|LOCUS_10860 25079 22764 gene locus_tag LOCUS_10870 25079 22764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 26829 25450 gene locus_tag LOCUS_10880 26829 25450 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_10880 27013 27249 gene locus_tag LOCUS_10890 27013 27249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 27518 27707 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27784 28368 gene locus_tag LOCUS_10900 27784 28368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 28508 31828 gene locus_tag LOCUS_10910 28508 31828 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666716.1 protein_id gnl|my_center|LOCUS_10910 29389 29514 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31855 32400 gene locus_tag LOCUS_10920 31855 32400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 32983 33126 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33652 33812 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33852 34181 gene locus_tag LOCUS_10930 33852 34181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 34215 34383 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35923 34535 gene locus_tag LOCUS_10940 gene lpdA 35923 34535 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388970.1 protein_id gnl|my_center|LOCUS_10940 36079 36250 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36475 36686 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39738 38575 gene locus_tag LOCUS_10950 39738 38575 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411661.1 protein_id gnl|my_center|LOCUS_10950 39822 40067 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40361 40454 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41854 41979 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42184 42357 gene locus_tag LOCUS_10960 42184 42357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 42616 42738 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43645 43004 gene locus_tag LOCUS_10970 43645 43004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 45011 44301 gene locus_tag LOCUS_10980 45011 44301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 45996 45112 gene locus_tag LOCUS_10990 45996 45112 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_10990 47088 46150 gene locus_tag LOCUS_11000 47088 46150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 48662 47202 gene locus_tag LOCUS_11010 48662 47202 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663784.1 protein_id gnl|my_center|LOCUS_11010 49024 49464 gene locus_tag LOCUS_11020 49024 49464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 49591 50094 gene locus_tag LOCUS_11030 49591 50094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 50135 51262 gene locus_tag LOCUS_11040 gene rsgA 50135 51262 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119119.1 protein_id gnl|my_center|LOCUS_11040 >Feature sequence023 1 4491 gene locus_tag LOCUS_11050 1 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 2775 3163 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6005 4611 gene locus_tag LOCUS_11060 6005 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 6009 6089 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6740 7306 gene locus_tag LOCUS_11070 6740 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328536.1 protein_id gnl|my_center|LOCUS_11070 8022 7459 gene locus_tag LOCUS_11080 8022 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 8372 9382 gene locus_tag LOCUS_11090 8372 9382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 9770 11638 gene locus_tag LOCUS_11100 9770 11638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 11211 11367 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11656 11871 gene locus_tag LOCUS_11110 11656 11871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 11892 12650 gene locus_tag LOCUS_11120 11892 12650 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066331278.1 protein_id gnl|my_center|LOCUS_11120 13286 14218 gene locus_tag LOCUS_11130 13286 14218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 13296 13381 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14497 16695 gene locus_tag LOCUS_11140 14497 16695 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118691.1 protein_id gnl|my_center|LOCUS_11140 17699 16704 gene locus_tag LOCUS_11150 17699 16704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 18087 18213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19000 18491 gene locus_tag LOCUS_11160 19000 18491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 19467 18997 gene locus_tag LOCUS_11170 19467 18997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 21140 19491 gene locus_tag LOCUS_11180 21140 19491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 21418 21846 gene locus_tag LOCUS_11190 21418 21846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 21898 22293 gene locus_tag LOCUS_11200 21898 22293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 22342 23778 gene locus_tag LOCUS_11210 22342 23778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 23775 24110 gene locus_tag LOCUS_11220 23775 24110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 24107 25855 gene locus_tag LOCUS_11230 24107 25855 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_11230 25880 27208 gene locus_tag LOCUS_11240 gene xcpS 25880 27208 CDS product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 protein_id gnl|my_center|LOCUS_11240 26558 26667 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27661 27758 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27776 28402 gene locus_tag LOCUS_11250 27776 28402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 28399 29034 gene locus_tag LOCUS_11260 28399 29034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 29031 29621 gene locus_tag LOCUS_11270 29031 29621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 29626 30126 gene locus_tag LOCUS_11280 29626 30126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 30394 31200 gene locus_tag LOCUS_11290 30394 31200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 31219 35406 gene locus_tag LOCUS_11300 31219 35406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 36159 35599 gene locus_tag LOCUS_11310 gene frr 36159 35599 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339966.1 protein_id gnl|my_center|LOCUS_11310 37030 36284 gene locus_tag LOCUS_11320 gene pyrH 37030 36284 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261659.1 protein_id gnl|my_center|LOCUS_11320 37961 37131 gene locus_tag LOCUS_11330 gene tsf 37961 37131 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733232.1 protein_id gnl|my_center|LOCUS_11330 38231 37992 gene locus_tag LOCUS_11340 38231 37992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 39028 38276 gene locus_tag LOCUS_11350 gene rpsB 39028 38276 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122857.1 protein_id gnl|my_center|LOCUS_11350 39888 39328 gene locus_tag LOCUS_11360 39888 39328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 40356 40036 gene locus_tag LOCUS_11370 40356 40036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 40621 40726 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41856 40816 gene locus_tag LOCUS_11380 41856 40816 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_11380 42166 42347 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42608 43111 gene locus_tag LOCUS_11390 42608 43111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 43251 44144 gene locus_tag LOCUS_11400 gene lipA 43251 44144 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665013.1 protein_id gnl|my_center|LOCUS_11400 44160 44459 gene locus_tag LOCUS_11410 44160 44459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 45088 44456 gene locus_tag LOCUS_11420 45088 44456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 45514 46287 gene locus_tag LOCUS_11430 45514 46287 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338881.1 protein_id gnl|my_center|LOCUS_11430 46463 47269 gene locus_tag LOCUS_11440 gene flgG 46463 47269 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329888.1 protein_id gnl|my_center|LOCUS_11440 47316 48515 gene locus_tag LOCUS_11450 47316 48515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 49068 49230 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49729 49809 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49894 50772 gene locus_tag LOCUS_11460 49894 50772 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869891.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence024 318 465 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 683 2914 gene locus_tag LOCUS_11470 683 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 4391 3609 gene locus_tag LOCUS_11480 4391 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 4431 4526 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6282 5752 gene locus_tag LOCUS_11490 6282 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 6898 7641 gene locus_tag LOCUS_11500 6898 7641 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340410.1 protein_id gnl|my_center|LOCUS_11500 8162 9313 gene locus_tag LOCUS_11510 8162 9313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 12558 9703 gene locus_tag LOCUS_11520 gene secD 12558 9703 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921767.1 protein_id gnl|my_center|LOCUS_11520 13173 12790 gene locus_tag LOCUS_11530 13173 12790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 13434 13584 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13823 14010 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15734 15003 gene locus_tag LOCUS_11540 15734 15003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 15766 15832 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16453 15920 gene locus_tag LOCUS_11550 16453 15920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 18400 16820 gene locus_tag LOCUS_11560 18400 16820 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120586.1 protein_id gnl|my_center|LOCUS_11560 18891 20348 gene locus_tag LOCUS_11570 gene pyk 18891 20348 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_11570 20387 20815 gene locus_tag LOCUS_11580 20387 20815 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976464.1 protein_id gnl|my_center|LOCUS_11580 21198 20881 gene locus_tag LOCUS_11590 21198 20881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 23675 22371 gene locus_tag LOCUS_11600 23675 22371 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145108765.1 protein_id gnl|my_center|LOCUS_11600 24840 23890 gene locus_tag LOCUS_11610 24840 23890 CDS product sugar phosphate isomerase/epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421554.1 protein_id gnl|my_center|LOCUS_11610 26523 25114 gene locus_tag LOCUS_11620 26523 25114 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_11620 29147 26721 gene locus_tag LOCUS_11630 29147 26721 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118122.1 protein_id gnl|my_center|LOCUS_11630 29621 30595 gene locus_tag LOCUS_11640 29621 30595 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120825.1 protein_id gnl|my_center|LOCUS_11640 30699 31172 gene locus_tag LOCUS_11650 30699 31172 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921738.1 protein_id gnl|my_center|LOCUS_11650 31338 31464 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31834 31940 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32112 32627 gene locus_tag LOCUS_11660 32112 32627 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922234.1 protein_id gnl|my_center|LOCUS_11660 32810 32646 gene locus_tag LOCUS_11670 32810 32646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 33350 34174 gene locus_tag LOCUS_11680 33350 34174 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664611.1 protein_id gnl|my_center|LOCUS_11680 35060 34200 gene locus_tag LOCUS_11690 35060 34200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 35092 35261 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36281 35559 gene locus_tag LOCUS_11700 36281 35559 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880787.1 protein_id gnl|my_center|LOCUS_11700 36750 36904 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37434 37567 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37577 37747 gene locus_tag LOCUS_11710 37577 37747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 37806 37960 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38968 38054 gene locus_tag LOCUS_11720 38968 38054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 39134 39237 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39786 39924 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39931 40866 gene locus_tag LOCUS_11730 39931 40866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 40866 42242 gene locus_tag LOCUS_11740 gene pabB 40866 42242 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267422.1 protein_id gnl|my_center|LOCUS_11740 42967 42401 gene locus_tag LOCUS_11750 42967 42401 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119882.1 protein_id gnl|my_center|LOCUS_11750 43256 43038 gene locus_tag LOCUS_11760 43256 43038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 44271 43597 gene locus_tag LOCUS_11770 44271 43597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 44318 44514 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45729 45883 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45905 48637 gene locus_tag LOCUS_11780 45905 48637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 49007 48813 gene locus_tag LOCUS_11790 49007 48813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 49099 49161 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49460 50374 gene locus_tag LOCUS_11800 49460 50374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence025 200 422 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2059 3597 gene locus_tag LOCUS_11810 2059 3597 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615974.1 protein_id gnl|my_center|LOCUS_11810 3636 4430 gene locus_tag LOCUS_11820 3636 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 4549 6360 gene locus_tag LOCUS_11830 4549 6360 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_11830 6424 6635 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6889 7019 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7032 7817 gene locus_tag LOCUS_11840 7032 7817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 7860 8054 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8166 9218 gene locus_tag LOCUS_11850 gene cyoE 8166 9218 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_11850 8592 8693 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9399 10400 gene locus_tag LOCUS_11860 9399 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 10426 10554 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10919 11157 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12365 11622 gene locus_tag LOCUS_11870 12365 11622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 14149 12365 gene locus_tag LOCUS_11880 14149 12365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 12490 12562 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15192 15289 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15608 15772 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16289 16472 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17100 17258 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17371 17787 gene locus_tag LOCUS_11890 17371 17787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 18505 17888 gene locus_tag LOCUS_11900 18505 17888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 18740 18498 gene locus_tag LOCUS_11910 18740 18498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 18853 19656 gene locus_tag LOCUS_11920 18853 19656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 20857 19658 gene locus_tag LOCUS_11930 20857 19658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 21385 20975 gene locus_tag LOCUS_11940 21385 20975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 21675 23093 gene locus_tag LOCUS_11950 gene glnA 21675 23093 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_11950 23425 24930 gene locus_tag LOCUS_11960 23425 24930 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922306.1 protein_id gnl|my_center|LOCUS_11960 24612 24742 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25512 25000 gene locus_tag LOCUS_11970 25512 25000 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774219.1 protein_id gnl|my_center|LOCUS_11970 27058 25910 gene locus_tag LOCUS_11980 27058 25910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 27266 27493 gene locus_tag LOCUS_11990 27266 27493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 28663 28847 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29545 28868 gene locus_tag LOCUS_12000 29545 28868 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 protein_id gnl|my_center|LOCUS_12000 31988 29460 gene locus_tag LOCUS_12010 31988 29460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 29568 29691 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32342 34381 gene locus_tag LOCUS_12020 32342 34381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 33963 34091 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34266 37307 gene locus_tag LOCUS_12030 34266 37307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 38206 37475 gene locus_tag LOCUS_12040 38206 37475 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022379.1 protein_id gnl|my_center|LOCUS_12040 38638 38216 gene locus_tag LOCUS_12050 38638 38216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 39097 38645 gene locus_tag LOCUS_12060 39097 38645 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328798.1 protein_id gnl|my_center|LOCUS_12060 39585 41387 gene locus_tag LOCUS_12070 39585 41387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 41854 41974 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42454 42593 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42761 43738 gene locus_tag LOCUS_12080 42761 43738 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121388.1 protein_id gnl|my_center|LOCUS_12080 43891 45600 gene locus_tag LOCUS_12090 43891 45600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 45265 45344 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45647 45836 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47137 46046 gene locus_tag LOCUS_12100 47137 46046 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615834.1 protein_id gnl|my_center|LOCUS_12100 47992 47249 gene locus_tag LOCUS_12110 47992 47249 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008656119.1 protein_id gnl|my_center|LOCUS_12110 49367 48288 gene locus_tag LOCUS_12120 49367 48288 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_12120 50439 49468 gene locus_tag LOCUS_12130 50439 49468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 >Feature sequence026 1127 933 gene locus_tag LOCUS_12140 1127 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1162 1330 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2768 1920 gene locus_tag LOCUS_12150 2768 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 3649 4821 gene locus_tag LOCUS_12160 gene egtB 3649 4821 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_12160 4863 5825 gene locus_tag LOCUS_12170 gene egtD 4863 5825 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146537107.1 protein_id gnl|my_center|LOCUS_12170 7562 6330 gene locus_tag LOCUS_12180 7562 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 8341 7559 gene locus_tag LOCUS_12190 8341 7559 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889919.1 protein_id gnl|my_center|LOCUS_12190 10049 8589 gene locus_tag LOCUS_12200 10049 8589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 8611 8642 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10256 11698 gene locus_tag LOCUS_12210 gene gatA 10256 11698 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141527.1 protein_id gnl|my_center|LOCUS_12210 11844 13256 gene locus_tag LOCUS_12220 11844 13256 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525109.1 protein_id gnl|my_center|LOCUS_12220 13534 13649 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13984 14093 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14717 14499 gene locus_tag LOCUS_12230 14717 14499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 15860 14823 gene locus_tag LOCUS_12240 15860 14823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 16499 16032 gene locus_tag LOCUS_12250 16499 16032 CDS product PA2169 family four-helix-bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324679.1 protein_id gnl|my_center|LOCUS_12250 16901 16626 gene locus_tag LOCUS_12260 16901 16626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 17185 17766 gene locus_tag LOCUS_12270 17185 17766 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975865.1 protein_id gnl|my_center|LOCUS_12270 17953 19446 gene locus_tag LOCUS_12280 17953 19446 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921752.1 protein_id gnl|my_center|LOCUS_12280 19836 22790 gene locus_tag LOCUS_12290 19836 22790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 22553 22674 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23086 23250 gene locus_tag LOCUS_12300 23086 23250 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096961.1 protein_id gnl|my_center|LOCUS_12300 23315 23506 gene locus_tag LOCUS_12310 23315 23506 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084988.1 protein_id gnl|my_center|LOCUS_12310 23591 23845 gene locus_tag LOCUS_12320 23591 23845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 24329 23931 gene locus_tag LOCUS_12330 24329 23931 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183065.1 protein_id gnl|my_center|LOCUS_12330 25115 24372 gene locus_tag LOCUS_12340 25115 24372 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_12340 25438 27297 gene locus_tag LOCUS_12350 25438 27297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 26965 27040 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27183 29177 gene locus_tag LOCUS_12360 27183 29177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 29301 30719 gene locus_tag LOCUS_12370 29301 30719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_12370 32220 30862 gene locus_tag LOCUS_12380 32220 30862 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447204.1 protein_id gnl|my_center|LOCUS_12380 32373 32476 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33481 33671 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34172 34285 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34403 35494 gene locus_tag LOCUS_12390 34403 35494 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921758.1 protein_id gnl|my_center|LOCUS_12390 35554 38772 gene locus_tag LOCUS_12400 35554 38772 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_12400 38854 39408 gene locus_tag LOCUS_12410 38854 39408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 39630 42779 gene locus_tag LOCUS_12420 39630 42779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 42642 42749 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42766 43494 gene locus_tag LOCUS_12430 42766 43494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 44737 43541 gene locus_tag LOCUS_12440 44737 43541 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_12440 44780 44863 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45935 45000 gene locus_tag LOCUS_12450 45935 45000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 46104 46204 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47993 46641 gene locus_tag LOCUS_12460 47993 46641 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_12460 49222 48047 gene locus_tag LOCUS_12470 49222 48047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 49301 49414 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence027 698 2245 gene locus_tag LOCUS_12480 gene rny 698 2245 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325643.1 protein_id gnl|my_center|LOCUS_12480 2370 3866 gene locus_tag LOCUS_12490 gene trpE 2370 3866 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121650.1 protein_id gnl|my_center|LOCUS_12490 4025 4645 gene locus_tag LOCUS_12500 4025 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 4649 5833 gene locus_tag LOCUS_12510 gene hemW 4649 5833 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122512.1 protein_id gnl|my_center|LOCUS_12510 5939 7360 gene locus_tag LOCUS_12520 gene rimO 5939 7360 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922374.1 protein_id gnl|my_center|LOCUS_12520 7447 7983 gene locus_tag LOCUS_12530 7447 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 10118 8142 gene locus_tag LOCUS_12540 gene asnB 10118 8142 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_12540 11291 10143 gene locus_tag LOCUS_12550 11291 10143 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120966.1 protein_id gnl|my_center|LOCUS_12550 11273 11485 gene locus_tag LOCUS_12560 11273 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 11547 13169 gene locus_tag LOCUS_12570 11547 13169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 11748 11869 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14506 13322 gene locus_tag LOCUS_12580 gene dprA 14506 13322 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922340.1 protein_id gnl|my_center|LOCUS_12580 15682 14738 gene locus_tag LOCUS_12590 gene ispH 15682 14738 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922221.1 protein_id gnl|my_center|LOCUS_12590 16240 15962 gene locus_tag LOCUS_12600 16240 15962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 16748 16815 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16831 17190 gene locus_tag LOCUS_12610 16831 17190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12610 17309 20551 gene locus_tag LOCUS_12620 17309 20551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 18085 18260 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22237 20864 gene locus_tag LOCUS_12630 22237 20864 CDS product DUF4147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922364.1 protein_id gnl|my_center|LOCUS_12630 22616 23383 gene locus_tag LOCUS_12640 22616 23383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 23717 24412 gene locus_tag LOCUS_12650 23717 24412 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554843.1 protein_id gnl|my_center|LOCUS_12650 25481 24477 gene locus_tag LOCUS_12660 gene ilvC 25481 24477 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339869.1 protein_id gnl|my_center|LOCUS_12660 26158 25631 gene locus_tag LOCUS_12670 gene ilvN 26158 25631 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339870.1 protein_id gnl|my_center|LOCUS_12670 27984 26548 gene locus_tag LOCUS_12680 27984 26548 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919304.1 protein_id gnl|my_center|LOCUS_12680 28177 28851 gene locus_tag LOCUS_12690 28177 28851 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120140.1 protein_id gnl|my_center|LOCUS_12690 28920 30284 gene locus_tag LOCUS_12700 28920 30284 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327631.1 protein_id gnl|my_center|LOCUS_12700 30885 30565 gene locus_tag LOCUS_12710 30885 30565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334037.1 protein_id gnl|my_center|LOCUS_12710 31103 32683 gene locus_tag LOCUS_12720 31103 32683 CDS product glycosyhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120634.1 protein_id gnl|my_center|LOCUS_12720 32894 32658 gene locus_tag LOCUS_12730 32894 32658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 34124 33681 gene locus_tag LOCUS_12740 34124 33681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 34568 35524 gene locus_tag LOCUS_12750 34568 35524 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_12750 35655 36089 gene locus_tag LOCUS_12760 35655 36089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 36193 36357 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37511 36408 gene locus_tag LOCUS_12770 37511 36408 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434952.1 protein_id gnl|my_center|LOCUS_12770 37701 37902 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37989 38846 gene locus_tag LOCUS_12780 37989 38846 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421593.1 protein_id gnl|my_center|LOCUS_12780 38921 39331 gene locus_tag LOCUS_12790 38921 39331 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_12790 41128 39404 gene locus_tag LOCUS_12800 41128 39404 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333284.1 protein_id gnl|my_center|LOCUS_12800 41166 41372 gene locus_tag LOCUS_12810 41166 41372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 41648 41436 gene locus_tag LOCUS_12820 41648 41436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 42180 42551 gene locus_tag LOCUS_12830 42180 42551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 42602 43288 gene locus_tag LOCUS_12840 gene trmD 42602 43288 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123923.1 protein_id gnl|my_center|LOCUS_12840 43376 43765 gene locus_tag LOCUS_12850 gene rplS 43376 43765 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814465.1 protein_id gnl|my_center|LOCUS_12850 43782 44183 gene locus_tag LOCUS_12860 43782 44183 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392503.1 protein_id gnl|my_center|LOCUS_12860 44451 44909 gene locus_tag LOCUS_12870 gene hisI 44451 44909 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088269.1 protein_id gnl|my_center|LOCUS_12870 44909 46156 gene locus_tag LOCUS_12880 44909 46156 CDS product tRNA adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262485.1 protein_id gnl|my_center|LOCUS_12880 <47394 46289 gene locus_tag LOCUS_12890 <47394 46289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119342.1:sulfatase-like hydrolase/transferase >Feature sequence028 227 1168 gene locus_tag LOCUS_12900 227 1168 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118998.1 protein_id gnl|my_center|LOCUS_12900 1368 2432 gene locus_tag LOCUS_12910 1368 2432 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814616.1 protein_id gnl|my_center|LOCUS_12910 2796 3071 gene locus_tag LOCUS_12920 2796 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 3607 3742 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3909 5273 gene locus_tag LOCUS_12930 3909 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 5387 6241 gene locus_tag LOCUS_12940 5387 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 6241 7413 gene locus_tag LOCUS_12950 6241 7413 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_12950 8823 7441 gene locus_tag LOCUS_12960 8823 7441 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329168.1 protein_id gnl|my_center|LOCUS_12960 8998 9175 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10523 9222 gene locus_tag LOCUS_12970 10523 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 11800 10658 gene locus_tag LOCUS_12980 11800 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 13124 12099 gene locus_tag LOCUS_12990 gene tdh 13124 12099 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707888.1 protein_id gnl|my_center|LOCUS_12990 13610 13695 gene locus_tag LOCUS_t00070 13610 13695 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 14738 18052 gene locus_tag LOCUS_13000 14738 18052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 14763 14864 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19088 18156 gene locus_tag LOCUS_13010 19088 18156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 19221 19298 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21508 19709 gene locus_tag LOCUS_13020 21508 19709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 21570 21696 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22481 21801 gene locus_tag LOCUS_13030 22481 21801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 22709 23557 gene locus_tag LOCUS_13040 22709 23557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 24396 24506 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24844 25665 gene locus_tag LOCUS_13050 24844 25665 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 protein_id gnl|my_center|LOCUS_13050 25749 26636 gene locus_tag LOCUS_13060 25749 26636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 26814 27461 gene locus_tag LOCUS_13070 26814 27461 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_13070 29156 27777 gene locus_tag LOCUS_13080 29156 27777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 29578 29886 gene locus_tag LOCUS_13090 29578 29886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 31692 29917 gene locus_tag LOCUS_13100 31692 29917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 33253 31856 gene locus_tag LOCUS_13110 33253 31856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 33397 33618 gene locus_tag LOCUS_13120 33397 33618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 33649 34377 gene locus_tag LOCUS_13130 33649 34377 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122354.1 protein_id gnl|my_center|LOCUS_13130 35191 34571 gene locus_tag LOCUS_13140 35191 34571 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974604.1 protein_id gnl|my_center|LOCUS_13140 38634 35287 gene locus_tag LOCUS_13150 38634 35287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 38996 39183 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40540 39230 gene locus_tag LOCUS_13160 40540 39230 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529386.1 protein_id gnl|my_center|LOCUS_13160 39886 39933 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40690 41073 gene locus_tag LOCUS_13170 40690 41073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 41291 43720 gene locus_tag LOCUS_13180 41291 43720 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664503.1 protein_id gnl|my_center|LOCUS_13180 43926 45155 gene locus_tag LOCUS_13190 43926 45155 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121153.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence029 567 28 gene locus_tag LOCUS_13200 567 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 913 1842 gene locus_tag LOCUS_13210 gene ilvE 913 1842 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878433.1 protein_id gnl|my_center|LOCUS_13210 1957 2883 gene locus_tag LOCUS_13220 1957 2883 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120550.1 protein_id gnl|my_center|LOCUS_13220 2935 3987 gene locus_tag LOCUS_13230 2935 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 4502 4855 gene locus_tag LOCUS_13240 4502 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 5081 5614 gene locus_tag LOCUS_13250 5081 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 5845 5963 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6434 6498 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8205 6685 gene locus_tag LOCUS_13260 8205 6685 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402000.1 protein_id gnl|my_center|LOCUS_13260 8564 9121 gene locus_tag LOCUS_13270 8564 9121 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119378.1 protein_id gnl|my_center|LOCUS_13270 9121 10419 gene locus_tag LOCUS_13280 9121 10419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 10539 11147 gene locus_tag LOCUS_13290 gene hisH 10539 11147 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943718.1 protein_id gnl|my_center|LOCUS_13290 11212 11955 gene locus_tag LOCUS_13300 gene hisA 11212 11955 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327023.1 protein_id gnl|my_center|LOCUS_13300 12239 13147 gene locus_tag LOCUS_13310 12239 13147 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122336.1 protein_id gnl|my_center|LOCUS_13310 13147 14847 gene locus_tag LOCUS_13320 13147 14847 CDS product mu-protocadherin- cell-suface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122337.1 protein_id gnl|my_center|LOCUS_13320 15343 14936 gene locus_tag LOCUS_13330 15343 14936 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922498.1 protein_id gnl|my_center|LOCUS_13330 15743 15360 gene locus_tag LOCUS_13340 15743 15360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 16235 15768 gene locus_tag LOCUS_13350 16235 15768 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948144.1 protein_id gnl|my_center|LOCUS_13350 16884 16393 gene locus_tag LOCUS_13360 16884 16393 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_13360 17286 16927 gene locus_tag LOCUS_13370 17286 16927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 18212 17343 gene locus_tag LOCUS_13380 18212 17343 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117977.1 protein_id gnl|my_center|LOCUS_13380 18776 18342 gene locus_tag LOCUS_13390 18776 18342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 20197 18938 gene locus_tag LOCUS_13400 20197 18938 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117973.1 protein_id gnl|my_center|LOCUS_13400 21803 20313 gene locus_tag LOCUS_13410 gene aroE 21803 20313 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_13410 23564 22056 gene locus_tag LOCUS_13420 23564 22056 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073422.1 protein_id gnl|my_center|LOCUS_13420 24686 23658 gene locus_tag LOCUS_13430 24686 23658 CDS product beta-ribofuranosylaminobenzene 5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119640.1 protein_id gnl|my_center|LOCUS_13430 25327 24683 gene locus_tag LOCUS_13440 25327 24683 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119639.1 protein_id gnl|my_center|LOCUS_13440 25593 26300 gene locus_tag LOCUS_13450 25593 26300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 26341 26712 gene locus_tag LOCUS_13460 26341 26712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 26732 27355 gene locus_tag LOCUS_13470 26732 27355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 27438 27646 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27748 28761 gene locus_tag LOCUS_13480 gene obgE 27748 28761 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_13480 28878 29495 gene locus_tag LOCUS_13490 28878 29495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 29900 30727 gene locus_tag LOCUS_13500 29900 30727 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333052.1 protein_id gnl|my_center|LOCUS_13500 30746 31468 gene locus_tag LOCUS_13510 30746 31468 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329973.1 protein_id gnl|my_center|LOCUS_13510 31772 33385 gene locus_tag LOCUS_13520 gene ilvD 31772 33385 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922486.1 protein_id gnl|my_center|LOCUS_13520 33513 34652 gene locus_tag LOCUS_13530 33513 34652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 36020 34758 gene locus_tag LOCUS_13540 36020 34758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 36140 36265 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36657 36834 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37096 37285 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37781 38419 gene locus_tag LOCUS_13550 37781 38419 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967892.1 protein_id gnl|my_center|LOCUS_13550 39136 38423 gene locus_tag LOCUS_13560 39136 38423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 40361 39231 gene locus_tag LOCUS_13570 40361 39231 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_13570 41869 40757 gene locus_tag LOCUS_13580 41869 40757 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654729.1 protein_id gnl|my_center|LOCUS_13580 42024 42129 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43746 42334 gene locus_tag LOCUS_13590 43746 42334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 43867 44025 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44384 44553 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45150 44992 gene locus_tag LOCUS_13600 45150 44992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 45178 45232 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence030 349 858 gene locus_tag LOCUS_13610 349 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1359 1470 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1534 2211 gene locus_tag LOCUS_13620 1534 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 2672 4012 gene locus_tag LOCUS_13630 2672 4012 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_13630 4451 4564 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5025 5145 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5403 6398 gene locus_tag LOCUS_13640 5403 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 6388 7404 gene locus_tag LOCUS_13650 6388 7404 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327669.1 protein_id gnl|my_center|LOCUS_13650 7634 8134 gene locus_tag LOCUS_13660 7634 8134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 9784 8264 gene locus_tag LOCUS_13670 9784 8264 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_13670 10600 10166 gene locus_tag LOCUS_13680 10600 10166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 10745 10845 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11419 11534 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11549 11773 gene locus_tag LOCUS_13690 11549 11773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 11925 12107 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13578 13673 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14626 14759 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16420 15509 gene locus_tag LOCUS_13700 16420 15509 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_13700 16556 18028 gene locus_tag LOCUS_13710 16556 18028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 18151 19116 gene locus_tag LOCUS_13720 gene hpnD 18151 19116 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417954.1 protein_id gnl|my_center|LOCUS_13720 20097 19270 gene locus_tag LOCUS_13730 20097 19270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 20259 20648 gene locus_tag LOCUS_13740 20259 20648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 21854 20823 gene locus_tag LOCUS_13750 21854 20823 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401898.1 protein_id gnl|my_center|LOCUS_13750 24114 22066 gene locus_tag LOCUS_13760 24114 22066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 25051 24308 gene locus_tag LOCUS_13770 25051 24308 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_13770 25557 25684 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28091 27045 gene locus_tag LOCUS_13780 28091 27045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 28327 29274 gene locus_tag LOCUS_13790 28327 29274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 29715 29940 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31638 30118 gene locus_tag LOCUS_13800 31638 30118 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107859.1 protein_id gnl|my_center|LOCUS_13800 32063 31788 gene locus_tag LOCUS_13810 32063 31788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 33737 32307 gene locus_tag LOCUS_13820 33737 32307 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_13820 33903 34820 gene locus_tag LOCUS_13830 33903 34820 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_13830 34902 35579 gene locus_tag LOCUS_13840 34902 35579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 35713 36228 gene locus_tag LOCUS_13850 35713 36228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 36261 36417 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37068 36451 gene locus_tag LOCUS_13860 37068 36451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 37137 37294 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37534 37760 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38518 37907 gene locus_tag LOCUS_13870 gene cysC 38518 37907 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380502.1 protein_id gnl|my_center|LOCUS_13870 38878 39384 gene locus_tag LOCUS_13880 38878 39384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328133.1 protein_id gnl|my_center|LOCUS_13880 39699 40334 gene locus_tag LOCUS_13890 39699 40334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 40615 41391 gene locus_tag LOCUS_13900 40615 41391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 41775 41467 gene locus_tag LOCUS_13910 41775 41467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 42350 41970 gene locus_tag LOCUS_13920 42350 41970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 42459 42566 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43553 45322 gene locus_tag LOCUS_13930 43553 45322 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122985.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence031 765 1193 gene locus_tag LOCUS_13940 765 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1186 1614 gene locus_tag LOCUS_13950 1186 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1668 1938 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2202 2507 gene locus_tag LOCUS_13960 2202 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 3090 2521 gene locus_tag LOCUS_13970 3090 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 3809 3111 gene locus_tag LOCUS_13980 3809 3111 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921488.1 protein_id gnl|my_center|LOCUS_13980 3878 4074 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4297 4456 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4559 5455 gene locus_tag LOCUS_13990 4559 5455 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324200.1 protein_id gnl|my_center|LOCUS_13990 5892 5683 gene locus_tag LOCUS_14000 5892 5683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 6485 5892 gene locus_tag LOCUS_14010 6485 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 7099 6722 gene locus_tag LOCUS_14020 7099 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081025014.1 protein_id gnl|my_center|LOCUS_14020 8220 7096 gene locus_tag LOCUS_14030 8220 7096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269295.1 protein_id gnl|my_center|LOCUS_14030 8545 10032 gene locus_tag LOCUS_14040 gene ffh 8545 10032 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329358.1 protein_id gnl|my_center|LOCUS_14040 10176 11603 gene locus_tag LOCUS_14050 gene purB 10176 11603 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 protein_id gnl|my_center|LOCUS_14050 11677 11901 gene locus_tag LOCUS_14060 11677 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 12663 12061 gene locus_tag LOCUS_14070 12663 12061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 12994 13263 gene locus_tag LOCUS_14080 gene rpsO 12994 13263 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329975.1 protein_id gnl|my_center|LOCUS_14080 13471 14067 gene locus_tag LOCUS_14090 13471 14067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14090 13825 13883 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14060 15760 gene locus_tag LOCUS_14100 14060 15760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14100 16283 16407 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16575 16949 gene locus_tag LOCUS_14110 16575 16949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 16954 17232 gene locus_tag LOCUS_14120 16954 17232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 17763 18263 gene locus_tag LOCUS_14130 17763 18263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 19043 19139 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19327 20220 gene locus_tag LOCUS_14140 19327 20220 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922494.1 protein_id gnl|my_center|LOCUS_14140 20459 20761 gene locus_tag LOCUS_14150 20459 20761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 21103 21189 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21682 21804 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22219 22395 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22632 22767 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24873 23908 gene locus_tag LOCUS_14160 24873 23908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 25021 24827 gene locus_tag LOCUS_14170 25021 24827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 25630 25680 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25732 26274 gene locus_tag LOCUS_14180 25732 26274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14180 26295 26420 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26979 26506 gene locus_tag LOCUS_14190 gene dps 26979 26506 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326579.1 protein_id gnl|my_center|LOCUS_14190 27093 27253 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28090 27365 gene locus_tag LOCUS_14200 28090 27365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 28655 29128 gene locus_tag LOCUS_14210 28655 29128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 31099 29234 gene locus_tag LOCUS_14220 31099 29234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 31308 31508 gene locus_tag LOCUS_14230 31308 31508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 32841 31651 gene locus_tag LOCUS_14240 32841 31651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 33828 32881 gene locus_tag LOCUS_14250 33828 32881 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_14250 34132 35625 gene locus_tag LOCUS_14260 34132 35625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 35717 36478 gene locus_tag LOCUS_14270 35717 36478 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_14270 36569 36709 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38777 36774 gene locus_tag LOCUS_14280 38777 36774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 37196 37367 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38811 38936 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39135 39343 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39415 39609 gene locus_tag LOCUS_14290 39415 39609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 39726 39937 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40140 40315 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42648 40624 gene locus_tag LOCUS_14300 42648 40624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 44676 44902 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence032 673 206 gene locus_tag LOCUS_14310 673 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1670 690 gene locus_tag LOCUS_14320 1670 690 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_14320 1910 3238 gene locus_tag LOCUS_14330 1910 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 3445 5058 gene locus_tag LOCUS_14340 3445 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 4679 4762 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5063 6286 gene locus_tag LOCUS_14350 5063 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 6476 7615 gene locus_tag LOCUS_14360 6476 7615 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120966.1 protein_id gnl|my_center|LOCUS_14360 7783 8982 gene locus_tag LOCUS_14370 7783 8982 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_14370 9131 9240 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10223 10351 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10481 10888 gene locus_tag LOCUS_14380 10481 10888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 10923 12098 gene locus_tag LOCUS_14390 10923 12098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 12285 12626 gene locus_tag LOCUS_14400 12285 12626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 14664 12868 gene locus_tag LOCUS_14410 14664 12868 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329990.1 protein_id gnl|my_center|LOCUS_14410 15026 14841 gene locus_tag LOCUS_14420 15026 14841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 15609 17417 gene locus_tag LOCUS_14430 15609 17417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 16862 17003 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17469 17618 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17744 18679 gene locus_tag LOCUS_14440 17744 18679 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324520.1 protein_id gnl|my_center|LOCUS_14440 19344 18775 gene locus_tag LOCUS_14450 19344 18775 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 protein_id gnl|my_center|LOCUS_14450 19638 21752 gene locus_tag LOCUS_14460 19638 21752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 22022 21828 gene locus_tag LOCUS_14470 22022 21828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 22041 22898 gene locus_tag LOCUS_14480 22041 22898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 23721 22903 gene locus_tag LOCUS_14490 23721 22903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 23848 24005 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24209 24365 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24655 24398 gene locus_tag LOCUS_14500 gene gatC 24655 24398 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143272.1 protein_id gnl|my_center|LOCUS_14500 24694 24784 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25155 24841 gene locus_tag LOCUS_14510 25155 24841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 25710 26024 gene locus_tag LOCUS_14520 25710 26024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 27139 27223 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27583 29613 gene locus_tag LOCUS_14530 27583 29613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122606.1 protein_id gnl|my_center|LOCUS_14530 29641 29713 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29906 30853 gene locus_tag LOCUS_14540 29906 30853 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122858.1 protein_id gnl|my_center|LOCUS_14540 31010 32311 gene locus_tag LOCUS_14550 31010 32311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 32460 33131 gene locus_tag LOCUS_14560 32460 33131 CDS product LssY C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816911.1 protein_id gnl|my_center|LOCUS_14560 34324 34466 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34487 34819 gene locus_tag LOCUS_14570 34487 34819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 34859 35212 gene locus_tag LOCUS_14580 34859 35212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 35963 35775 gene locus_tag LOCUS_14590 35963 35775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 36663 36109 gene locus_tag LOCUS_14600 gene bcp 36663 36109 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220392.1 protein_id gnl|my_center|LOCUS_14600 37040 36714 gene locus_tag LOCUS_14610 37040 36714 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877119.1 protein_id gnl|my_center|LOCUS_14610 37987 37229 gene locus_tag LOCUS_14620 37987 37229 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922179.1 protein_id gnl|my_center|LOCUS_14620 38820 38236 gene locus_tag LOCUS_14630 38820 38236 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921906.1 protein_id gnl|my_center|LOCUS_14630 39230 40174 gene locus_tag LOCUS_14640 39230 40174 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_14640 40258 40716 gene locus_tag LOCUS_14650 40258 40716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 40806 41999 gene locus_tag LOCUS_14660 40806 41999 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262953.1 protein_id gnl|my_center|LOCUS_14660 41663 41779 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42128 43210 gene locus_tag LOCUS_14670 42128 43210 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262953.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence033 161 319 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1823 801 gene locus_tag LOCUS_14680 1823 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 2237 2389 gene locus_tag LOCUS_14690 2237 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 2907 5183 gene locus_tag LOCUS_14700 2907 5183 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259371.1 protein_id gnl|my_center|LOCUS_14700 5180 6073 gene locus_tag LOCUS_14710 5180 6073 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_14710 6364 6855 gene locus_tag LOCUS_14720 6364 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 7031 7202 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9575 7341 gene locus_tag LOCUS_14730 9575 7341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 9608 9707 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10029 10157 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10456 10725 gene locus_tag LOCUS_14740 10456 10725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 11474 12193 gene locus_tag LOCUS_14750 11474 12193 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277074.1 protein_id gnl|my_center|LOCUS_14750 12087 12156 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12413 13996 gene locus_tag LOCUS_14760 12413 13996 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 protein_id gnl|my_center|LOCUS_14760 15500 14082 gene locus_tag LOCUS_14770 15500 14082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 16586 15891 gene locus_tag LOCUS_14780 16586 15891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 16657 16793 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19705 17816 gene locus_tag LOCUS_14790 19705 17816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 21501 19816 gene locus_tag LOCUS_14800 21501 19816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 23685 21682 gene locus_tag LOCUS_14810 23685 21682 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328238.1 protein_id gnl|my_center|LOCUS_14810 21939 21999 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24031 23705 gene locus_tag LOCUS_14820 24031 23705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 24253 24417 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26775 26353 gene locus_tag LOCUS_14830 26775 26353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 27224 27634 gene locus_tag LOCUS_14840 27224 27634 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086522.1 protein_id gnl|my_center|LOCUS_14840 27842 29338 gene locus_tag LOCUS_14850 gene argH 27842 29338 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037227775.1 protein_id gnl|my_center|LOCUS_14850 29325 30155 gene locus_tag LOCUS_14860 gene truA 29325 30155 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_14860 30350 30493 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31625 30588 gene locus_tag LOCUS_14870 31625 30588 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_14870 32140 31793 gene locus_tag LOCUS_14880 32140 31793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 35397 32191 gene locus_tag LOCUS_14890 35397 32191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 32240 32314 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35491 35597 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36019 37122 gene locus_tag LOCUS_14900 36019 37122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 38162 37455 gene locus_tag LOCUS_14910 38162 37455 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903268.1 protein_id gnl|my_center|LOCUS_14910 40198 38426 gene locus_tag LOCUS_14920 40198 38426 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990142.1 protein_id gnl|my_center|LOCUS_14920 40934 40239 gene locus_tag LOCUS_14930 40934 40239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 41034 41169 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence034 478 1077 gene locus_tag LOCUS_14940 478 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14940 971 1024 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1043 2455 gene locus_tag LOCUS_14950 1043 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14950 2458 3201 gene locus_tag LOCUS_14960 2458 3201 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_14960 4146 5273 gene locus_tag LOCUS_14970 4146 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 5276 6742 gene locus_tag LOCUS_14980 5276 6742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 5462 5523 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7272 6829 gene locus_tag LOCUS_14990 7272 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 7739 7380 gene locus_tag LOCUS_15000 7739 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 8092 7958 gene locus_tag LOCUS_15010 8092 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 8712 8884 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9795 8953 gene locus_tag LOCUS_15020 9795 8953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 9820 9926 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13770 11290 gene locus_tag LOCUS_15030 13770 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 15086 13767 gene locus_tag LOCUS_15040 15086 13767 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_15040 16664 15267 gene locus_tag LOCUS_15050 16664 15267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 16695 16955 gene locus_tag LOCUS_15060 16695 16955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 17239 18717 gene locus_tag LOCUS_15070 17239 18717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 20118 18832 gene locus_tag LOCUS_15080 20118 18832 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203404.1 protein_id gnl|my_center|LOCUS_15080 20932 20333 gene locus_tag LOCUS_15090 20932 20333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 22397 20973 gene locus_tag LOCUS_15100 22397 20973 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_15100 23227 22589 gene locus_tag LOCUS_15110 23227 22589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 23239 23356 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24868 24071 gene locus_tag LOCUS_15120 24868 24071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 24929 25029 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27070 25718 gene locus_tag LOCUS_15130 27070 25718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 27470 28618 gene locus_tag LOCUS_15140 27470 28618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 29371 31422 gene locus_tag LOCUS_15150 29371 31422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 31511 31672 gene locus_tag LOCUS_15160 31511 31672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 32952 34109 gene locus_tag LOCUS_15170 32952 34109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 34246 36771 gene locus_tag LOCUS_15180 34246 36771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 37923 37504 gene locus_tag LOCUS_15190 37923 37504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15190 38703 38972 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39225 39472 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <41227 40364 gene locus_tag LOCUS_15200 <41227 40364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921757.1:efflux RND transporter permease subunit >Feature sequence035 308 413 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 778 935 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2261 1557 gene locus_tag LOCUS_15210 2261 1557 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812013.1 protein_id gnl|my_center|LOCUS_15210 2651 2268 gene locus_tag LOCUS_15220 gene acpS 2651 2268 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174182.1 protein_id gnl|my_center|LOCUS_15220 3329 2811 gene locus_tag LOCUS_15230 3329 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 4093 7218 gene locus_tag LOCUS_15240 4093 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 7328 7753 gene locus_tag LOCUS_15250 7328 7753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 8261 9838 gene locus_tag LOCUS_15260 gene dnaK 8261 9838 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902322.1 protein_id gnl|my_center|LOCUS_15260 9890 10912 gene locus_tag LOCUS_15270 9890 10912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 12076 11045 gene locus_tag LOCUS_15280 12076 11045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15280 12136 12278 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12776 12939 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13426 15486 gene locus_tag LOCUS_15290 13426 15486 CDS product isoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120158.1 protein_id gnl|my_center|LOCUS_15290 15547 15688 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16016 16083 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16518 16650 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17468 17803 gene locus_tag LOCUS_15300 17468 17803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 17945 18463 gene locus_tag LOCUS_15310 17945 18463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 19294 18521 gene locus_tag LOCUS_15320 19294 18521 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120816.1 protein_id gnl|my_center|LOCUS_15320 20815 19481 gene locus_tag LOCUS_15330 gene dnaB 20815 19481 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815191.1 protein_id gnl|my_center|LOCUS_15330 20822 20903 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21613 21104 gene locus_tag LOCUS_15340 gene rplI 21613 21104 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122533.1 protein_id gnl|my_center|LOCUS_15340 22313 21816 gene locus_tag LOCUS_15350 22313 21816 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339883.1 protein_id gnl|my_center|LOCUS_15350 22828 22409 gene locus_tag LOCUS_15360 22828 22409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 23641 23072 gene locus_tag LOCUS_15370 gene pth 23641 23072 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122535.1 protein_id gnl|my_center|LOCUS_15370 23762 23879 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24260 24051 gene locus_tag LOCUS_15380 24260 24051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 24339 24464 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24848 24480 gene locus_tag LOCUS_15390 24848 24480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 26367 26487 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26540 26959 gene locus_tag LOCUS_15400 26540 26959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 26985 27854 gene locus_tag LOCUS_15410 26985 27854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 29472 28192 gene locus_tag LOCUS_15420 29472 28192 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331975.1 protein_id gnl|my_center|LOCUS_15420 30978 29563 gene locus_tag LOCUS_15430 30978 29563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 31426 32640 gene locus_tag LOCUS_15440 31426 32640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 33505 33600 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33661 34371 gene locus_tag LOCUS_15450 33661 34371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 34563 35483 gene locus_tag LOCUS_15460 34563 35483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 36666 35494 gene locus_tag LOCUS_15470 36666 35494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 38227 36671 gene locus_tag LOCUS_15480 38227 36671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 36675 36797 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38251 38404 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38941 38468 gene locus_tag LOCUS_15490 38941 38468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 38981 39115 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39399 39693 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40265 40329 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40675 40910 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence036 <1 733 gene locus_tag LOCUS_15500 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085687.1:sulfite oxidase-like oxidoreductase 802 897 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1466 1044 gene locus_tag LOCUS_15510 1466 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1600 2562 gene locus_tag LOCUS_15520 1600 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 2563 3255 gene locus_tag LOCUS_15530 2563 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 4441 3383 gene locus_tag LOCUS_15540 gene rodA 4441 3383 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957655.1 protein_id gnl|my_center|LOCUS_15540 5076 5852 gene locus_tag LOCUS_15550 gene lpxA 5076 5852 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921002.1 protein_id gnl|my_center|LOCUS_15550 6457 5954 gene locus_tag LOCUS_15560 6457 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 6523 6649 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7393 7893 gene locus_tag LOCUS_15570 gene coaD 7393 7893 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122863.1 protein_id gnl|my_center|LOCUS_15570 8781 7942 gene locus_tag LOCUS_15580 8781 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 10194 8842 gene locus_tag LOCUS_15590 10194 8842 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_15590 11116 10307 gene locus_tag LOCUS_15600 11116 10307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 12478 11132 gene locus_tag LOCUS_15610 12478 11132 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 protein_id gnl|my_center|LOCUS_15610 14053 12737 gene locus_tag LOCUS_15620 14053 12737 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119953.1 protein_id gnl|my_center|LOCUS_15620 14882 14394 gene locus_tag LOCUS_15630 14882 14394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 14894 14968 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16066 15248 gene locus_tag LOCUS_15640 16066 15248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 17605 16172 gene locus_tag LOCUS_15650 17605 16172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 18374 17829 gene locus_tag LOCUS_15660 18374 17829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 18629 18804 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20754 18835 gene locus_tag LOCUS_15670 20754 18835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 19421 19525 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20795 20927 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21344 22579 gene locus_tag LOCUS_15680 21344 22579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 22612 22738 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22950 23852 gene locus_tag LOCUS_15690 22950 23852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 24336 24133 gene locus_tag LOCUS_15700 24336 24133 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061019.1 protein_id gnl|my_center|LOCUS_15700 24593 24384 gene locus_tag LOCUS_15710 24593 24384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 25098 24628 gene locus_tag LOCUS_15720 25098 24628 CDS product PA2169 family four-helix-bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324679.1 protein_id gnl|my_center|LOCUS_15720 25508 25852 gene locus_tag LOCUS_15730 25508 25852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15730 26759 25959 gene locus_tag LOCUS_15740 26759 25959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 28667 26985 gene locus_tag LOCUS_15750 28667 26985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 31276 28931 gene locus_tag LOCUS_15760 31276 28931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 31438 31911 gene locus_tag LOCUS_15770 31438 31911 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_15770 32587 33132 gene locus_tag LOCUS_15780 32587 33132 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263004.1 protein_id gnl|my_center|LOCUS_15780 33327 34271 gene locus_tag LOCUS_15790 gene fhcD 33327 34271 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334456.1 protein_id gnl|my_center|LOCUS_15790 34363 36354 gene locus_tag LOCUS_15800 34363 36354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 36373 37551 gene locus_tag LOCUS_15810 36373 37551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530033.1 protein_id gnl|my_center|LOCUS_15810 38924 37548 gene locus_tag LOCUS_15820 38924 37548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 39885 38995 gene locus_tag LOCUS_15830 39885 38995 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228479.1 protein_id gnl|my_center|LOCUS_15830 40298 40446 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence037 114 1106 gene locus_tag LOCUS_15840 114 1106 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331126.1 protein_id gnl|my_center|LOCUS_15840 1144 1269 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1482 2585 gene locus_tag LOCUS_15850 gene mraY 1482 2585 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313553.1 protein_id gnl|my_center|LOCUS_15850 3575 3735 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4033 4193 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4227 4427 gene locus_tag LOCUS_15860 4227 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 4540 5946 gene locus_tag LOCUS_15870 4540 5946 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_15870 5987 6841 gene locus_tag LOCUS_15880 5987 6841 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947363.1 protein_id gnl|my_center|LOCUS_15880 6923 7195 gene locus_tag LOCUS_15890 6923 7195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15890 7438 7097 gene locus_tag LOCUS_15900 7438 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 7516 7600 gene locus_tag LOCUS_t00080 7516 7600 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9643 7721 gene locus_tag LOCUS_15910 9643 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 9915 10685 gene locus_tag LOCUS_15920 gene kdsB 9915 10685 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123860.1 protein_id gnl|my_center|LOCUS_15920 10837 12459 gene locus_tag LOCUS_15930 10837 12459 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326169.1 protein_id gnl|my_center|LOCUS_15930 12634 14988 gene locus_tag LOCUS_15940 12634 14988 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121337.1 protein_id gnl|my_center|LOCUS_15940 14992 16323 gene locus_tag LOCUS_15950 14992 16323 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921544.1 protein_id gnl|my_center|LOCUS_15950 17598 16447 gene locus_tag LOCUS_15960 17598 16447 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922354.1 protein_id gnl|my_center|LOCUS_15960 18339 17629 gene locus_tag LOCUS_15970 18339 17629 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_15970 18628 19233 gene locus_tag LOCUS_15980 18628 19233 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442700.1 protein_id gnl|my_center|LOCUS_15980 19292 19651 gene locus_tag LOCUS_15990 19292 19651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 19706 20965 gene locus_tag LOCUS_16000 19706 20965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 21064 22092 gene locus_tag LOCUS_16010 21064 22092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 22231 23481 gene locus_tag LOCUS_16020 gene gspF 22231 23481 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112721.1 protein_id gnl|my_center|LOCUS_16020 23560 24732 gene locus_tag LOCUS_16030 23560 24732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 24738 25184 gene locus_tag LOCUS_16040 24738 25184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 25177 25788 gene locus_tag LOCUS_16050 25177 25788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 25785 26195 gene locus_tag LOCUS_16060 25785 26195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 26275 26383 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27787 27921 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29051 28023 gene locus_tag LOCUS_16070 29051 28023 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324151.1 protein_id gnl|my_center|LOCUS_16070 30230 29118 gene locus_tag LOCUS_16080 30230 29118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 30370 30482 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32790 32924 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33105 34556 gene locus_tag LOCUS_16090 33105 34556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 34379 34485 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34540 35130 gene locus_tag LOCUS_16100 34540 35130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 36245 35283 gene locus_tag LOCUS_16110 36245 35283 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_16110 36796 37980 gene locus_tag LOCUS_16120 gene sucC 36796 37980 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327386.1 protein_id gnl|my_center|LOCUS_16120 38053 38226 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39005 39130 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence038 1645 2619 gene locus_tag LOCUS_16130 1645 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 3223 3361 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6285 5203 gene locus_tag LOCUS_16140 gene fliM 6285 5203 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334519.1 protein_id gnl|my_center|LOCUS_16140 7592 6324 gene locus_tag LOCUS_16150 7592 6324 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121351.1 protein_id gnl|my_center|LOCUS_16150 8313 8538 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8818 8570 gene locus_tag LOCUS_16160 8818 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 8822 9030 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9342 9514 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9986 10144 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10344 11816 gene locus_tag LOCUS_16170 10344 11816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 11655 11770 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11842 14172 gene locus_tag LOCUS_16180 11842 14172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 13349 13541 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14264 14395 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15632 14487 gene locus_tag LOCUS_16190 15632 14487 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921398.1 protein_id gnl|my_center|LOCUS_16190 15081 15191 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15838 16578 gene locus_tag LOCUS_16200 15838 16578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 16693 18252 gene locus_tag LOCUS_16210 16693 18252 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119512.1 protein_id gnl|my_center|LOCUS_16210 18242 18709 gene locus_tag LOCUS_16220 18242 18709 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404314.1 protein_id gnl|my_center|LOCUS_16220 18724 18944 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19203 19326 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19826 20026 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20114 20794 gene locus_tag LOCUS_16230 20114 20794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16230 20934 21003 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21274 22629 gene locus_tag LOCUS_16240 gene thrC 21274 22629 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_16240 22766 23269 gene locus_tag LOCUS_16250 22766 23269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 23364 24686 gene locus_tag LOCUS_16260 23364 24686 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 protein_id gnl|my_center|LOCUS_16260 25772 24690 gene locus_tag LOCUS_16270 25772 24690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 26260 25802 gene locus_tag LOCUS_16280 26260 25802 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120329.1 protein_id gnl|my_center|LOCUS_16280 27230 26283 gene locus_tag LOCUS_16290 27230 26283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 28173 27310 gene locus_tag LOCUS_16300 28173 27310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 28722 29132 gene locus_tag LOCUS_16310 28722 29132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 29235 29972 gene locus_tag LOCUS_16320 29235 29972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 30156 29986 gene locus_tag LOCUS_16330 30156 29986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 31014 30253 gene locus_tag LOCUS_16340 31014 30253 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119307.1 protein_id gnl|my_center|LOCUS_16340 31934 31116 gene locus_tag LOCUS_16350 31934 31116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 31954 32051 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33737 32802 gene locus_tag LOCUS_16360 33737 32802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 33751 33866 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35201 34203 gene locus_tag LOCUS_16370 35201 34203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 35509 35243 gene locus_tag LOCUS_16380 gene fliQ 35509 35243 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811859.1 protein_id gnl|my_center|LOCUS_16380 36523 35588 gene locus_tag LOCUS_16390 36523 35588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 37638 36520 gene locus_tag LOCUS_16400 37638 36520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 36709 36785 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38368 37703 gene locus_tag LOCUS_16410 38368 37703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 38979 38431 gene locus_tag LOCUS_16420 38979 38431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 39903 39199 gene locus_tag LOCUS_16430 39903 39199 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326459.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence039 1269 283 gene locus_tag LOCUS_16440 1269 283 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_16440 1559 1266 gene locus_tag LOCUS_16450 1559 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 1960 3720 gene locus_tag LOCUS_16460 1960 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 4772 3792 gene locus_tag LOCUS_16470 4772 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 3898 3958 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5037 5516 gene locus_tag LOCUS_16480 5037 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 5606 5775 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6258 6443 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6794 6931 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7318 7460 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10371 7810 gene locus_tag LOCUS_16490 10371 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 13002 10591 gene locus_tag LOCUS_16500 13002 10591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 11312 11403 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14165 13179 gene locus_tag LOCUS_16510 14165 13179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 14364 14182 gene locus_tag LOCUS_16520 14364 14182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 14760 15179 gene locus_tag LOCUS_16530 14760 15179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 15409 15522 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16490 16646 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16682 16906 gene locus_tag LOCUS_16540 16682 16906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 17980 16991 gene locus_tag LOCUS_16550 17980 16991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 20034 17983 gene locus_tag LOCUS_16560 gene fadJ 20034 17983 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151654740.1 protein_id gnl|my_center|LOCUS_16560 20102 20259 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21640 20318 gene locus_tag LOCUS_16570 21640 20318 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957671.1 protein_id gnl|my_center|LOCUS_16570 21845 21977 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22278 22048 gene locus_tag LOCUS_16580 22278 22048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 23420 22266 gene locus_tag LOCUS_16590 23420 22266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 22319 22423 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23584 23772 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24117 24218 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25491 24928 gene locus_tag LOCUS_16600 25491 24928 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329717.1 protein_id gnl|my_center|LOCUS_16600 25656 25762 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28182 26098 gene locus_tag LOCUS_16610 gene fusA 28182 26098 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121593.1 protein_id gnl|my_center|LOCUS_16610 28392 28739 gene locus_tag LOCUS_16620 28392 28739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 29058 28903 gene locus_tag LOCUS_16630 29058 28903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 29094 29193 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29932 30084 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30174 30524 gene locus_tag LOCUS_16640 30174 30524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 30664 30772 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31409 31008 gene locus_tag LOCUS_16650 31409 31008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 31614 33458 gene locus_tag LOCUS_16660 31614 33458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 33455 34645 gene locus_tag LOCUS_16670 33455 34645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 34801 35379 gene locus_tag LOCUS_16680 34801 35379 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921657.1 protein_id gnl|my_center|LOCUS_16680 <37066 35553 gene locus_tag LOCUS_16690 <37066 35553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007337137.1:glycine--tRNA ligase >Feature sequence040 169 343 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 358 1005 gene locus_tag LOCUS_16700 gene sigW 358 1005 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_16700 1075 1359 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1960 2045 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2481 2332 gene locus_tag LOCUS_16710 2481 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 5092 2666 gene locus_tag LOCUS_16720 5092 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 2672 2818 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5863 5306 gene locus_tag LOCUS_16730 5863 5306 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332895.1 protein_id gnl|my_center|LOCUS_16730 8265 5992 gene locus_tag LOCUS_16740 8265 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 10871 8415 gene locus_tag LOCUS_16750 10871 8415 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_16750 12717 11041 gene locus_tag LOCUS_16760 12717 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 13486 12677 gene locus_tag LOCUS_16770 13486 12677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 12815 12887 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15187 13847 gene locus_tag LOCUS_16780 15187 13847 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_16780 16003 15563 gene locus_tag LOCUS_16790 16003 15563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 16209 16359 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17358 16819 gene locus_tag LOCUS_16800 gene dtd 17358 16819 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_16800 17861 17409 gene locus_tag LOCUS_16810 17861 17409 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 protein_id gnl|my_center|LOCUS_16810 18642 17935 gene locus_tag LOCUS_16820 18642 17935 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_16820 19151 21889 gene locus_tag LOCUS_16830 19151 21889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 22236 21904 gene locus_tag LOCUS_16840 22236 21904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 22266 22394 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23875 23267 gene locus_tag LOCUS_16850 gene sodA 23875 23267 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052031.1 protein_id gnl|my_center|LOCUS_16850 24547 24686 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24886 25533 gene locus_tag LOCUS_16860 24886 25533 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122890.1 protein_id gnl|my_center|LOCUS_16860 25668 29063 gene locus_tag LOCUS_16870 25668 29063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 29279 31732 gene locus_tag LOCUS_16880 29279 31732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 33026 31791 gene locus_tag LOCUS_16890 33026 31791 CDS product DUF5690 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120645.1 protein_id gnl|my_center|LOCUS_16890 34138 33284 gene locus_tag LOCUS_16900 34138 33284 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206428.1 protein_id gnl|my_center|LOCUS_16900 35096 34320 gene locus_tag LOCUS_16910 gene hisF 35096 34320 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325161.1 protein_id gnl|my_center|LOCUS_16910 35364 35149 gene locus_tag LOCUS_16920 35364 35149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 36274 35900 gene locus_tag LOCUS_16930 36274 35900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence041 603 1586 gene locus_tag LOCUS_16940 603 1586 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_16940 1965 1720 gene locus_tag LOCUS_16950 1965 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1846 2292 gene locus_tag LOCUS_16960 1846 2292 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339818.1 protein_id gnl|my_center|LOCUS_16960 5303 2496 gene locus_tag LOCUS_16970 5303 2496 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922491.1 protein_id gnl|my_center|LOCUS_16970 5397 5483 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5932 6058 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6751 6470 gene locus_tag LOCUS_16980 6751 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 7887 6853 gene locus_tag LOCUS_16990 7887 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 6867 6950 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8067 9056 gene locus_tag LOCUS_17000 gene nadA 8067 9056 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140196.1 protein_id gnl|my_center|LOCUS_17000 9159 10520 gene locus_tag LOCUS_17010 9159 10520 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121268.1 protein_id gnl|my_center|LOCUS_17010 11814 10618 gene locus_tag LOCUS_17020 11814 10618 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965859.1 protein_id gnl|my_center|LOCUS_17020 12362 11979 gene locus_tag LOCUS_17030 12362 11979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 12879 14807 gene locus_tag LOCUS_17040 gene speA 12879 14807 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767598.1 protein_id gnl|my_center|LOCUS_17040 14926 16236 gene locus_tag LOCUS_17050 14926 16236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 16300 17136 gene locus_tag LOCUS_17060 16300 17136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 17189 18271 gene locus_tag LOCUS_17070 17189 18271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 21427 18332 gene locus_tag LOCUS_17080 21427 18332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 22583 21435 gene locus_tag LOCUS_17090 22583 21435 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731604.1 protein_id gnl|my_center|LOCUS_17090 22989 22654 gene locus_tag LOCUS_17100 22989 22654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 26114 23124 gene locus_tag LOCUS_17110 26114 23124 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416348.1 protein_id gnl|my_center|LOCUS_17110 27809 26232 gene locus_tag LOCUS_17120 gene cimA 27809 26232 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332450.1 protein_id gnl|my_center|LOCUS_17120 30152 28149 gene locus_tag LOCUS_17130 30152 28149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 28474 28604 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29512 29566 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31106 30282 gene locus_tag LOCUS_17140 31106 30282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 33171 31111 gene locus_tag LOCUS_17150 33171 31111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 31157 31299 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33212 33377 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33935 33423 gene locus_tag LOCUS_17160 33935 33423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 33971 34149 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35781 34666 gene locus_tag LOCUS_17170 35781 34666 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122077.1 protein_id gnl|my_center|LOCUS_17170 36046 36693 gene locus_tag LOCUS_17180 36046 36693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence042 1366 947 gene locus_tag LOCUS_17190 1366 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 2227 1391 gene locus_tag LOCUS_17200 2227 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 2893 3924 gene locus_tag LOCUS_17210 gene argC 2893 3924 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118924.1 protein_id gnl|my_center|LOCUS_17210 4564 4271 gene locus_tag LOCUS_17220 4564 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 6384 4684 gene locus_tag LOCUS_17230 6384 4684 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123969.1 protein_id gnl|my_center|LOCUS_17230 7234 7342 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7371 7898 gene locus_tag LOCUS_17240 7371 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 8466 7951 gene locus_tag LOCUS_17250 8466 7951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 9701 8673 gene locus_tag LOCUS_17260 9701 8673 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_17260 10018 10356 gene locus_tag LOCUS_17270 10018 10356 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122463.1 protein_id gnl|my_center|LOCUS_17270 11769 10357 gene locus_tag LOCUS_17280 11769 10357 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037247553.1 protein_id gnl|my_center|LOCUS_17280 12207 13268 gene locus_tag LOCUS_17290 12207 13268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17290 13141 13203 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13261 13620 gene locus_tag LOCUS_17300 13261 13620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 13707 14990 gene locus_tag LOCUS_17310 13707 14990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 14687 14796 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14900 15136 gene locus_tag LOCUS_17320 14900 15136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 15163 15270 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17014 15458 gene locus_tag LOCUS_17330 17014 15458 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118024.1 protein_id gnl|my_center|LOCUS_17330 17837 17118 gene locus_tag LOCUS_17340 17837 17118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 18097 21135 gene locus_tag LOCUS_17350 18097 21135 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_17350 21894 22068 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22104 22733 gene locus_tag LOCUS_17360 22104 22733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 23261 22773 gene locus_tag LOCUS_17370 23261 22773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 23265 23380 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23744 23828 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25050 24265 gene locus_tag LOCUS_17380 25050 24265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 25100 25220 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26473 27018 gene locus_tag LOCUS_17390 26473 27018 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937609.1 protein_id gnl|my_center|LOCUS_17390 27066 27431 gene locus_tag LOCUS_17400 27066 27431 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546608.1 protein_id gnl|my_center|LOCUS_17400 29059 27632 gene locus_tag LOCUS_17410 29059 27632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086332.1 protein_id gnl|my_center|LOCUS_17410 31983 29122 gene locus_tag LOCUS_17420 31983 29122 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_17420 32793 34289 gene locus_tag LOCUS_17430 32793 34289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 35169 34591 gene locus_tag LOCUS_17440 35169 34591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 35948 35259 gene locus_tag LOCUS_17450 35948 35259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 36356 36455 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence043 1418 2776 gene locus_tag LOCUS_17460 1418 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 3469 4932 gene locus_tag LOCUS_17470 3469 4932 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021070980.1 protein_id gnl|my_center|LOCUS_17470 4982 5194 gene locus_tag LOCUS_17480 4982 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 5309 5659 gene locus_tag LOCUS_17490 5309 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 7861 5822 gene locus_tag LOCUS_17500 7861 5822 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669835.1 protein_id gnl|my_center|LOCUS_17500 8168 9061 gene locus_tag LOCUS_17510 8168 9061 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_17510 9202 9927 gene locus_tag LOCUS_17520 9202 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 11042 10023 gene locus_tag LOCUS_17530 11042 10023 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337669.1 protein_id gnl|my_center|LOCUS_17530 11832 11500 gene locus_tag LOCUS_17540 11832 11500 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326964.1 protein_id gnl|my_center|LOCUS_17540 12185 13552 gene locus_tag LOCUS_17550 12185 13552 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107715.1 protein_id gnl|my_center|LOCUS_17550 13961 13575 gene locus_tag LOCUS_17560 13961 13575 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_17560 14146 14407 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15433 14510 gene locus_tag LOCUS_17570 15433 14510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 15501 15586 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16070 16228 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16811 17602 gene locus_tag LOCUS_17580 16811 17602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17580 17467 17536 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17602 17874 gene locus_tag LOCUS_17590 17602 17874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 18043 19455 gene locus_tag LOCUS_17600 18043 19455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 19323 19445 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19481 20362 gene locus_tag LOCUS_17610 19481 20362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 21100 21211 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21260 21676 gene locus_tag LOCUS_17620 21260 21676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 23372 21654 gene locus_tag LOCUS_17630 23372 21654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 26661 23446 gene locus_tag LOCUS_17640 26661 23446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 26092 26176 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27970 26744 gene locus_tag LOCUS_17650 27970 26744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 28217 28387 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29972 28413 gene locus_tag LOCUS_17660 29972 28413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 31626 30061 gene locus_tag LOCUS_17670 31626 30061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 32235 31777 gene locus_tag LOCUS_17680 32235 31777 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922384.1 protein_id gnl|my_center|LOCUS_17680 32337 32966 gene locus_tag LOCUS_17690 32337 32966 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186100.1 protein_id gnl|my_center|LOCUS_17690 33593 33786 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34111 34304 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34546 35673 gene locus_tag LOCUS_17700 34546 35673 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782251.1 protein_id gnl|my_center|LOCUS_17700 35797 35976 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence044 463 595 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1243 1776 gene locus_tag LOCUS_17710 1243 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1769 3559 gene locus_tag LOCUS_17720 1769 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 3734 7108 gene locus_tag LOCUS_17730 3734 7108 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119561.1 protein_id gnl|my_center|LOCUS_17730 5251 5334 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7007 7098 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7141 7644 gene locus_tag LOCUS_17740 7141 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 7711 8985 gene locus_tag LOCUS_17750 7711 8985 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921673.1 protein_id gnl|my_center|LOCUS_17750 9050 9844 gene locus_tag LOCUS_17760 9050 9844 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527984.1 protein_id gnl|my_center|LOCUS_17760 10973 12298 gene locus_tag LOCUS_17770 10973 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 12107 12178 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12453 13862 gene locus_tag LOCUS_17780 12453 13862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 14012 16213 gene locus_tag LOCUS_17790 14012 16213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 16634 16721 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17624 19591 gene locus_tag LOCUS_17800 17624 19591 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122606.1 protein_id gnl|my_center|LOCUS_17800 20716 19691 gene locus_tag LOCUS_17810 20716 19691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 21053 22576 gene locus_tag LOCUS_17820 21053 22576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 22432 22505 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22896 22981 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24455 23208 gene locus_tag LOCUS_17830 24455 23208 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_17830 27387 24526 gene locus_tag LOCUS_17840 27387 24526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 28440 27517 gene locus_tag LOCUS_17850 28440 27517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 31521 29038 gene locus_tag LOCUS_17860 31521 29038 CDS product DUF1588 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921596.1 protein_id gnl|my_center|LOCUS_17860 32660 31518 gene locus_tag LOCUS_17870 32660 31518 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921597.1 protein_id gnl|my_center|LOCUS_17870 33789 35270 gene locus_tag LOCUS_17880 33789 35270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 35120 35230 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35419 35653 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence045 422 165 gene locus_tag LOCUS_17890 422 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 412 1833 gene locus_tag LOCUS_17900 412 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 2192 1830 gene locus_tag LOCUS_17910 2192 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 5565 2263 gene locus_tag LOCUS_17920 5565 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 6013 6804 gene locus_tag LOCUS_17930 6013 6804 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122726.1 protein_id gnl|my_center|LOCUS_17930 6997 7953 gene locus_tag LOCUS_17940 6997 7953 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_17940 8408 8611 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9304 9448 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9563 10600 gene locus_tag LOCUS_17950 gene pstA 9563 10600 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405019.1 protein_id gnl|my_center|LOCUS_17950 10685 11542 gene locus_tag LOCUS_17960 gene pstB 10685 11542 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962535.1 protein_id gnl|my_center|LOCUS_17960 11657 12268 gene locus_tag LOCUS_17970 gene phoU 11657 12268 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_17970 12684 12880 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13347 14852 gene locus_tag LOCUS_17980 13347 14852 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123160.1 protein_id gnl|my_center|LOCUS_17980 15635 15985 gene locus_tag LOCUS_17990 15635 15985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 15985 17094 gene locus_tag LOCUS_18000 15985 17094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 16951 17048 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17141 18292 gene locus_tag LOCUS_18010 17141 18292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 18682 18383 gene locus_tag LOCUS_18020 18682 18383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 19311 20924 gene locus_tag LOCUS_18030 19311 20924 CDS product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615374.1 protein_id gnl|my_center|LOCUS_18030 20981 21259 gene locus_tag LOCUS_18040 20981 21259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 21348 22784 gene locus_tag LOCUS_18050 21348 22784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 22647 22756 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22766 23491 gene locus_tag LOCUS_18060 22766 23491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 24133 23660 gene locus_tag LOCUS_18070 24133 23660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 25300 24260 gene locus_tag LOCUS_18080 25300 24260 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_18080 27314 25689 gene locus_tag LOCUS_18090 27314 25689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 26482 26574 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28196 27435 gene locus_tag LOCUS_18100 28196 27435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 28260 28400 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29659 28775 gene locus_tag LOCUS_18110 29659 28775 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 protein_id gnl|my_center|LOCUS_18110 29952 31238 gene locus_tag LOCUS_18120 29952 31238 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_18120 31419 31772 gene locus_tag LOCUS_18130 31419 31772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 31957 32955 gene locus_tag LOCUS_18140 31957 32955 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326204.1 protein_id gnl|my_center|LOCUS_18140 32992 33816 gene locus_tag LOCUS_18150 32992 33816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 33579 33641 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34025 34121 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34175 34537 gene locus_tag LOCUS_18160 34175 34537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 <35637 34606 gene locus_tag LOCUS_18170 <35637 34606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122381.1:DUF1501 domain-containing protein >Feature sequence046 736 29 gene locus_tag LOCUS_18180 736 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1751 759 gene locus_tag LOCUS_18190 gene fliG 1751 759 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326344.1 protein_id gnl|my_center|LOCUS_18190 2626 1844 gene locus_tag LOCUS_18200 2626 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 2635 2763 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3964 3656 gene locus_tag LOCUS_18210 3964 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 4410 4009 gene locus_tag LOCUS_18220 gene flgC 4410 4009 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442696.1 protein_id gnl|my_center|LOCUS_18220 4477 4638 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5256 4717 gene locus_tag LOCUS_18230 5256 4717 CDS product flagellar biosynthesis protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922066.1 protein_id gnl|my_center|LOCUS_18230 5854 5405 gene locus_tag LOCUS_18240 5854 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 8585 5901 gene locus_tag LOCUS_18250 8585 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 10662 8836 gene locus_tag LOCUS_18260 10662 8836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 12083 10944 gene locus_tag LOCUS_18270 12083 10944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 13830 12835 gene locus_tag LOCUS_18280 13830 12835 CDS product DUF21 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324277.1 protein_id gnl|my_center|LOCUS_18280 15128 13827 gene locus_tag LOCUS_18290 15128 13827 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324278.1 protein_id gnl|my_center|LOCUS_18290 15294 15433 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15732 17576 gene locus_tag LOCUS_18300 15732 17576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 17443 17516 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17711 18214 gene locus_tag LOCUS_18310 17711 18214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 18365 18976 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatggggccgtccattttcaggacggaagac 18977 19075 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19229 19333 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19320 20078 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatggggccgtccattttcaggacggaagac 20558 20265 gene locus_tag LOCUS_18320 20558 20265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 20976 20632 gene locus_tag LOCUS_18330 20976 20632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18330 21693 20986 gene locus_tag LOCUS_18340 21693 20986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18340 21750 21926 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22465 22662 gene locus_tag LOCUS_18350 22465 22662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 24492 22879 gene locus_tag LOCUS_18360 24492 22879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 25458 24499 gene locus_tag LOCUS_18370 25458 24499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 27707 25515 gene locus_tag LOCUS_18380 27707 25515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 30217 27704 gene locus_tag LOCUS_18390 30217 27704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 31243 30230 gene locus_tag LOCUS_18400 31243 30230 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118773.1 protein_id gnl|my_center|LOCUS_18400 34181 34305 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35120 35267 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence047 358 50 gene locus_tag LOCUS_18410 358 50 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336823.1 protein_id gnl|my_center|LOCUS_18410 625 1434 gene locus_tag LOCUS_18420 625 1434 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327143.1 protein_id gnl|my_center|LOCUS_18420 1570 2433 gene locus_tag LOCUS_18430 1570 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 2682 2805 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2863 3021 gene locus_tag LOCUS_18440 2863 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 3380 3595 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6680 3678 gene locus_tag LOCUS_18450 6680 3678 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_18450 6894 7000 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8859 7138 gene locus_tag LOCUS_18460 gene recQ 8859 7138 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921919.1 protein_id gnl|my_center|LOCUS_18460 8865 8976 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9214 9405 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9638 10444 gene locus_tag LOCUS_18470 9638 10444 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922163.1 protein_id gnl|my_center|LOCUS_18470 10657 11313 gene locus_tag LOCUS_18480 10657 11313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 11957 12169 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12448 12662 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12739 13458 gene locus_tag LOCUS_18490 12739 13458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 13948 13475 gene locus_tag LOCUS_18500 13948 13475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 13956 14062 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14421 14510 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16204 15362 gene locus_tag LOCUS_18510 gene pstC 16204 15362 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814831.1 protein_id gnl|my_center|LOCUS_18510 16853 16191 gene locus_tag LOCUS_18520 16853 16191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 17007 17135 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17689 17366 gene locus_tag LOCUS_18530 17689 17366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 17872 17983 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18769 18068 gene locus_tag LOCUS_18540 18769 18068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 19001 19154 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21584 22174 gene locus_tag LOCUS_18550 21584 22174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 24388 22274 gene locus_tag LOCUS_18560 24388 22274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 24461 24688 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26238 24745 gene locus_tag LOCUS_18570 26238 24745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119062.1 protein_id gnl|my_center|LOCUS_18570 26879 26313 gene locus_tag LOCUS_18580 26879 26313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 28108 26876 gene locus_tag LOCUS_18590 28108 26876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 26950 27032 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28137 28257 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30221 29121 gene locus_tag LOCUS_18600 30221 29121 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120858.1 protein_id gnl|my_center|LOCUS_18600 31006 30719 gene locus_tag LOCUS_18610 31006 30719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 32427 31243 gene locus_tag LOCUS_18620 32427 31243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 32758 33273 gene locus_tag LOCUS_18630 32758 33273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 33653 33976 gene locus_tag LOCUS_18640 33653 33976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence048 1105 887 gene locus_tag LOCUS_18650 1105 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1709 1134 gene locus_tag LOCUS_18660 1709 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 2401 2090 gene locus_tag LOCUS_18670 2401 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2659 2423 gene locus_tag LOCUS_18680 2659 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 2662 2730 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3161 3327 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3673 3771 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5043 3967 gene locus_tag LOCUS_18690 5043 3967 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_18690 5690 5118 gene locus_tag LOCUS_18700 5690 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 6987 5770 gene locus_tag LOCUS_18710 gene tyrS 6987 5770 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_18710 7145 8296 gene locus_tag LOCUS_18720 gene murG 7145 8296 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_18720 9401 8283 gene locus_tag LOCUS_18730 9401 8283 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_18730 9677 10459 gene locus_tag LOCUS_18740 9677 10459 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775976.1 protein_id gnl|my_center|LOCUS_18740 10599 11990 gene locus_tag LOCUS_18750 10599 11990 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665703.1 protein_id gnl|my_center|LOCUS_18750 13750 12332 gene locus_tag LOCUS_18760 gene nadB 13750 12332 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119573.1 protein_id gnl|my_center|LOCUS_18760 13852 13936 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14903 14112 gene locus_tag LOCUS_18770 14903 14112 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_18770 16010 15147 gene locus_tag LOCUS_18780 16010 15147 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_18780 16287 17444 gene locus_tag LOCUS_18790 gene queG 16287 17444 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120810.1 protein_id gnl|my_center|LOCUS_18790 17537 17726 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17935 18112 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18198 18755 gene locus_tag LOCUS_18800 18198 18755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 18776 18886 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19155 20930 gene locus_tag LOCUS_18810 19155 20930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120907.1 protein_id gnl|my_center|LOCUS_18810 19573 19682 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20957 22927 gene locus_tag LOCUS_18820 20957 22927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 21739 21859 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23258 23812 gene locus_tag LOCUS_18830 23258 23812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 24411 23977 gene locus_tag LOCUS_18840 24411 23977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 25003 25710 gene locus_tag LOCUS_18850 25003 25710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 25707 27350 gene locus_tag LOCUS_18860 25707 27350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 28834 27347 gene locus_tag LOCUS_18870 28834 27347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 29550 28831 gene locus_tag LOCUS_18880 29550 28831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 32984 29547 gene locus_tag LOCUS_18890 32984 29547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 >Feature sequence049 170 1648 gene locus_tag LOCUS_18900 170 1648 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922709.1 protein_id gnl|my_center|LOCUS_18900 1737 3167 gene locus_tag LOCUS_18910 1737 3167 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120435.1 protein_id gnl|my_center|LOCUS_18910 3944 3240 gene locus_tag LOCUS_18920 3944 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 4580 5428 gene locus_tag LOCUS_18930 4580 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 6744 5659 gene locus_tag LOCUS_18940 gene recA 6744 5659 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813294.1 protein_id gnl|my_center|LOCUS_18940 7177 7557 gene locus_tag LOCUS_18950 7177 7557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 8059 8185 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9725 11098 gene locus_tag LOCUS_18960 9725 11098 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229640.1 protein_id gnl|my_center|LOCUS_18960 11309 12202 gene locus_tag LOCUS_18970 gene truB 11309 12202 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728501.1 protein_id gnl|my_center|LOCUS_18970 12430 13863 gene locus_tag LOCUS_18980 12430 13863 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340179.1 protein_id gnl|my_center|LOCUS_18980 14001 14990 gene locus_tag LOCUS_18990 14001 14990 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_18990 15045 18407 gene locus_tag LOCUS_19000 15045 18407 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122581.1 protein_id gnl|my_center|LOCUS_19000 18741 21290 gene locus_tag LOCUS_19010 18741 21290 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008668559.1 protein_id gnl|my_center|LOCUS_19010 21287 22204 gene locus_tag LOCUS_19020 21287 22204 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407851.1 protein_id gnl|my_center|LOCUS_19020 22307 24451 gene locus_tag LOCUS_19030 22307 24451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 25642 24743 gene locus_tag LOCUS_19040 25642 24743 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008670430.1 protein_id gnl|my_center|LOCUS_19040 27115 25688 gene locus_tag LOCUS_19050 27115 25688 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_19050 27590 28564 gene locus_tag LOCUS_19060 27590 28564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 28379 28458 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28554 29033 gene locus_tag LOCUS_19070 28554 29033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 29030 29323 gene locus_tag LOCUS_19080 29030 29323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 29327 29938 gene locus_tag LOCUS_19090 29327 29938 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812379.1 protein_id gnl|my_center|LOCUS_19090 31483 30107 gene locus_tag LOCUS_19100 31483 30107 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_19100 31986 31663 gene locus_tag LOCUS_19110 31986 31663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 32014 32176 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32506 32615 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33243 33472 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence050 747 938 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2471 3043 gene locus_tag LOCUS_19120 2471 3043 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329551.1 protein_id gnl|my_center|LOCUS_19120 3639 3849 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4545 4027 gene locus_tag LOCUS_19130 gene mscL 4545 4027 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932912.1 protein_id gnl|my_center|LOCUS_19130 4867 5424 gene locus_tag LOCUS_19140 4867 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 5478 5690 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6938 5778 gene locus_tag LOCUS_19150 6938 5778 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922070.1 protein_id gnl|my_center|LOCUS_19150 6308 6378 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7003 7130 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8631 8134 gene locus_tag LOCUS_19160 8631 8134 CDS product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318810.1 protein_id gnl|my_center|LOCUS_19160 10783 8708 gene locus_tag LOCUS_19170 gene tssH 10783 8708 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549921.1 protein_id gnl|my_center|LOCUS_19170 10821 10927 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12616 11549 gene locus_tag LOCUS_19180 gene tssG 12616 11549 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705450.1 protein_id gnl|my_center|LOCUS_19180 14454 12613 gene locus_tag LOCUS_19190 gene tssF 14454 12613 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343627.1 protein_id gnl|my_center|LOCUS_19190 15279 14803 gene locus_tag LOCUS_19200 gene tssE 15279 14803 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318239.1 protein_id gnl|my_center|LOCUS_19200 16133 15333 gene locus_tag LOCUS_19210 16133 15333 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463815.1 protein_id gnl|my_center|LOCUS_19210 18090 16459 gene locus_tag LOCUS_19220 gene tssC 18090 16459 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480259.1 protein_id gnl|my_center|LOCUS_19220 19702 18206 gene locus_tag LOCUS_19230 gene tssC 19702 18206 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463811.1 protein_id gnl|my_center|LOCUS_19230 20218 19823 gene locus_tag LOCUS_19240 20218 19823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 20243 20336 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21919 20795 gene locus_tag LOCUS_19250 gene tssA 21919 20795 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480330.1 protein_id gnl|my_center|LOCUS_19250 22240 22368 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22602 23498 gene locus_tag LOCUS_19260 22602 23498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 23553 23828 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25485 24028 gene locus_tag LOCUS_19270 25485 24028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 26636 25851 gene locus_tag LOCUS_19280 26636 25851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 27365 26856 gene locus_tag LOCUS_19290 27365 26856 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_19290 27961 27587 gene locus_tag LOCUS_19300 27961 27587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 28073 28185 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28849 29448 gene locus_tag LOCUS_19310 28849 29448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 30992 29628 gene locus_tag LOCUS_19320 30992 29628 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_19320 31246 32451 gene locus_tag LOCUS_19330 31246 32451 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880318.1 protein_id gnl|my_center|LOCUS_19330 33108 33288 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence051 50 1489 gene locus_tag LOCUS_19340 50 1489 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922918.1 protein_id gnl|my_center|LOCUS_19340 1570 2808 gene locus_tag LOCUS_19350 1570 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 4212 3103 gene locus_tag LOCUS_19360 4212 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 4498 5055 gene locus_tag LOCUS_19370 4498 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921838.1 protein_id gnl|my_center|LOCUS_19370 5414 5504 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5533 5994 gene locus_tag LOCUS_19380 5533 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 6144 7568 gene locus_tag LOCUS_19390 6144 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 8162 7755 gene locus_tag LOCUS_19400 8162 7755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 8168 8401 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8786 9103 gene locus_tag LOCUS_19410 8786 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 11012 9003 gene locus_tag LOCUS_19420 11012 9003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 11892 12134 gene locus_tag LOCUS_19430 11892 12134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 15254 12471 gene locus_tag LOCUS_19440 15254 12471 CDS product vegetatible incompatibility protein HET-E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122384.1 protein_id gnl|my_center|LOCUS_19440 18264 15286 gene locus_tag LOCUS_19450 18264 15286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 20941 18407 gene locus_tag LOCUS_19460 20941 18407 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816832.1 protein_id gnl|my_center|LOCUS_19460 21509 21946 gene locus_tag LOCUS_19470 21509 21946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 22008 23492 gene locus_tag LOCUS_19480 22008 23492 CDS product PA14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260479.1 protein_id gnl|my_center|LOCUS_19480 23493 23831 gene locus_tag LOCUS_19490 23493 23831 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635217.1 protein_id gnl|my_center|LOCUS_19490 23943 24491 gene locus_tag LOCUS_19500 23943 24491 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194622.1 protein_id gnl|my_center|LOCUS_19500 26300 25194 gene locus_tag LOCUS_19510 26300 25194 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327198.1 protein_id gnl|my_center|LOCUS_19510 26975 27715 gene locus_tag LOCUS_19520 26975 27715 CDS product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964070.1 protein_id gnl|my_center|LOCUS_19520 27802 28239 gene locus_tag LOCUS_19530 27802 28239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 28250 29371 gene locus_tag LOCUS_19540 28250 29371 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202982.1 protein_id gnl|my_center|LOCUS_19540 30608 29415 gene locus_tag LOCUS_19550 30608 29415 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442691.1 protein_id gnl|my_center|LOCUS_19550 31661 30621 gene locus_tag LOCUS_19560 31661 30621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922092.1 protein_id gnl|my_center|LOCUS_19560 32803 31661 gene locus_tag LOCUS_19570 32803 31661 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427735.1 protein_id gnl|my_center|LOCUS_19570 33336 32875 gene locus_tag LOCUS_19580 33336 32875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121521.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence052 3609 76 gene locus_tag LOCUS_19590 3609 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 259 372 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3960 4409 gene locus_tag LOCUS_19600 3960 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 5808 4564 gene locus_tag LOCUS_19610 5808 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 7228 5810 gene locus_tag LOCUS_19620 7228 5810 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_19620 9124 7511 gene locus_tag LOCUS_19630 gene groL 9124 7511 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325911.1 protein_id gnl|my_center|LOCUS_19630 9531 9229 gene locus_tag LOCUS_19640 9531 9229 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325910.1 protein_id gnl|my_center|LOCUS_19640 9757 10005 gene locus_tag LOCUS_19650 9757 10005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 10623 10120 gene locus_tag LOCUS_19660 10623 10120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 11299 10694 gene locus_tag LOCUS_19670 11299 10694 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_19670 12656 12811 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12900 13388 gene locus_tag LOCUS_19680 12900 13388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 13491 14096 gene locus_tag LOCUS_19690 13491 14096 CDS product DUF4291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 protein_id gnl|my_center|LOCUS_19690 14705 14109 gene locus_tag LOCUS_19700 14705 14109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 14770 14882 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14938 15285 gene locus_tag LOCUS_19710 14938 15285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 15716 15970 gene locus_tag LOCUS_19720 15716 15970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 16155 16982 gene locus_tag LOCUS_19730 16155 16982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 17110 17514 gene locus_tag LOCUS_19740 17110 17514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 18990 17782 gene locus_tag LOCUS_19750 18990 17782 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_19750 19705 19121 gene locus_tag LOCUS_19760 19705 19121 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082901050.1 protein_id gnl|my_center|LOCUS_19760 19939 20013 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20316 20095 gene locus_tag LOCUS_19770 20316 20095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 20653 20856 gene locus_tag LOCUS_19780 20653 20856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 21295 21837 gene locus_tag LOCUS_19790 gene rimI 21295 21837 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017535.1 protein_id gnl|my_center|LOCUS_19790 23217 21949 gene locus_tag LOCUS_19800 23217 21949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 24343 23309 gene locus_tag LOCUS_19810 24343 23309 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118600.1 protein_id gnl|my_center|LOCUS_19810 24350 24441 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25123 24494 gene locus_tag LOCUS_19820 25123 24494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 25928 25383 gene locus_tag LOCUS_19830 25928 25383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 26161 25925 gene locus_tag LOCUS_19840 26161 25925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 27971 26736 gene locus_tag LOCUS_19850 27971 26736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 29291 29487 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29608 30459 gene locus_tag LOCUS_19860 29608 30459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 31467 30736 gene locus_tag LOCUS_19870 31467 30736 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122357.1 protein_id gnl|my_center|LOCUS_19870 33046 31472 gene locus_tag LOCUS_19880 33046 31472 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_19880 >Feature sequence053 109 3990 gene locus_tag LOCUS_19890 109 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 4673 7183 gene locus_tag LOCUS_19900 4673 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19900 7016 7102 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7129 7704 gene locus_tag LOCUS_19910 7129 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 7701 9095 gene locus_tag LOCUS_19920 7701 9095 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122712.1 protein_id gnl|my_center|LOCUS_19920 9095 10570 gene locus_tag LOCUS_19930 9095 10570 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122711.1 protein_id gnl|my_center|LOCUS_19930 10563 12551 gene locus_tag LOCUS_19940 10563 12551 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615587.1 protein_id gnl|my_center|LOCUS_19940 12835 15087 gene locus_tag LOCUS_19950 12835 15087 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921395.1 protein_id gnl|my_center|LOCUS_19950 16107 16196 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16934 17072 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17114 17755 gene locus_tag LOCUS_19960 17114 17755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 17848 18642 gene locus_tag LOCUS_19970 17848 18642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 18574 18627 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18644 19525 gene locus_tag LOCUS_19980 18644 19525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 19825 19920 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20348 20544 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20958 21030 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21090 22460 gene locus_tag LOCUS_19990 21090 22460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 22345 23511 gene locus_tag LOCUS_20000 22345 23511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 22351 22428 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23514 24947 gene locus_tag LOCUS_20010 23514 24947 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120961.1 protein_id gnl|my_center|LOCUS_20010 25879 25184 gene locus_tag LOCUS_20020 25879 25184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 26607 25957 gene locus_tag LOCUS_20030 26607 25957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 26656 26780 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27707 27363 gene locus_tag LOCUS_20040 27707 27363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615892.1 protein_id gnl|my_center|LOCUS_20040 28339 27707 gene locus_tag LOCUS_20050 28339 27707 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921580.1 protein_id gnl|my_center|LOCUS_20050 29394 28339 gene locus_tag LOCUS_20060 29394 28339 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119071.1 protein_id gnl|my_center|LOCUS_20060 30496 29489 gene locus_tag LOCUS_20070 30496 29489 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615893.1 protein_id gnl|my_center|LOCUS_20070 31002 31190 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31671 31805 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence054 1160 1362 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1667 1800 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2655 4835 gene locus_tag LOCUS_20080 2655 4835 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336886.1 protein_id gnl|my_center|LOCUS_20080 4819 6771 gene locus_tag LOCUS_20090 4819 6771 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616027.1 protein_id gnl|my_center|LOCUS_20090 7405 6788 gene locus_tag LOCUS_20100 gene rdgB 7405 6788 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921833.1 protein_id gnl|my_center|LOCUS_20100 9161 7458 gene locus_tag LOCUS_20110 9161 7458 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123836.1 protein_id gnl|my_center|LOCUS_20110 10399 9338 gene locus_tag LOCUS_20120 10399 9338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 11391 10609 gene locus_tag LOCUS_20130 11391 10609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 13380 11470 gene locus_tag LOCUS_20140 13380 11470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 14374 15777 gene locus_tag LOCUS_20150 14374 15777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 15823 16305 gene locus_tag LOCUS_20160 15823 16305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 16982 16302 gene locus_tag LOCUS_20170 16982 16302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 17486 18463 gene locus_tag LOCUS_20180 17486 18463 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921954.1 protein_id gnl|my_center|LOCUS_20180 19505 18474 gene locus_tag LOCUS_20190 19505 18474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20190 20382 19810 gene locus_tag LOCUS_20200 20382 19810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 21439 20417 gene locus_tag LOCUS_20210 21439 20417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 20458 20543 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22554 21439 gene locus_tag LOCUS_20220 22554 21439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 23202 25079 gene locus_tag LOCUS_20230 23202 25079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 25247 25507 gene locus_tag LOCUS_20240 25247 25507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 25504 26271 gene locus_tag LOCUS_20250 25504 26271 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266861.1 protein_id gnl|my_center|LOCUS_20250 28373 26292 gene locus_tag LOCUS_20260 28373 26292 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 protein_id gnl|my_center|LOCUS_20260 29138 29219 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29346 30035 gene locus_tag LOCUS_20270 29346 30035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 30117 31727 gene locus_tag LOCUS_20280 30117 31727 CDS product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073595568.1 protein_id gnl|my_center|LOCUS_20280 32327 31743 gene locus_tag LOCUS_20290 32327 31743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence055 1081 197 gene locus_tag LOCUS_20300 1081 197 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846539.1 protein_id gnl|my_center|LOCUS_20300 2426 1056 gene locus_tag LOCUS_20310 gene murC 2426 1056 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_20310 3108 2614 gene locus_tag LOCUS_20320 3108 2614 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334911.1 protein_id gnl|my_center|LOCUS_20320 3268 3358 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4656 4800 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4958 5407 gene locus_tag LOCUS_20330 4958 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 5768 5436 gene locus_tag LOCUS_20340 5768 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 6094 10299 gene locus_tag LOCUS_20350 6094 10299 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039974.1 protein_id gnl|my_center|LOCUS_20350 9199 9346 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10111 10243 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10548 10330 gene locus_tag LOCUS_20360 10548 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 10800 10918 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13616 11004 gene locus_tag LOCUS_20370 gene alaS 13616 11004 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121911.1 protein_id gnl|my_center|LOCUS_20370 14335 14036 gene locus_tag LOCUS_20380 14335 14036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 14712 15941 gene locus_tag LOCUS_20390 14712 15941 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616082.1 protein_id gnl|my_center|LOCUS_20390 16786 16938 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17440 16976 gene locus_tag LOCUS_20400 17440 16976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 17552 17707 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18205 18358 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18790 18488 gene locus_tag LOCUS_20410 gene rplT 18790 18488 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332030.1 protein_id gnl|my_center|LOCUS_20410 19234 18971 gene locus_tag LOCUS_20420 19234 18971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 19739 19410 gene locus_tag LOCUS_20430 19739 19410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 19746 19875 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20580 23129 gene locus_tag LOCUS_20440 20580 23129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 23197 23706 gene locus_tag LOCUS_20450 23197 23706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 24609 23731 gene locus_tag LOCUS_20460 24609 23731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 24631 24719 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24890 25052 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25613 25762 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26509 25898 gene locus_tag LOCUS_20470 26509 25898 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123705.1 protein_id gnl|my_center|LOCUS_20470 29132 26649 gene locus_tag LOCUS_20480 gene glgX 29132 26649 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898930.1 protein_id gnl|my_center|LOCUS_20480 29529 29637 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30202 31374 gene locus_tag LOCUS_20490 30202 31374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 30314 30386 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence056 490 296 gene locus_tag LOCUS_20500 490 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 855 487 gene locus_tag LOCUS_20510 855 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 1370 1594 gene locus_tag LOCUS_20520 1370 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 4283 1962 gene locus_tag LOCUS_20530 4283 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 6627 4276 gene locus_tag LOCUS_20540 gene pglZ 6627 4276 CDS product BREX-1 system phosphatase PglZ type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393722.1 protein_id gnl|my_center|LOCUS_20540 7416 6655 gene locus_tag LOCUS_20550 7416 6655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 8489 7398 gene locus_tag LOCUS_20560 8489 7398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 12134 8499 gene locus_tag LOCUS_20570 12134 8499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 11061 11187 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13157 12228 gene locus_tag LOCUS_20580 13157 12228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 13251 13399 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14583 14697 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16453 15905 gene locus_tag LOCUS_20590 16453 15905 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_20590 17231 16440 gene locus_tag LOCUS_20600 17231 16440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393727.1 protein_id gnl|my_center|LOCUS_20600 17538 17287 gene locus_tag LOCUS_20610 17538 17287 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459051.1 protein_id gnl|my_center|LOCUS_20610 17703 18005 gene locus_tag LOCUS_20620 17703 18005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 18142 18762 gene locus_tag LOCUS_20630 18142 18762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 20025 19129 gene locus_tag LOCUS_20640 20025 19129 CDS product plasmid partitioning protein RepB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974303.1 protein_id gnl|my_center|LOCUS_20640 20912 20022 gene locus_tag LOCUS_20650 20912 20022 CDS product plasmid partitioning protein RepB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974304.1 protein_id gnl|my_center|LOCUS_20650 22483 20909 gene locus_tag LOCUS_20660 22483 20909 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338946.1 protein_id gnl|my_center|LOCUS_20660 23047 22607 gene locus_tag LOCUS_20670 23047 22607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 24246 24485 gene locus_tag LOCUS_20680 24246 24485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 25650 25462 gene locus_tag LOCUS_20690 25650 25462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 25943 25629 gene locus_tag LOCUS_20700 25943 25629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 26366 26058 gene locus_tag LOCUS_20710 26366 26058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 29185 28202 gene locus_tag LOCUS_20720 29185 28202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 29506 29303 gene locus_tag LOCUS_20730 29506 29303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 30740 29913 gene locus_tag LOCUS_20740 30740 29913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence057 2419 1418 gene locus_tag LOCUS_20750 gene prfB 2419 1418 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146392543.1 protein_id gnl|my_center|LOCUS_20750 3976 2654 gene locus_tag LOCUS_20760 3976 2654 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_20760 5242 4136 gene locus_tag LOCUS_20770 gene rfbB 5242 4136 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_20770 5984 5283 gene locus_tag LOCUS_20780 5984 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333116.1 protein_id gnl|my_center|LOCUS_20780 8110 6236 gene locus_tag LOCUS_20790 8110 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 8801 8247 gene locus_tag LOCUS_20800 8801 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 8958 10124 gene locus_tag LOCUS_20810 8958 10124 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_20810 10329 10150 gene locus_tag LOCUS_20820 10329 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 10396 11493 gene locus_tag LOCUS_20830 10396 11493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 11570 11725 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11931 13109 gene locus_tag LOCUS_20840 11931 13109 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324149.1 protein_id gnl|my_center|LOCUS_20840 13111 13677 gene locus_tag LOCUS_20850 13111 13677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 14302 14451 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14601 14740 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16856 17167 gene locus_tag LOCUS_20860 16856 17167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 17765 17283 gene locus_tag LOCUS_20870 gene greA 17765 17283 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339475.1 protein_id gnl|my_center|LOCUS_20870 18257 17976 gene locus_tag LOCUS_20880 18257 17976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 18338 18492 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19673 19359 gene locus_tag LOCUS_20890 19673 19359 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_20890 20263 19787 gene locus_tag LOCUS_20900 20263 19787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 20398 20513 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22735 21089 gene locus_tag LOCUS_20910 22735 21089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 23037 22732 gene locus_tag LOCUS_20920 23037 22732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 24100 23558 gene locus_tag LOCUS_20930 24100 23558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 24117 24304 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25129 25515 gene locus_tag LOCUS_20940 25129 25515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 25604 25732 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25908 26882 gene locus_tag LOCUS_20950 25908 26882 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 protein_id gnl|my_center|LOCUS_20950 26912 28330 gene locus_tag LOCUS_20960 26912 28330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 28226 28303 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28371 29237 gene locus_tag LOCUS_20970 28371 29237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 30269 29268 gene locus_tag LOCUS_20980 30269 29268 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_20980 30295 30404 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31010 31093 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence058 857 318 gene locus_tag LOCUS_20990 857 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 1007 1190 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1221 1463 gene locus_tag LOCUS_21000 1221 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 1535 1611 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2957 1920 gene locus_tag LOCUS_21010 2957 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 3015 3198 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5602 4328 gene locus_tag LOCUS_21020 5602 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 5997 6215 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6466 6656 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9816 7459 gene locus_tag LOCUS_21030 9816 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 10271 11293 gene locus_tag LOCUS_21040 10271 11293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 11432 11555 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12679 11591 gene locus_tag LOCUS_21050 gene waaC 12679 11591 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_21050 13189 12758 gene locus_tag LOCUS_21060 13189 12758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 13225 13315 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14081 14212 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15254 15376 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15913 15401 gene locus_tag LOCUS_21070 15913 15401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 15914 16125 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17032 18996 gene locus_tag LOCUS_21080 17032 18996 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120288.1 protein_id gnl|my_center|LOCUS_21080 20400 20587 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21080 21173 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21305 23290 gene locus_tag LOCUS_21090 21305 23290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 23409 23491 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24841 23585 gene locus_tag LOCUS_21100 24841 23585 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_21100 24933 25078 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26143 25298 gene locus_tag LOCUS_21110 26143 25298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 28027 28159 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28512 28687 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29300 31003 gene locus_tag LOCUS_21120 29300 31003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence059 2594 1599 gene locus_tag LOCUS_21130 2594 1599 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_21130 2991 4220 gene locus_tag LOCUS_21140 2991 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21140 4133 4194 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4747 4856 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5081 5275 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5529 7676 gene locus_tag LOCUS_21150 5529 7676 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922898.1 protein_id gnl|my_center|LOCUS_21150 7418 7533 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7673 7861 gene locus_tag LOCUS_21160 7673 7861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 7933 8135 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8578 9756 gene locus_tag LOCUS_21170 gene mutY 8578 9756 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117840.1 protein_id gnl|my_center|LOCUS_21170 10021 10135 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10780 10906 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11006 11722 gene locus_tag LOCUS_21180 11006 11722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 12091 12306 gene locus_tag LOCUS_21190 12091 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 12948 12556 gene locus_tag LOCUS_21200 12948 12556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 14203 13076 gene locus_tag LOCUS_21210 14203 13076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 14250 14405 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17864 16422 gene locus_tag LOCUS_21220 17864 16422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 19417 17867 gene locus_tag LOCUS_21230 19417 17867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 21298 19559 gene locus_tag LOCUS_21240 21298 19559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 21367 21525 gene locus_tag LOCUS_21250 21367 21525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 21799 21545 gene locus_tag LOCUS_21260 21799 21545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21260 23735 21687 gene locus_tag LOCUS_21270 23735 21687 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120937.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21270 21902 21963 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24475 23732 gene locus_tag LOCUS_21280 24475 23732 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327800.1 protein_id gnl|my_center|LOCUS_21280 25535 25041 gene locus_tag LOCUS_21290 25535 25041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 26089 25787 gene locus_tag LOCUS_21300 26089 25787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 27981 26317 gene locus_tag LOCUS_21310 27981 26317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 30578 29574 gene locus_tag LOCUS_21320 30578 29574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 >Feature sequence060 379 518 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1080 1234 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1277 1858 gene locus_tag LOCUS_21330 1277 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 1980 2069 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2617 2922 gene locus_tag LOCUS_21340 2617 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21340 2919 3644 gene locus_tag LOCUS_21350 2919 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21350 4437 3688 gene locus_tag LOCUS_21360 4437 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 5094 4516 gene locus_tag LOCUS_21370 5094 4516 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328727.1 protein_id gnl|my_center|LOCUS_21370 5888 6865 gene locus_tag LOCUS_21380 5888 6865 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329644.1 protein_id gnl|my_center|LOCUS_21380 6939 8333 gene locus_tag LOCUS_21390 6939 8333 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21390 8220 8277 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8357 8575 gene locus_tag LOCUS_21400 8357 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 8690 8858 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8995 11091 gene locus_tag LOCUS_21410 gene ppk1 8995 11091 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922240.1 protein_id gnl|my_center|LOCUS_21410 11717 11205 gene locus_tag LOCUS_21420 11717 11205 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014064.1 protein_id gnl|my_center|LOCUS_21420 11957 12808 gene locus_tag LOCUS_21430 11957 12808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 13493 13906 gene locus_tag LOCUS_21440 13493 13906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 14079 15218 gene locus_tag LOCUS_21450 gene carA 14079 15218 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921837.1 protein_id gnl|my_center|LOCUS_21450 15218 15736 gene locus_tag LOCUS_21460 gene ndk 15218 15736 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123449.1 protein_id gnl|my_center|LOCUS_21460 15861 16697 gene locus_tag LOCUS_21470 15861 16697 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256575.1 protein_id gnl|my_center|LOCUS_21470 16888 19206 gene locus_tag LOCUS_21480 16888 19206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 20174 19347 gene locus_tag LOCUS_21490 20174 19347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 20661 22256 gene locus_tag LOCUS_21500 20661 22256 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615418.1 protein_id gnl|my_center|LOCUS_21500 22320 23975 gene locus_tag LOCUS_21510 22320 23975 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340030.1 protein_id gnl|my_center|LOCUS_21510 24375 24061 gene locus_tag LOCUS_21520 24375 24061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 24824 24375 gene locus_tag LOCUS_21530 24824 24375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 24907 25127 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25438 25616 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25895 26041 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26078 26488 gene locus_tag LOCUS_21540 gene mntR 26078 26488 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327586.1 protein_id gnl|my_center|LOCUS_21540 26621 26737 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27756 27313 gene locus_tag LOCUS_21550 27756 27313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 27863 27977 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29319 28774 gene locus_tag LOCUS_21560 29319 28774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 29342 29458 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence061 <1 1120 gene locus_tag LOCUS_21570 <1 1120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921834.1:sialidase family protein 1878 2366 gene locus_tag LOCUS_21580 1878 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 2367 3911 gene locus_tag LOCUS_21590 2367 3911 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140144.1 protein_id gnl|my_center|LOCUS_21590 4080 4454 gene locus_tag LOCUS_21600 4080 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 4525 6108 gene locus_tag LOCUS_21610 4525 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 6092 6733 gene locus_tag LOCUS_21620 6092 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 6733 7575 gene locus_tag LOCUS_21630 6733 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 8140 7580 gene locus_tag LOCUS_21640 8140 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 8539 10419 gene locus_tag LOCUS_21650 8539 10419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 11376 10618 gene locus_tag LOCUS_21660 11376 10618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 11565 12215 gene locus_tag LOCUS_21670 11565 12215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 12240 12731 gene locus_tag LOCUS_21680 12240 12731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 12728 13687 gene locus_tag LOCUS_21690 12728 13687 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080803342.1 protein_id gnl|my_center|LOCUS_21690 13817 14191 gene locus_tag LOCUS_21700 13817 14191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 14267 14653 gene locus_tag LOCUS_21710 14267 14653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 15665 14733 gene locus_tag LOCUS_21720 15665 14733 CDS product Bpu10I family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259288.1 protein_id gnl|my_center|LOCUS_21720 16933 15662 gene locus_tag LOCUS_21730 16933 15662 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259289.1 protein_id gnl|my_center|LOCUS_21730 17310 17237 gene locus_tag LOCUS_t00090 17310 17237 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 17826 17632 gene locus_tag LOCUS_21740 17826 17632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 18153 18467 gene locus_tag LOCUS_21750 18153 18467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 18471 19145 gene locus_tag LOCUS_21760 18471 19145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 20094 21797 gene locus_tag LOCUS_21770 20094 21797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 22370 24013 gene locus_tag LOCUS_21780 22370 24013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 24010 24396 gene locus_tag LOCUS_21790 24010 24396 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545378.1 protein_id gnl|my_center|LOCUS_21790 24396 27962 gene locus_tag LOCUS_21800 24396 27962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 28273 28770 gene locus_tag LOCUS_21810 gene nrfH 28273 28770 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325128.1 protein_id gnl|my_center|LOCUS_21810 28776 30188 gene locus_tag LOCUS_21820 28776 30188 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123116.1 protein_id gnl|my_center|LOCUS_21820 >Feature sequence062 565 65 gene locus_tag LOCUS_21830 565 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 620 785 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1265 888 gene locus_tag LOCUS_21840 1265 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 1345 1538 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1888 2028 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2566 2707 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3279 3377 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5225 3507 gene locus_tag LOCUS_21850 5225 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 5644 7434 gene locus_tag LOCUS_21860 5644 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 7821 7630 gene locus_tag LOCUS_21870 7821 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 8195 8339 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8754 8847 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9780 9010 gene locus_tag LOCUS_21880 9780 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 10051 12369 gene locus_tag LOCUS_21890 gene ppdK 10051 12369 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21890 12275 12319 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12332 12844 gene locus_tag LOCUS_21900 12332 12844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21900 13836 12952 gene locus_tag LOCUS_21910 13836 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 14021 14169 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14637 14299 gene locus_tag LOCUS_21920 14637 14299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 14728 14792 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16226 15168 gene locus_tag LOCUS_21930 16226 15168 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061017.1 protein_id gnl|my_center|LOCUS_21930 18196 16649 gene locus_tag LOCUS_21940 18196 16649 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666312.1 protein_id gnl|my_center|LOCUS_21940 18403 18495 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18834 18535 gene locus_tag LOCUS_21950 18834 18535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 21179 18882 gene locus_tag LOCUS_21960 21179 18882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 18932 19030 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21239 21355 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22542 23915 gene locus_tag LOCUS_21970 22542 23915 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615810.1 protein_id gnl|my_center|LOCUS_21970 24466 23990 gene locus_tag LOCUS_21980 24466 23990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 24852 24941 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25402 24971 gene locus_tag LOCUS_21990 25402 24971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 25410 25565 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26458 26660 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26961 27134 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27512 28156 gene locus_tag LOCUS_22000 27512 28156 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327156.1 protein_id gnl|my_center|LOCUS_22000 28285 28384 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29558 29739 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence063 2939 4855 gene locus_tag LOCUS_22010 2939 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 4498 4647 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4792 7647 gene locus_tag LOCUS_22020 4792 7647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 8812 8036 gene locus_tag LOCUS_22030 8812 8036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 9680 10855 gene locus_tag LOCUS_22040 9680 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 10262 10309 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10906 11298 gene locus_tag LOCUS_22050 10906 11298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 12528 11401 gene locus_tag LOCUS_22060 12528 11401 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921852.1 protein_id gnl|my_center|LOCUS_22060 15193 12599 gene locus_tag LOCUS_22070 15193 12599 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923035.1 protein_id gnl|my_center|LOCUS_22070 15852 17093 gene locus_tag LOCUS_22080 15852 17093 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117991.1 protein_id gnl|my_center|LOCUS_22080 17207 17656 gene locus_tag LOCUS_22090 17207 17656 CDS product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269323.1 protein_id gnl|my_center|LOCUS_22090 18407 17727 gene locus_tag LOCUS_22100 18407 17727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 21416 18759 gene locus_tag LOCUS_22110 gene topA 21416 18759 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057718.1 protein_id gnl|my_center|LOCUS_22110 21833 23518 gene locus_tag LOCUS_22120 21833 23518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 23329 23468 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23493 24548 gene locus_tag LOCUS_22130 23493 24548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 24734 25339 gene locus_tag LOCUS_22140 24734 25339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 25843 25379 gene locus_tag LOCUS_22150 25843 25379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 25940 26070 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26338 26120 gene locus_tag LOCUS_22160 26338 26120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 27004 26465 gene locus_tag LOCUS_22170 27004 26465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 27025 27197 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28106 28244 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28531 28280 gene locus_tag LOCUS_22180 28531 28280 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921431.1 protein_id gnl|my_center|LOCUS_22180 29243 28629 gene locus_tag LOCUS_22190 29243 28629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 29307 29430 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence064 1271 345 gene locus_tag LOCUS_22200 1271 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 1582 3162 gene locus_tag LOCUS_22210 1582 3162 CDS product lysine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886371.1 protein_id gnl|my_center|LOCUS_22210 4307 3183 gene locus_tag LOCUS_22220 4307 3183 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922313.1 protein_id gnl|my_center|LOCUS_22220 4711 4352 gene locus_tag LOCUS_22230 4711 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 4904 5449 gene locus_tag LOCUS_22240 4904 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 5762 10858 gene locus_tag LOCUS_22250 5762 10858 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669069.1 protein_id gnl|my_center|LOCUS_22250 11251 10982 gene locus_tag LOCUS_22260 11251 10982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 12230 11451 gene locus_tag LOCUS_22270 12230 11451 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817082.1 protein_id gnl|my_center|LOCUS_22270 12693 12427 gene locus_tag LOCUS_22280 12693 12427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 13861 12956 gene locus_tag LOCUS_22290 13861 12956 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946724.1 protein_id gnl|my_center|LOCUS_22290 14673 14023 gene locus_tag LOCUS_22300 14673 14023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 14736 14824 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15545 15658 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16940 15705 gene locus_tag LOCUS_22310 16940 15705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 16952 17142 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18213 18419 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18563 18776 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19157 19314 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19977 19351 gene locus_tag LOCUS_22320 19977 19351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 19995 20113 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21053 21218 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21482 21635 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22024 23115 gene locus_tag LOCUS_22330 gene ychF 22024 23115 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037200879.1 protein_id gnl|my_center|LOCUS_22330 23164 23835 gene locus_tag LOCUS_22340 23164 23835 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325327.1 protein_id gnl|my_center|LOCUS_22340 23875 23978 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24326 24580 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24827 24972 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24985 27138 gene locus_tag LOCUS_22350 24985 27138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 27140 27291 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27412 29133 gene locus_tag LOCUS_22360 27412 29133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 28866 29006 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29130 29321 gene locus_tag LOCUS_22370 29130 29321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 >Feature sequence065 284 533 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2255 1482 gene locus_tag LOCUS_22380 2255 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2450 2962 gene locus_tag LOCUS_22390 2450 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 6149 3327 gene locus_tag LOCUS_22400 6149 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 4660 4727 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6281 6364 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7754 7086 gene locus_tag LOCUS_22410 7754 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 8376 7819 gene locus_tag LOCUS_22420 8376 7819 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008652955.1 protein_id gnl|my_center|LOCUS_22420 8502 8562 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8951 8736 gene locus_tag LOCUS_22430 8951 8736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 10170 9199 gene locus_tag LOCUS_22440 10170 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 11122 10724 gene locus_tag LOCUS_22450 11122 10724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 11967 11185 gene locus_tag LOCUS_22460 11967 11185 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121332.1 protein_id gnl|my_center|LOCUS_22460 12231 12956 gene locus_tag LOCUS_22470 12231 12956 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_22470 13618 13022 gene locus_tag LOCUS_22480 13618 13022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 16128 13576 gene locus_tag LOCUS_22490 16128 13576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 13647 13708 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16961 18424 gene locus_tag LOCUS_22500 16961 18424 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_22500 19656 18598 gene locus_tag LOCUS_22510 19656 18598 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050459751.1 protein_id gnl|my_center|LOCUS_22510 20939 20115 gene locus_tag LOCUS_22520 gene trpA 20939 20115 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921878.1 protein_id gnl|my_center|LOCUS_22520 21110 21246 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21548 21622 gene locus_tag LOCUS_t00100 21548 21622 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 21752 22858 gene locus_tag LOCUS_22530 21752 22858 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922445.1 protein_id gnl|my_center|LOCUS_22530 23078 24064 gene locus_tag LOCUS_22540 23078 24064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 24172 24471 gene locus_tag LOCUS_22550 24172 24471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 24590 24955 gene locus_tag LOCUS_22560 24590 24955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 24955 26265 gene locus_tag LOCUS_22570 24955 26265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 26255 26719 gene locus_tag LOCUS_22580 26255 26719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 28113 27586 gene locus_tag LOCUS_22590 28113 27586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 28603 28653 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence066 825 953 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1133 1285 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1630 1319 gene locus_tag LOCUS_22600 1630 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 1716 1828 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2147 2320 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3199 3777 gene locus_tag LOCUS_22610 3199 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 5570 4050 gene locus_tag LOCUS_22620 gene dnaA 5570 4050 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391551.1 protein_id gnl|my_center|LOCUS_22620 7212 6169 gene locus_tag LOCUS_22630 7212 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 7308 9122 gene locus_tag LOCUS_22640 7308 9122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 11363 9216 gene locus_tag LOCUS_22650 11363 9216 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_22650 11760 11551 gene locus_tag LOCUS_22660 11760 11551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 13005 13154 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13376 13464 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13585 14100 gene locus_tag LOCUS_22670 13585 14100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 14346 16208 gene locus_tag LOCUS_22680 14346 16208 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048118.1 protein_id gnl|my_center|LOCUS_22680 16881 18143 gene locus_tag LOCUS_22690 16881 18143 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669743.1 protein_id gnl|my_center|LOCUS_22690 19479 18244 gene locus_tag LOCUS_22700 19479 18244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 18286 18393 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22035 19831 gene locus_tag LOCUS_22710 22035 19831 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921616.1 protein_id gnl|my_center|LOCUS_22710 22390 22767 gene locus_tag LOCUS_22720 22390 22767 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454676.1 protein_id gnl|my_center|LOCUS_22720 22872 23759 gene locus_tag LOCUS_22730 22872 23759 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921771.1 protein_id gnl|my_center|LOCUS_22730 23990 26878 gene locus_tag LOCUS_22740 23990 26878 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922097.1 protein_id gnl|my_center|LOCUS_22740 26895 28340 gene locus_tag LOCUS_22750 26895 28340 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_22750 >Feature sequence067 1103 69 gene locus_tag LOCUS_22760 gene epmB 1103 69 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482201.1 protein_id gnl|my_center|LOCUS_22760 1193 1297 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1712 1830 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2289 2394 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2459 2704 gene locus_tag LOCUS_22770 2459 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 3027 4487 gene locus_tag LOCUS_22780 gene miaB 3027 4487 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122282.1 protein_id gnl|my_center|LOCUS_22780 5813 4827 gene locus_tag LOCUS_22790 gene glk 5813 4827 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_22790 6932 5892 gene locus_tag LOCUS_22800 6932 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 7252 7443 gene locus_tag LOCUS_22810 7252 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 9643 7895 gene locus_tag LOCUS_22820 gene ptsP 9643 7895 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328922.1 protein_id gnl|my_center|LOCUS_22820 13170 9907 gene locus_tag LOCUS_22830 13170 9907 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615881.1 protein_id gnl|my_center|LOCUS_22830 14052 14156 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14158 15444 gene locus_tag LOCUS_22840 14158 15444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 15709 16050 gene locus_tag LOCUS_22850 15709 16050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 16273 16417 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16438 17451 gene locus_tag LOCUS_22860 16438 17451 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_22860 17649 18590 gene locus_tag LOCUS_22870 17649 18590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 18850 18975 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19830 19201 gene locus_tag LOCUS_22880 19830 19201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 20284 19943 gene locus_tag LOCUS_22890 20284 19943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 21102 20773 gene locus_tag LOCUS_22900 21102 20773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 22026 22141 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22353 22943 gene locus_tag LOCUS_22910 22353 22943 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921755.1 protein_id gnl|my_center|LOCUS_22910 23798 23895 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23913 24410 gene locus_tag LOCUS_22920 23913 24410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22920 24940 24704 gene locus_tag LOCUS_22930 24940 24704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 25237 25321 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25755 25879 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25955 26347 gene locus_tag LOCUS_22940 25955 26347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 26442 27281 gene locus_tag LOCUS_22950 26442 27281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 >Feature sequence068 1447 248 gene locus_tag LOCUS_22960 1447 248 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 protein_id gnl|my_center|LOCUS_22960 1549 1696 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3406 1967 gene locus_tag LOCUS_22970 3406 1967 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_22970 2083 2202 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4051 4413 gene locus_tag LOCUS_22980 4051 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 4707 5540 gene locus_tag LOCUS_22990 4707 5540 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330043.1 protein_id gnl|my_center|LOCUS_22990 6368 6455 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6509 7276 gene locus_tag LOCUS_23000 6509 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 8745 7312 gene locus_tag LOCUS_23010 8745 7312 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525043.1 protein_id gnl|my_center|LOCUS_23010 9033 9413 gene locus_tag LOCUS_23020 9033 9413 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118554.1 protein_id gnl|my_center|LOCUS_23020 9460 10515 gene locus_tag LOCUS_23030 9460 10515 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260609.1 protein_id gnl|my_center|LOCUS_23030 9843 9921 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10613 13705 gene locus_tag LOCUS_23040 10613 13705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 11733 11852 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14194 13775 gene locus_tag LOCUS_23050 14194 13775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 15295 14210 gene locus_tag LOCUS_23060 gene hisC 15295 14210 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121508.1 protein_id gnl|my_center|LOCUS_23060 15549 15337 gene locus_tag LOCUS_23070 15549 15337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 15623 15794 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17304 16012 gene locus_tag LOCUS_23080 gene xseA 17304 16012 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 protein_id gnl|my_center|LOCUS_23080 16380 16456 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18073 18177 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18196 18867 gene locus_tag LOCUS_23090 18196 18867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 18906 19111 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19164 22646 gene locus_tag LOCUS_23100 gene nolG 19164 22646 CDS product nodulation protein NolG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970886.1 protein_id gnl|my_center|LOCUS_23100 19995 20060 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21393 21523 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22264 22341 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22882 23478 gene locus_tag LOCUS_23110 22882 23478 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120779.1 protein_id gnl|my_center|LOCUS_23110 23936 25027 gene locus_tag LOCUS_23120 23936 25027 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922635.1 protein_id gnl|my_center|LOCUS_23120 <27104 25183 gene locus_tag LOCUS_23130 <27104 25183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_109982246.1:response regulator >Feature sequence069 165 338 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 681 1178 gene locus_tag LOCUS_23140 681 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 1214 1421 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1895 1509 gene locus_tag LOCUS_23150 1895 1509 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090251.1 protein_id gnl|my_center|LOCUS_23150 3240 2086 gene locus_tag LOCUS_23160 3240 2086 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434916.1 protein_id gnl|my_center|LOCUS_23160 3810 3295 gene locus_tag LOCUS_23170 3810 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 5112 3871 gene locus_tag LOCUS_23180 5112 3871 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921947.1 protein_id gnl|my_center|LOCUS_23180 5378 8389 gene locus_tag LOCUS_23190 5378 8389 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142749.1 protein_id gnl|my_center|LOCUS_23190 8494 8591 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9410 8637 gene locus_tag LOCUS_23200 9410 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 11107 9353 gene locus_tag LOCUS_23210 11107 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 9468 9604 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12400 11411 gene locus_tag LOCUS_23220 12400 11411 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119981.1 protein_id gnl|my_center|LOCUS_23220 12838 14625 gene locus_tag LOCUS_23230 12838 14625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 14685 14952 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16733 15129 gene locus_tag LOCUS_23240 16733 15129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 17574 16864 gene locus_tag LOCUS_23250 17574 16864 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883144.1 protein_id gnl|my_center|LOCUS_23250 18840 17680 gene locus_tag LOCUS_23260 gene corA 18840 17680 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_23260 20059 18941 gene locus_tag LOCUS_23270 20059 18941 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037227959.1 protein_id gnl|my_center|LOCUS_23270 21313 20108 gene locus_tag LOCUS_23280 21313 20108 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337623.1 protein_id gnl|my_center|LOCUS_23280 >Feature sequence070 262 2298 gene locus_tag LOCUS_23290 262 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 3334 3672 gene locus_tag LOCUS_23300 3334 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 3938 3756 gene locus_tag LOCUS_23310 3938 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 4035 4138 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4574 4182 gene locus_tag LOCUS_23320 4574 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 7044 4681 gene locus_tag LOCUS_23330 7044 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 4725 4900 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7983 7156 gene locus_tag LOCUS_23340 7983 7156 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815129.1 protein_id gnl|my_center|LOCUS_23340 8566 8102 gene locus_tag LOCUS_23350 8566 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 8636 8814 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9943 10212 gene locus_tag LOCUS_23360 9943 10212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 10276 10461 gene locus_tag LOCUS_23370 10276 10461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 12680 11679 gene locus_tag LOCUS_23380 12680 11679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 12712 12857 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15861 13273 gene locus_tag LOCUS_23390 15861 13273 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120839.1 protein_id gnl|my_center|LOCUS_23390 16604 16425 gene locus_tag LOCUS_23400 16604 16425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 17983 20478 gene locus_tag LOCUS_23410 17983 20478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 19079 19227 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20629 20836 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21275 21060 gene locus_tag LOCUS_23420 21275 21060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23420 22530 22739 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22752 23996 gene locus_tag LOCUS_23430 22752 23996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 24635 26215 gene locus_tag LOCUS_23440 24635 26215 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037201681.1 protein_id gnl|my_center|LOCUS_23440 >Feature sequence071 198 13 gene locus_tag LOCUS_23450 198 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 427 679 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 848 1031 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1716 1854 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1974 2159 gene locus_tag LOCUS_23460 1974 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 2636 2728 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2783 3181 gene locus_tag LOCUS_23470 2783 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 4794 3646 gene locus_tag LOCUS_23480 gene aroB 4794 3646 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174702.1 protein_id gnl|my_center|LOCUS_23480 5519 7567 gene locus_tag LOCUS_23490 5519 7567 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_23490 8838 7681 gene locus_tag LOCUS_23500 gene mqnC 8838 7681 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921709.1 protein_id gnl|my_center|LOCUS_23500 9826 8969 gene locus_tag LOCUS_23510 9826 8969 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_23510 10224 11543 gene locus_tag LOCUS_23520 10224 11543 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328879.1 protein_id gnl|my_center|LOCUS_23520 11540 12058 gene locus_tag LOCUS_23530 11540 12058 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643199.1 protein_id gnl|my_center|LOCUS_23530 13008 12118 gene locus_tag LOCUS_23540 13008 12118 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329092.1 protein_id gnl|my_center|LOCUS_23540 15998 13176 gene locus_tag LOCUS_23550 gene polA 15998 13176 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099383.1 protein_id gnl|my_center|LOCUS_23550 16156 16437 gene locus_tag LOCUS_23560 16156 16437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 16531 17067 gene locus_tag LOCUS_23570 16531 17067 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922248.1 protein_id gnl|my_center|LOCUS_23570 18406 17072 gene locus_tag LOCUS_23580 18406 17072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 19731 18490 gene locus_tag LOCUS_23590 gene hmpA 19731 18490 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922502.1 protein_id gnl|my_center|LOCUS_23590 19850 20272 gene locus_tag LOCUS_23600 19850 20272 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922126.1 protein_id gnl|my_center|LOCUS_23600 23638 20468 gene locus_tag LOCUS_23610 23638 20468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 23973 24452 gene locus_tag LOCUS_23620 23973 24452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 >Feature sequence072 1040 168 gene locus_tag LOCUS_23630 1040 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 1997 1155 gene locus_tag LOCUS_23640 1997 1155 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_23640 2839 2150 gene locus_tag LOCUS_23650 2839 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 3255 4130 gene locus_tag LOCUS_23660 3255 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 6161 4473 gene locus_tag LOCUS_23670 6161 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 5736 5874 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6685 6287 gene locus_tag LOCUS_23680 6685 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 7666 6932 gene locus_tag LOCUS_23690 7666 6932 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401997.1 protein_id gnl|my_center|LOCUS_23690 7945 9762 gene locus_tag LOCUS_23700 gene typA 7945 9762 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324768.1 protein_id gnl|my_center|LOCUS_23700 9940 10575 gene locus_tag LOCUS_23710 9940 10575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 12415 10706 gene locus_tag LOCUS_23720 12415 10706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 15160 12818 gene locus_tag LOCUS_23730 15160 12818 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122749.1 protein_id gnl|my_center|LOCUS_23730 15652 15266 gene locus_tag LOCUS_23740 15652 15266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23740 16062 15649 gene locus_tag LOCUS_23750 16062 15649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23750 15681 15719 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16106 16248 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22450 17180 gene locus_tag LOCUS_23760 gene uvrA 22450 17180 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121648.1 protein_id gnl|my_center|LOCUS_23760 21542 21626 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23793 22381 gene locus_tag LOCUS_23770 23793 22381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 22497 22610 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24034 24231 gene locus_tag LOCUS_23780 24034 24231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 24228 24632 gene locus_tag LOCUS_23790 24228 24632 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 protein_id gnl|my_center|LOCUS_23790 25643 25764 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25787 26101 gene locus_tag LOCUS_23800 25787 26101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 >Feature sequence073 719 30 gene locus_tag LOCUS_23810 719 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 726 829 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1093 1213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1218 1493 gene locus_tag LOCUS_23820 1218 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 1618 1750 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1885 1932 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2144 4129 gene locus_tag LOCUS_23830 2144 4129 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_23830 4594 4190 gene locus_tag LOCUS_23840 4594 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 5420 4707 gene locus_tag LOCUS_23850 5420 4707 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660467.1 protein_id gnl|my_center|LOCUS_23850 6825 5680 gene locus_tag LOCUS_23860 gene ispG 6825 5680 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118672.1 protein_id gnl|my_center|LOCUS_23860 8378 7080 gene locus_tag LOCUS_23870 8378 7080 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122348.1 protein_id gnl|my_center|LOCUS_23870 8529 8807 gene locus_tag LOCUS_23880 8529 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 10062 8824 gene locus_tag LOCUS_23890 10062 8824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122399.1 protein_id gnl|my_center|LOCUS_23890 10419 11939 gene locus_tag LOCUS_23900 10419 11939 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922192.1 protein_id gnl|my_center|LOCUS_23900 11973 12713 gene locus_tag LOCUS_23910 11973 12713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 13110 14324 gene locus_tag LOCUS_23920 gene proB 13110 14324 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_23920 15831 14491 gene locus_tag LOCUS_23930 15831 14491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 17513 15831 gene locus_tag LOCUS_23940 17513 15831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 18556 17621 gene locus_tag LOCUS_23950 18556 17621 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_23950 19377 18916 gene locus_tag LOCUS_23960 19377 18916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 19827 19420 gene locus_tag LOCUS_23970 19827 19420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 20925 20020 gene locus_tag LOCUS_23980 20925 20020 CDS product TIGR03009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922291.1 protein_id gnl|my_center|LOCUS_23980 21686 24289 gene locus_tag LOCUS_23990 21686 24289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 25733 24393 gene locus_tag LOCUS_24000 gene hisS 25733 24393 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117814.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence074 775 924 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1872 958 gene locus_tag LOCUS_24010 gene hpnC 1872 958 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 protein_id gnl|my_center|LOCUS_24010 2309 1908 gene locus_tag LOCUS_24020 2309 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 3716 2598 gene locus_tag LOCUS_24030 3716 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 2702 2756 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3947 5548 gene locus_tag LOCUS_24040 3947 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 7684 5579 gene locus_tag LOCUS_24050 7684 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 8108 9442 gene locus_tag LOCUS_24060 8108 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 9297 9420 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9528 12035 gene locus_tag LOCUS_24070 9528 12035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 11215 11353 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11715 11817 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13194 13366 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13429 14316 gene locus_tag LOCUS_24080 13429 14316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 14565 16775 gene locus_tag LOCUS_24090 14565 16775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 16614 16722 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16772 17377 gene locus_tag LOCUS_24100 16772 17377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 17521 17967 gene locus_tag LOCUS_24110 17521 17967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 18043 18933 gene locus_tag LOCUS_24120 18043 18933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 19113 21695 gene locus_tag LOCUS_24130 19113 21695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 22529 21708 gene locus_tag LOCUS_24140 22529 21708 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530346.1 protein_id gnl|my_center|LOCUS_24140 22810 23526 gene locus_tag LOCUS_24150 22810 23526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 23541 23912 gene locus_tag LOCUS_24160 23541 23912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 23995 25410 gene locus_tag LOCUS_24170 23995 25410 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_24170 >Feature sequence075 1339 149 gene locus_tag LOCUS_24180 1339 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 3117 1336 gene locus_tag LOCUS_24190 3117 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 3658 3230 gene locus_tag LOCUS_24200 3658 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 4820 3789 gene locus_tag LOCUS_24210 4820 3789 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_24210 6422 5532 gene locus_tag LOCUS_24220 6422 5532 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121449.1 protein_id gnl|my_center|LOCUS_24220 6996 7175 gene locus_tag LOCUS_24230 6996 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 7168 8520 gene locus_tag LOCUS_24240 7168 8520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 8706 8918 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9891 10036 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10128 11678 gene locus_tag LOCUS_24250 10128 11678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24250 11566 11636 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11653 12360 gene locus_tag LOCUS_24260 11653 12360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24260 12407 13897 gene locus_tag LOCUS_24270 12407 13897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 13535 13640 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14236 14367 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14843 15355 gene locus_tag LOCUS_24280 14843 15355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 15461 16234 gene locus_tag LOCUS_24290 15461 16234 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068264628.1 protein_id gnl|my_center|LOCUS_24290 16231 17226 gene locus_tag LOCUS_24300 16231 17226 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336191.1 protein_id gnl|my_center|LOCUS_24300 17216 18010 gene locus_tag LOCUS_24310 17216 18010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921699.1 protein_id gnl|my_center|LOCUS_24310 18035 18814 gene locus_tag LOCUS_24320 18035 18814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 18811 19932 gene locus_tag LOCUS_24330 18811 19932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 19929 21023 gene locus_tag LOCUS_24340 19929 21023 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119708.1 protein_id gnl|my_center|LOCUS_24340 21020 22354 gene locus_tag LOCUS_24350 21020 22354 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121952.1 protein_id gnl|my_center|LOCUS_24350 22732 22553 gene locus_tag LOCUS_24360 22732 22553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 23520 24980 gene locus_tag LOCUS_24370 23520 24980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 >Feature sequence076 352 478 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1247 1020 gene locus_tag LOCUS_24380 1247 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 1448 1284 gene locus_tag LOCUS_24390 1448 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 2506 1460 gene locus_tag LOCUS_24400 2506 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 3314 2547 gene locus_tag LOCUS_24410 3314 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 3435 3584 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5096 4881 gene locus_tag LOCUS_24420 5096 4881 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459051.1 protein_id gnl|my_center|LOCUS_24420 5226 5411 gene locus_tag LOCUS_24430 5226 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 5408 5659 gene locus_tag LOCUS_24440 5408 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 5845 5996 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7014 7122 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7888 8054 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8239 8469 gene locus_tag LOCUS_24450 8239 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 11179 8858 gene locus_tag LOCUS_24460 11179 8858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 11848 11969 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13257 12058 gene locus_tag LOCUS_24470 gene rpoD 13257 12058 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_24470 15051 14878 gene locus_tag LOCUS_24480 15051 14878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 15209 15442 gene locus_tag LOCUS_24490 15209 15442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 15439 15627 gene locus_tag LOCUS_24500 15439 15627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 15859 15990 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16059 17267 gene locus_tag LOCUS_24510 16059 17267 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_24510 17657 17701 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17713 18357 gene locus_tag LOCUS_24520 17713 18357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 18369 18614 gene locus_tag LOCUS_24530 18369 18614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 18707 18925 gene locus_tag LOCUS_24540 18707 18925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 20091 20278 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20661 21245 gene locus_tag LOCUS_24550 20661 21245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 20795 20850 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21242 22069 gene locus_tag LOCUS_24560 21242 22069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 22117 22290 gene locus_tag LOCUS_24570 22117 22290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 23089 22505 gene locus_tag LOCUS_24580 23089 22505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 23350 23437 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24560 24102 gene locus_tag LOCUS_24590 24560 24102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 24582 24688 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence077 515 6328 gene locus_tag LOCUS_24600 515 6328 CDS product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061269.1 protein_id gnl|my_center|LOCUS_24600 6381 8690 gene locus_tag LOCUS_24610 6381 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 8694 10013 gene locus_tag LOCUS_24620 8694 10013 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861451.1 protein_id gnl|my_center|LOCUS_24620 10169 10780 gene locus_tag LOCUS_24630 10169 10780 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325155.1 protein_id gnl|my_center|LOCUS_24630 10789 14433 gene locus_tag LOCUS_24640 10789 14433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 14523 15863 gene locus_tag LOCUS_24650 14523 15863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 15964 16668 gene locus_tag LOCUS_24660 15964 16668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 16965 17318 gene locus_tag LOCUS_24670 16965 17318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 17415 17972 gene locus_tag LOCUS_24680 17415 17972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 19381 19253 gene locus_tag LOCUS_24690 19381 19253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 21860 19602 gene locus_tag LOCUS_24700 21860 19602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 22761 24350 gene locus_tag LOCUS_24710 22761 24350 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922210.1 protein_id gnl|my_center|LOCUS_24710 24449 24657 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence078 205 388 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2363 1026 gene locus_tag LOCUS_24720 gene accC 2363 1026 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332220.1 protein_id gnl|my_center|LOCUS_24720 2952 2431 gene locus_tag LOCUS_24730 gene accB 2952 2431 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328900.1 protein_id gnl|my_center|LOCUS_24730 4201 3098 gene locus_tag LOCUS_24740 4201 3098 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121913.1 protein_id gnl|my_center|LOCUS_24740 4410 4659 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5790 5542 gene locus_tag LOCUS_24750 5790 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 5907 7136 gene locus_tag LOCUS_24760 5907 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 8239 8393 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8405 8788 gene locus_tag LOCUS_24770 8405 8788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 8981 9161 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9599 9755 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10860 11201 gene locus_tag LOCUS_24780 10860 11201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 20015 11355 gene locus_tag LOCUS_24790 20015 11355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 12610 12686 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15573 15670 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18643 18787 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20083 20312 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21204 20425 gene locus_tag LOCUS_24800 21204 20425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 22661 21111 gene locus_tag LOCUS_24810 22661 21111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 21240 21394 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23910 22684 gene locus_tag LOCUS_24820 23910 22684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 22707 22820 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23920 24024 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24266 24442 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence079 2610 883 gene locus_tag LOCUS_24830 2610 883 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_24830 3122 4573 gene locus_tag LOCUS_24840 3122 4573 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_24840 4557 5099 gene locus_tag LOCUS_24850 4557 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 5367 5296 gene locus_tag LOCUS_t00110 5367 5296 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6620 5493 gene locus_tag LOCUS_24860 6620 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 6870 7988 gene locus_tag LOCUS_24870 6870 7988 CDS product DUF1570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616071.1 protein_id gnl|my_center|LOCUS_24870 8809 8087 gene locus_tag LOCUS_24880 8809 8087 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400058.1 protein_id gnl|my_center|LOCUS_24880 9181 8852 gene locus_tag LOCUS_24890 9181 8852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 9406 10161 gene locus_tag LOCUS_24900 9406 10161 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226565.1 protein_id gnl|my_center|LOCUS_24900 10158 11468 gene locus_tag LOCUS_24910 gene bioA 10158 11468 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655595.1 protein_id gnl|my_center|LOCUS_24910 11375 11442 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11776 12750 gene locus_tag LOCUS_24920 11776 12750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 13044 13496 gene locus_tag LOCUS_24930 13044 13496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 13592 14161 gene locus_tag LOCUS_24940 13592 14161 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946639.1 protein_id gnl|my_center|LOCUS_24940 14538 14167 gene locus_tag LOCUS_24950 14538 14167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 14566 14763 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15825 16028 gene locus_tag LOCUS_24960 15825 16028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 16353 17618 gene locus_tag LOCUS_24970 16353 17618 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616070.1 protein_id gnl|my_center|LOCUS_24970 16888 16999 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18604 17639 gene locus_tag LOCUS_24980 18604 17639 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921771.1 protein_id gnl|my_center|LOCUS_24980 19156 20280 gene locus_tag LOCUS_24990 19156 20280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_24990 20485 20563 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21343 23922 gene locus_tag LOCUS_25000 21343 23922 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666716.1 protein_id gnl|my_center|LOCUS_25000 23727 23854 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23870 24514 gene locus_tag LOCUS_25010 23870 24514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence080 147 1343 gene locus_tag LOCUS_25020 147 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 1356 2120 gene locus_tag LOCUS_25030 1356 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 2550 3794 gene locus_tag LOCUS_25040 gene mdoC 2550 3794 CDS product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816063.1 protein_id gnl|my_center|LOCUS_25040 4259 3798 gene locus_tag LOCUS_25050 4259 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 6169 4307 gene locus_tag LOCUS_25060 6169 4307 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_25060 6839 7384 gene locus_tag LOCUS_25070 6839 7384 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329169.1 protein_id gnl|my_center|LOCUS_25070 7481 8842 gene locus_tag LOCUS_25080 7481 8842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616020.1 protein_id gnl|my_center|LOCUS_25080 9432 9022 gene locus_tag LOCUS_25090 9432 9022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 10596 9562 gene locus_tag LOCUS_25100 10596 9562 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_25100 11961 10786 gene locus_tag LOCUS_25110 11961 10786 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324978.1 protein_id gnl|my_center|LOCUS_25110 12402 12109 gene locus_tag LOCUS_25120 12402 12109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 12407 12520 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14237 12999 gene locus_tag LOCUS_25130 14237 12999 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_25130 14734 14282 gene locus_tag LOCUS_25140 14734 14282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 14841 14984 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19299 15616 gene locus_tag LOCUS_25150 19299 15616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 16170 16263 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16964 17051 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20762 19437 gene locus_tag LOCUS_25160 20762 19437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 21080 21264 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21482 22765 gene locus_tag LOCUS_25170 21482 22765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 22669 22754 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23831 23966 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23975 24499 gene locus_tag LOCUS_25180 23975 24499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 >Feature sequence081 138 548 gene locus_tag LOCUS_25190 138 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122820.1 protein_id gnl|my_center|LOCUS_25190 607 754 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1782 826 gene locus_tag LOCUS_25200 1782 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 1846 1944 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2725 3894 gene locus_tag LOCUS_25210 2725 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 3751 3850 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3869 6175 gene locus_tag LOCUS_25220 3869 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 6182 9658 gene locus_tag LOCUS_25230 6182 9658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 9648 10850 gene locus_tag LOCUS_25240 9648 10850 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257321.1 protein_id gnl|my_center|LOCUS_25240 11422 10919 gene locus_tag LOCUS_25250 11422 10919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 11849 13048 gene locus_tag LOCUS_25260 11849 13048 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669535.1 protein_id gnl|my_center|LOCUS_25260 13177 14190 gene locus_tag LOCUS_25270 13177 14190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 14219 15043 gene locus_tag LOCUS_25280 14219 15043 CDS product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265558.1 protein_id gnl|my_center|LOCUS_25280 15633 15118 gene locus_tag LOCUS_25290 15633 15118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 15890 17113 gene locus_tag LOCUS_25300 15890 17113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 17478 18077 gene locus_tag LOCUS_25310 17478 18077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 19580 18153 gene locus_tag LOCUS_25320 19580 18153 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228658.1 protein_id gnl|my_center|LOCUS_25320 21045 20050 gene locus_tag LOCUS_25330 21045 20050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 21444 22994 gene locus_tag LOCUS_25340 21444 22994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 23609 23894 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence082 179 358 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3591 1570 gene locus_tag LOCUS_25350 gene dnaG 3591 1570 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120867.1 protein_id gnl|my_center|LOCUS_25350 5981 4644 gene locus_tag LOCUS_25360 5981 4644 CDS product retron St85 family RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124764.1 protein_id gnl|my_center|LOCUS_25360 6040 6161 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7066 6761 gene locus_tag LOCUS_25370 7066 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 7330 8250 gene locus_tag LOCUS_25380 gene rsmA 7330 8250 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922514.1 protein_id gnl|my_center|LOCUS_25380 8368 9861 gene locus_tag LOCUS_25390 gene guaB 8368 9861 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325011.1 protein_id gnl|my_center|LOCUS_25390 9794 11305 gene locus_tag LOCUS_25400 9794 11305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 9986 10096 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12988 11504 gene locus_tag LOCUS_25410 12988 11504 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_25410 13088 13255 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13694 13296 gene locus_tag LOCUS_25420 13694 13296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 13723 13943 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14881 14345 gene locus_tag LOCUS_25430 14881 14345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 16404 15082 gene locus_tag LOCUS_25440 gene murD 16404 15082 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256652.1 protein_id gnl|my_center|LOCUS_25440 16562 17791 gene locus_tag LOCUS_25450 16562 17791 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_25450 17844 17952 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18207 17995 gene locus_tag LOCUS_25460 18207 17995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 18261 18389 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18783 18975 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19272 19439 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20936 19932 gene locus_tag LOCUS_25470 20936 19932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 19982 20061 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20991 21203 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21650 21841 gene locus_tag LOCUS_25480 21650 21841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 22303 22614 gene locus_tag LOCUS_25490 22303 22614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260968.1 protein_id gnl|my_center|LOCUS_25490 23253 22621 gene locus_tag LOCUS_25500 23253 22621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 23269 23544 gene locus_tag LOCUS_25510 23269 23544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence083 829 221 gene locus_tag LOCUS_25520 829 221 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338439.1 protein_id gnl|my_center|LOCUS_25520 951 3254 gene locus_tag LOCUS_25530 951 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 4102 3311 gene locus_tag LOCUS_25540 4102 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 5132 4257 gene locus_tag LOCUS_25550 5132 4257 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_25550 5456 5905 gene locus_tag LOCUS_25560 5456 5905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 6891 6376 gene locus_tag LOCUS_25570 6891 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 6935 7720 gene locus_tag LOCUS_25580 6935 7720 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_25580 7787 9298 gene locus_tag LOCUS_25590 7787 9298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 9760 9875 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10137 10395 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13950 10474 gene locus_tag LOCUS_25600 13950 10474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 16175 14028 gene locus_tag LOCUS_25610 16175 14028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 15158 15264 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16561 16307 gene locus_tag LOCUS_25620 16561 16307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 16956 17030 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18866 17412 gene locus_tag LOCUS_25630 18866 17412 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084998.1 protein_id gnl|my_center|LOCUS_25630 20403 18967 gene locus_tag LOCUS_25640 20403 18967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 21934 20459 gene locus_tag LOCUS_25650 21934 20459 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_25650 23739 22597 gene locus_tag LOCUS_25660 23739 22597 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922783.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence084 1627 599 gene locus_tag LOCUS_25670 1627 599 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262120.1 protein_id gnl|my_center|LOCUS_25670 641 716 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3300 1639 gene locus_tag LOCUS_25680 3300 1639 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479312.1 protein_id gnl|my_center|LOCUS_25680 3382 3601 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3763 3877 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4096 4365 gene locus_tag LOCUS_25690 4096 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 4419 4523 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5814 5074 gene locus_tag LOCUS_25700 5814 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 7286 5880 gene locus_tag LOCUS_25710 7286 5880 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123146.1 protein_id gnl|my_center|LOCUS_25710 8142 7318 gene locus_tag LOCUS_25720 8142 7318 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922402.1 protein_id gnl|my_center|LOCUS_25720 8843 8349 gene locus_tag LOCUS_25730 8843 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 10013 9258 gene locus_tag LOCUS_25740 10013 9258 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667131.1 protein_id gnl|my_center|LOCUS_25740 10268 10507 gene locus_tag LOCUS_25750 10268 10507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 10689 12374 gene locus_tag LOCUS_25760 10689 12374 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334446.1 protein_id gnl|my_center|LOCUS_25760 11917 12071 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12634 15831 gene locus_tag LOCUS_25770 12634 15831 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921330.1 protein_id gnl|my_center|LOCUS_25770 16358 15867 gene locus_tag LOCUS_25780 16358 15867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 16652 17689 gene locus_tag LOCUS_25790 16652 17689 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_25790 17788 18258 gene locus_tag LOCUS_25800 17788 18258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 19126 18407 gene locus_tag LOCUS_25810 19126 18407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 19350 20492 gene locus_tag LOCUS_25820 19350 20492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 20581 20828 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21565 21646 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21932 21711 gene locus_tag LOCUS_25830 21932 21711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 22094 22205 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23412 22492 gene locus_tag LOCUS_25840 23412 22492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 23457 23615 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence085 9428 459 gene locus_tag LOCUS_25850 9428 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 489 607 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4988 5073 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10321 9686 gene locus_tag LOCUS_25860 10321 9686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 11278 12696 gene locus_tag LOCUS_25870 11278 12696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 12338 12468 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12656 13831 gene locus_tag LOCUS_25880 12656 13831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 13855 14877 gene locus_tag LOCUS_25890 13855 14877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 15171 14851 gene locus_tag LOCUS_25900 15171 14851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 15444 16118 gene locus_tag LOCUS_25910 15444 16118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 16590 18749 gene locus_tag LOCUS_25920 gene fusA 16590 18749 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120445.1 protein_id gnl|my_center|LOCUS_25920 19078 19217 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19440 20291 gene locus_tag LOCUS_25930 19440 20291 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827560.1 protein_id gnl|my_center|LOCUS_25930 20383 20928 gene locus_tag LOCUS_25940 20383 20928 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330217.1 protein_id gnl|my_center|LOCUS_25940 21075 21257 gene locus_tag LOCUS_25950 21075 21257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 21562 21254 gene locus_tag LOCUS_25960 21562 21254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 21987 22157 gene locus_tag LOCUS_25970 21987 22157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 22141 23568 gene locus_tag LOCUS_25980 22141 23568 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447220.1 protein_id gnl|my_center|LOCUS_25980 >Feature sequence086 3 173 gene locus_tag LOCUS_25990 3 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 371 1426 gene locus_tag LOCUS_26000 371 1426 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120182.1 protein_id gnl|my_center|LOCUS_26000 1489 1648 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3620 1791 gene locus_tag LOCUS_26010 3620 1791 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120741.1 protein_id gnl|my_center|LOCUS_26010 4705 3974 gene locus_tag LOCUS_26020 4705 3974 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_26020 5105 4869 gene locus_tag LOCUS_26030 5105 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 7242 5080 gene locus_tag LOCUS_26040 7242 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 5122 5317 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7379 7538 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7671 8561 gene locus_tag LOCUS_26050 7671 8561 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037253110.1 protein_id gnl|my_center|LOCUS_26050 9635 8856 gene locus_tag LOCUS_26060 9635 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 11570 10104 gene locus_tag LOCUS_26070 gene gnd 11570 10104 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119037.1 protein_id gnl|my_center|LOCUS_26070 12553 11621 gene locus_tag LOCUS_26080 12553 11621 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120218.1 protein_id gnl|my_center|LOCUS_26080 13255 12671 gene locus_tag LOCUS_26090 13255 12671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 14149 13280 gene locus_tag LOCUS_26100 14149 13280 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027122.1 protein_id gnl|my_center|LOCUS_26100 14973 14239 gene locus_tag LOCUS_26110 14973 14239 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929061.1 protein_id gnl|my_center|LOCUS_26110 16316 15021 gene locus_tag LOCUS_26120 16316 15021 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_26120 17280 16501 gene locus_tag LOCUS_26130 17280 16501 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199071.1 protein_id gnl|my_center|LOCUS_26130 17571 17891 gene locus_tag LOCUS_26140 17571 17891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 17987 18466 gene locus_tag LOCUS_26150 gene rnhA 17987 18466 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326294.1 protein_id gnl|my_center|LOCUS_26150 18611 19210 gene locus_tag LOCUS_26160 18611 19210 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723402.1 protein_id gnl|my_center|LOCUS_26160 19343 19849 gene locus_tag LOCUS_26170 19343 19849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 20000 20228 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20397 21575 gene locus_tag LOCUS_26180 20397 21575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 21649 22095 gene locus_tag LOCUS_26190 21649 22095 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729724.1 protein_id gnl|my_center|LOCUS_26190 22659 22390 gene locus_tag LOCUS_26200 22659 22390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 22870 23499 gene locus_tag LOCUS_26210 22870 23499 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427748.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence087 1376 345 gene locus_tag LOCUS_26220 1376 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 2392 1451 gene locus_tag LOCUS_26230 2392 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 2822 3550 gene locus_tag LOCUS_26240 2822 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 4020 3832 gene locus_tag LOCUS_26250 4020 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 5419 4187 gene locus_tag LOCUS_26260 5419 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 5774 7885 gene locus_tag LOCUS_26270 5774 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 8472 8086 gene locus_tag LOCUS_26280 8472 8086 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812273.1 protein_id gnl|my_center|LOCUS_26280 8646 9824 gene locus_tag LOCUS_26290 8646 9824 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403248.1 protein_id gnl|my_center|LOCUS_26290 11072 9897 gene locus_tag LOCUS_26300 11072 9897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 11076 11176 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11937 11485 gene locus_tag LOCUS_26310 gene mraZ 11937 11485 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804693.1 protein_id gnl|my_center|LOCUS_26310 13849 14031 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14163 14786 gene locus_tag LOCUS_26320 14163 14786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 14816 14870 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15094 15744 gene locus_tag LOCUS_26330 15094 15744 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324221.1 protein_id gnl|my_center|LOCUS_26330 15934 19566 gene locus_tag LOCUS_26340 15934 19566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922202.1 protein_id gnl|my_center|LOCUS_26340 19629 20720 gene locus_tag LOCUS_26350 19629 20720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 20889 21734 gene locus_tag LOCUS_26360 20889 21734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 21885 22361 gene locus_tag LOCUS_26370 21885 22361 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327446.1 protein_id gnl|my_center|LOCUS_26370 22419 22919 gene locus_tag LOCUS_26380 22419 22919 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327445.1 protein_id gnl|my_center|LOCUS_26380 >Feature sequence088 472 8 gene locus_tag LOCUS_26390 472 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 538 694 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1581 913 gene locus_tag LOCUS_26400 1581 913 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090711.1 protein_id gnl|my_center|LOCUS_26400 4282 2753 gene locus_tag LOCUS_26410 4282 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_26410 8444 4269 gene locus_tag LOCUS_26420 8444 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 8459 8594 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9125 9249 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9955 11316 gene locus_tag LOCUS_26430 9955 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 11871 11377 gene locus_tag LOCUS_26440 11871 11377 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257245.1 protein_id gnl|my_center|LOCUS_26440 12526 13326 gene locus_tag LOCUS_26450 12526 13326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 13344 15317 gene locus_tag LOCUS_26460 13344 15317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 15938 16009 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16040 17245 gene locus_tag LOCUS_26470 16040 17245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 17282 17500 gene locus_tag LOCUS_26480 17282 17500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 17722 19143 gene locus_tag LOCUS_26490 17722 19143 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_26490 19659 20756 gene locus_tag LOCUS_26500 19659 20756 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329196.1 protein_id gnl|my_center|LOCUS_26500 20968 21429 gene locus_tag LOCUS_26510 20968 21429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118347.1 protein_id gnl|my_center|LOCUS_26510 22640 21894 gene locus_tag LOCUS_26520 22640 21894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 22788 22958 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence089 170 302 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 606 746 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1196 1714 gene locus_tag LOCUS_26530 1196 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 1782 2621 gene locus_tag LOCUS_26540 gene floA 1782 2621 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327752.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26540 2583 2605 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2618 2782 gene locus_tag LOCUS_26550 2618 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 2843 3250 gene locus_tag LOCUS_26560 2843 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921589.1 protein_id gnl|my_center|LOCUS_26560 3569 3988 gene locus_tag LOCUS_26570 gene tnpA 3569 3988 CDS product IS200/IS605-like element IS1004 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503164.1 protein_id gnl|my_center|LOCUS_26570 4098 4913 gene locus_tag LOCUS_26580 4098 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 4910 5221 gene locus_tag LOCUS_26590 4910 5221 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256234.1 protein_id gnl|my_center|LOCUS_26590 5272 5760 gene locus_tag LOCUS_26600 5272 5760 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227509.1 protein_id gnl|my_center|LOCUS_26600 5913 6110 gene locus_tag LOCUS_26610 5913 6110 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_26610 6583 6715 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6851 7117 gene locus_tag LOCUS_26620 6851 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 7553 7134 gene locus_tag LOCUS_26630 7553 7134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 7863 7991 gene locus_tag LOCUS_26640 7863 7991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 10001 8265 gene locus_tag LOCUS_26650 10001 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 12973 9998 gene locus_tag LOCUS_26660 12973 9998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 10027 10144 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13445 14068 gene locus_tag LOCUS_26670 13445 14068 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767407.1 protein_id gnl|my_center|LOCUS_26670 14078 15238 gene locus_tag LOCUS_26680 14078 15238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 15845 15450 gene locus_tag LOCUS_26690 15845 15450 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031500121.1 protein_id gnl|my_center|LOCUS_26690 16544 16221 gene locus_tag LOCUS_26700 16544 16221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 16842 16591 gene locus_tag LOCUS_26710 16842 16591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 16984 16817 gene locus_tag LOCUS_26720 16984 16817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 17636 17184 gene locus_tag LOCUS_26730 17636 17184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 17924 18757 gene locus_tag LOCUS_26740 17924 18757 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123168.1 protein_id gnl|my_center|LOCUS_26740 19005 19274 gene locus_tag LOCUS_26750 19005 19274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 19431 19670 gene locus_tag LOCUS_26760 19431 19670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922413.1 protein_id gnl|my_center|LOCUS_26760 20207 19980 gene locus_tag LOCUS_26770 20207 19980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 20215 20450 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence090 1702 287 gene locus_tag LOCUS_26780 1702 287 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615434.1 protein_id gnl|my_center|LOCUS_26780 3528 1732 gene locus_tag LOCUS_26790 3528 1732 CDS product NPCBM/NEW2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615476.1 protein_id gnl|my_center|LOCUS_26790 3643 3479 gene locus_tag LOCUS_26800 3643 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 5127 4159 gene locus_tag LOCUS_26810 5127 4159 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704299.1 protein_id gnl|my_center|LOCUS_26810 6091 5114 gene locus_tag LOCUS_26820 6091 5114 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329070.1 protein_id gnl|my_center|LOCUS_26820 6315 7082 gene locus_tag LOCUS_26830 6315 7082 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036308.1 protein_id gnl|my_center|LOCUS_26830 7131 7457 gene locus_tag LOCUS_26840 7131 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 7728 8279 gene locus_tag LOCUS_26850 7728 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 8319 8501 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8707 9315 gene locus_tag LOCUS_26860 8707 9315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 9321 9959 gene locus_tag LOCUS_26870 9321 9959 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029057.1 protein_id gnl|my_center|LOCUS_26870 9977 10128 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11871 11981 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13632 13135 gene locus_tag LOCUS_26880 13632 13135 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328025.1 protein_id gnl|my_center|LOCUS_26880 13775 14656 gene locus_tag LOCUS_26890 13775 14656 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_26890 14846 15838 gene locus_tag LOCUS_26900 14846 15838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 16026 16424 gene locus_tag LOCUS_26910 16026 16424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 16492 17415 gene locus_tag LOCUS_26920 16492 17415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 17504 17776 gene locus_tag LOCUS_26930 17504 17776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 17855 18553 gene locus_tag LOCUS_26940 17855 18553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 18623 19267 gene locus_tag LOCUS_26950 18623 19267 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067136.1 protein_id gnl|my_center|LOCUS_26950 19218 20768 gene locus_tag LOCUS_26960 gene atpA 19218 20768 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334261.1 protein_id gnl|my_center|LOCUS_26960 20878 21792 gene locus_tag LOCUS_26970 gene atpG 20878 21792 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122671.1 protein_id gnl|my_center|LOCUS_26970 >Feature sequence091 1239 196 gene locus_tag LOCUS_26980 1239 196 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_26980 5118 1330 gene locus_tag LOCUS_26990 5118 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 5356 6276 gene locus_tag LOCUS_27000 5356 6276 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922282.1 protein_id gnl|my_center|LOCUS_27000 7409 6522 gene locus_tag LOCUS_27010 7409 6522 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921650.1 protein_id gnl|my_center|LOCUS_27010 7534 8559 gene locus_tag LOCUS_27020 7534 8559 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921278.1 protein_id gnl|my_center|LOCUS_27020 7588 7655 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8593 8770 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8941 9969 gene locus_tag LOCUS_27030 8941 9969 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119735.1 protein_id gnl|my_center|LOCUS_27030 10204 11481 gene locus_tag LOCUS_27040 gene uxaE 10204 11481 CDS product D-tagaturonate epimerase UxaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081526.1 protein_id gnl|my_center|LOCUS_27040 11829 13385 gene locus_tag LOCUS_27050 11829 13385 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922522.1 protein_id gnl|my_center|LOCUS_27050 13597 14529 gene locus_tag LOCUS_27060 13597 14529 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615454.1 protein_id gnl|my_center|LOCUS_27060 14593 14919 gene locus_tag LOCUS_27070 14593 14919 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122598.1 protein_id gnl|my_center|LOCUS_27070 15448 15897 gene locus_tag LOCUS_27080 15448 15897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 15894 17666 gene locus_tag LOCUS_27090 15894 17666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 17678 20785 gene locus_tag LOCUS_27100 17678 20785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 20849 21661 gene locus_tag LOCUS_27110 20849 21661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 21547 21620 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21658 22338 gene locus_tag LOCUS_27120 21658 22338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 >Feature sequence092 555 55 gene locus_tag LOCUS_27130 555 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 2048 558 gene locus_tag LOCUS_27140 2048 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 598 744 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3201 2746 gene locus_tag LOCUS_27150 3201 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 4646 3255 gene locus_tag LOCUS_27160 gene sthA 4646 3255 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325276.1 protein_id gnl|my_center|LOCUS_27160 5908 4862 gene locus_tag LOCUS_27170 5908 4862 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615376.1 protein_id gnl|my_center|LOCUS_27170 7384 5912 gene locus_tag LOCUS_27180 7384 5912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 9839 7314 gene locus_tag LOCUS_27190 9839 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947112.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27190 7438 7538 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8511 8573 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9937 10060 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11854 10688 gene locus_tag LOCUS_27200 11854 10688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 10697 10745 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12023 12234 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14421 12775 gene locus_tag LOCUS_27210 14421 12775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 12804 12898 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14471 14611 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16048 15026 gene locus_tag LOCUS_27220 16048 15026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 16063 16199 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18176 17055 gene locus_tag LOCUS_27230 18176 17055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 17521 17615 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18289 19332 gene locus_tag LOCUS_27240 18289 19332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 19561 21555 gene locus_tag LOCUS_27250 19561 21555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 21277 21368 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21624 21763 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence093 133 1335 gene locus_tag LOCUS_27260 133 1335 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922523.1 protein_id gnl|my_center|LOCUS_27260 1529 2632 gene locus_tag LOCUS_27270 1529 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 2746 4245 gene locus_tag LOCUS_27280 2746 4245 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528380.1 protein_id gnl|my_center|LOCUS_27280 4885 4409 gene locus_tag LOCUS_27290 4885 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 6135 5047 gene locus_tag LOCUS_27300 6135 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 7426 6374 gene locus_tag LOCUS_27310 7426 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 7538 7694 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8232 7792 gene locus_tag LOCUS_27320 8232 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 8521 8605 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9720 9250 gene locus_tag LOCUS_27330 9720 9250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197998779.1 protein_id gnl|my_center|LOCUS_27330 10056 9982 gene locus_tag LOCUS_t00120 10056 9982 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 10417 11781 gene locus_tag LOCUS_27340 10417 11781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 11821 12014 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12165 12370 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12751 12938 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13110 13323 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14801 13359 gene locus_tag LOCUS_27350 14801 13359 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_27350 15003 15887 gene locus_tag LOCUS_27360 15003 15887 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327171.1 protein_id gnl|my_center|LOCUS_27360 15945 16192 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17890 16298 gene locus_tag LOCUS_27370 17890 16298 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327245.1 protein_id gnl|my_center|LOCUS_27370 19360 18380 gene locus_tag LOCUS_27380 gene trpS 19360 18380 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120916.1 protein_id gnl|my_center|LOCUS_27380 20374 19409 gene locus_tag LOCUS_27390 20374 19409 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332287.1 protein_id gnl|my_center|LOCUS_27390 20600 20707 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20973 20755 gene locus_tag LOCUS_27400 20973 20755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672712.1 protein_id gnl|my_center|LOCUS_27400 >Feature sequence094 62 2497 gene locus_tag LOCUS_27410 62 2497 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921453.1 protein_id gnl|my_center|LOCUS_27410 2494 4926 gene locus_tag LOCUS_27420 2494 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 5178 7574 gene locus_tag LOCUS_27430 5178 7574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 7638 9392 gene locus_tag LOCUS_27440 7638 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921469.1 protein_id gnl|my_center|LOCUS_27440 9435 10466 gene locus_tag LOCUS_27450 9435 10466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 10514 11755 gene locus_tag LOCUS_27460 10514 11755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 11805 13541 gene locus_tag LOCUS_27470 11805 13541 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922881.1 protein_id gnl|my_center|LOCUS_27470 13567 14616 gene locus_tag LOCUS_27480 13567 14616 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922058.1 protein_id gnl|my_center|LOCUS_27480 14839 16923 gene locus_tag LOCUS_27490 gene uvrB 14839 16923 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329492.1 protein_id gnl|my_center|LOCUS_27490 17130 17762 gene locus_tag LOCUS_27500 17130 17762 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073379.1 protein_id gnl|my_center|LOCUS_27500 17759 18901 gene locus_tag LOCUS_27510 17759 18901 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926879.1 protein_id gnl|my_center|LOCUS_27510 18948 19727 gene locus_tag LOCUS_27520 18948 19727 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057678.1 protein_id gnl|my_center|LOCUS_27520 19729 20817 gene locus_tag LOCUS_27530 19729 20817 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187814.1 protein_id gnl|my_center|LOCUS_27530 >Feature sequence095 173 357 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 669 837 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 953 1453 gene locus_tag LOCUS_27540 953 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 2966 1509 gene locus_tag LOCUS_27550 2966 1509 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120624.1 protein_id gnl|my_center|LOCUS_27550 3267 4619 gene locus_tag LOCUS_27560 3267 4619 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921592.1 protein_id gnl|my_center|LOCUS_27560 4959 6296 gene locus_tag LOCUS_27570 4959 6296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 7340 6321 gene locus_tag LOCUS_27580 7340 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 8483 7551 gene locus_tag LOCUS_27590 8483 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 9708 9890 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10231 10381 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10483 14175 gene locus_tag LOCUS_27600 10483 14175 CDS product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922355.1 protein_id gnl|my_center|LOCUS_27600 12451 12613 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14716 14812 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15517 15212 gene locus_tag LOCUS_27610 15517 15212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 15416 15955 gene locus_tag LOCUS_27620 15416 15955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 18652 17039 gene locus_tag LOCUS_27630 18652 17039 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044334326.1 protein_id gnl|my_center|LOCUS_27630 18848 18669 gene locus_tag LOCUS_27640 18848 18669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 18883 18945 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20421 20520 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20767 20865 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence096 213 1478 gene locus_tag LOCUS_27650 213 1478 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037250665.1 protein_id gnl|my_center|LOCUS_27650 1820 1482 gene locus_tag LOCUS_27660 1820 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 3169 1850 gene locus_tag LOCUS_27670 3169 1850 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906404.1 protein_id gnl|my_center|LOCUS_27670 4313 3384 gene locus_tag LOCUS_27680 4313 3384 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333288.1 protein_id gnl|my_center|LOCUS_27680 4498 4310 gene locus_tag LOCUS_27690 4498 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 4534 4754 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7939 5867 gene locus_tag LOCUS_27700 7939 5867 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 protein_id gnl|my_center|LOCUS_27700 8690 10729 gene locus_tag LOCUS_27710 gene metG 8690 10729 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120499.1 protein_id gnl|my_center|LOCUS_27710 11089 11237 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11544 11660 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12763 12302 gene locus_tag LOCUS_27720 12763 12302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 13294 12779 gene locus_tag LOCUS_27730 13294 12779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 13312 13430 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13811 13968 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14548 14318 gene locus_tag LOCUS_27740 14548 14318 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324899.1 protein_id gnl|my_center|LOCUS_27740 15719 14799 gene locus_tag LOCUS_27750 gene fabD 15719 14799 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117846.1 protein_id gnl|my_center|LOCUS_27750 16809 15802 gene locus_tag LOCUS_27760 gene plsX 16809 15802 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_27760 17809 17967 gene locus_tag LOCUS_27770 17809 17967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 18164 18376 gene locus_tag LOCUS_27780 18164 18376 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_27780 <21232 18457 gene locus_tag LOCUS_27790 <21232 18457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121554.1:autotransporter outer membrane beta-barrel domain-containing protein 18779 18917 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence097 76 537 gene locus_tag LOCUS_27800 76 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 654 839 gene locus_tag LOCUS_27810 654 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 922 1005 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1958 2144 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2239 3633 gene locus_tag LOCUS_27820 2239 3633 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_27820 4342 3683 gene locus_tag LOCUS_27830 4342 3683 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_27830 4627 5496 gene locus_tag LOCUS_27840 4627 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 5391 5444 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5493 5756 gene locus_tag LOCUS_27850 5493 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 6700 5789 gene locus_tag LOCUS_27860 6700 5789 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_27860 7024 7162 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8300 8419 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8964 8464 gene locus_tag LOCUS_27870 8964 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 9084 9219 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9515 9697 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10635 10777 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10858 11670 gene locus_tag LOCUS_27880 10858 11670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 11738 13399 gene locus_tag LOCUS_27890 11738 13399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 13473 13958 gene locus_tag LOCUS_27900 gene moaC 13473 13958 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093030.1 protein_id gnl|my_center|LOCUS_27900 14365 14126 gene locus_tag LOCUS_27910 gene csrA 14365 14126 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632782.1 protein_id gnl|my_center|LOCUS_27910 14884 16026 gene locus_tag LOCUS_27920 gene hpnH 14884 16026 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_27920 16098 16643 gene locus_tag LOCUS_27930 16098 16643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 19213 16649 gene locus_tag LOCUS_27940 19213 16649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 <21133 19397 gene locus_tag LOCUS_27950 <21133 19397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122073.1:leucine--tRNA ligase >Feature sequence098 2145 2258 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2280 2921 gene locus_tag LOCUS_27960 2280 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 3046 3444 gene locus_tag LOCUS_27970 gene rplU 3046 3444 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325148.1 protein_id gnl|my_center|LOCUS_27970 4423 3482 gene locus_tag LOCUS_27980 gene miaA 4423 3482 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546758.1 protein_id gnl|my_center|LOCUS_27980 5152 4685 gene locus_tag LOCUS_27990 5152 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 7095 5431 gene locus_tag LOCUS_28000 gene murJ 7095 5431 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948335.1 protein_id gnl|my_center|LOCUS_28000 7700 7209 gene locus_tag LOCUS_28010 7700 7209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 8214 8369 gene locus_tag LOCUS_28020 8214 8369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 9253 8699 gene locus_tag LOCUS_28030 9253 8699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 9525 9250 gene locus_tag LOCUS_28040 9525 9250 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326729.1 protein_id gnl|my_center|LOCUS_28040 10138 9518 gene locus_tag LOCUS_28050 gene gmk 10138 9518 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326728.1 protein_id gnl|my_center|LOCUS_28050 10737 10315 gene locus_tag LOCUS_28060 10737 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 10745 10871 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11069 11226 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11543 11809 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12214 12444 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12915 15221 gene locus_tag LOCUS_28070 12915 15221 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_28070 15648 15316 gene locus_tag LOCUS_28080 15648 15316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 15999 15784 gene locus_tag LOCUS_28090 15999 15784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 16288 16653 gene locus_tag LOCUS_28100 16288 16653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 18354 16873 gene locus_tag LOCUS_28110 18354 16873 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061798.1 protein_id gnl|my_center|LOCUS_28110 18825 19286 gene locus_tag LOCUS_28120 18825 19286 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_28120 >Feature sequence099 814 50 gene locus_tag LOCUS_28130 814 50 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117867.1 protein_id gnl|my_center|LOCUS_28130 2233 896 gene locus_tag LOCUS_28140 2233 896 CDS product BtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117868.1 protein_id gnl|my_center|LOCUS_28140 3248 2202 gene locus_tag LOCUS_28150 3248 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 3449 3309 gene locus_tag LOCUS_28160 3449 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 3620 3859 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4132 3944 gene locus_tag LOCUS_28170 4132 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 5409 4168 gene locus_tag LOCUS_28180 5409 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 4180 4302 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6641 6768 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6961 7211 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9392 10396 gene locus_tag LOCUS_28190 9392 10396 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123109.1 protein_id gnl|my_center|LOCUS_28190 11240 10422 gene locus_tag LOCUS_28200 11240 10422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 12001 11312 gene locus_tag LOCUS_28210 12001 11312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 12619 12083 gene locus_tag LOCUS_28220 12619 12083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 12631 12796 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14318 15379 gene locus_tag LOCUS_28230 14318 15379 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565946.1 protein_id gnl|my_center|LOCUS_28230 15510 16511 gene locus_tag LOCUS_28240 15510 16511 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615404.1 protein_id gnl|my_center|LOCUS_28240 16731 17474 gene locus_tag LOCUS_28250 16731 17474 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_28250 17561 17635 gene locus_tag LOCUS_t00130 17561 17635 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 18684 17764 gene locus_tag LOCUS_28260 18684 17764 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922180.1 protein_id gnl|my_center|LOCUS_28260 20352 20524 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence100 437 530 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1199 1303 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2023 2134 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2339 2815 gene locus_tag LOCUS_28270 2339 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 3190 3897 gene locus_tag LOCUS_28280 3190 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014503.1 protein_id gnl|my_center|LOCUS_28280 6383 4281 gene locus_tag LOCUS_28290 6383 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 6578 7525 gene locus_tag LOCUS_28300 6578 7525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 7532 8440 gene locus_tag LOCUS_28310 7532 8440 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_28310 8522 9409 gene locus_tag LOCUS_28320 8522 9409 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_28320 9483 12638 gene locus_tag LOCUS_28330 9483 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 12972 13080 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14166 14287 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14824 14973 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15664 16461 gene locus_tag LOCUS_28340 15664 16461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 16468 17430 gene locus_tag LOCUS_28350 16468 17430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 18978 19089 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence101 2267 1137 gene locus_tag LOCUS_28360 2267 1137 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_28360 2492 3178 gene locus_tag LOCUS_28370 2492 3178 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_28370 3272 3568 gene locus_tag LOCUS_28380 3272 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 4480 3713 gene locus_tag LOCUS_28390 4480 3713 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223885.1 protein_id gnl|my_center|LOCUS_28390 5715 4477 gene locus_tag LOCUS_28400 gene pepT 5715 4477 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087691.1 protein_id gnl|my_center|LOCUS_28400 6617 5733 gene locus_tag LOCUS_28410 6617 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339871.1 protein_id gnl|my_center|LOCUS_28410 9861 6880 gene locus_tag LOCUS_28420 9861 6880 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118092.1 protein_id gnl|my_center|LOCUS_28420 8120 8236 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9888 10071 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10801 11427 gene locus_tag LOCUS_28430 10801 11427 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061309.1 protein_id gnl|my_center|LOCUS_28430 11850 11991 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12775 12931 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13119 14564 gene locus_tag LOCUS_28440 13119 14564 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_28440 15346 14723 gene locus_tag LOCUS_28450 15346 14723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 15600 16598 gene locus_tag LOCUS_28460 gene thyX 15600 16598 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_28460 15988 16047 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17429 16845 gene locus_tag LOCUS_28470 17429 16845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 17458 17529 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18923 17874 gene locus_tag LOCUS_28480 18923 17874 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324646.1 protein_id gnl|my_center|LOCUS_28480 19391 19557 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19603 19971 gene locus_tag LOCUS_28490 19603 19971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 20015 20491 gene locus_tag LOCUS_28500 gene queD 20015 20491 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704886.1 protein_id gnl|my_center|LOCUS_28500 >Feature sequence102 2171 2280 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3588 2578 gene locus_tag LOCUS_28510 3588 2578 CDS product DUF4365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108028898.1 protein_id gnl|my_center|LOCUS_28510 3917 3585 gene locus_tag LOCUS_28520 3917 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 3955 4113 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4304 4612 gene locus_tag LOCUS_28530 4304 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 5390 5833 gene locus_tag LOCUS_28540 5390 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 6480 5812 gene locus_tag LOCUS_28550 6480 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 6563 6691 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9125 9250 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10390 10477 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11037 10855 gene locus_tag LOCUS_28560 11037 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 12311 12505 gene locus_tag LOCUS_28570 12311 12505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 13725 13561 gene locus_tag LOCUS_28580 13725 13561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 17092 15311 gene locus_tag LOCUS_28590 17092 15311 CDS product response regulator receiver domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530590.1 protein_id gnl|my_center|LOCUS_28590 20042 17085 gene locus_tag LOCUS_28600 20042 17085 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939035.1 protein_id gnl|my_center|LOCUS_28600 >Feature sequence103 625 53 gene locus_tag LOCUS_28610 625 53 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404273.1 protein_id gnl|my_center|LOCUS_28610 1698 613 gene locus_tag LOCUS_28620 1698 613 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_28620 1801 1923 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3277 1970 gene locus_tag LOCUS_28630 3277 1970 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921673.1 protein_id gnl|my_center|LOCUS_28630 4939 3407 gene locus_tag LOCUS_28640 4939 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 6921 5077 gene locus_tag LOCUS_28650 6921 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 5115 5216 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7556 7843 gene locus_tag LOCUS_28660 7556 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 8195 7926 gene locus_tag LOCUS_28670 8195 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 8803 8967 gene locus_tag LOCUS_28680 8803 8967 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096961.1 protein_id gnl|my_center|LOCUS_28680 9007 9198 gene locus_tag LOCUS_28690 9007 9198 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390272.1 protein_id gnl|my_center|LOCUS_28690 9319 10218 gene locus_tag LOCUS_28700 9319 10218 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977671.1 protein_id gnl|my_center|LOCUS_28700 11962 10433 gene locus_tag LOCUS_28710 11962 10433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 12122 13702 gene locus_tag LOCUS_28720 12122 13702 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125187.1 protein_id gnl|my_center|LOCUS_28720 14032 14568 gene locus_tag LOCUS_28730 14032 14568 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811261.1 protein_id gnl|my_center|LOCUS_28730 15753 14587 gene locus_tag LOCUS_28740 15753 14587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 18078 16078 gene locus_tag LOCUS_28750 18078 16078 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921992.1 protein_id gnl|my_center|LOCUS_28750 18775 18317 gene locus_tag LOCUS_28760 18775 18317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 18974 19213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19376 19549 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <20387 19800 gene locus_tag LOCUS_28770 <20387 19800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393770.1:acetylornithine transaminase >Feature sequence104 160 519 gene locus_tag LOCUS_28780 160 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 694 1209 gene locus_tag LOCUS_28790 694 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 1246 2943 gene locus_tag LOCUS_28800 gene flgK 1246 2943 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616092.1 protein_id gnl|my_center|LOCUS_28800 2978 3169 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3564 3761 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4135 4300 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4582 4781 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4807 6024 gene locus_tag LOCUS_28810 4807 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 7158 6118 gene locus_tag LOCUS_28820 7158 6118 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922558.1 protein_id gnl|my_center|LOCUS_28820 7368 8534 gene locus_tag LOCUS_28830 7368 8534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 9317 8616 gene locus_tag LOCUS_28840 9317 8616 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_28840 11294 9555 gene locus_tag LOCUS_28850 11294 9555 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228370.1 protein_id gnl|my_center|LOCUS_28850 14232 11269 gene locus_tag LOCUS_28860 14232 11269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922069.1 protein_id gnl|my_center|LOCUS_28860 14964 15719 gene locus_tag LOCUS_28870 14964 15719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814201.1 protein_id gnl|my_center|LOCUS_28870 17029 15818 gene locus_tag LOCUS_28880 17029 15818 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_28880 17227 17493 gene locus_tag LOCUS_28890 17227 17493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 19010 17589 gene locus_tag LOCUS_28900 19010 17589 CDS product glycosyltransferase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922438.1 protein_id gnl|my_center|LOCUS_28900 19636 19271 gene locus_tag LOCUS_28910 19636 19271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 >Feature sequence105 267 1937 gene locus_tag LOCUS_28920 267 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 1998 3008 gene locus_tag LOCUS_28930 1998 3008 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927014.1 protein_id gnl|my_center|LOCUS_28930 4005 3076 gene locus_tag LOCUS_28940 4005 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 5615 4002 gene locus_tag LOCUS_28950 5615 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 4122 4237 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6788 5727 gene locus_tag LOCUS_28960 gene hypE 6788 5727 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077175158.1 protein_id gnl|my_center|LOCUS_28960 7912 6785 gene locus_tag LOCUS_28970 gene hypD 7912 6785 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893645.1 protein_id gnl|my_center|LOCUS_28970 8169 7909 gene locus_tag LOCUS_28980 8169 7909 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893644.1 protein_id gnl|my_center|LOCUS_28980 10565 8169 gene locus_tag LOCUS_28990 gene hypF 10565 8169 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258631.1 protein_id gnl|my_center|LOCUS_28990 8871 8934 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11242 10583 gene locus_tag LOCUS_29000 gene hypB 11242 10583 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 protein_id gnl|my_center|LOCUS_29000 11571 11239 gene locus_tag LOCUS_29010 11571 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 11579 11691 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12246 11725 gene locus_tag LOCUS_29020 12246 11725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 13516 12290 gene locus_tag LOCUS_29030 13516 12290 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895383.1 protein_id gnl|my_center|LOCUS_29030 13520 13626 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14059 14149 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15449 14589 gene locus_tag LOCUS_29040 15449 14589 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948171.1 protein_id gnl|my_center|LOCUS_29040 16489 15446 gene locus_tag LOCUS_29050 16489 15446 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_29050 17005 16595 gene locus_tag LOCUS_29060 17005 16595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 18015 17182 gene locus_tag LOCUS_29070 18015 17182 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123124.1 protein_id gnl|my_center|LOCUS_29070 18937 18065 gene locus_tag LOCUS_29080 18937 18065 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123124.1 protein_id gnl|my_center|LOCUS_29080 >Feature sequence106 243 1076 gene locus_tag LOCUS_29090 243 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 1888 2077 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2670 2776 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3339 8624 gene locus_tag LOCUS_29100 3339 8624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 5937 6032 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8418 8573 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8621 9151 gene locus_tag LOCUS_29110 8621 9151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 9405 9482 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10858 9539 gene locus_tag LOCUS_29120 gene wbpA 10858 9539 CDS product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113429.1 protein_id gnl|my_center|LOCUS_29120 11069 10878 gene locus_tag LOCUS_29130 11069 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29130 12346 12509 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18357 12991 gene locus_tag LOCUS_29140 18357 12991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 15949 16124 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18480 18613 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19022 19177 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence107 217 382 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1577 1960 gene locus_tag LOCUS_29150 1577 1960 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121923.1 protein_id gnl|my_center|LOCUS_29150 2114 2650 gene locus_tag LOCUS_29160 2114 2650 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_29160 2677 2842 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4391 2895 gene locus_tag LOCUS_29170 4391 2895 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669743.1 protein_id gnl|my_center|LOCUS_29170 4816 5934 gene locus_tag LOCUS_29180 gene tatC 4816 5934 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338730.1 protein_id gnl|my_center|LOCUS_29180 7709 6111 gene locus_tag LOCUS_29190 7709 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 9160 7775 gene locus_tag LOCUS_29200 9160 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 9479 9147 gene locus_tag LOCUS_29210 9479 9147 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 protein_id gnl|my_center|LOCUS_29210 9917 10027 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10233 11000 gene locus_tag LOCUS_29220 10233 11000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29220 10919 10981 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11003 11332 gene locus_tag LOCUS_29230 11003 11332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29230 11491 11898 gene locus_tag LOCUS_29240 11491 11898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 11955 12812 gene locus_tag LOCUS_29250 11955 12812 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_29250 12939 13301 gene locus_tag LOCUS_29260 12939 13301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 13432 13563 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13606 14652 gene locus_tag LOCUS_29270 13606 14652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 14551 14634 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14663 16246 gene locus_tag LOCUS_29280 14663 16246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29280 16266 18188 gene locus_tag LOCUS_29290 gene lepB 16266 18188 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442624.1 protein_id gnl|my_center|LOCUS_29290 18709 18272 gene locus_tag LOCUS_29300 18709 18272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 18822 19181 gene locus_tag LOCUS_29310 18822 19181 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141229.1 protein_id gnl|my_center|LOCUS_29310 >Feature sequence108 882 1637 gene locus_tag LOCUS_29320 882 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 3611 2874 gene locus_tag LOCUS_29330 3611 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 3968 3693 gene locus_tag LOCUS_29340 3968 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 4645 4788 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5084 4857 gene locus_tag LOCUS_29350 5084 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 5799 5888 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5996 6238 gene locus_tag LOCUS_29360 5996 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 6534 6196 gene locus_tag LOCUS_29370 6534 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 7244 6603 gene locus_tag LOCUS_29380 7244 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326285.1 protein_id gnl|my_center|LOCUS_29380 7404 8387 gene locus_tag LOCUS_29390 7404 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 8384 8941 gene locus_tag LOCUS_29400 8384 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 9990 10694 gene locus_tag LOCUS_29410 9990 10694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 11363 11513 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11834 13690 gene locus_tag LOCUS_29420 11834 13690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 13694 14896 gene locus_tag LOCUS_29430 13694 14896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 15056 15418 gene locus_tag LOCUS_29440 15056 15418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 15472 16326 gene locus_tag LOCUS_29450 15472 16326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 16370 18055 gene locus_tag LOCUS_29460 16370 18055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 18055 19020 gene locus_tag LOCUS_29470 18055 19020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 >Feature sequence109 317 1291 gene locus_tag LOCUS_29480 gene folP 317 1291 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_29480 930 1006 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1308 1518 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2082 2144 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2791 2910 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3016 3927 gene locus_tag LOCUS_29490 3016 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 4273 4082 gene locus_tag LOCUS_29500 gene rpsU 4273 4082 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338941.1 protein_id gnl|my_center|LOCUS_29500 5502 5665 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5804 5673 gene locus_tag LOCUS_29510 5804 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 5865 6074 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6487 6635 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7825 6869 gene locus_tag LOCUS_29520 7825 6869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 8265 8379 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10205 9366 gene locus_tag LOCUS_29530 10205 9366 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084985.1 protein_id gnl|my_center|LOCUS_29530 11389 10202 gene locus_tag LOCUS_29540 11389 10202 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868672.1 protein_id gnl|my_center|LOCUS_29540 11848 11594 gene locus_tag LOCUS_29550 11848 11594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29550 13601 11871 gene locus_tag LOCUS_29560 13601 11871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29560 11906 11964 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14162 13692 gene locus_tag LOCUS_29570 14162 13692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 17138 14196 gene locus_tag LOCUS_29580 17138 14196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 17478 17200 gene locus_tag LOCUS_29590 17478 17200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 17893 17528 gene locus_tag LOCUS_29600 17893 17528 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940486.1 protein_id gnl|my_center|LOCUS_29600 18433 17942 gene locus_tag LOCUS_29610 18433 17942 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073661.1 protein_id gnl|my_center|LOCUS_29610 18489 18558 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18926 19097 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence110 887 438 gene locus_tag LOCUS_29620 gene rplO 887 438 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326814.1 protein_id gnl|my_center|LOCUS_29620 1511 1032 gene locus_tag LOCUS_29630 gene rpsE 1511 1032 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326813.1 protein_id gnl|my_center|LOCUS_29630 1941 1690 gene locus_tag LOCUS_29640 1941 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 2098 2187 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2830 2285 gene locus_tag LOCUS_29650 gene rplF 2830 2285 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121609.1 protein_id gnl|my_center|LOCUS_29650 3277 2882 gene locus_tag LOCUS_29660 gene rpsH 3277 2882 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326810.1 protein_id gnl|my_center|LOCUS_29660 3948 3394 gene locus_tag LOCUS_29670 gene rplE 3948 3394 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225809.1 protein_id gnl|my_center|LOCUS_29670 4359 4003 gene locus_tag LOCUS_29680 gene rplX 4359 4003 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326807.1 protein_id gnl|my_center|LOCUS_29680 4879 4511 gene locus_tag LOCUS_29690 gene rplN 4879 4511 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326806.1 protein_id gnl|my_center|LOCUS_29690 5234 4935 gene locus_tag LOCUS_29700 5234 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 5505 5293 gene locus_tag LOCUS_29710 gene rpmC 5505 5293 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326804.1 protein_id gnl|my_center|LOCUS_29710 5988 5566 gene locus_tag LOCUS_29720 gene rplP 5988 5566 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121605.1 protein_id gnl|my_center|LOCUS_29720 6628 5927 gene locus_tag LOCUS_29730 gene rpsC 6628 5927 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326802.1 protein_id gnl|my_center|LOCUS_29730 7025 6681 gene locus_tag LOCUS_29740 7025 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 7379 7110 gene locus_tag LOCUS_29750 gene rpsS 7379 7110 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326800.1 protein_id gnl|my_center|LOCUS_29750 8295 7441 gene locus_tag LOCUS_29760 gene rplB 8295 7441 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121603.1 protein_id gnl|my_center|LOCUS_29760 8665 8357 gene locus_tag LOCUS_29770 gene rplW 8665 8357 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326798.1 protein_id gnl|my_center|LOCUS_29770 9181 8735 gene locus_tag LOCUS_29780 9181 8735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 9191 9298 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10254 9559 gene locus_tag LOCUS_29790 gene rplC 10254 9559 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121602.1 protein_id gnl|my_center|LOCUS_29790 10253 10474 gene locus_tag LOCUS_29800 10253 10474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 10753 10430 gene locus_tag LOCUS_29810 gene rpsJ 10753 10430 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326795.1 protein_id gnl|my_center|LOCUS_29810 11851 11081 gene locus_tag LOCUS_29820 11851 11081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 12522 12661 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13151 13229 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13811 14896 gene locus_tag LOCUS_29830 13811 14896 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338937.1 protein_id gnl|my_center|LOCUS_29830 15150 17084 gene locus_tag LOCUS_29840 15150 17084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 16854 16992 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17634 17206 gene locus_tag LOCUS_29850 17634 17206 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123285.1 protein_id gnl|my_center|LOCUS_29850 17732 17830 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19138 17900 gene locus_tag LOCUS_29860 19138 17900 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122283.1 protein_id gnl|my_center|LOCUS_29860 >Feature sequence111 67 675 gene locus_tag LOCUS_29870 67 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 746 853 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 903 1067 gene locus_tag LOCUS_29880 903 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 1320 1466 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1956 2159 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3022 3345 gene locus_tag LOCUS_29890 3022 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 4131 4523 gene locus_tag LOCUS_29900 4131 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 4622 5191 gene locus_tag LOCUS_29910 4622 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 5306 5533 gene locus_tag LOCUS_29920 5306 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 6091 6263 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6632 6318 gene locus_tag LOCUS_29930 6632 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 7184 6945 gene locus_tag LOCUS_29940 7184 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 8131 7958 gene locus_tag LOCUS_29950 8131 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 8608 8219 gene locus_tag LOCUS_29960 8608 8219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 9252 8728 gene locus_tag LOCUS_29970 9252 8728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 9347 9492 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9927 10124 gene locus_tag LOCUS_29980 9927 10124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 10480 10352 gene locus_tag LOCUS_29990 10480 10352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 10499 10588 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10945 11247 gene locus_tag LOCUS_30000 10945 11247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 11846 12199 gene locus_tag LOCUS_30010 11846 12199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 12531 12658 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12666 13595 gene locus_tag LOCUS_30020 12666 13595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 14822 15307 gene locus_tag LOCUS_30030 14822 15307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 15364 15570 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16169 16275 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16314 17603 gene locus_tag LOCUS_30040 16314 17603 CDS product STM4012 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058547.1 protein_id gnl|my_center|LOCUS_30040 17437 17487 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17662 18567 gene locus_tag LOCUS_30050 17662 18567 CDS product STM4011 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640248.1 protein_id gnl|my_center|LOCUS_30050 >Feature sequence112 433 38 gene locus_tag LOCUS_30060 433 38 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 protein_id gnl|my_center|LOCUS_30060 1696 509 gene locus_tag LOCUS_30070 1696 509 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615932.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30070 2201 2379 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4141 5835 gene locus_tag LOCUS_30080 4141 5835 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_30080 5838 6680 gene locus_tag LOCUS_30090 gene rfbD 5838 6680 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868299.1 protein_id gnl|my_center|LOCUS_30090 6766 6863 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6899 8758 gene locus_tag LOCUS_30100 gene asnB 6899 8758 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_30100 9169 8762 gene locus_tag LOCUS_30110 9169 8762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 11692 9230 gene locus_tag LOCUS_30120 11692 9230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 13746 11836 gene locus_tag LOCUS_30130 13746 11836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 14188 13832 gene locus_tag LOCUS_30140 14188 13832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 15084 14185 gene locus_tag LOCUS_30150 15084 14185 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816586.1 protein_id gnl|my_center|LOCUS_30150 15382 18324 gene locus_tag LOCUS_30160 15382 18324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 17799 17818 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18099 18204 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence113 217 383 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1008 430 gene locus_tag LOCUS_30170 1008 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 1439 1870 gene locus_tag LOCUS_30180 1439 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 2005 2712 gene locus_tag LOCUS_30190 gene metW 2005 2712 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918412.1 protein_id gnl|my_center|LOCUS_30190 2815 3459 gene locus_tag LOCUS_30200 2815 3459 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123691.1 protein_id gnl|my_center|LOCUS_30200 3595 4452 gene locus_tag LOCUS_30210 3595 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123690.1 protein_id gnl|my_center|LOCUS_30210 4478 4993 gene locus_tag LOCUS_30220 4478 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 4990 6435 gene locus_tag LOCUS_30230 gene hpnE 4990 6435 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122224.1 protein_id gnl|my_center|LOCUS_30230 6633 8180 gene locus_tag LOCUS_30240 6633 8180 CDS product ATPase with chaperone activity inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615735.1 protein_id gnl|my_center|LOCUS_30240 8552 8690 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8770 9339 gene locus_tag LOCUS_30250 8770 9339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 9410 9847 gene locus_tag LOCUS_30260 9410 9847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 9849 9980 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10379 11185 gene locus_tag LOCUS_30270 10379 11185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 14252 11265 gene locus_tag LOCUS_30280 14252 11265 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922034.1 protein_id gnl|my_center|LOCUS_30280 14315 14452 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15753 15022 gene locus_tag LOCUS_30290 15753 15022 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118407.1 protein_id gnl|my_center|LOCUS_30290 15870 16027 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16480 16040 gene locus_tag LOCUS_30300 16480 16040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 17077 16601 gene locus_tag LOCUS_30310 17077 16601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 17126 17245 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17635 17782 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence114 147 298 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 448 738 gene locus_tag LOCUS_30320 448 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 789 882 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 965 1981 gene locus_tag LOCUS_30330 965 1981 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_30330 2757 2924 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2941 4065 gene locus_tag LOCUS_30340 2941 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 4214 4975 gene locus_tag LOCUS_30350 4214 4975 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_30350 4968 5519 gene locus_tag LOCUS_30360 4968 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 5618 8269 gene locus_tag LOCUS_30370 5618 8269 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615489.1 protein_id gnl|my_center|LOCUS_30370 8266 9687 gene locus_tag LOCUS_30380 8266 9687 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921968.1 protein_id gnl|my_center|LOCUS_30380 9905 9978 gene locus_tag LOCUS_t00140 9905 9978 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 11241 10036 gene locus_tag LOCUS_30390 11241 10036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 11969 11796 gene locus_tag LOCUS_30400 11969 11796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 12074 12225 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12341 12511 gene locus_tag LOCUS_30410 12341 12511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 12913 12749 gene locus_tag LOCUS_30420 12913 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 13861 12914 gene locus_tag LOCUS_30430 13861 12914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 16485 14098 gene locus_tag LOCUS_30440 16485 14098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 16880 16473 gene locus_tag LOCUS_30450 16880 16473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 16944 17052 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence115 1936 1682 gene locus_tag LOCUS_30460 1936 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 3992 2193 gene locus_tag LOCUS_30470 3992 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 5385 4393 gene locus_tag LOCUS_30480 5385 4393 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618875.1 protein_id gnl|my_center|LOCUS_30480 6037 5549 gene locus_tag LOCUS_30490 gene rpiB 6037 5549 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615468.1 protein_id gnl|my_center|LOCUS_30490 7103 6363 gene locus_tag LOCUS_30500 7103 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 7557 9053 gene locus_tag LOCUS_30510 7557 9053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 10027 9218 gene locus_tag LOCUS_30520 10027 9218 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845492.1 protein_id gnl|my_center|LOCUS_30520 10431 12986 gene locus_tag LOCUS_30530 10431 12986 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_30530 14028 13027 gene locus_tag LOCUS_30540 14028 13027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 14436 15386 gene locus_tag LOCUS_30550 14436 15386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 15459 15785 gene locus_tag LOCUS_30560 15459 15785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119559.1 protein_id gnl|my_center|LOCUS_30560 17475 16066 gene locus_tag LOCUS_30570 gene murF 17475 16066 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610677.1 protein_id gnl|my_center|LOCUS_30570 <18145 17498 gene locus_tag LOCUS_30580 <18145 17498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057081.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence116 1206 364 gene locus_tag LOCUS_30590 1206 364 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121456.1 protein_id gnl|my_center|LOCUS_30590 1496 3232 gene locus_tag LOCUS_30600 1496 3232 CDS product DUF1598 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435082.1 protein_id gnl|my_center|LOCUS_30600 3744 5291 gene locus_tag LOCUS_30610 3744 5291 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973343.1 protein_id gnl|my_center|LOCUS_30610 5921 6103 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6119 7657 gene locus_tag LOCUS_30620 6119 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 9044 7917 gene locus_tag LOCUS_30630 gene citZ 9044 7917 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503660.1 protein_id gnl|my_center|LOCUS_30630 9099 9332 gene locus_tag LOCUS_30640 9099 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 10172 9225 gene locus_tag LOCUS_30650 gene xerD 10172 9225 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921953.1 protein_id gnl|my_center|LOCUS_30650 11371 10436 gene locus_tag LOCUS_30660 11371 10436 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334279.1 protein_id gnl|my_center|LOCUS_30660 11802 11999 gene locus_tag LOCUS_30670 11802 11999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 12443 12048 gene locus_tag LOCUS_30680 12443 12048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 14122 12512 gene locus_tag LOCUS_30690 gene pckA 14122 12512 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405091.1 protein_id gnl|my_center|LOCUS_30690 14844 14920 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15001 16266 gene locus_tag LOCUS_30700 15001 16266 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921570.1 protein_id gnl|my_center|LOCUS_30700 16483 16719 gene locus_tag LOCUS_30710 16483 16719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 >Feature sequence117 213 316 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 675 466 gene locus_tag LOCUS_30720 675 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 1715 876 gene locus_tag LOCUS_30730 1715 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 2321 2488 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2599 2808 gene locus_tag LOCUS_30740 2599 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 2884 3225 gene locus_tag LOCUS_30750 2884 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 3839 5251 gene locus_tag LOCUS_30760 3839 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 5755 6363 gene locus_tag LOCUS_30770 gene lexA 5755 6363 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986377.1 protein_id gnl|my_center|LOCUS_30770 6607 8100 gene locus_tag LOCUS_30780 6607 8100 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922314.1 protein_id gnl|my_center|LOCUS_30780 8131 8253 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9717 8359 gene locus_tag LOCUS_30790 9717 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 10330 9851 gene locus_tag LOCUS_30800 10330 9851 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660073.1 protein_id gnl|my_center|LOCUS_30800 10741 10337 gene locus_tag LOCUS_30810 gene mutT 10741 10337 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210424.1 protein_id gnl|my_center|LOCUS_30810 11369 10839 gene locus_tag LOCUS_30820 11369 10839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 11378 11480 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11685 13763 gene locus_tag LOCUS_30830 11685 13763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 14044 14925 gene locus_tag LOCUS_30840 14044 14925 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_30840 15024 17180 gene locus_tag LOCUS_30850 gene ftsH 15024 17180 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325413.1 protein_id gnl|my_center|LOCUS_30850 16434 16564 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17240 17442 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17673 17826 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence118 350 703 gene locus_tag LOCUS_30860 350 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 963 3146 gene locus_tag LOCUS_30870 963 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 3420 3818 gene locus_tag LOCUS_30880 3420 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 3818 4423 gene locus_tag LOCUS_30890 3818 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 4447 5742 gene locus_tag LOCUS_30900 4447 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 5976 6045 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6215 8416 gene locus_tag LOCUS_30910 6215 8416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 8445 11432 gene locus_tag LOCUS_30920 8445 11432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 11486 12961 gene locus_tag LOCUS_30930 11486 12961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 13006 13842 gene locus_tag LOCUS_30940 13006 13842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 13866 14684 gene locus_tag LOCUS_30950 13866 14684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 14772 15611 gene locus_tag LOCUS_30960 14772 15611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 16835 17105 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17435 17629 gene locus_tag LOCUS_30970 17435 17629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 >Feature sequence119 420 619 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 786 909 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 946 1182 gene locus_tag LOCUS_30980 946 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 1287 1676 gene locus_tag LOCUS_30990 1287 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 1792 2238 gene locus_tag LOCUS_31000 1792 2238 CDS product molybdate metabolism regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921610.1 protein_id gnl|my_center|LOCUS_31000 2370 3893 gene locus_tag LOCUS_31010 2370 3893 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615477.1 protein_id gnl|my_center|LOCUS_31010 3744 3817 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3886 5118 gene locus_tag LOCUS_31020 3886 5118 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 protein_id gnl|my_center|LOCUS_31020 5115 8222 gene locus_tag LOCUS_31030 5115 8222 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_31030 8504 8755 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10119 9352 gene locus_tag LOCUS_31040 10119 9352 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900356.1 protein_id gnl|my_center|LOCUS_31040 10707 10201 gene locus_tag LOCUS_31050 10707 10201 CDS product DUF1569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123026.1 protein_id gnl|my_center|LOCUS_31050 11388 11170 gene locus_tag LOCUS_31060 11388 11170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 11278 12564 gene locus_tag LOCUS_31070 11278 12564 CDS product MBOAT family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035887521.1 protein_id gnl|my_center|LOCUS_31070 12688 13830 gene locus_tag LOCUS_31080 12688 13830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 13920 14258 gene locus_tag LOCUS_31090 13920 14258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 16154 14787 gene locus_tag LOCUS_31100 16154 14787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 16441 16537 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16992 17130 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17296 17557 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence120 519 1868 gene locus_tag LOCUS_31110 519 1868 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122715.1 protein_id gnl|my_center|LOCUS_31110 2921 3105 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3647 3752 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4204 8970 gene locus_tag LOCUS_31120 4204 8970 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921683.1 protein_id gnl|my_center|LOCUS_31120 5788 5894 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10388 8994 gene locus_tag LOCUS_31130 10388 8994 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121615.1 protein_id gnl|my_center|LOCUS_31130 12218 10491 gene locus_tag LOCUS_31140 12218 10491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 12777 12247 gene locus_tag LOCUS_31150 12777 12247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 12884 12990 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13776 14027 gene locus_tag LOCUS_31160 13776 14027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 14298 14654 gene locus_tag LOCUS_31170 14298 14654 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324538.1 protein_id gnl|my_center|LOCUS_31170 15201 15334 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15998 16143 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16591 17559 gene locus_tag LOCUS_31180 16591 17559 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328629.1 protein_id gnl|my_center|LOCUS_31180 17001 17088 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence121 2 358 gene locus_tag LOCUS_31190 2 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 406 746 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1285 1794 gene locus_tag LOCUS_31200 1285 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 2757 1912 gene locus_tag LOCUS_31210 2757 1912 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328056.1 protein_id gnl|my_center|LOCUS_31210 3215 2847 gene locus_tag LOCUS_31220 3215 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 3216 3317 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5053 3752 gene locus_tag LOCUS_31230 5053 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 6141 5167 gene locus_tag LOCUS_31240 6141 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 6158 6352 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7086 7237 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7456 7747 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9911 7773 gene locus_tag LOCUS_31250 9911 7773 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_31250 11017 9911 gene locus_tag LOCUS_31260 11017 9911 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123514.1 protein_id gnl|my_center|LOCUS_31260 11664 11323 gene locus_tag LOCUS_31270 11664 11323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 12138 12587 gene locus_tag LOCUS_31280 12138 12587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 13424 12594 gene locus_tag LOCUS_31290 13424 12594 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207902.1 protein_id gnl|my_center|LOCUS_31290 14133 13441 gene locus_tag LOCUS_31300 14133 13441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 14160 14301 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16784 14562 gene locus_tag LOCUS_31310 16784 14562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615391.1 protein_id gnl|my_center|LOCUS_31310 17057 17213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence122 1110 112 gene locus_tag LOCUS_31320 1110 112 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_31320 1436 1363 gene locus_tag LOCUS_t00150 1436 1363 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1812 2615 gene locus_tag LOCUS_31330 1812 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 3660 3810 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4086 4270 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4468 4307 gene locus_tag LOCUS_31340 4468 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 5631 4627 gene locus_tag LOCUS_31350 5631 4627 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120806.1 protein_id gnl|my_center|LOCUS_31350 5689 5811 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6070 6298 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6939 7070 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7073 7954 gene locus_tag LOCUS_31360 7073 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 8880 8029 gene locus_tag LOCUS_31370 8880 8029 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329162.1 protein_id gnl|my_center|LOCUS_31370 9254 10573 gene locus_tag LOCUS_31380 9254 10573 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922160.1 protein_id gnl|my_center|LOCUS_31380 10760 10890 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11529 11674 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12026 13063 gene locus_tag LOCUS_31390 12026 13063 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_31390 14342 13164 gene locus_tag LOCUS_31400 14342 13164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 15575 14448 gene locus_tag LOCUS_31410 15575 14448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 16790 15732 gene locus_tag LOCUS_31420 16790 15732 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_31420 17225 16965 gene locus_tag LOCUS_31430 17225 16965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 >Feature sequence123 426 576 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 609 992 gene locus_tag LOCUS_31440 609 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 1081 2148 gene locus_tag LOCUS_31450 1081 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 2242 3150 gene locus_tag LOCUS_31460 2242 3150 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 protein_id gnl|my_center|LOCUS_31460 3182 3402 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3436 4278 gene locus_tag LOCUS_31470 3436 4278 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211996.1 protein_id gnl|my_center|LOCUS_31470 4310 4484 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4567 5283 gene locus_tag LOCUS_31480 4567 5283 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120828.1 protein_id gnl|my_center|LOCUS_31480 5280 5714 gene locus_tag LOCUS_31490 5280 5714 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_31490 5867 5989 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6338 6440 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6794 7702 gene locus_tag LOCUS_31500 6794 7702 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 protein_id gnl|my_center|LOCUS_31500 8286 8419 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8449 8790 gene locus_tag LOCUS_31510 8449 8790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 8996 9211 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10286 10411 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10420 10572 gene locus_tag LOCUS_31520 10420 10572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 11699 10590 gene locus_tag LOCUS_31530 gene hemG 11699 10590 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122777.1 protein_id gnl|my_center|LOCUS_31530 11741 11835 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11963 12101 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13358 12288 gene locus_tag LOCUS_31540 13358 12288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 13886 13515 gene locus_tag LOCUS_31550 13886 13515 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008656289.1 protein_id gnl|my_center|LOCUS_31550 15271 13883 gene locus_tag LOCUS_31560 15271 13883 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_31560 16026 15346 gene locus_tag LOCUS_31570 16026 15346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 16233 16949 gene locus_tag LOCUS_31580 16233 16949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260192.1 protein_id gnl|my_center|LOCUS_31580 >Feature sequence124 182 42 gene locus_tag LOCUS_31590 182 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 230 347 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4394 1314 gene locus_tag LOCUS_31600 4394 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 5884 4739 gene locus_tag LOCUS_31610 5884 4739 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073077526.1 protein_id gnl|my_center|LOCUS_31610 6930 7065 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7179 7871 gene locus_tag LOCUS_31620 7179 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 8152 9915 gene locus_tag LOCUS_31630 8152 9915 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262483.1 protein_id gnl|my_center|LOCUS_31630 9970 10968 gene locus_tag LOCUS_31640 9970 10968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 10979 11926 gene locus_tag LOCUS_31650 10979 11926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329547.1 protein_id gnl|my_center|LOCUS_31650 12019 12993 gene locus_tag LOCUS_31660 12019 12993 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121256.1 protein_id gnl|my_center|LOCUS_31660 15739 13184 gene locus_tag LOCUS_31670 15739 13184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 16190 15822 gene locus_tag LOCUS_31680 16190 15822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 16559 16392 gene locus_tag LOCUS_31690 16559 16392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 >Feature sequence125 284 451 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1436 654 gene locus_tag LOCUS_31700 1436 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 1729 1499 gene locus_tag LOCUS_31710 1729 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 1875 2054 gene locus_tag LOCUS_31720 1875 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 2126 2367 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2544 4997 gene locus_tag LOCUS_31730 2544 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 4832 4957 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7904 5307 gene locus_tag LOCUS_31740 7904 5307 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530161.1 protein_id gnl|my_center|LOCUS_31740 8726 7905 gene locus_tag LOCUS_31750 8726 7905 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122379.1 protein_id gnl|my_center|LOCUS_31750 8024 8085 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9106 8732 gene locus_tag LOCUS_31760 9106 8732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975153.1 protein_id gnl|my_center|LOCUS_31760 9646 9116 gene locus_tag LOCUS_31770 9646 9116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 9737 9832 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10687 10145 gene locus_tag LOCUS_31780 10687 10145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 12069 10684 gene locus_tag LOCUS_31790 12069 10684 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042159660.1 protein_id gnl|my_center|LOCUS_31790 15348 12472 gene locus_tag LOCUS_31800 15348 12472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 15367 15512 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16294 15800 gene locus_tag LOCUS_31810 16294 15800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 17109 16912 gene locus_tag LOCUS_31820 17109 16912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 >Feature sequence126 387 971 gene locus_tag LOCUS_31830 387 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 1255 1327 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1470 2258 gene locus_tag LOCUS_31840 1470 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31840 2280 2594 gene locus_tag LOCUS_31850 2280 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 2702 2869 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3178 2942 gene locus_tag LOCUS_31860 3178 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 3778 3981 gene locus_tag LOCUS_31870 3778 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 4391 4029 gene locus_tag LOCUS_31880 4391 4029 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330019.1 protein_id gnl|my_center|LOCUS_31880 7522 4616 gene locus_tag LOCUS_31890 7522 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 8988 9542 gene locus_tag LOCUS_31900 8988 9542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 9708 11363 gene locus_tag LOCUS_31910 9708 11363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 11681 11394 gene locus_tag LOCUS_31920 11681 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 11698 11868 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12236 12385 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12687 12862 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13275 14180 gene locus_tag LOCUS_31930 13275 14180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 15880 14486 gene locus_tag LOCUS_31940 15880 14486 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_31940 15918 16040 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16600 16808 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence127 1270 1848 gene locus_tag LOCUS_31950 1270 1848 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143802.1 protein_id gnl|my_center|LOCUS_31950 2033 2674 gene locus_tag LOCUS_31960 2033 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 2882 3874 gene locus_tag LOCUS_31970 2882 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640454.1 protein_id gnl|my_center|LOCUS_31970 3982 4530 gene locus_tag LOCUS_31980 3982 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 5429 4581 gene locus_tag LOCUS_31990 gene larE 5429 4581 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920840.1 protein_id gnl|my_center|LOCUS_31990 5581 7485 gene locus_tag LOCUS_32000 5581 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 7661 8791 gene locus_tag LOCUS_32010 gene thiO 7661 8791 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266588.1 protein_id gnl|my_center|LOCUS_32010 8878 10095 gene locus_tag LOCUS_32020 8878 10095 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007445862.1 protein_id gnl|my_center|LOCUS_32020 10194 10309 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10691 10863 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10983 11438 gene locus_tag LOCUS_32030 10983 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 11448 12290 gene locus_tag LOCUS_32040 11448 12290 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_32040 12613 13995 gene locus_tag LOCUS_32050 12613 13995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 13890 13977 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13979 14296 gene locus_tag LOCUS_32060 13979 14296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 14514 15185 gene locus_tag LOCUS_32070 14514 15185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340960.1 protein_id gnl|my_center|LOCUS_32070 15269 15427 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15464 16876 gene locus_tag LOCUS_32080 15464 16876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921376.1 protein_id gnl|my_center|LOCUS_32080 >Feature sequence128 1486 2190 gene locus_tag LOCUS_32090 1486 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 2190 3203 gene locus_tag LOCUS_32100 gene epmA 2190 3203 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456968.1 protein_id gnl|my_center|LOCUS_32100 4067 3390 gene locus_tag LOCUS_32110 4067 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 4778 4137 gene locus_tag LOCUS_32120 4778 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 5017 4778 gene locus_tag LOCUS_32130 5017 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 6364 5465 gene locus_tag LOCUS_32140 6364 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 6443 6530 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6879 7067 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7170 8171 gene locus_tag LOCUS_32150 7170 8171 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266745.1 protein_id gnl|my_center|LOCUS_32150 9846 8212 gene locus_tag LOCUS_32160 9846 8212 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123091.1 protein_id gnl|my_center|LOCUS_32160 10079 10306 gene locus_tag LOCUS_32170 10079 10306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146535257.1 protein_id gnl|my_center|LOCUS_32170 10337 11812 gene locus_tag LOCUS_32180 10337 11812 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922160.1 protein_id gnl|my_center|LOCUS_32180 11855 12781 gene locus_tag LOCUS_32190 11855 12781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 13096 14946 gene locus_tag LOCUS_32200 13096 14946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 14998 15585 gene locus_tag LOCUS_32210 14998 15585 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122524.1 protein_id gnl|my_center|LOCUS_32210 16654 15722 gene locus_tag LOCUS_32220 16654 15722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 >Feature sequence129 270 1331 gene locus_tag LOCUS_32230 270 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 2129 1596 gene locus_tag LOCUS_32240 2129 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 2589 2209 gene locus_tag LOCUS_32250 2589 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 3586 2612 gene locus_tag LOCUS_32260 3586 2612 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921857.1 protein_id gnl|my_center|LOCUS_32260 3960 4226 gene locus_tag LOCUS_32270 3960 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 5788 5558 gene locus_tag LOCUS_32280 5788 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 6020 6284 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6429 6726 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6880 7144 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7201 7542 gene locus_tag LOCUS_32290 7201 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 7562 7891 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9751 9011 gene locus_tag LOCUS_32300 9751 9011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 11118 10081 gene locus_tag LOCUS_32310 11118 10081 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262953.1 protein_id gnl|my_center|LOCUS_32310 12049 11141 gene locus_tag LOCUS_32320 12049 11141 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124007.1 protein_id gnl|my_center|LOCUS_32320 13980 12214 gene locus_tag LOCUS_32330 13980 12214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 14201 14332 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15839 15219 gene locus_tag LOCUS_32340 15839 15219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 16302 16063 gene locus_tag LOCUS_32350 16302 16063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 >Feature sequence130 413 538 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 972 1081 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1652 1762 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2528 1857 gene locus_tag LOCUS_32360 2528 1857 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057788.1 protein_id gnl|my_center|LOCUS_32360 2962 3088 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3118 4152 gene locus_tag LOCUS_32370 3118 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 4274 5050 gene locus_tag LOCUS_32380 4274 5050 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266475.1 protein_id gnl|my_center|LOCUS_32380 5337 7184 gene locus_tag LOCUS_32390 5337 7184 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816805.1 protein_id gnl|my_center|LOCUS_32390 7270 8616 gene locus_tag LOCUS_32400 7270 8616 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_32400 8228 8275 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8708 8822 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10631 9102 gene locus_tag LOCUS_32410 10631 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 11441 10770 gene locus_tag LOCUS_32420 11441 10770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 11635 12204 gene locus_tag LOCUS_32430 11635 12204 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219860.1 protein_id gnl|my_center|LOCUS_32430 12568 13965 gene locus_tag LOCUS_32440 12568 13965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 14231 14920 gene locus_tag LOCUS_32450 14231 14920 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_32450 15032 15832 gene locus_tag LOCUS_32460 15032 15832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 15905 16076 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence131 298 361 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 370 1101 gene locus_tag LOCUS_32470 370 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 1117 1336 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1610 1392 gene locus_tag LOCUS_32480 gene csrA 1610 1392 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219727.1 protein_id gnl|my_center|LOCUS_32480 1863 1970 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2430 2032 gene locus_tag LOCUS_32490 2430 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 2436 2552 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2829 3041 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3280 3442 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5263 5760 gene locus_tag LOCUS_32500 5263 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 7004 5796 gene locus_tag LOCUS_32510 7004 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 7452 7742 gene locus_tag LOCUS_32520 gene rpsT 7452 7742 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326150.1 protein_id gnl|my_center|LOCUS_32520 7914 8339 gene locus_tag LOCUS_32530 7914 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 8444 9229 gene locus_tag LOCUS_32540 8444 9229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 10613 9315 gene locus_tag LOCUS_32550 10613 9315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 12205 10628 gene locus_tag LOCUS_32560 12205 10628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 12506 13411 gene locus_tag LOCUS_32570 gene map 12506 13411 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328287.1 protein_id gnl|my_center|LOCUS_32570 13624 14592 gene locus_tag LOCUS_32580 13624 14592 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324266.1 protein_id gnl|my_center|LOCUS_32580 14963 16108 gene locus_tag LOCUS_32590 14963 16108 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_32590 16169 16325 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence132 856 782 gene locus_tag LOCUS_t00160 856 782 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2010 922 gene locus_tag LOCUS_32600 2010 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 2814 2179 gene locus_tag LOCUS_32610 2814 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 3351 2878 gene locus_tag LOCUS_32620 3351 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 4036 3314 gene locus_tag LOCUS_32630 4036 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 3360 3426 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4836 4249 gene locus_tag LOCUS_32640 4836 4249 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812221.1 protein_id gnl|my_center|LOCUS_32640 5660 4863 gene locus_tag LOCUS_32650 5660 4863 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667138.1 protein_id gnl|my_center|LOCUS_32650 5997 5782 gene locus_tag LOCUS_32660 5997 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 5984 7498 gene locus_tag LOCUS_32670 5984 7498 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427734.1 protein_id gnl|my_center|LOCUS_32670 7691 8575 gene locus_tag LOCUS_32680 gene mmuM 7691 8575 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246467.1 protein_id gnl|my_center|LOCUS_32680 9129 14021 gene locus_tag LOCUS_32690 9129 14021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 14773 14889 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14903 15838 gene locus_tag LOCUS_32700 14903 15838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 15862 15956 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence133 1047 1120 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1294 2583 gene locus_tag LOCUS_32710 1294 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 2713 2968 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3281 4384 gene locus_tag LOCUS_32720 3281 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 4443 5522 gene locus_tag LOCUS_32730 4443 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 5602 5780 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5864 6925 gene locus_tag LOCUS_32740 5864 6925 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615657.1 protein_id gnl|my_center|LOCUS_32740 7687 6989 gene locus_tag LOCUS_32750 7687 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 7762 7875 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9483 8815 gene locus_tag LOCUS_32760 9483 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 9643 9807 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11169 9892 gene locus_tag LOCUS_32770 11169 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 11382 11723 gene locus_tag LOCUS_32780 11382 11723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32780 11740 11970 gene locus_tag LOCUS_32790 11740 11970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 11977 12171 gene locus_tag LOCUS_32800 11977 12171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 13608 12415 gene locus_tag LOCUS_32810 13608 12415 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922962.1 protein_id gnl|my_center|LOCUS_32810 13623 13746 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16229 13914 gene locus_tag LOCUS_32820 16229 13914 CDS product PA14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122548.1 protein_id gnl|my_center|LOCUS_32820 >Feature sequence134 4670 252 gene locus_tag LOCUS_32830 4670 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 6660 5347 gene locus_tag LOCUS_32840 6660 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 7969 6707 gene locus_tag LOCUS_32850 7969 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 9704 8148 gene locus_tag LOCUS_32860 gene dnaK 9704 8148 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101636.1 protein_id gnl|my_center|LOCUS_32860 8808 8863 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13447 9875 gene locus_tag LOCUS_32870 13447 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 14007 13657 gene locus_tag LOCUS_32880 14007 13657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 15503 15144 gene locus_tag LOCUS_32890 15503 15144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 16161 15544 gene locus_tag LOCUS_32900 16161 15544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 >Feature sequence135 602 1240 gene locus_tag LOCUS_32910 602 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 2292 1837 gene locus_tag LOCUS_32920 2292 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 2969 3120 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4277 3546 gene locus_tag LOCUS_32930 4277 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 4408 4941 gene locus_tag LOCUS_32940 4408 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 5139 5199 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5762 5895 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6170 6260 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6576 7967 gene locus_tag LOCUS_32950 6576 7967 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615810.1 protein_id gnl|my_center|LOCUS_32950 8132 9955 gene locus_tag LOCUS_32960 8132 9955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 10935 11124 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11347 11493 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11502 11804 gene locus_tag LOCUS_32970 11502 11804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 11877 12051 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12958 13992 gene locus_tag LOCUS_32980 12958 13992 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261424.1 protein_id gnl|my_center|LOCUS_32980 14900 14094 gene locus_tag LOCUS_32990 14900 14094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 15170 15895 gene locus_tag LOCUS_33000 15170 15895 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122175.1 protein_id gnl|my_center|LOCUS_33000 >Feature sequence136 313 461 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 711 1133 gene locus_tag LOCUS_33010 711 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 1760 3007 gene locus_tag LOCUS_33020 1760 3007 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_33020 3165 4178 gene locus_tag LOCUS_33030 3165 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 5609 4194 gene locus_tag LOCUS_33040 5609 4194 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123577.1 protein_id gnl|my_center|LOCUS_33040 6696 5920 gene locus_tag LOCUS_33050 6696 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 6793 6953 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8344 9036 gene locus_tag LOCUS_33060 gene tsaB 8344 9036 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546261.1 protein_id gnl|my_center|LOCUS_33060 9632 9051 gene locus_tag LOCUS_33070 9632 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 10329 9688 gene locus_tag LOCUS_33080 10329 9688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 10491 11498 gene locus_tag LOCUS_33090 10491 11498 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327113.1 protein_id gnl|my_center|LOCUS_33090 12903 11581 gene locus_tag LOCUS_33100 12903 11581 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339900.1 protein_id gnl|my_center|LOCUS_33100 13192 14661 gene locus_tag LOCUS_33110 13192 14661 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119613.1 protein_id gnl|my_center|LOCUS_33110 14932 15417 gene locus_tag LOCUS_33120 14932 15417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 15454 15948 gene locus_tag LOCUS_33130 15454 15948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 15953 16050 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence137 1267 272 gene locus_tag LOCUS_33140 1267 272 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208809.1 protein_id gnl|my_center|LOCUS_33140 2846 1578 gene locus_tag LOCUS_33150 2846 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 3135 2914 gene locus_tag LOCUS_33160 3135 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 5242 4325 gene locus_tag LOCUS_33170 5242 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 5376 5891 gene locus_tag LOCUS_33180 5376 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 6303 6566 gene locus_tag LOCUS_33190 6303 6566 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038339.1 protein_id gnl|my_center|LOCUS_33190 6780 7847 gene locus_tag LOCUS_33200 gene prfA 6780 7847 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328933.1 protein_id gnl|my_center|LOCUS_33200 7984 8889 gene locus_tag LOCUS_33210 gene prmC 7984 8889 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122233.1 protein_id gnl|my_center|LOCUS_33210 8959 9068 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9488 9618 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9963 10135 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10162 10704 gene locus_tag LOCUS_33220 10162 10704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 10774 10888 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11283 12998 gene locus_tag LOCUS_33230 gene aspS 11283 12998 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121776.1 protein_id gnl|my_center|LOCUS_33230 13171 13530 gene locus_tag LOCUS_33240 13171 13530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 13828 13556 gene locus_tag LOCUS_33250 13828 13556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_33250 14040 13828 gene locus_tag LOCUS_33260 14040 13828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 14907 14143 gene locus_tag LOCUS_33270 14907 14143 CDS product protocatechuate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922892.1 protein_id gnl|my_center|LOCUS_33270 15693 15778 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence138 134 416 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 619 895 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1250 1074 gene locus_tag LOCUS_33280 1250 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 1534 1229 gene locus_tag LOCUS_33290 1534 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 2021 1713 gene locus_tag LOCUS_33300 2021 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 4984 3128 gene locus_tag LOCUS_33310 4984 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 7296 5431 gene locus_tag LOCUS_33320 7296 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 7298 7369 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8584 7919 gene locus_tag LOCUS_33330 8584 7919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 8722 8823 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9935 10130 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10365 10534 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12910 13119 gene locus_tag LOCUS_33340 12910 13119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 13138 13314 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13524 13682 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14613 14711 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15305 15448 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence139 2455 1028 gene locus_tag LOCUS_33350 2455 1028 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921402.1 protein_id gnl|my_center|LOCUS_33350 2993 3688 gene locus_tag LOCUS_33360 2993 3688 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 protein_id gnl|my_center|LOCUS_33360 5114 4206 gene locus_tag LOCUS_33370 5114 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 5934 5362 gene locus_tag LOCUS_33380 5934 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 5960 6065 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6638 6764 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7722 7117 gene locus_tag LOCUS_33390 7722 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 8915 7770 gene locus_tag LOCUS_33400 8915 7770 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122678.1 protein_id gnl|my_center|LOCUS_33400 9512 9159 gene locus_tag LOCUS_33410 9512 9159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 10182 10248 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10735 12033 gene locus_tag LOCUS_33420 10735 12033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 12201 12632 gene locus_tag LOCUS_33430 12201 12632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 12690 13637 gene locus_tag LOCUS_33440 12690 13637 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337669.1 protein_id gnl|my_center|LOCUS_33440 13765 15159 gene locus_tag LOCUS_33450 13765 15159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 15741 15250 gene locus_tag LOCUS_33460 15741 15250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 >Feature sequence140 320 417 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 835 946 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 988 1539 gene locus_tag LOCUS_33470 988 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 1628 1735 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3479 1845 gene locus_tag LOCUS_33480 3479 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 3542 3628 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4061 4239 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4662 4835 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5526 5712 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6192 6440 gene locus_tag LOCUS_33490 6192 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 6512 6598 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7400 7550 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7683 9242 gene locus_tag LOCUS_33500 7683 9242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 8855 8905 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9268 9425 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10094 9636 gene locus_tag LOCUS_33510 10094 9636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 10346 10110 gene locus_tag LOCUS_33520 10346 10110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 11815 10628 gene locus_tag LOCUS_33530 11815 10628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 12344 11805 gene locus_tag LOCUS_33540 12344 11805 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921996.1 protein_id gnl|my_center|LOCUS_33540 13609 12566 gene locus_tag LOCUS_33550 13609 12566 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203529.1 protein_id gnl|my_center|LOCUS_33550 14028 14212 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15554 14244 gene locus_tag LOCUS_33560 gene xylA 15554 14244 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118969.1 protein_id gnl|my_center|LOCUS_33560 >Feature sequence141 153 731 gene locus_tag LOCUS_33570 gene def 153 731 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324462.1 protein_id gnl|my_center|LOCUS_33570 1234 1340 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2475 2593 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3230 3435 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3786 3886 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3979 4461 gene locus_tag LOCUS_33580 3979 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 4597 7080 gene locus_tag LOCUS_33590 4597 7080 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037247075.1 protein_id gnl|my_center|LOCUS_33590 7129 7229 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7324 8769 gene locus_tag LOCUS_33600 7324 8769 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120117.1 protein_id gnl|my_center|LOCUS_33600 9032 10507 gene locus_tag LOCUS_33610 9032 10507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 10520 11575 gene locus_tag LOCUS_33620 10520 11575 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331752.1 protein_id gnl|my_center|LOCUS_33620 12609 11707 gene locus_tag LOCUS_33630 12609 11707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 14480 13086 gene locus_tag LOCUS_33640 14480 13086 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_33640 14915 14541 gene locus_tag LOCUS_33650 14915 14541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 15508 14972 gene locus_tag LOCUS_33660 15508 14972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 15532 15660 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence142 219 393 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 822 951 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1270 1399 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1567 2892 gene locus_tag LOCUS_33670 1567 2892 CDS product putative sugar nucleotidyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256908.1 protein_id gnl|my_center|LOCUS_33670 2361 2462 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3276 3368 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3379 4392 gene locus_tag LOCUS_33680 3379 4392 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_33680 4954 4547 gene locus_tag LOCUS_33690 4954 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 6046 5015 gene locus_tag LOCUS_33700 6046 5015 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615947.1 protein_id gnl|my_center|LOCUS_33700 6208 6768 gene locus_tag LOCUS_33710 gene pyrE 6208 6768 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846080.1 protein_id gnl|my_center|LOCUS_33710 7026 8342 gene locus_tag LOCUS_33720 7026 8342 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676943.1 protein_id gnl|my_center|LOCUS_33720 9469 8555 gene locus_tag LOCUS_33730 9469 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 11595 9532 gene locus_tag LOCUS_33740 11595 9532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 10715 10804 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11637 11728 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12512 11805 gene locus_tag LOCUS_33750 12512 11805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 12629 12769 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13690 12896 gene locus_tag LOCUS_33760 13690 12896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 14317 14084 gene locus_tag LOCUS_33770 14317 14084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 15380 15511 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence143 532 29 gene locus_tag LOCUS_33780 532 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 622 793 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2990 3137 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3167 5104 gene locus_tag LOCUS_33790 3167 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 7293 5389 gene locus_tag LOCUS_33800 7293 5389 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119431.1 protein_id gnl|my_center|LOCUS_33800 7741 8709 gene locus_tag LOCUS_33810 7741 8709 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616218.1 protein_id gnl|my_center|LOCUS_33810 8811 9866 gene locus_tag LOCUS_33820 8811 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 10708 10854 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11369 10881 gene locus_tag LOCUS_33830 gene lptE 11369 10881 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119987.1 protein_id gnl|my_center|LOCUS_33830 13100 11505 gene locus_tag LOCUS_33840 13100 11505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 13494 13279 gene locus_tag LOCUS_33850 13494 13279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 13508 13596 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13946 14137 gene locus_tag LOCUS_33860 13946 14137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 14439 14540 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15420 15498 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence144 1833 166 gene locus_tag LOCUS_33870 1833 166 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667792.1 protein_id gnl|my_center|LOCUS_33870 3575 2091 gene locus_tag LOCUS_33880 3575 2091 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140024.1 protein_id gnl|my_center|LOCUS_33880 5700 3568 gene locus_tag LOCUS_33890 5700 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 8499 5890 gene locus_tag LOCUS_33900 8499 5890 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667788.1 protein_id gnl|my_center|LOCUS_33900 10127 8556 gene locus_tag LOCUS_33910 10127 8556 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921384.1 protein_id gnl|my_center|LOCUS_33910 10324 10809 gene locus_tag LOCUS_33920 10324 10809 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118223.1 protein_id gnl|my_center|LOCUS_33920 10806 11000 gene locus_tag LOCUS_33930 10806 11000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 12696 11071 gene locus_tag LOCUS_33940 12696 11071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 13190 12693 gene locus_tag LOCUS_33950 13190 12693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 14372 13296 gene locus_tag LOCUS_33960 14372 13296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 14492 14611 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <15484 14952 gene locus_tag LOCUS_33970 <15484 14952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008666047.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence145 1071 760 gene locus_tag LOCUS_33980 gene fliN 1071 760 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089739.1 protein_id gnl|my_center|LOCUS_33980 1741 1968 gene locus_tag LOCUS_33990 1741 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 2136 2405 gene locus_tag LOCUS_34000 2136 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 2802 2509 gene locus_tag LOCUS_34010 2802 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 4751 2868 gene locus_tag LOCUS_34020 4751 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 5902 7110 gene locus_tag LOCUS_34030 5902 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 7579 7214 gene locus_tag LOCUS_34040 7579 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 8265 7894 gene locus_tag LOCUS_34050 8265 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 9176 9320 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9427 9594 gene locus_tag LOCUS_34060 9427 9594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 10312 9833 gene locus_tag LOCUS_34070 10312 9833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 10790 10368 gene locus_tag LOCUS_34080 10790 10368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 10857 11001 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11036 11275 gene locus_tag LOCUS_34090 11036 11275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 11515 11439 gene locus_tag LOCUS_t00170 11515 11439 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11556 11735 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12479 12159 gene locus_tag LOCUS_34100 12479 12159 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_34100 13124 12768 gene locus_tag LOCUS_34110 13124 12768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 13362 13442 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14363 15334 gene locus_tag LOCUS_34120 gene hemC 14363 15334 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260939.1 protein_id gnl|my_center|LOCUS_34120 >Feature sequence146 415 161 gene locus_tag LOCUS_34130 415 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 449 573 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2088 1057 gene locus_tag LOCUS_34140 2088 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 3008 2082 gene locus_tag LOCUS_34150 3008 2082 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263515.1 protein_id gnl|my_center|LOCUS_34150 3409 3005 gene locus_tag LOCUS_34160 3409 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 3498 3637 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5001 4108 gene locus_tag LOCUS_34170 5001 4108 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120923.1 protein_id gnl|my_center|LOCUS_34170 6166 5114 gene locus_tag LOCUS_34180 6166 5114 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_34180 7523 6519 gene locus_tag LOCUS_34190 7523 6519 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123048.1 protein_id gnl|my_center|LOCUS_34190 7688 9367 gene locus_tag LOCUS_34200 7688 9367 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920950.1 protein_id gnl|my_center|LOCUS_34200 9503 11770 gene locus_tag LOCUS_34210 9503 11770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 12274 15201 gene locus_tag LOCUS_34220 gene ppc 12274 15201 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_34220 12613 12814 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence147 203 450 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 642 838 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1100 1399 gene locus_tag LOCUS_34230 1100 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 1757 1410 gene locus_tag LOCUS_34240 1757 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 2131 3561 gene locus_tag LOCUS_34250 2131 3561 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_34250 3798 4814 gene locus_tag LOCUS_34260 3798 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 4911 5993 gene locus_tag LOCUS_34270 4911 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 6816 6172 gene locus_tag LOCUS_34280 6816 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 7532 6954 gene locus_tag LOCUS_34290 7532 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 8064 9269 gene locus_tag LOCUS_34300 8064 9269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 9318 9815 gene locus_tag LOCUS_34310 9318 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 10410 12020 gene locus_tag LOCUS_34320 10410 12020 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921618.1 protein_id gnl|my_center|LOCUS_34320 12050 12940 gene locus_tag LOCUS_34330 12050 12940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 13057 14763 gene locus_tag LOCUS_34340 13057 14763 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921498.1 protein_id gnl|my_center|LOCUS_34340 13110 13240 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15300 14797 gene locus_tag LOCUS_34350 15300 14797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 >Feature sequence148 1134 1195 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1970 3121 gene locus_tag LOCUS_34360 1970 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 4270 3116 gene locus_tag LOCUS_34370 gene mnmA 4270 3116 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120981.1 protein_id gnl|my_center|LOCUS_34370 4661 4410 gene locus_tag LOCUS_34380 4661 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 6227 8797 gene locus_tag LOCUS_34390 6227 8797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 9064 9693 gene locus_tag LOCUS_34400 9064 9693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 10016 9690 gene locus_tag LOCUS_34410 10016 9690 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945958.1 protein_id gnl|my_center|LOCUS_34410 10449 13343 gene locus_tag LOCUS_34420 10449 13343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 13614 15302 gene locus_tag LOCUS_34430 13614 15302 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_34430 >Feature sequence149 245 3685 gene locus_tag LOCUS_34440 245 3685 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121181.1 protein_id gnl|my_center|LOCUS_34440 3509 3680 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6333 3898 gene locus_tag LOCUS_34450 6333 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 7306 6380 gene locus_tag LOCUS_34460 gene thiL 7306 6380 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121111.1 protein_id gnl|my_center|LOCUS_34460 7378 8799 gene locus_tag LOCUS_34470 7378 8799 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140350.1 protein_id gnl|my_center|LOCUS_34470 9588 9759 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10203 9835 gene locus_tag LOCUS_34480 10203 9835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 10117 12585 gene locus_tag LOCUS_34490 10117 12585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 12706 12818 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13062 13880 gene locus_tag LOCUS_34500 13062 13880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34500 >Feature sequence150 897 19 gene locus_tag LOCUS_34510 897 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 2417 1089 gene locus_tag LOCUS_34520 2417 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 3477 2740 gene locus_tag LOCUS_34530 3477 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 4485 3760 gene locus_tag LOCUS_34540 4485 3760 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325025.1 protein_id gnl|my_center|LOCUS_34540 4722 7211 gene locus_tag LOCUS_34550 4722 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 7040 7207 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7387 8883 gene locus_tag LOCUS_34560 7387 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 9005 9379 gene locus_tag LOCUS_34570 9005 9379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 10603 9638 gene locus_tag LOCUS_34580 10603 9638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 10827 11612 gene locus_tag LOCUS_34590 10827 11612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 11747 11934 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12302 12389 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12656 14062 gene locus_tag LOCUS_34600 12656 14062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 15068 14079 gene locus_tag LOCUS_34610 gene tilS 15068 14079 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615481.1 protein_id gnl|my_center|LOCUS_34610 >Feature sequence151 169 372 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 770 864 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1589 1896 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2104 2336 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3016 3217 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3592 3722 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4728 4918 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5136 5286 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6211 5381 gene locus_tag LOCUS_34620 6211 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 6648 7373 gene locus_tag LOCUS_34630 6648 7373 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326459.1 protein_id gnl|my_center|LOCUS_34630 7538 7669 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8593 8880 gene locus_tag LOCUS_34640 8593 8880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 10413 9211 gene locus_tag LOCUS_34650 10413 9211 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190627.1 protein_id gnl|my_center|LOCUS_34650 11569 11186 gene locus_tag LOCUS_34660 11569 11186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 12319 11969 gene locus_tag LOCUS_34670 12319 11969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 12546 12328 gene locus_tag LOCUS_34680 12546 12328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 14308 12857 gene locus_tag LOCUS_34690 14308 12857 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615810.1 protein_id gnl|my_center|LOCUS_34690 14442 14581 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence152 1314 1622 gene locus_tag LOCUS_34700 1314 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 1917 1832 gene locus_tag LOCUS_t00180 1917 1832 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2211 4286 gene locus_tag LOCUS_34710 2211 4286 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_34710 5195 4380 gene locus_tag LOCUS_34720 5195 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 6761 5418 gene locus_tag LOCUS_34730 6761 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 6795 6904 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8512 7496 gene locus_tag LOCUS_34740 8512 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 7507 7569 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8626 8725 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10760 8979 gene locus_tag LOCUS_34750 10760 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 11174 10878 gene locus_tag LOCUS_34760 11174 10878 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329447.1 protein_id gnl|my_center|LOCUS_34760 12828 13017 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14190 14310 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14368 14712 gene locus_tag LOCUS_34770 14368 14712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 >Feature sequence153 1119 127 gene locus_tag LOCUS_34780 1119 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 1410 1572 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1989 1657 gene locus_tag LOCUS_34790 1989 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 2068 2219 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2905 2684 gene locus_tag LOCUS_34800 2905 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 3047 3172 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7750 3509 gene locus_tag LOCUS_34810 7750 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 4966 5010 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8638 7856 gene locus_tag LOCUS_34820 8638 7856 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_34820 9042 10019 gene locus_tag LOCUS_34830 9042 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 10117 13731 gene locus_tag LOCUS_34840 10117 13731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 14190 13807 gene locus_tag LOCUS_34850 14190 13807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 14550 14209 gene locus_tag LOCUS_34860 14550 14209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34860 >Feature sequence154 138 407 gene locus_tag LOCUS_34870 138 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 1443 1045 gene locus_tag LOCUS_34880 1443 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 2350 1577 gene locus_tag LOCUS_34890 2350 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 4028 2394 gene locus_tag LOCUS_34900 4028 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 5209 4085 gene locus_tag LOCUS_34910 5209 4085 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921506.1 protein_id gnl|my_center|LOCUS_34910 6124 6915 gene locus_tag LOCUS_34920 gene rlmB 6124 6915 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399684.1 protein_id gnl|my_center|LOCUS_34920 8557 6950 gene locus_tag LOCUS_34930 8557 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 8707 8883 gene locus_tag LOCUS_34940 8707 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 9095 8889 gene locus_tag LOCUS_34950 9095 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 9015 9365 gene locus_tag LOCUS_34960 9015 9365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 9592 10713 gene locus_tag LOCUS_34970 9592 10713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 10988 11177 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11486 11634 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11916 11758 gene locus_tag LOCUS_34980 11916 11758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 12075 12157 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12713 12252 gene locus_tag LOCUS_34990 12713 12252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 13020 12832 gene locus_tag LOCUS_35000 13020 12832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 13336 13124 gene locus_tag LOCUS_35010 13336 13124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 14095 14323 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence155 215 1771 gene locus_tag LOCUS_35020 215 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 1870 4980 gene locus_tag LOCUS_35030 1870 4980 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615874.1 protein_id gnl|my_center|LOCUS_35030 6591 5170 gene locus_tag LOCUS_35040 6591 5170 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123376.1 protein_id gnl|my_center|LOCUS_35040 7601 6576 gene locus_tag LOCUS_35050 7601 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 8457 9752 gene locus_tag LOCUS_35060 8457 9752 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_35060 9815 11959 gene locus_tag LOCUS_35070 9815 11959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 12028 14307 gene locus_tag LOCUS_35080 12028 14307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 >Feature sequence156 517 11 gene locus_tag LOCUS_35090 517 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 1682 771 gene locus_tag LOCUS_35100 1682 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 1896 2034 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2215 2757 gene locus_tag LOCUS_35110 2215 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 3019 3531 gene locus_tag LOCUS_35120 3019 3531 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531462.1 protein_id gnl|my_center|LOCUS_35120 5338 3836 gene locus_tag LOCUS_35130 5338 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 5650 6147 gene locus_tag LOCUS_35140 5650 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 7972 6506 gene locus_tag LOCUS_35150 7972 6506 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122596.1 protein_id gnl|my_center|LOCUS_35150 11305 7979 gene locus_tag LOCUS_35160 11305 7979 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_35160 8879 9011 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12658 12275 gene locus_tag LOCUS_35170 12658 12275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 12886 12689 gene locus_tag LOCUS_35180 12886 12689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 13641 13760 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence157 253 624 gene locus_tag LOCUS_35190 gene rpsL 253 624 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_35190 687 1160 gene locus_tag LOCUS_35200 gene rpsG 687 1160 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326864.1 protein_id gnl|my_center|LOCUS_35200 1304 1684 gene locus_tag LOCUS_35210 1304 1684 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943630.1 protein_id gnl|my_center|LOCUS_35210 1806 2507 gene locus_tag LOCUS_35220 1806 2507 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122007.1 protein_id gnl|my_center|LOCUS_35220 2526 4115 gene locus_tag LOCUS_35230 2526 4115 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_35230 4115 5020 gene locus_tag LOCUS_35240 4115 5020 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122009.1 protein_id gnl|my_center|LOCUS_35240 5061 7019 gene locus_tag LOCUS_35250 5061 7019 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615420.1 protein_id gnl|my_center|LOCUS_35250 7704 7859 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8751 8269 gene locus_tag LOCUS_35260 8751 8269 CDS product YfbM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061753.1 protein_id gnl|my_center|LOCUS_35260 8752 8886 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9507 9434 gene locus_tag LOCUS_t00190 9507 9434 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9660 10490 gene locus_tag LOCUS_35270 9660 10490 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_35270 11235 11345 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11388 11930 gene locus_tag LOCUS_35280 11388 11930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 13081 12014 gene locus_tag LOCUS_35290 13081 12014 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140702.1 protein_id gnl|my_center|LOCUS_35290 13872 13078 gene locus_tag LOCUS_35300 13872 13078 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_35300 >Feature sequence158 1574 210 gene locus_tag LOCUS_35310 1574 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 2350 1607 gene locus_tag LOCUS_35320 2350 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 2634 2374 gene locus_tag LOCUS_35330 2634 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35330 3962 3228 gene locus_tag LOCUS_35340 3962 3228 CDS product IS5-like element ISMac15 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065538.1 protein_id gnl|my_center|LOCUS_35340 7947 4330 gene locus_tag LOCUS_35350 7947 4330 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814813.1 protein_id gnl|my_center|LOCUS_35350 7978 8100 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8883 9007 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11287 9383 gene locus_tag LOCUS_35360 11287 9383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 12267 11446 gene locus_tag LOCUS_35370 12267 11446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 12278 12381 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13936 12383 gene locus_tag LOCUS_35380 13936 12383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 >Feature sequence159 509 608 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1116 1256 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1343 1789 gene locus_tag LOCUS_35390 1343 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 1954 2331 gene locus_tag LOCUS_35400 1954 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 2470 2595 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2711 3181 gene locus_tag LOCUS_35410 2711 3181 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_35410 3571 3891 gene locus_tag LOCUS_35420 3571 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 4873 3962 gene locus_tag LOCUS_35430 4873 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 4984 5080 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6076 6206 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6264 7043 gene locus_tag LOCUS_35440 6264 7043 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_35440 7078 8001 gene locus_tag LOCUS_35450 gene ptb 7078 8001 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357252.1 protein_id gnl|my_center|LOCUS_35450 8026 8442 gene locus_tag LOCUS_35460 8026 8442 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455485.1 protein_id gnl|my_center|LOCUS_35460 12271 8465 gene locus_tag LOCUS_35470 12271 8465 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921330.1 protein_id gnl|my_center|LOCUS_35470 13528 12617 gene locus_tag LOCUS_35480 13528 12617 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141082.1 protein_id gnl|my_center|LOCUS_35480 13794 13513 gene locus_tag LOCUS_35490 13794 13513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35490 >Feature sequence160 170 262 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 802 338 gene locus_tag LOCUS_35500 802 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 931 1045 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1938 1741 gene locus_tag LOCUS_35510 1938 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 5222 2217 gene locus_tag LOCUS_35520 5222 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 5714 6325 gene locus_tag LOCUS_35530 5714 6325 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121917.1 protein_id gnl|my_center|LOCUS_35530 6849 6961 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6967 9993 gene locus_tag LOCUS_35540 6967 9993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 10451 11722 gene locus_tag LOCUS_35550 10451 11722 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113306.1 protein_id gnl|my_center|LOCUS_35550 12571 11873 gene locus_tag LOCUS_35560 12571 11873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 13092 12574 gene locus_tag LOCUS_35570 gene rpoE 13092 12574 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_35570 13199 13279 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence161 441 19 gene locus_tag LOCUS_35580 441 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 1498 473 gene locus_tag LOCUS_35590 1498 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 477 563 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1850 1958 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2127 3830 gene locus_tag LOCUS_35600 gene ilvD 2127 3830 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922486.1 protein_id gnl|my_center|LOCUS_35600 3820 4860 gene locus_tag LOCUS_35610 3820 4860 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241535.1 protein_id gnl|my_center|LOCUS_35610 5008 7122 gene locus_tag LOCUS_35620 5008 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 7153 7327 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8359 7367 gene locus_tag LOCUS_35630 8359 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 8412 8559 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8959 9927 gene locus_tag LOCUS_35640 8959 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 10555 11343 gene locus_tag LOCUS_35650 10555 11343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 11671 12942 gene locus_tag LOCUS_35660 11671 12942 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880955.1 protein_id gnl|my_center|LOCUS_35660 13248 13375 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence162 128 256 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1090 1239 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1263 1889 gene locus_tag LOCUS_35670 1263 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 1932 2291 gene locus_tag LOCUS_35680 1932 2291 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_35680 2318 3130 gene locus_tag LOCUS_35690 gene dinD 2318 3130 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297973.1 protein_id gnl|my_center|LOCUS_35690 3193 4254 gene locus_tag LOCUS_35700 3193 4254 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873440.1 protein_id gnl|my_center|LOCUS_35700 5782 4526 gene locus_tag LOCUS_35710 5782 4526 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122402.1 protein_id gnl|my_center|LOCUS_35710 6036 7802 gene locus_tag LOCUS_35720 6036 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 7954 9324 gene locus_tag LOCUS_35730 7954 9324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 9819 9891 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9987 10646 gene locus_tag LOCUS_35740 9987 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 10769 10939 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12030 11122 gene locus_tag LOCUS_35750 12030 11122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 12539 12093 gene locus_tag LOCUS_35760 12539 12093 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120861.1 protein_id gnl|my_center|LOCUS_35760 12571 12647 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13033 13527 gene locus_tag LOCUS_35770 13033 13527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 >Feature sequence163 623 1630 gene locus_tag LOCUS_35780 623 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 1872 2528 gene locus_tag LOCUS_35790 1872 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 2807 2971 gene locus_tag LOCUS_35800 2807 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 3332 4816 gene locus_tag LOCUS_35810 3332 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 6297 5041 gene locus_tag LOCUS_35820 6297 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 7625 6399 gene locus_tag LOCUS_35830 7625 6399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 7874 7686 gene locus_tag LOCUS_35840 7874 7686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 7961 9133 gene locus_tag LOCUS_35850 7961 9133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 10206 9181 gene locus_tag LOCUS_35860 10206 9181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 11028 10285 gene locus_tag LOCUS_35870 11028 10285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 11155 11310 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11577 11764 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11956 12152 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13073 13172 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence164 1830 784 gene locus_tag LOCUS_35880 1830 784 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061017.1 protein_id gnl|my_center|LOCUS_35880 2330 3586 gene locus_tag LOCUS_35890 2330 3586 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777076.1 protein_id gnl|my_center|LOCUS_35890 3831 4640 gene locus_tag LOCUS_35900 gene hisN 3831 4640 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927030.1 protein_id gnl|my_center|LOCUS_35900 4704 6236 gene locus_tag LOCUS_35910 4704 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 6086 6232 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6334 6867 gene locus_tag LOCUS_35920 6334 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 6926 7984 gene locus_tag LOCUS_35930 6926 7984 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975709.1 protein_id gnl|my_center|LOCUS_35930 8174 8518 gene locus_tag LOCUS_35940 8174 8518 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326696.1 protein_id gnl|my_center|LOCUS_35940 8561 9271 gene locus_tag LOCUS_35950 8561 9271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 9399 10670 gene locus_tag LOCUS_35960 9399 10670 CDS product Trx7/PDZ domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922213.1 protein_id gnl|my_center|LOCUS_35960 12269 10695 gene locus_tag LOCUS_35970 12269 10695 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_35970 13140 13310 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence165 2399 921 gene locus_tag LOCUS_35980 2399 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 3131 3769 gene locus_tag LOCUS_35990 3131 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 3897 5864 gene locus_tag LOCUS_36000 3897 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 6126 5902 gene locus_tag LOCUS_36010 6126 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 7400 7825 gene locus_tag LOCUS_36020 7400 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 8044 8868 gene locus_tag LOCUS_36030 8044 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 9161 10684 gene locus_tag LOCUS_36040 9161 10684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 10473 10603 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11086 11184 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11351 12958 gene locus_tag LOCUS_36050 11351 12958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 12071 12185 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13057 13211 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence166 764 102 gene locus_tag LOCUS_36060 764 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 988 2448 gene locus_tag LOCUS_36070 988 2448 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816379.1 protein_id gnl|my_center|LOCUS_36070 4544 2541 gene locus_tag LOCUS_36080 4544 2541 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119585.1 protein_id gnl|my_center|LOCUS_36080 5415 5254 gene locus_tag LOCUS_36090 5415 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 5398 7605 gene locus_tag LOCUS_36100 5398 7605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 7371 7544 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7599 8342 gene locus_tag LOCUS_36110 7599 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 8339 9787 gene locus_tag LOCUS_36120 8339 9787 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122596.1 protein_id gnl|my_center|LOCUS_36120 11135 9927 gene locus_tag LOCUS_36130 11135 9927 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121299.1 protein_id gnl|my_center|LOCUS_36130 12654 12766 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence167 2105 162 gene locus_tag LOCUS_36140 2105 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 3685 5607 gene locus_tag LOCUS_36150 3685 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 6312 6115 gene locus_tag LOCUS_36160 6312 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 7081 7803 gene locus_tag LOCUS_36170 7081 7803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 8924 9265 gene locus_tag LOCUS_36180 8924 9265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 9278 10447 gene locus_tag LOCUS_36190 9278 10447 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922784.1 protein_id gnl|my_center|LOCUS_36190 10508 11026 gene locus_tag LOCUS_36200 10508 11026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119839.1 protein_id gnl|my_center|LOCUS_36200 11027 12661 gene locus_tag LOCUS_36210 11027 12661 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119838.1 protein_id gnl|my_center|LOCUS_36210 >Feature sequence168 384 496 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1037 1235 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1263 2261 gene locus_tag LOCUS_36220 1263 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 2407 2500 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2842 2564 gene locus_tag LOCUS_36230 2842 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 2934 3079 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3955 4062 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6011 4536 gene locus_tag LOCUS_36240 6011 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 7046 6300 gene locus_tag LOCUS_36250 7046 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 7990 7058 gene locus_tag LOCUS_36260 7990 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 9173 8280 gene locus_tag LOCUS_36270 9173 8280 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427744.1 protein_id gnl|my_center|LOCUS_36270 10080 9412 gene locus_tag LOCUS_36280 10080 9412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 10599 10267 gene locus_tag LOCUS_36290 10599 10267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 10987 10670 gene locus_tag LOCUS_36300 10987 10670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 11052 11216 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12344 12928 gene locus_tag LOCUS_36310 12344 12928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 >Feature sequence169 1420 857 gene locus_tag LOCUS_36320 1420 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 1990 1574 gene locus_tag LOCUS_36330 1990 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 2215 1991 gene locus_tag LOCUS_36340 2215 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 3038 2673 gene locus_tag LOCUS_36350 3038 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 3037 3165 gene locus_tag LOCUS_36360 3037 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 3587 3336 gene locus_tag LOCUS_36370 3587 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36370 3803 3624 gene locus_tag LOCUS_36380 3803 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36380 6494 3948 gene locus_tag LOCUS_36390 6494 3948 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918869.1 protein_id gnl|my_center|LOCUS_36390 7174 6716 gene locus_tag LOCUS_36400 7174 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 8231 7248 gene locus_tag LOCUS_36410 8231 7248 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_36410 9709 8516 gene locus_tag LOCUS_36420 9709 8516 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324978.1 protein_id gnl|my_center|LOCUS_36420 10047 11360 gene locus_tag LOCUS_36430 10047 11360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 11414 12181 gene locus_tag LOCUS_36440 11414 12181 CDS product BPL-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336892.1 protein_id gnl|my_center|LOCUS_36440 12272 12997 gene locus_tag LOCUS_36450 12272 12997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 >Feature sequence170 306 433 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 810 979 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1345 3012 gene locus_tag LOCUS_36460 1345 3012 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324371.1 protein_id gnl|my_center|LOCUS_36460 2877 2970 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2978 3361 gene locus_tag LOCUS_36470 2978 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 3544 4401 gene locus_tag LOCUS_36480 3544 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 4684 6135 gene locus_tag LOCUS_36490 4684 6135 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_36490 6281 7318 gene locus_tag LOCUS_36500 6281 7318 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_36500 8728 7397 gene locus_tag LOCUS_36510 8728 7397 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123371.1 protein_id gnl|my_center|LOCUS_36510 8906 9072 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9436 9110 gene locus_tag LOCUS_36520 9436 9110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 9454 9611 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10348 10788 gene locus_tag LOCUS_36530 10348 10788 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_36530 11573 11747 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12211 12287 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <13118 12345 gene locus_tag LOCUS_36540 <13118 12345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120422.1:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence171 504 28 gene locus_tag LOCUS_36550 504 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 582 750 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1023 1076 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2539 2725 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3003 3179 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3310 4161 gene locus_tag LOCUS_36560 3310 4161 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_36560 4526 5296 gene locus_tag LOCUS_36570 4526 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 7413 5866 gene locus_tag LOCUS_36580 7413 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 8417 7707 gene locus_tag LOCUS_36590 8417 7707 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480398.1 protein_id gnl|my_center|LOCUS_36590 9491 8580 gene locus_tag LOCUS_36600 9491 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 9732 10778 gene locus_tag LOCUS_36610 9732 10778 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922462.1 protein_id gnl|my_center|LOCUS_36610 11100 11747 gene locus_tag LOCUS_36620 11100 11747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 12148 12219 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12568 12690 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence172 313 1551 gene locus_tag LOCUS_36630 313 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 1707 3029 gene locus_tag LOCUS_36640 1707 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 3040 4338 gene locus_tag LOCUS_36650 3040 4338 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120135.1 protein_id gnl|my_center|LOCUS_36650 5197 6306 gene locus_tag LOCUS_36660 5197 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 6852 7394 gene locus_tag LOCUS_36670 6852 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 7885 8397 gene locus_tag LOCUS_36680 7885 8397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 8614 8865 gene locus_tag LOCUS_36690 8614 8865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 9879 11072 gene locus_tag LOCUS_36700 9879 11072 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921573.1 protein_id gnl|my_center|LOCUS_36700 11345 11142 gene locus_tag LOCUS_36710 11345 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 12717 11485 gene locus_tag LOCUS_36720 12717 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 >Feature sequence173 1179 1934 gene locus_tag LOCUS_36730 1179 1934 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921816.1 protein_id gnl|my_center|LOCUS_36730 2644 3753 gene locus_tag LOCUS_36740 2644 3753 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065824.1 protein_id gnl|my_center|LOCUS_36740 4231 3815 gene locus_tag LOCUS_36750 4231 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 7247 4623 gene locus_tag LOCUS_36760 7247 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 7840 8337 gene locus_tag LOCUS_36770 gene ispF 7840 8337 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488386.1 protein_id gnl|my_center|LOCUS_36770 8347 8841 gene locus_tag LOCUS_36780 gene ruvC 8347 8841 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120029.1 protein_id gnl|my_center|LOCUS_36780 8885 9511 gene locus_tag LOCUS_36790 8885 9511 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326966.1 protein_id gnl|my_center|LOCUS_36790 9556 10548 gene locus_tag LOCUS_36800 9556 10548 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_36800 10733 11323 gene locus_tag LOCUS_36810 10733 11323 CDS product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296608.1 protein_id gnl|my_center|LOCUS_36810 11353 12081 gene locus_tag LOCUS_36820 11353 12081 CDS product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972295.1 protein_id gnl|my_center|LOCUS_36820 12398 12961 gene locus_tag LOCUS_36830 12398 12961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 >Feature sequence174 2999 48 gene locus_tag LOCUS_36840 2999 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 254 406 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3119 3310 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3623 3333 gene locus_tag LOCUS_36850 3623 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 3802 3973 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4059 4667 gene locus_tag LOCUS_36860 4059 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 4866 6311 gene locus_tag LOCUS_36870 4866 6311 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_36870 6403 6523 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6732 6910 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8708 8163 gene locus_tag LOCUS_36880 8708 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 8766 8915 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10640 9777 gene locus_tag LOCUS_36890 10640 9777 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255294.1 protein_id gnl|my_center|LOCUS_36890 10797 10990 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11528 11121 gene locus_tag LOCUS_36900 11528 11121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 11544 11667 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11889 12028 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12468 12637 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence175 875 2353 gene locus_tag LOCUS_36910 875 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 2773 3486 gene locus_tag LOCUS_36920 2773 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 3534 5006 gene locus_tag LOCUS_36930 3534 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 5162 5089 gene locus_tag LOCUS_t00200 5162 5089 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5498 5704 gene locus_tag LOCUS_36940 5498 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 5879 5670 gene locus_tag LOCUS_36950 5879 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 6738 8210 gene locus_tag LOCUS_36960 6738 8210 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963189.1 protein_id gnl|my_center|LOCUS_36960 8207 8917 gene locus_tag LOCUS_36970 8207 8917 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730515.1 protein_id gnl|my_center|LOCUS_36970 8883 9296 gene locus_tag LOCUS_36980 8883 9296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 9412 9780 gene locus_tag LOCUS_36990 9412 9780 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_36990 9792 10283 gene locus_tag LOCUS_37000 9792 10283 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271000.1 protein_id gnl|my_center|LOCUS_37000 11871 10288 gene locus_tag LOCUS_37010 11871 10288 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081614227.1 protein_id gnl|my_center|LOCUS_37010 12184 12114 gene locus_tag LOCUS_t00210 12184 12114 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence176 264 1562 gene locus_tag LOCUS_37020 264 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 2043 1699 gene locus_tag LOCUS_37030 2043 1699 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941930.1 protein_id gnl|my_center|LOCUS_37030 3355 2231 gene locus_tag LOCUS_37040 3355 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 4163 3444 gene locus_tag LOCUS_37050 4163 3444 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038927.1 protein_id gnl|my_center|LOCUS_37050 5115 4507 gene locus_tag LOCUS_37060 5115 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 5202 5303 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5442 6002 gene locus_tag LOCUS_37070 5442 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 6470 7288 gene locus_tag LOCUS_37080 6470 7288 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_37080 8029 7481 gene locus_tag LOCUS_37090 8029 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329453.1 protein_id gnl|my_center|LOCUS_37090 9776 8622 gene locus_tag LOCUS_37100 9776 8622 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329274.1 protein_id gnl|my_center|LOCUS_37100 10455 10922 gene locus_tag LOCUS_37110 10455 10922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 11137 12777 gene locus_tag LOCUS_37120 gene serA 11137 12777 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326392.1 protein_id gnl|my_center|LOCUS_37120 >Feature sequence177 454 722 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 767 1093 gene locus_tag LOCUS_37130 767 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 1160 1352 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2591 1578 gene locus_tag LOCUS_37140 2591 1578 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162996.1 protein_id gnl|my_center|LOCUS_37140 4232 2808 gene locus_tag LOCUS_37150 4232 2808 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_37150 4681 4794 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6898 4988 gene locus_tag LOCUS_37160 6898 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 7770 6895 gene locus_tag LOCUS_37170 7770 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 7796 7910 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8351 8646 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9685 9293 gene locus_tag LOCUS_37180 9685 9293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 9708 9797 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10305 10468 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11024 10599 gene locus_tag LOCUS_37190 11024 10599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 11135 11283 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11426 12664 gene locus_tag LOCUS_37200 11426 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 >Feature sequence178 362 958 gene locus_tag LOCUS_37210 362 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 2138 1032 gene locus_tag LOCUS_37220 2138 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 6360 2362 gene locus_tag LOCUS_37230 6360 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 8615 6354 gene locus_tag LOCUS_37240 8615 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 6372 6472 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence179 2473 1319 gene locus_tag LOCUS_37250 2473 1319 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122758.1 protein_id gnl|my_center|LOCUS_37250 2733 2957 gene locus_tag LOCUS_37260 2733 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 2954 5245 gene locus_tag LOCUS_37270 2954 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37270 5477 5588 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5635 7770 gene locus_tag LOCUS_37280 5635 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 7561 7716 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence180 1056 1193 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1248 1547 gene locus_tag LOCUS_37290 1248 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 1628 1872 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2960 1944 gene locus_tag LOCUS_37300 2960 1944 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667541.1 protein_id gnl|my_center|LOCUS_37300 2993 3126 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3708 4217 gene locus_tag LOCUS_37310 3708 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615841.1 protein_id gnl|my_center|LOCUS_37310 4274 6088 gene locus_tag LOCUS_37320 4274 6088 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123401.1 protein_id gnl|my_center|LOCUS_37320 6460 6125 gene locus_tag LOCUS_37330 6460 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 6598 6757 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7916 8578 gene locus_tag LOCUS_37340 7916 8578 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769285.1 protein_id gnl|my_center|LOCUS_37340 8708 10309 gene locus_tag LOCUS_37350 gene dhaS 8708 10309 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399332.1 protein_id gnl|my_center|LOCUS_37350 10070 10148 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10423 10567 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10823 11428 gene locus_tag LOCUS_37360 10823 11428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 11545 11748 gene locus_tag LOCUS_37370 11545 11748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 11859 12227 gene locus_tag LOCUS_37380 11859 12227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 >Feature sequence181 301 484 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 861 1022 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1857 1324 gene locus_tag LOCUS_37390 1857 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 1895 2020 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2281 2491 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4014 2875 gene locus_tag LOCUS_37400 4014 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921966.1 protein_id gnl|my_center|LOCUS_37400 4469 4251 gene locus_tag LOCUS_37410 4469 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 4839 4975 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5484 6989 gene locus_tag LOCUS_37420 gene hslU 5484 6989 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081401.1 protein_id gnl|my_center|LOCUS_37420 5819 5924 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7029 7297 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7451 8719 gene locus_tag LOCUS_37430 7451 8719 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921846.1 protein_id gnl|my_center|LOCUS_37430 9584 8721 gene locus_tag LOCUS_37440 9584 8721 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 protein_id gnl|my_center|LOCUS_37440 9812 10049 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10935 10090 gene locus_tag LOCUS_37450 10935 10090 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085059.1 protein_id gnl|my_center|LOCUS_37450 11034 11103 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11796 11347 gene locus_tag LOCUS_37460 11796 11347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 11797 11945 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence182 1256 1978 gene locus_tag LOCUS_37470 1256 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 2076 2414 gene locus_tag LOCUS_37480 2076 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 2465 3727 gene locus_tag LOCUS_37490 2465 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 3813 5495 gene locus_tag LOCUS_37500 3813 5495 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_37500 5710 5859 gene locus_tag LOCUS_37510 5710 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 7298 5892 gene locus_tag LOCUS_37520 7298 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 7509 7659 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8107 8201 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8245 8562 gene locus_tag LOCUS_37530 8245 8562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 8687 9904 gene locus_tag LOCUS_37540 8687 9904 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_37540 9574 9666 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9993 10172 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10417 11988 gene locus_tag LOCUS_37550 10417 11988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 >Feature sequence183 271 523 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 850 566 gene locus_tag LOCUS_37560 850 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 904 1076 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1496 1586 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3897 1972 gene locus_tag LOCUS_37570 3897 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 2055 2235 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4446 4054 gene locus_tag LOCUS_37580 4446 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 4842 6446 gene locus_tag LOCUS_37590 4842 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 7639 6500 gene locus_tag LOCUS_37600 7639 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 7973 8167 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8294 8532 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9927 8572 gene locus_tag LOCUS_37610 9927 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 11317 11475 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence184 199 364 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1016 1075 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3778 1112 gene locus_tag LOCUS_37620 3778 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 5647 4436 gene locus_tag LOCUS_37630 5647 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 9182 5889 gene locus_tag LOCUS_37640 gene mfd 9182 5889 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427773.1 protein_id gnl|my_center|LOCUS_37640 6447 6577 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9216 9390 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9706 9868 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9937 11031 gene locus_tag LOCUS_37650 9937 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682355.1 protein_id gnl|my_center|LOCUS_37650 >Feature sequence185 1896 247 gene locus_tag LOCUS_37660 1896 247 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122614.1 protein_id gnl|my_center|LOCUS_37660 2496 2032 gene locus_tag LOCUS_37670 2496 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 3403 2486 gene locus_tag LOCUS_37680 3403 2486 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615454.1 protein_id gnl|my_center|LOCUS_37680 3761 3940 gene locus_tag LOCUS_37690 3761 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 4778 4014 gene locus_tag LOCUS_37700 4778 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 5337 6830 gene locus_tag LOCUS_37710 5337 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 7016 7146 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7912 7280 gene locus_tag LOCUS_37720 7912 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 8271 8104 gene locus_tag LOCUS_37730 8271 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 8828 11671 gene locus_tag LOCUS_37740 gene gyrA 8828 11671 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922184.1 protein_id gnl|my_center|LOCUS_37740 >Feature sequence186 1988 168 gene locus_tag LOCUS_37750 1988 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 2562 4055 gene locus_tag LOCUS_37760 2562 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 5138 4095 gene locus_tag LOCUS_37770 5138 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 5745 5131 gene locus_tag LOCUS_37780 5745 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 9605 5745 gene locus_tag LOCUS_37790 9605 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 10889 9966 gene locus_tag LOCUS_37800 10889 9966 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505073.1 protein_id gnl|my_center|LOCUS_37800 >Feature sequence187 1993 80 gene locus_tag LOCUS_37810 1993 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 2526 2828 gene locus_tag LOCUS_37820 2526 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 3992 3072 gene locus_tag LOCUS_37830 3992 3072 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_37830 4167 4292 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4706 4806 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6099 5365 gene locus_tag LOCUS_37840 6099 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 6266 6460 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6630 6810 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7131 7211 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8684 7524 gene locus_tag LOCUS_37850 gene gdhA 8684 7524 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_37850 8690 8824 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9160 10782 gene locus_tag LOCUS_37860 9160 10782 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922119.1 protein_id gnl|my_center|LOCUS_37860 9786 9862 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11336 10845 gene locus_tag LOCUS_37870 11336 10845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 >Feature sequence188 160 383 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1197 445 gene locus_tag LOCUS_37880 gene lpxI 1197 445 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922990.1 protein_id gnl|my_center|LOCUS_37880 1261 1430 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2674 1574 gene locus_tag LOCUS_37890 gene lpxD 2674 1574 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922341.1 protein_id gnl|my_center|LOCUS_37890 4343 3294 gene locus_tag LOCUS_37900 gene thiF 4343 3294 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065417.1 protein_id gnl|my_center|LOCUS_37900 4644 4997 gene locus_tag LOCUS_37910 4644 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 5163 5729 gene locus_tag LOCUS_37920 5163 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 5726 5890 gene locus_tag LOCUS_37930 5726 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 6013 6876 gene locus_tag LOCUS_37940 6013 6876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 6037 6082 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7495 7569 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8535 8616 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8758 9618 gene locus_tag LOCUS_37950 8758 9618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 10598 10768 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10833 11111 gene locus_tag LOCUS_37960 10833 11111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 >Feature sequence189 206 286 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 853 972 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2257 1376 gene locus_tag LOCUS_37970 2257 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 2781 2251 gene locus_tag LOCUS_37980 2781 2251 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809919.1 protein_id gnl|my_center|LOCUS_37980 3105 2848 gene locus_tag LOCUS_37990 3105 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 3965 4180 gene locus_tag LOCUS_38000 3965 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 5453 5558 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8748 7336 gene locus_tag LOCUS_38010 8748 7336 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_38010 9501 9292 gene locus_tag LOCUS_38020 9501 9292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 >Feature sequence190 10 1236 gene locus_tag LOCUS_38030 gene ahcY 10 1236 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 protein_id gnl|my_center|LOCUS_38030 1541 1598 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2880 3052 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3512 4036 gene locus_tag LOCUS_38040 3512 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 5506 4160 gene locus_tag LOCUS_38050 5506 4160 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122601.1 protein_id gnl|my_center|LOCUS_38050 7314 5971 gene locus_tag LOCUS_38060 7314 5971 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122601.1 protein_id gnl|my_center|LOCUS_38060 9228 7747 gene locus_tag LOCUS_38070 9228 7747 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_38070 9713 9369 gene locus_tag LOCUS_38080 9713 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 10592 10770 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10778 11029 gene locus_tag LOCUS_38090 10778 11029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 >Feature sequence191 2073 43 gene locus_tag LOCUS_38100 2073 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 2544 2137 gene locus_tag LOCUS_38110 2544 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 2579 2723 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3131 3319 gene locus_tag LOCUS_38120 3131 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 3435 3561 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5049 3658 gene locus_tag LOCUS_38130 5049 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 5295 5424 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5628 5830 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6579 6715 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7123 7246 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7492 7621 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7690 8895 gene locus_tag LOCUS_38140 7690 8895 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169830.1 protein_id gnl|my_center|LOCUS_38140 9326 10444 gene locus_tag LOCUS_38150 9326 10444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38150 10602 10757 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence192 1087 1193 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1887 1627 gene locus_tag LOCUS_38160 1887 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 1977 2082 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2645 2211 gene locus_tag LOCUS_38170 2645 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 3578 2859 gene locus_tag LOCUS_38180 3578 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 5905 3608 gene locus_tag LOCUS_38190 5905 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 3902 3977 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6390 5929 gene locus_tag LOCUS_38200 6390 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 6750 6409 gene locus_tag LOCUS_38210 6750 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 7126 6935 gene locus_tag LOCUS_38220 7126 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 7448 7996 gene locus_tag LOCUS_38230 7448 7996 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331069.1 protein_id gnl|my_center|LOCUS_38230 8786 8883 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8906 9262 gene locus_tag LOCUS_38240 8906 9262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 9329 9634 gene locus_tag LOCUS_38250 9329 9634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 10203 10325 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10526 10676 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence193 6058 5189 gene locus_tag LOCUS_38260 6058 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 6830 6594 gene locus_tag LOCUS_38270 6830 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 6888 7107 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7608 7177 gene locus_tag LOCUS_38280 7608 7177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 7654 7768 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8106 7882 gene locus_tag LOCUS_38290 8106 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 8537 8103 gene locus_tag LOCUS_38300 8537 8103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 8999 8619 gene locus_tag LOCUS_38310 8999 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 10832 9075 gene locus_tag LOCUS_38320 10832 9075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 >Feature sequence194 <1 771 gene locus_tag LOCUS_38330 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119651.1:sodium:solute symporter family protein 949 1021 gene locus_tag LOCUS_t00220 949 1021 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3599 1296 gene locus_tag LOCUS_38340 3599 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 3685 3828 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4131 4258 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4776 6191 gene locus_tag LOCUS_38350 4776 6191 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615621.1 protein_id gnl|my_center|LOCUS_38350 7979 8150 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8390 8818 gene locus_tag LOCUS_38360 8390 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 9038 9337 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9833 9979 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence195 290 48 gene locus_tag LOCUS_38370 290 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 1649 777 gene locus_tag LOCUS_38380 1649 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 2611 1961 gene locus_tag LOCUS_38390 2611 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 3690 3810 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4042 4225 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4559 4703 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5181 5365 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5688 5845 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6593 6792 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7152 7269 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7846 7938 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8020 9354 gene locus_tag LOCUS_38400 8020 9354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 9724 10308 gene locus_tag LOCUS_38410 9724 10308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 10547 10723 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence196 146 386 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 775 1176 gene locus_tag LOCUS_38420 775 1176 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327186.1 protein_id gnl|my_center|LOCUS_38420 2068 1274 gene locus_tag LOCUS_38430 2068 1274 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942965.1 protein_id gnl|my_center|LOCUS_38430 2194 2333 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2643 2401 gene locus_tag LOCUS_38440 2643 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 2832 3028 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3276 3476 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3913 4069 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5082 6377 gene locus_tag LOCUS_38450 5082 6377 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615817.1 protein_id gnl|my_center|LOCUS_38450 6574 8541 gene locus_tag LOCUS_38460 6574 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 9125 8922 gene locus_tag LOCUS_38470 9125 8922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 10161 9664 gene locus_tag LOCUS_38480 10161 9664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 10362 10466 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence197 101 1033 gene locus_tag LOCUS_38490 101 1033 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335393.1 protein_id gnl|my_center|LOCUS_38490 1316 3259 gene locus_tag LOCUS_38500 1316 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 3507 4400 gene locus_tag LOCUS_38510 gene ispE 3507 4400 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772094.1 protein_id gnl|my_center|LOCUS_38510 4424 5095 gene locus_tag LOCUS_38520 4424 5095 CDS product SpoVG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122807.1 protein_id gnl|my_center|LOCUS_38520 7123 5348 gene locus_tag LOCUS_38530 7123 5348 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057111.1 protein_id gnl|my_center|LOCUS_38530 7349 8380 gene locus_tag LOCUS_38540 7349 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 8447 9883 gene locus_tag LOCUS_38550 gene rsmB 8447 9883 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460525.1 protein_id gnl|my_center|LOCUS_38550 9914 10002 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10405 10529 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence198 4117 2798 gene locus_tag LOCUS_38560 4117 2798 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_38560 5201 4191 gene locus_tag LOCUS_38570 5201 4191 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933029.1 protein_id gnl|my_center|LOCUS_38570 5274 5486 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7388 5586 gene locus_tag LOCUS_38580 7388 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 7555 7760 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9274 7787 gene locus_tag LOCUS_38590 9274 7787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 10263 9295 gene locus_tag LOCUS_38600 10263 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 >Feature sequence199 327 414 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1181 1317 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2034 1405 gene locus_tag LOCUS_38610 2034 1405 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142877.1 protein_id gnl|my_center|LOCUS_38610 2794 2993 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3323 3404 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3688 3856 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3993 5696 gene locus_tag LOCUS_38620 3993 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 5724 5946 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6141 7451 gene locus_tag LOCUS_38630 6141 7451 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922096.1 protein_id gnl|my_center|LOCUS_38630 7435 7902 gene locus_tag LOCUS_38640 7435 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 8100 8259 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8312 10219 gene locus_tag LOCUS_38650 gene asnB 8312 10219 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906399.1 protein_id gnl|my_center|LOCUS_38650 >Feature sequence200 421 1761 gene locus_tag LOCUS_38660 421 1761 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921564.1 protein_id gnl|my_center|LOCUS_38660 3492 1783 gene locus_tag LOCUS_38670 3492 1783 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332180.1 protein_id gnl|my_center|LOCUS_38670 7748 3807 gene locus_tag LOCUS_38680 gene hrpA 7748 3807 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072251.1 protein_id gnl|my_center|LOCUS_38680 8325 7888 gene locus_tag LOCUS_38690 8325 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 8369 8511 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <10709 9757 gene locus_tag LOCUS_38700 <10709 9757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007325434.1:TlpA disulfide reductase family protein >Feature sequence201 <1 843 gene locus_tag LOCUS_38710 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326816.1:preprotein translocase subunit SecY 1039 1827 gene locus_tag LOCUS_38720 gene map 1039 1827 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_38720 2576 2962 gene locus_tag LOCUS_38730 gene rpsM 2576 2962 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123828.1 protein_id gnl|my_center|LOCUS_38730 3132 3515 gene locus_tag LOCUS_38740 gene rpsK 3132 3515 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328401.1 protein_id gnl|my_center|LOCUS_38740 3615 4634 gene locus_tag LOCUS_38750 3615 4634 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328400.1 protein_id gnl|my_center|LOCUS_38750 4815 5504 gene locus_tag LOCUS_38760 4815 5504 CDS product L17 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123829.1 protein_id gnl|my_center|LOCUS_38760 7174 5654 gene locus_tag LOCUS_38770 gene cobA 7174 5654 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_38770 7549 9450 gene locus_tag LOCUS_38780 gene ilvB 7549 9450 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327661.1 protein_id gnl|my_center|LOCUS_38780 7946 8046 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9754 9854 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10387 10043 gene locus_tag LOCUS_38790 10387 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 >Feature sequence202 2 418 gene locus_tag LOCUS_38800 2 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 462 539 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 591 1982 gene locus_tag LOCUS_38810 591 1982 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921646.1 protein_id gnl|my_center|LOCUS_38810 2509 2006 gene locus_tag LOCUS_38820 2509 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 2698 2901 gene locus_tag LOCUS_38830 2698 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 2898 3248 gene locus_tag LOCUS_38840 2898 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 5317 3377 gene locus_tag LOCUS_38850 5317 3377 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123461.1 protein_id gnl|my_center|LOCUS_38850 5568 5314 gene locus_tag LOCUS_38860 5568 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 5801 6289 gene locus_tag LOCUS_38870 gene tsaE 5801 6289 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_38870 7069 7200 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7945 8150 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8510 10462 gene locus_tag LOCUS_38880 gene asnB 8510 10462 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976178.1 protein_id gnl|my_center|LOCUS_38880 >Feature sequence203 <1 927 gene locus_tag LOCUS_38890 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404993.1:TrkH family potassium uptake protein 960 1616 gene locus_tag LOCUS_38900 960 1616 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037344.1 protein_id gnl|my_center|LOCUS_38900 3400 1919 gene locus_tag LOCUS_38910 3400 1919 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922489.1 protein_id gnl|my_center|LOCUS_38910 4630 3593 gene locus_tag LOCUS_38920 4630 3593 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_38920 5177 5356 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7386 5386 gene locus_tag LOCUS_38930 7386 5386 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921313.1 protein_id gnl|my_center|LOCUS_38930 5583 5759 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8376 8089 gene locus_tag LOCUS_38940 8376 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 9174 8419 gene locus_tag LOCUS_38950 9174 8419 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090604.1 protein_id gnl|my_center|LOCUS_38950 9978 9265 gene locus_tag LOCUS_38960 9978 9265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 10006 10209 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence204 3561 259 gene locus_tag LOCUS_38970 gene rpoB 3561 259 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340662.1 protein_id gnl|my_center|LOCUS_38970 308 493 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4565 4080 gene locus_tag LOCUS_38980 gene rplL 4565 4080 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324459.1 protein_id gnl|my_center|LOCUS_38980 5186 4611 gene locus_tag LOCUS_38990 gene rplJ 5186 4611 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324458.1 protein_id gnl|my_center|LOCUS_38990 4929 4981 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5589 5269 gene locus_tag LOCUS_39000 5589 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 5880 6004 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6586 6161 gene locus_tag LOCUS_39010 gene rplK 6586 6161 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324993.1 protein_id gnl|my_center|LOCUS_39010 6902 6684 gene locus_tag LOCUS_39020 6902 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 6971 7118 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8143 7640 gene locus_tag LOCUS_39030 gene secE 8143 7640 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324991.1 protein_id gnl|my_center|LOCUS_39030 8229 8398 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8728 8573 gene locus_tag LOCUS_39040 gene rpmG 8728 8573 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556991.1 protein_id gnl|my_center|LOCUS_39040 9739 8930 gene locus_tag LOCUS_39050 9739 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 9778 9965 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence205 285 58 gene locus_tag LOCUS_39060 285 58 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966860.1 protein_id gnl|my_center|LOCUS_39060 772 275 gene locus_tag LOCUS_39070 772 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 911 1177 gene locus_tag LOCUS_39080 911 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 1209 1901 gene locus_tag LOCUS_39090 1209 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 3710 2166 gene locus_tag LOCUS_39100 3710 2166 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_39100 5161 5310 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5393 10090 gene locus_tag LOCUS_39110 5393 10090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 7063 7172 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence206 1379 3 gene locus_tag LOCUS_39120 1379 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121732.1 protein_id gnl|my_center|LOCUS_39120 1636 4074 gene locus_tag LOCUS_39130 1636 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 3922 4059 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4830 4968 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5500 5626 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5840 6781 gene locus_tag LOCUS_39140 5840 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 6820 6996 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7018 7221 gene locus_tag LOCUS_39150 7018 7221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 7240 8796 gene locus_tag LOCUS_39160 7240 8796 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921691.1 protein_id gnl|my_center|LOCUS_39160 9034 9106 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9756 9857 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence207 4179 1180 gene locus_tag LOCUS_39170 4179 1180 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146849598.1 protein_id gnl|my_center|LOCUS_39170 1191 1306 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4273 4442 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6099 4651 gene locus_tag LOCUS_39180 6099 4651 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_39180 7896 6166 gene locus_tag LOCUS_39190 7896 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 6727 6852 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8022 8136 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9518 9682 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10115 9882 gene locus_tag LOCUS_39200 10115 9882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 >Feature sequence208 787 362 gene locus_tag LOCUS_39210 787 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 2296 1313 gene locus_tag LOCUS_39220 2296 1313 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337669.1 protein_id gnl|my_center|LOCUS_39220 2752 2324 gene locus_tag LOCUS_39230 2752 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 4797 3178 gene locus_tag LOCUS_39240 4797 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 10068 4918 gene locus_tag LOCUS_39250 10068 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 >Feature sequence209 214 777 gene locus_tag LOCUS_39260 214 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 1924 1169 gene locus_tag LOCUS_39270 1924 1169 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672317.1 protein_id gnl|my_center|LOCUS_39270 2287 3159 gene locus_tag LOCUS_39280 gene rsmH 2287 3159 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_39280 3241 3438 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3585 5330 gene locus_tag LOCUS_39290 3585 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 5423 5614 gene locus_tag LOCUS_39300 5423 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 7171 7347 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7430 7663 gene locus_tag LOCUS_39310 7430 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 7708 7965 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8449 8027 gene locus_tag LOCUS_39320 8449 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 9165 9335 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9351 9680 gene locus_tag LOCUS_39330 9351 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 9739 9921 gene locus_tag LOCUS_39340 9739 9921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 >Feature sequence210 160 336 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 661 797 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1535 1618 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3001 3200 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3350 3547 gene locus_tag LOCUS_39350 3350 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 5278 5423 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6871 5846 gene locus_tag LOCUS_39360 6871 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 6886 7032 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7776 7925 gene locus_tag LOCUS_39370 7776 7925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39370 8570 8675 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9063 9839 gene locus_tag LOCUS_39380 9063 9839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 >Feature sequence211 2008 182 gene locus_tag LOCUS_39390 2008 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 2054 2178 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2791 2928 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3532 3693 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3960 4065 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5142 4183 gene locus_tag LOCUS_39400 5142 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 6775 5489 gene locus_tag LOCUS_39410 gene serS 6775 5489 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118185.1 protein_id gnl|my_center|LOCUS_39410 6931 7093 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <9798 7214 gene locus_tag LOCUS_39420 <9798 7214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228544.1:S8 family serine peptidase >Feature sequence212 499 645 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 938 699 gene locus_tag LOCUS_39430 gene yidD 938 699 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214730.1 protein_id gnl|my_center|LOCUS_39430 1758 1327 gene locus_tag LOCUS_39440 1758 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 2495 1755 gene locus_tag LOCUS_39450 2495 1755 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056682.1 protein_id gnl|my_center|LOCUS_39450 2952 2692 gene locus_tag LOCUS_39460 2952 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 3028 3152 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5740 4301 gene locus_tag LOCUS_39470 5740 4301 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922220.1 protein_id gnl|my_center|LOCUS_39470 6025 7068 gene locus_tag LOCUS_39480 gene mtnA 6025 7068 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_39480 7065 7637 gene locus_tag LOCUS_39490 7065 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 8292 9329 gene locus_tag LOCUS_39500 8292 9329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 9376 9534 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence213 2008 812 gene locus_tag LOCUS_39510 2008 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 882 969 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2887 2213 gene locus_tag LOCUS_39520 2887 2213 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121464.1 protein_id gnl|my_center|LOCUS_39520 4508 2985 gene locus_tag LOCUS_39530 gene gcvPB 4508 2985 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121465.1 protein_id gnl|my_center|LOCUS_39530 6016 4670 gene locus_tag LOCUS_39540 gene gcvPA 6016 4670 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331407.1 protein_id gnl|my_center|LOCUS_39540 6462 6196 gene locus_tag LOCUS_39550 6462 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 6591 6853 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7375 6989 gene locus_tag LOCUS_39560 gene gcvH 7375 6989 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222781.1 protein_id gnl|my_center|LOCUS_39560 7914 7471 gene locus_tag LOCUS_39570 gene rpiB 7914 7471 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122948.1 protein_id gnl|my_center|LOCUS_39570 8249 8043 gene locus_tag LOCUS_39580 8249 8043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 8254 8374 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence214 314 509 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2073 661 gene locus_tag LOCUS_39590 2073 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 2761 4200 gene locus_tag LOCUS_39600 gene tssK 2761 4200 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616050.1 protein_id gnl|my_center|LOCUS_39600 4197 4838 gene locus_tag LOCUS_39610 4197 4838 CDS product DotU family type IV/VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922257.1 protein_id gnl|my_center|LOCUS_39610 4853 6490 gene locus_tag LOCUS_39620 4853 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 6832 7905 gene locus_tag LOCUS_39630 6832 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 9348 7999 gene locus_tag LOCUS_39640 9348 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 8114 8219 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence215 1735 2103 gene locus_tag LOCUS_39650 1735 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 2566 2135 gene locus_tag LOCUS_39660 2566 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093116.1 protein_id gnl|my_center|LOCUS_39660 2980 5346 gene locus_tag LOCUS_39670 2980 5346 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123067.1 protein_id gnl|my_center|LOCUS_39670 4915 5084 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5459 6256 gene locus_tag LOCUS_39680 5459 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 6135 6202 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6207 6521 gene locus_tag LOCUS_39690 6207 6521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 6960 7931 gene locus_tag LOCUS_39700 6960 7931 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325399.1 protein_id gnl|my_center|LOCUS_39700 8439 8005 gene locus_tag LOCUS_39710 8439 8005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 8584 8664 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence216 367 541 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1171 1328 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2466 2653 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3172 3285 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3311 4030 gene locus_tag LOCUS_39720 3311 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 4121 4366 gene locus_tag LOCUS_39730 4121 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 4551 4725 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5062 5826 gene locus_tag LOCUS_39740 gene panC 5062 5826 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966198.1 protein_id gnl|my_center|LOCUS_39740 6009 6161 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6230 7342 gene locus_tag LOCUS_39750 6230 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 7672 7802 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8097 8289 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8767 8929 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence217 628 710 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 907 1073 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1494 2465 gene locus_tag LOCUS_39760 1494 2465 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227916.1 protein_id gnl|my_center|LOCUS_39760 2452 3180 gene locus_tag LOCUS_39770 2452 3180 CDS product PaeR7I family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176598.1 protein_id gnl|my_center|LOCUS_39770 4415 3186 gene locus_tag LOCUS_39780 4415 3186 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123718.1 protein_id gnl|my_center|LOCUS_39780 5557 4586 gene locus_tag LOCUS_39790 5557 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 6273 6458 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6532 7191 gene locus_tag LOCUS_39800 6532 7191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 7313 7585 gene locus_tag LOCUS_39810 7313 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 8597 8842 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence218 634 275 gene locus_tag LOCUS_39820 634 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 1121 693 gene locus_tag LOCUS_39830 gene rnk 1121 693 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815299.1 protein_id gnl|my_center|LOCUS_39830 1647 1228 gene locus_tag LOCUS_39840 gene rnk 1647 1228 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815299.1 protein_id gnl|my_center|LOCUS_39840 1920 1660 gene locus_tag LOCUS_39850 1920 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 3670 2282 gene locus_tag LOCUS_39860 3670 2282 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922760.1 protein_id gnl|my_center|LOCUS_39860 4829 3663 gene locus_tag LOCUS_39870 4829 3663 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119450.1 protein_id gnl|my_center|LOCUS_39870 5043 5225 gene locus_tag LOCUS_39880 5043 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 5681 5808 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6495 5974 gene locus_tag LOCUS_39890 6495 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 7149 7285 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7431 8909 gene locus_tag LOCUS_39900 7431 8909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 >Feature sequence219 <1 606 gene locus_tag LOCUS_39910 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121200.1:GTPase HflX 644 795 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 941 2272 gene locus_tag LOCUS_39920 941 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 2068 2192 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2644 2825 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2860 3378 gene locus_tag LOCUS_39930 2860 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 3970 3440 gene locus_tag LOCUS_39940 3970 3440 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938968.1 protein_id gnl|my_center|LOCUS_39940 7335 3973 gene locus_tag LOCUS_39950 7335 3973 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615995.1 protein_id gnl|my_center|LOCUS_39950 7837 7379 gene locus_tag LOCUS_39960 7837 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 7981 8877 gene locus_tag LOCUS_39970 7981 8877 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_39970 >Feature sequence220 313 491 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1470 1243 gene locus_tag LOCUS_39980 1470 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 2469 2134 gene locus_tag LOCUS_39990 2469 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 3397 2711 gene locus_tag LOCUS_40000 3397 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 4102 3539 gene locus_tag LOCUS_40010 4102 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 4399 4530 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5108 5267 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5588 5858 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6500 6078 gene locus_tag LOCUS_40020 6500 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 7071 6634 gene locus_tag LOCUS_40030 7071 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 8115 7165 gene locus_tag LOCUS_40040 8115 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 8742 8221 gene locus_tag LOCUS_40050 8742 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 >Feature sequence221 419 180 gene locus_tag LOCUS_40060 419 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 556 649 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2336 1803 gene locus_tag LOCUS_40070 2336 1803 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120138.1 protein_id gnl|my_center|LOCUS_40070 4726 3182 gene locus_tag LOCUS_40080 4726 3182 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_40080 5806 5042 gene locus_tag LOCUS_40090 5806 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 7478 6981 gene locus_tag LOCUS_40100 7478 6981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 8049 7585 gene locus_tag LOCUS_40110 8049 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 8777 8283 gene locus_tag LOCUS_40120 8777 8283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 >Feature sequence222 810 124 gene locus_tag LOCUS_40130 810 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 876 1005 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1187 1402 gene locus_tag LOCUS_40140 1187 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 2828 2241 gene locus_tag LOCUS_40150 2828 2241 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 protein_id gnl|my_center|LOCUS_40150 2950 3156 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3961 3233 gene locus_tag LOCUS_40160 3961 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 4096 6564 gene locus_tag LOCUS_40170 4096 6564 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_40170 8640 6670 gene locus_tag LOCUS_40180 8640 6670 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143249.1 protein_id gnl|my_center|LOCUS_40180 9107 8766 gene locus_tag LOCUS_40190 9107 8766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 >Feature sequence223 2515 1226 gene locus_tag LOCUS_40200 2515 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 2583 2752 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3259 2756 gene locus_tag LOCUS_40210 3259 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 4622 3309 gene locus_tag LOCUS_40220 4622 3309 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135617729.1 protein_id gnl|my_center|LOCUS_40220 3683 3762 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5366 4707 gene locus_tag LOCUS_40230 gene purN 5366 4707 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326621.1 protein_id gnl|my_center|LOCUS_40230 6390 5626 gene locus_tag LOCUS_40240 6390 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 6736 7065 gene locus_tag LOCUS_40250 gene trxA 6736 7065 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 protein_id gnl|my_center|LOCUS_40250 7316 8824 gene locus_tag LOCUS_40260 7316 8824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 >Feature sequence224 304 1686 gene locus_tag LOCUS_40270 gene aroE 304 1686 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_40270 1761 1901 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2425 2069 gene locus_tag LOCUS_40280 2425 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 2992 2537 gene locus_tag LOCUS_40290 2992 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 3068 3191 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3242 3631 gene locus_tag LOCUS_40300 3242 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 3632 3955 gene locus_tag LOCUS_40310 3632 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 4422 4186 gene locus_tag LOCUS_40320 4422 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40320 5300 4449 gene locus_tag LOCUS_40330 5300 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 7404 5374 gene locus_tag LOCUS_40340 7404 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 5414 5612 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7556 7675 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8001 8867 gene locus_tag LOCUS_40350 8001 8867 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145885.1 protein_id gnl|my_center|LOCUS_40350 >Feature sequence225 492 64 gene locus_tag LOCUS_40360 492 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 933 1073 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3851 1248 gene locus_tag LOCUS_40370 3851 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 4633 4019 gene locus_tag LOCUS_40380 4633 4019 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122304.1 protein_id gnl|my_center|LOCUS_40380 8381 4998 gene locus_tag LOCUS_40390 8381 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 >Feature sequence226 3064 395 gene locus_tag LOCUS_40400 3064 395 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144156.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40400 3537 3061 gene locus_tag LOCUS_40410 3537 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40410 3095 3139 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4917 3646 gene locus_tag LOCUS_40420 4917 3646 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207560.1 protein_id gnl|my_center|LOCUS_40420 6401 4914 gene locus_tag LOCUS_40430 6401 4914 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444660.1 protein_id gnl|my_center|LOCUS_40430 8385 6865 gene locus_tag LOCUS_40440 8385 6865 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545380.1 protein_id gnl|my_center|LOCUS_40440 7182 7278 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <8918 8382 gene locus_tag LOCUS_40450 <8918 8382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025775002.1:response regulator transcription factor >Feature sequence227 1155 2147 gene locus_tag LOCUS_40460 1155 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40460 2018 2076 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2724 2871 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2912 3112 gene locus_tag LOCUS_40470 2912 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 3201 3314 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4019 3432 gene locus_tag LOCUS_40480 4019 3432 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117887.1 protein_id gnl|my_center|LOCUS_40480 5861 4416 gene locus_tag LOCUS_40490 5861 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 6692 6117 gene locus_tag LOCUS_40500 6692 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 7046 7121 gene locus_tag LOCUS_t00230 7046 7121 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8476 8638 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence228 384 2675 gene locus_tag LOCUS_40510 384 2675 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146514631.1 protein_id gnl|my_center|LOCUS_40510 2500 2591 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2782 4779 gene locus_tag LOCUS_40520 2782 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 4965 5858 gene locus_tag LOCUS_40530 4965 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 5858 6229 gene locus_tag LOCUS_40540 5858 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 6507 8201 gene locus_tag LOCUS_40550 6507 8201 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 protein_id gnl|my_center|LOCUS_40550 8349 8490 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence229 210 357 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3269 1029 gene locus_tag LOCUS_40560 3269 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 1105 1209 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4074 4182 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4186 4677 gene locus_tag LOCUS_40570 4186 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 5058 4678 gene locus_tag LOCUS_40580 5058 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 6268 5213 gene locus_tag LOCUS_40590 6268 5213 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260201.1 protein_id gnl|my_center|LOCUS_40590 6563 6378 gene locus_tag LOCUS_40600 6563 6378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 7027 6722 gene locus_tag LOCUS_40610 7027 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 7222 7330 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8283 8422 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence230 2821 512 gene locus_tag LOCUS_40620 2821 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 4355 3012 gene locus_tag LOCUS_40630 gene nhaA 4355 3012 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_40630 4512 4653 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4860 5038 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5473 6432 gene locus_tag LOCUS_40640 5473 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 5486 5571 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6420 8432 gene locus_tag LOCUS_40650 6420 8432 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435048.1 protein_id gnl|my_center|LOCUS_40650 >Feature sequence231 386 535 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2535 1630 gene locus_tag LOCUS_40660 2535 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 4029 2740 gene locus_tag LOCUS_40670 4029 2740 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329291.1 protein_id gnl|my_center|LOCUS_40670 4947 4084 gene locus_tag LOCUS_40680 4947 4084 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_40680 6381 5107 gene locus_tag LOCUS_40690 6381 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 7003 7710 gene locus_tag LOCUS_40700 7003 7710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 7812 7600 gene locus_tag LOCUS_40710 7812 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 7813 8379 gene locus_tag LOCUS_40720 7813 8379 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229518.1 protein_id gnl|my_center|LOCUS_40720 >Feature sequence232 229 1293 gene locus_tag LOCUS_40730 229 1293 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122045.1 protein_id gnl|my_center|LOCUS_40730 1354 1809 gene locus_tag LOCUS_40740 1354 1809 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918945.1 protein_id gnl|my_center|LOCUS_40740 1943 3190 gene locus_tag LOCUS_40750 1943 3190 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390320.1 protein_id gnl|my_center|LOCUS_40750 3964 3290 gene locus_tag LOCUS_40760 3964 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 5077 4190 gene locus_tag LOCUS_40770 5077 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 5309 5404 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5953 5798 gene locus_tag LOCUS_40780 5953 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 6149 6901 gene locus_tag LOCUS_40790 6149 6901 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118937.1 protein_id gnl|my_center|LOCUS_40790 7014 7733 gene locus_tag LOCUS_40800 7014 7733 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333582.1 protein_id gnl|my_center|LOCUS_40800 7844 8143 gene locus_tag LOCUS_40810 7844 8143 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324356.1 protein_id gnl|my_center|LOCUS_40810 8184 8489 gene locus_tag LOCUS_40820 8184 8489 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388663.1 protein_id gnl|my_center|LOCUS_40820 >Feature sequence233 960 127 gene locus_tag LOCUS_40830 960 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 2072 1068 gene locus_tag LOCUS_40840 2072 1068 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_40840 2859 2128 gene locus_tag LOCUS_40850 2859 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 4429 3050 gene locus_tag LOCUS_40860 4429 3050 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122601.1 protein_id gnl|my_center|LOCUS_40860 5176 4622 gene locus_tag LOCUS_40870 5176 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921915.1 protein_id gnl|my_center|LOCUS_40870 6039 5332 gene locus_tag LOCUS_40880 6039 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 6052 6139 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6182 6388 gene locus_tag LOCUS_40890 6182 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 6572 6688 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7123 7239 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7258 7455 gene locus_tag LOCUS_40900 7258 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 <8497 7473 gene locus_tag LOCUS_40910 <8497 7473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061304.1:PQQ-binding-like beta-propeller repeat protein >Feature sequence234 157 386 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1664 3091 gene locus_tag LOCUS_40920 1664 3091 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120393.1 protein_id gnl|my_center|LOCUS_40920 3693 3127 gene locus_tag LOCUS_40930 3693 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 3793 3935 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5038 5802 gene locus_tag LOCUS_40940 5038 5802 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731602.1 protein_id gnl|my_center|LOCUS_40940 5963 6081 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6641 6680 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7445 7119 gene locus_tag LOCUS_40950 7445 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 7464 7641 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7911 8234 gene locus_tag LOCUS_40960 7911 8234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 >Feature sequence235 207 377 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2225 1803 gene locus_tag LOCUS_40970 2225 1803 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118238.1 protein_id gnl|my_center|LOCUS_40970 3074 2661 gene locus_tag LOCUS_40980 3074 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 3984 3061 gene locus_tag LOCUS_40990 3984 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 3083 3142 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4098 4252 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4411 5331 gene locus_tag LOCUS_41000 4411 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 5723 5427 gene locus_tag LOCUS_41010 5723 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 5677 6999 gene locus_tag LOCUS_41020 5677 6999 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260005.1 protein_id gnl|my_center|LOCUS_41020 8136 7687 gene locus_tag LOCUS_41030 8136 7687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 >Feature sequence236 3139 290 gene locus_tag LOCUS_41040 3139 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 3433 4980 gene locus_tag LOCUS_41050 3433 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 5112 5645 gene locus_tag LOCUS_41060 5112 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 6481 5756 gene locus_tag LOCUS_41070 6481 5756 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340751.1 protein_id gnl|my_center|LOCUS_41070 7924 6581 gene locus_tag LOCUS_41080 7924 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 6787 6893 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8166 8324 gene locus_tag LOCUS_41090 8166 8324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 >Feature sequence237 373 563 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1155 760 gene locus_tag LOCUS_41100 1155 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920749.1 protein_id gnl|my_center|LOCUS_41100 1505 1597 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1698 1976 gene locus_tag LOCUS_41110 1698 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 2220 2367 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3165 4433 gene locus_tag LOCUS_41120 3165 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 4582 5322 gene locus_tag LOCUS_41130 4582 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 5552 5641 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6153 5794 gene locus_tag LOCUS_41140 6153 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 6420 6507 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7523 7702 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8002 8152 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence238 195 1688 gene locus_tag LOCUS_41150 195 1688 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037254759.1 protein_id gnl|my_center|LOCUS_41150 1785 2102 gene locus_tag LOCUS_41160 1785 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 2114 2287 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2445 3119 gene locus_tag LOCUS_41170 gene cobC 2445 3119 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914029.1 protein_id gnl|my_center|LOCUS_41170 3169 3285 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3320 3793 gene locus_tag LOCUS_41180 3320 3793 CDS product DUF4112 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089783.1 protein_id gnl|my_center|LOCUS_41180 4025 6067 gene locus_tag LOCUS_41190 4025 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 6826 7707 gene locus_tag LOCUS_41200 6826 7707 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665981.1 protein_id gnl|my_center|LOCUS_41200 7923 7696 gene locus_tag LOCUS_41210 7923 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 >Feature sequence239 743 2413 gene locus_tag LOCUS_41220 743 2413 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028668529.1 protein_id gnl|my_center|LOCUS_41220 6303 2737 gene locus_tag LOCUS_41230 6303 2737 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615508.1 protein_id gnl|my_center|LOCUS_41230 >Feature sequence240 198 343 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 755 842 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1278 1430 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1781 1915 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1963 2625 gene locus_tag LOCUS_41240 1963 2625 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_41240 3315 3410 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3472 3885 gene locus_tag LOCUS_41250 3472 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 4083 4175 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4218 4931 gene locus_tag LOCUS_41260 4218 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 5216 5031 gene locus_tag LOCUS_41270 5216 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 5988 6144 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6233 6784 gene locus_tag LOCUS_41280 6233 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 7060 7183 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence241 758 120 gene locus_tag LOCUS_41290 758 120 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921887.1 protein_id gnl|my_center|LOCUS_41290 967 2394 gene locus_tag LOCUS_41300 967 2394 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_41300 2723 4171 gene locus_tag LOCUS_41310 2723 4171 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921286.1 protein_id gnl|my_center|LOCUS_41310 4332 4670 gene locus_tag LOCUS_41320 4332 4670 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325418.1 protein_id gnl|my_center|LOCUS_41320 4836 7490 gene locus_tag LOCUS_41330 gene glnD 4836 7490 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325417.1 protein_id gnl|my_center|LOCUS_41330 7698 7887 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence242 232 717 gene locus_tag LOCUS_41340 232 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 1426 857 gene locus_tag LOCUS_41350 1426 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 2229 1489 gene locus_tag LOCUS_41360 2229 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 2686 2300 gene locus_tag LOCUS_41370 2686 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 2708 2874 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3704 3123 gene locus_tag LOCUS_41380 3704 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 3752 3849 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4892 4314 gene locus_tag LOCUS_41390 4892 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 5555 5010 gene locus_tag LOCUS_41400 5555 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 5890 7863 gene locus_tag LOCUS_41410 gene tssI 5890 7863 CDS product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922258.1 protein_id gnl|my_center|LOCUS_41410 >Feature sequence243 1708 563 gene locus_tag LOCUS_41420 1708 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 2849 1788 gene locus_tag LOCUS_41430 2849 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 3206 4423 gene locus_tag LOCUS_41440 3206 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 5029 5196 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5231 5500 gene locus_tag LOCUS_41450 5231 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 5549 5701 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6212 6366 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6572 6781 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7060 7257 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7305 7844 gene locus_tag LOCUS_41460 7305 7844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 >Feature sequence244 537 61 gene locus_tag LOCUS_41470 537 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 1004 582 gene locus_tag LOCUS_41480 1004 582 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921681.1 protein_id gnl|my_center|LOCUS_41480 2425 1298 gene locus_tag LOCUS_41490 gene aroC 2425 1298 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 protein_id gnl|my_center|LOCUS_41490 2832 4022 gene locus_tag LOCUS_41500 2832 4022 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_41500 5389 4025 gene locus_tag LOCUS_41510 5389 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 6760 5417 gene locus_tag LOCUS_41520 6760 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 >Feature sequence245 584 174 gene locus_tag LOCUS_41530 584 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 585 700 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 754 933 gene locus_tag LOCUS_41540 754 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 1682 1089 gene locus_tag LOCUS_41550 1682 1089 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532489.1 protein_id gnl|my_center|LOCUS_41550 1785 1962 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3683 2373 gene locus_tag LOCUS_41560 3683 2373 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_41560 4218 4051 gene locus_tag LOCUS_41570 4218 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 5697 4474 gene locus_tag LOCUS_41580 5697 4474 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101181.1 protein_id gnl|my_center|LOCUS_41580 7304 5727 gene locus_tag LOCUS_41590 7304 5727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 >Feature sequence246 798 82 gene locus_tag LOCUS_41600 798 82 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221202124.1 protein_id gnl|my_center|LOCUS_41600 1570 761 gene locus_tag LOCUS_41610 1570 761 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250526.1 protein_id gnl|my_center|LOCUS_41610 3746 1725 gene locus_tag LOCUS_41620 3746 1725 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921918.1 protein_id gnl|my_center|LOCUS_41620 4222 4623 gene locus_tag LOCUS_41630 4222 4623 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_41630 4755 6620 gene locus_tag LOCUS_41640 4755 6620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 6033 6169 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6611 7123 gene locus_tag LOCUS_41650 6611 7123 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721784.1 protein_id gnl|my_center|LOCUS_41650 <7862 7168 gene locus_tag LOCUS_41660 <7862 7168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703891.1:putative transporter >Feature sequence247 597 668 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1617 1120 gene locus_tag LOCUS_41670 1617 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 2771 1716 gene locus_tag LOCUS_41680 2771 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 2831 2926 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3261 3356 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3901 4072 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4398 4544 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4773 7193 gene locus_tag LOCUS_41690 4773 7193 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197444080.1 protein_id gnl|my_center|LOCUS_41690 >Feature sequence248 376 535 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 936 1061 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2532 1645 gene locus_tag LOCUS_41700 gene nadC 2532 1645 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920753.1 protein_id gnl|my_center|LOCUS_41700 2624 3967 gene locus_tag LOCUS_41710 2624 3967 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_41710 4302 5939 gene locus_tag LOCUS_41720 4302 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 6024 6182 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6606 6689 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6932 7058 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence249 611 754 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 782 1000 gene locus_tag LOCUS_41730 782 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 1175 1313 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1450 1848 gene locus_tag LOCUS_41740 1450 1848 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 protein_id gnl|my_center|LOCUS_41740 2019 1834 gene locus_tag LOCUS_41750 2019 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 2217 2050 gene locus_tag LOCUS_41760 2217 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 2815 3027 gene locus_tag LOCUS_41770 2815 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 3752 3857 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3915 4748 gene locus_tag LOCUS_41780 3915 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 4921 5379 gene locus_tag LOCUS_41790 gene gspG 4921 5379 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087289.1 protein_id gnl|my_center|LOCUS_41790 5677 6201 gene locus_tag LOCUS_41800 5677 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 6198 6596 gene locus_tag LOCUS_41810 6198 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 6974 7133 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7173 7487 gene locus_tag LOCUS_41820 7173 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 >Feature sequence250 280 762 gene locus_tag LOCUS_41830 280 762 CDS product DUF1569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123270.1 protein_id gnl|my_center|LOCUS_41830 961 2769 gene locus_tag LOCUS_41840 961 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 2886 3347 gene locus_tag LOCUS_41850 2886 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 4026 3460 gene locus_tag LOCUS_41860 4026 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 4167 4295 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5523 4450 gene locus_tag LOCUS_41870 5523 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 5965 6089 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6650 6949 gene locus_tag LOCUS_41880 6650 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 >Feature sequence251 528 1106 gene locus_tag LOCUS_41890 528 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 2719 1211 gene locus_tag LOCUS_41900 2719 1211 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122320.1 protein_id gnl|my_center|LOCUS_41900 2833 2958 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3270 6323 gene locus_tag LOCUS_41910 3270 6323 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_41910 7011 6457 gene locus_tag LOCUS_41920 7011 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 7187 7269 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence252 745 1893 gene locus_tag LOCUS_41930 745 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 822 920 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2240 3985 gene locus_tag LOCUS_41940 2240 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 3511 3559 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4315 4473 gene locus_tag LOCUS_41950 4315 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 4673 4830 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5206 5331 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5403 6149 gene locus_tag LOCUS_41960 5403 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 5941 5998 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6041 6934 gene locus_tag LOCUS_41970 6041 6934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 6961 7194 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence253 192 411 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 751 839 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2101 1601 gene locus_tag LOCUS_41980 2101 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 2651 2202 gene locus_tag LOCUS_41990 2651 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 2650 2802 gene locus_tag LOCUS_42000 2650 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 5689 2852 gene locus_tag LOCUS_42010 5689 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 5811 6428 gene locus_tag LOCUS_42020 5811 6428 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922102.1 protein_id gnl|my_center|LOCUS_42020 >Feature sequence254 1552 170 gene locus_tag LOCUS_42030 1552 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 1624 1790 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2934 4067 gene locus_tag LOCUS_42040 2934 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 4143 4262 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5115 4321 gene locus_tag LOCUS_42050 5115 4321 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121724.1 protein_id gnl|my_center|LOCUS_42050 5247 5918 gene locus_tag LOCUS_42060 5247 5918 CDS product DUF4328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066963.1 protein_id gnl|my_center|LOCUS_42060 7188 5992 gene locus_tag LOCUS_42070 7188 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 >Feature sequence255 335 491 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1225 1420 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4339 1895 gene locus_tag LOCUS_42080 4339 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 1968 2042 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5043 4336 gene locus_tag LOCUS_42090 5043 4336 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206150.1 protein_id gnl|my_center|LOCUS_42090 5863 5459 gene locus_tag LOCUS_42100 5863 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 6923 5943 gene locus_tag LOCUS_42110 6923 5943 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_42110 7225 7013 gene locus_tag LOCUS_42120 7225 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 >Feature sequence256 314 602 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1148 1270 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1577 3211 gene locus_tag LOCUS_42130 1577 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 2942 3080 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3232 5613 gene locus_tag LOCUS_42140 3232 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 5727 7139 gene locus_tag LOCUS_42150 5727 7139 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_42150 6954 7057 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence257 217 379 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 500 1195 gene locus_tag LOCUS_42160 500 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 2115 2222 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2298 2801 gene locus_tag LOCUS_42170 2298 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 3593 2823 gene locus_tag LOCUS_42180 3593 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 3619 3735 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4289 4450 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5531 5025 gene locus_tag LOCUS_42190 5531 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 6054 5566 gene locus_tag LOCUS_42200 6054 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 6305 7072 gene locus_tag LOCUS_42210 6305 7072 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_42210 >Feature sequence258 1235 1403 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1734 1905 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2176 2349 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2527 2612 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2618 4627 gene locus_tag LOCUS_42220 2618 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 4810 6192 gene locus_tag LOCUS_42230 4810 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 6392 6466 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence259 277 490 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1581 553 gene locus_tag LOCUS_42240 1581 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 1590 1730 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1974 2122 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2673 2822 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3513 3740 gene locus_tag LOCUS_42250 3513 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 3816 3913 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4598 4732 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4959 5138 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6588 5380 gene locus_tag LOCUS_42260 6588 5380 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123072.1 protein_id gnl|my_center|LOCUS_42260 6630 6773 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence260 3328 275 gene locus_tag LOCUS_42270 3328 275 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149111012.1 protein_id gnl|my_center|LOCUS_42270 5429 3411 gene locus_tag LOCUS_42280 5429 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 5500 5561 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6175 6266 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6498 6625 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence261 879 40 gene locus_tag LOCUS_42290 gene kdsA 879 40 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120986.1 protein_id gnl|my_center|LOCUS_42290 2647 1004 gene locus_tag LOCUS_42300 2647 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 2688 2776 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3314 3754 gene locus_tag LOCUS_42310 3314 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 3825 4238 gene locus_tag LOCUS_42320 3825 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 4356 4460 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4652 5686 gene locus_tag LOCUS_42330 4652 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 6866 5868 gene locus_tag LOCUS_42340 6866 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 5954 6024 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence262 360 521 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 911 3391 gene locus_tag LOCUS_42350 911 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 4105 5055 gene locus_tag LOCUS_42360 4105 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 6026 6153 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6238 6780 gene locus_tag LOCUS_42370 6238 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 >Feature sequence263 215 1099 gene locus_tag LOCUS_42380 215 1099 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_42380 1211 1380 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1845 1585 gene locus_tag LOCUS_42390 1845 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 3265 1886 gene locus_tag LOCUS_42400 3265 1886 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001969726.1 protein_id gnl|my_center|LOCUS_42400 1892 2004 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3495 4145 gene locus_tag LOCUS_42410 3495 4145 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887642.1 protein_id gnl|my_center|LOCUS_42410 4193 5002 gene locus_tag LOCUS_42420 gene sufC 4193 5002 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329802.1 protein_id gnl|my_center|LOCUS_42420 5096 6511 gene locus_tag LOCUS_42430 gene sufB 5096 6511 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_42430 >Feature sequence264 301 50 gene locus_tag LOCUS_42440 301 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 838 473 gene locus_tag LOCUS_42450 838 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 2361 835 gene locus_tag LOCUS_42460 2361 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 3307 2744 gene locus_tag LOCUS_42470 3307 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 6601 3314 gene locus_tag LOCUS_42480 6601 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 >Feature sequence265 1135 11 gene locus_tag LOCUS_42490 1135 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 1549 1169 gene locus_tag LOCUS_42500 1549 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 1897 1580 gene locus_tag LOCUS_42510 1897 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 3504 2794 gene locus_tag LOCUS_42520 3504 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 4255 3560 gene locus_tag LOCUS_42530 4255 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 4446 4895 gene locus_tag LOCUS_42540 4446 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 5445 5651 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6161 5961 gene locus_tag LOCUS_42550 6161 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 6507 6262 gene locus_tag LOCUS_42560 6507 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 >Feature sequence266 632 772 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1403 1497 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2862 3044 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5285 4668 gene locus_tag LOCUS_42570 5285 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 5303 5431 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5924 6166 gene locus_tag LOCUS_42580 5924 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 >Feature sequence267 224 370 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 747 857 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1457 1525 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2322 1543 gene locus_tag LOCUS_42590 2322 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922325.1 protein_id gnl|my_center|LOCUS_42590 2538 2631 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2675 3739 gene locus_tag LOCUS_42600 2675 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 4689 3754 gene locus_tag LOCUS_42610 4689 3754 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922143.1 protein_id gnl|my_center|LOCUS_42610 >Feature sequence268 325 107 gene locus_tag LOCUS_42620 325 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 813 883 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 991 1512 gene locus_tag LOCUS_42630 991 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42630 1665 1843 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2045 2947 gene locus_tag LOCUS_42640 2045 2947 CDS product DUF6528 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332817.1 protein_id gnl|my_center|LOCUS_42640 3642 5009 gene locus_tag LOCUS_42650 3642 5009 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123021.1 protein_id gnl|my_center|LOCUS_42650 5400 5524 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5748 5932 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6292 6406 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence269 409 176 gene locus_tag LOCUS_42660 409 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 1160 549 gene locus_tag LOCUS_42670 gene nadD 1160 549 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922150.1 protein_id gnl|my_center|LOCUS_42670 1695 1620 gene locus_tag LOCUS_t00240 1695 1620 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1883 1686 gene locus_tag LOCUS_42680 1883 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 2502 2281 gene locus_tag LOCUS_42690 2502 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 2730 4571 gene locus_tag LOCUS_42700 2730 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 4674 5693 gene locus_tag LOCUS_42710 4674 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 >Feature sequence270 <1 2401 gene locus_tag LOCUS_42720 <1 2401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146390841.1:DUF1549 domain-containing protein 2458 3933 gene locus_tag LOCUS_42730 2458 3933 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_42730 4055 4216 gene locus_tag LOCUS_42740 4055 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 4652 5530 gene locus_tag LOCUS_42750 4652 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 5633 5706 gene locus_tag LOCUS_t00250 5633 5706 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence271 276 422 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3060 1048 gene locus_tag LOCUS_42760 gene ligA 3060 1048 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122894.1 protein_id gnl|my_center|LOCUS_42760 3926 3159 gene locus_tag LOCUS_42770 3926 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 4383 4039 gene locus_tag LOCUS_42780 4383 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 4935 4516 gene locus_tag LOCUS_42790 4935 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 5565 5669 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6317 6407 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence272 1610 471 gene locus_tag LOCUS_42800 1610 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 2359 1607 gene locus_tag LOCUS_42810 2359 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 2989 3133 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3554 3982 gene locus_tag LOCUS_42820 3554 3982 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 protein_id gnl|my_center|LOCUS_42820 3992 4093 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5288 4269 gene locus_tag LOCUS_42830 5288 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 5318 5491 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6116 6236 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence273 126 336 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 346 1221 gene locus_tag LOCUS_42840 346 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 1516 2409 gene locus_tag LOCUS_42850 gene ricT 1516 2409 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615890.1 protein_id gnl|my_center|LOCUS_42850 2489 2719 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2972 3172 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4797 5081 gene locus_tag LOCUS_42860 4797 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 6194 5334 gene locus_tag LOCUS_42870 6194 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 6209 6363 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence274 1 495 gene locus_tag LOCUS_42880 1 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 1503 541 gene locus_tag LOCUS_42890 1503 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 2801 1500 gene locus_tag LOCUS_42900 2801 1500 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_42900 3244 2975 gene locus_tag LOCUS_42910 3244 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 3351 3440 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5633 5286 gene locus_tag LOCUS_42920 5633 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 5685 5775 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence275 1316 267 gene locus_tag LOCUS_42930 1316 267 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921780.1 protein_id gnl|my_center|LOCUS_42930 2472 1300 gene locus_tag LOCUS_42940 2472 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933801.1 protein_id gnl|my_center|LOCUS_42940 3051 2590 gene locus_tag LOCUS_42950 3051 2590 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087408.1 protein_id gnl|my_center|LOCUS_42950 4678 3608 gene locus_tag LOCUS_42960 4678 3608 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338403.1 protein_id gnl|my_center|LOCUS_42960 4833 5648 gene locus_tag LOCUS_42970 4833 5648 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122244.1 protein_id gnl|my_center|LOCUS_42970 6075 5878 gene locus_tag LOCUS_42980 6075 5878 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_42980 >Feature sequence276 369 82 gene locus_tag LOCUS_42990 369 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 540 1505 gene locus_tag LOCUS_43000 540 1505 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881382.1 protein_id gnl|my_center|LOCUS_43000 1601 3403 gene locus_tag LOCUS_43010 1601 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43010 3253 3332 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3349 6258 gene locus_tag LOCUS_43020 3349 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43020 >Feature sequence277 212 349 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 514 1803 gene locus_tag LOCUS_43030 514 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 1832 2113 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2260 3246 gene locus_tag LOCUS_43040 2260 3246 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122268.1 protein_id gnl|my_center|LOCUS_43040 3249 4145 gene locus_tag LOCUS_43050 3249 4145 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919889.1 protein_id gnl|my_center|LOCUS_43050 4205 4345 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4484 4720 gene locus_tag LOCUS_43060 4484 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 5081 5219 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence278 406 545 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3409 3535 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5506 5318 gene locus_tag LOCUS_43070 5506 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 >Feature sequence279 430 1818 gene locus_tag LOCUS_43080 430 1818 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922459.1 protein_id gnl|my_center|LOCUS_43080 1993 2145 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2350 3318 gene locus_tag LOCUS_43090 2350 3318 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921965.1 protein_id gnl|my_center|LOCUS_43090 3452 3841 gene locus_tag LOCUS_43100 3452 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 3906 4787 gene locus_tag LOCUS_43110 3906 4787 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325558.1 protein_id gnl|my_center|LOCUS_43110 5189 4788 gene locus_tag LOCUS_43120 5189 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 5294 5464 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence280 2 541 gene locus_tag LOCUS_43130 2 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 1421 555 gene locus_tag LOCUS_43140 1421 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 1618 3990 gene locus_tag LOCUS_43150 1618 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 4972 4076 gene locus_tag LOCUS_43160 4972 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 5828 5226 gene locus_tag LOCUS_43170 5828 5226 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_43170 >Feature sequence281 345 502 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1260 1357 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1366 1788 gene locus_tag LOCUS_43180 1366 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 1790 1999 gene locus_tag LOCUS_43190 1790 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 2820 2997 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3195 3407 gene locus_tag LOCUS_43200 3195 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 3527 3651 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3727 5784 gene locus_tag LOCUS_43210 3727 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 5954 6039 gene locus_tag LOCUS_t00260 5954 6039 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence282 336 522 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 607 828 gene locus_tag LOCUS_43220 607 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 889 1284 gene locus_tag LOCUS_43230 889 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 1349 1482 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1968 1759 gene locus_tag LOCUS_43240 1968 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 3489 3663 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3686 4990 gene locus_tag LOCUS_43250 3686 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 5416 5003 gene locus_tag LOCUS_43260 5416 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 5830 5537 gene locus_tag LOCUS_43270 5830 5537 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 protein_id gnl|my_center|LOCUS_43270 >Feature sequence283 1996 623 gene locus_tag LOCUS_43280 1996 623 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_43280 2226 2309 gene locus_tag LOCUS_t00270 2226 2309 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2989 4125 gene locus_tag LOCUS_43290 2989 4125 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329385.1 protein_id gnl|my_center|LOCUS_43290 5717 4260 gene locus_tag LOCUS_43300 5717 4260 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118996.1 protein_id gnl|my_center|LOCUS_43300 >Feature sequence284 447 532 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1204 1338 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1527 1805 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2084 2212 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2263 2484 gene locus_tag LOCUS_43310 2263 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 3087 3284 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3432 3959 gene locus_tag LOCUS_43320 3432 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 4069 4773 gene locus_tag LOCUS_43330 4069 4773 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 protein_id gnl|my_center|LOCUS_43330 5303 5431 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5432 5626 gene locus_tag LOCUS_43340 5432 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 >Feature sequence285 585 1526 gene locus_tag LOCUS_43350 585 1526 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122799.1 protein_id gnl|my_center|LOCUS_43350 3038 1575 gene locus_tag LOCUS_43360 3038 1575 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922025.1 protein_id gnl|my_center|LOCUS_43360 3354 3010 gene locus_tag LOCUS_43370 3354 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 4576 3605 gene locus_tag LOCUS_43380 4576 3605 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_43380 5039 4614 gene locus_tag LOCUS_43390 5039 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 5490 5544 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence286 273 398 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3193 545 gene locus_tag LOCUS_43400 3193 545 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922871.1 protein_id gnl|my_center|LOCUS_43400 4776 3568 gene locus_tag LOCUS_43410 4776 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 4789 4927 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5434 5618 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence287 1669 161 gene locus_tag LOCUS_43420 1669 161 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_43420 2284 2772 gene locus_tag LOCUS_43430 gene tadA 2284 2772 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325362.1 protein_id gnl|my_center|LOCUS_43430 2774 3178 gene locus_tag LOCUS_43440 2774 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 4551 3175 gene locus_tag LOCUS_43450 4551 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 4715 4834 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence288 731 873 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1327 1427 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1705 1832 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1869 2234 gene locus_tag LOCUS_43460 1869 2234 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_43460 2268 2522 gene locus_tag LOCUS_43470 gene eutN 2268 2522 CDS product ethanolamine utilization microcompartment protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762196.1 protein_id gnl|my_center|LOCUS_43470 2599 2801 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3342 3470 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3937 4022 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4143 4514 gene locus_tag LOCUS_43480 4143 4514 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_43480 4591 4791 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4935 5687 gene locus_tag LOCUS_43490 4935 5687 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324364.1 protein_id gnl|my_center|LOCUS_43490 >Feature sequence289 323 563 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1249 1512 gene locus_tag LOCUS_43500 1249 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 1582 1711 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3347 2310 gene locus_tag LOCUS_43510 3347 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 4102 3548 gene locus_tag LOCUS_43520 4102 3548 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_43520 4657 4773 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5346 5459 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence290 763 215 gene locus_tag LOCUS_43530 763 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 2084 846 gene locus_tag LOCUS_43540 2084 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 2684 2919 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4608 5189 gene locus_tag LOCUS_43550 4608 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 5379 5279 gene locus_tag LOCUS_r00010 5379 5279 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence291 176 1828 gene locus_tag LOCUS_43560 176 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 1572 1668 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1845 3116 gene locus_tag LOCUS_43570 1845 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 3654 3807 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3994 5304 gene locus_tag LOCUS_43580 3994 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 5208 5276 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5354 5599 gene locus_tag LOCUS_43590 5354 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 >Feature sequence292 926 1039 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1482 1587 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1615 2112 gene locus_tag LOCUS_43600 1615 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 3297 2737 gene locus_tag LOCUS_43610 3297 2737 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123297.1 protein_id gnl|my_center|LOCUS_43610 3931 3479 gene locus_tag LOCUS_43620 3931 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941231.1 protein_id gnl|my_center|LOCUS_43620 5164 4097 gene locus_tag LOCUS_43630 5164 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 >Feature sequence293 1130 516 gene locus_tag LOCUS_43640 1130 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 2476 1292 gene locus_tag LOCUS_43650 2476 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 2846 3670 gene locus_tag LOCUS_43660 2846 3670 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532025.1 protein_id gnl|my_center|LOCUS_43660 3789 5450 gene locus_tag LOCUS_43670 3789 5450 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_43670 >Feature sequence294 285 369 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 438 632 gene locus_tag LOCUS_43680 438 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 786 1262 gene locus_tag LOCUS_43690 786 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 1249 1575 gene locus_tag LOCUS_43700 1249 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 1572 2228 gene locus_tag LOCUS_43710 1572 2228 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665924.1 protein_id gnl|my_center|LOCUS_43710 2680 3054 gene locus_tag LOCUS_43720 2680 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 3495 3331 gene locus_tag LOCUS_43730 3495 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 3836 4294 gene locus_tag LOCUS_43740 3836 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 >Feature sequence295 537 106 gene locus_tag LOCUS_43750 537 106 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117815.1 protein_id gnl|my_center|LOCUS_43750 1009 2196 gene locus_tag LOCUS_43760 1009 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 3137 3260 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3737 3848 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4116 4289 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4834 5021 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence296 71 292 gene locus_tag LOCUS_43770 71 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 703 862 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2215 2367 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2744 2855 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3074 5050 gene locus_tag LOCUS_43780 3074 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 5052 5159 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence297 1415 1549 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4458 2707 gene locus_tag LOCUS_43790 4458 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 2803 2921 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4469 4601 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence298 352 74 gene locus_tag LOCUS_43800 352 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 3035 1224 gene locus_tag LOCUS_43810 3035 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 3597 3797 gene locus_tag LOCUS_43820 3597 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 3921 4039 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4156 5178 gene locus_tag LOCUS_43830 gene galT 4156 5178 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_43830 >Feature sequence299 1954 56 gene locus_tag LOCUS_43840 1954 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 2055 2161 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2664 2832 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3184 2942 gene locus_tag LOCUS_43850 3184 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 3226 3352 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3844 4034 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4745 4086 gene locus_tag LOCUS_43860 4745 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 4768 4926 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence300 1063 2280 gene locus_tag LOCUS_43870 1063 2280 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482205.1 protein_id gnl|my_center|LOCUS_43870 2247 2492 gene locus_tag LOCUS_43880 2247 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 2489 3859 gene locus_tag LOCUS_43890 2489 3859 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922160.1 protein_id gnl|my_center|LOCUS_43890 4862 3861 gene locus_tag LOCUS_43900 4862 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 >Feature sequence301 228 384 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1715 2962 gene locus_tag LOCUS_43910 1715 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 3071 4282 gene locus_tag LOCUS_43920 3071 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 >Feature sequence302 838 1779 gene locus_tag LOCUS_43930 gene floA 838 1779 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327752.1 protein_id gnl|my_center|LOCUS_43930 1822 1939 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2637 2852 gene locus_tag LOCUS_43940 2637 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 3107 3463 gene locus_tag LOCUS_43950 3107 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 3595 4875 gene locus_tag LOCUS_43960 3595 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 >Feature sequence303 1871 2008 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2277 2443 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2455 2994 gene locus_tag LOCUS_43970 2455 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 3048 3303 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4870 3482 gene locus_tag LOCUS_43980 gene sat 4870 3482 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438012.1 protein_id gnl|my_center|LOCUS_43980 4133 4247 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence304 188 339 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 901 605 gene locus_tag LOCUS_43990 901 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 1377 1012 gene locus_tag LOCUS_44000 1377 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 2915 1410 gene locus_tag LOCUS_44010 2915 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 3040 3366 gene locus_tag LOCUS_44020 3040 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 3960 4072 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4419 4563 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence305 436 508 gene locus_tag LOCUS_t00280 436 508 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 581 2050 gene locus_tag LOCUS_44030 gene tig 581 2050 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330527.1 protein_id gnl|my_center|LOCUS_44030 2320 4512 gene locus_tag LOCUS_44040 gene thrS 2320 4512 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329329.1 protein_id gnl|my_center|LOCUS_44040 >Feature sequence306 1222 113 gene locus_tag LOCUS_44050 1222 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 1236 1397 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3773 1863 gene locus_tag LOCUS_44060 3773 1863 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427755.1 protein_id gnl|my_center|LOCUS_44060 4366 3770 gene locus_tag LOCUS_44070 4366 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 4441 4533 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence307 637 1545 gene locus_tag LOCUS_44080 637 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 3001 1844 gene locus_tag LOCUS_44090 3001 1844 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_44090 3155 4480 gene locus_tag LOCUS_44100 3155 4480 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615837.1 protein_id gnl|my_center|LOCUS_44100 4616 4785 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence308 1505 222 gene locus_tag LOCUS_44110 1505 222 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_44110 1613 1772 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2501 2640 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4556 4722 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence309 1213 593 gene locus_tag LOCUS_44120 1213 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 1244 1385 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2330 1881 gene locus_tag LOCUS_44130 2330 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 3324 3413 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3991 3443 gene locus_tag LOCUS_44140 3991 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 4042 4203 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence310 1036 1608 gene locus_tag LOCUS_44150 1036 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 1676 2032 gene locus_tag LOCUS_44160 1676 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 2163 3239 gene locus_tag LOCUS_44170 2163 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 3252 3323 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3885 4055 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4135 4887 gene locus_tag LOCUS_44180 4135 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 >Feature sequence311 578 637 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 770 939 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1731 2270 gene locus_tag LOCUS_44190 1731 2270 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909489.1 protein_id gnl|my_center|LOCUS_44190 2369 3370 gene locus_tag LOCUS_44200 2369 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119567.1 protein_id gnl|my_center|LOCUS_44200 3434 3904 gene locus_tag LOCUS_44210 3434 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 4137 4244 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4288 4815 gene locus_tag LOCUS_44220 4288 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 >Feature sequence312 249 313 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1202 333 gene locus_tag LOCUS_44230 1202 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44230 1513 1199 gene locus_tag LOCUS_44240 1513 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44240 >Feature sequence313 1617 268 gene locus_tag LOCUS_44250 1617 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 1935 1726 gene locus_tag LOCUS_44260 1935 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 3530 2856 gene locus_tag LOCUS_44270 3530 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 3563 3691 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3953 4109 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence314 234 382 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1780 1941 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2163 2348 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2457 3191 gene locus_tag LOCUS_44280 2457 3191 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335855.1 protein_id gnl|my_center|LOCUS_44280 3240 3382 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3987 4178 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4451 4641 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence315 724 812 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1043 2071 gene locus_tag LOCUS_44290 1043 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 2205 3617 gene locus_tag LOCUS_44300 2205 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 3440 3578 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3890 4067 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4421 4627 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence316 208 768 gene locus_tag LOCUS_44310 gene dcd 208 768 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_44310 778 1317 gene locus_tag LOCUS_44320 778 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 1531 2685 gene locus_tag LOCUS_44330 1531 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 3600 2698 gene locus_tag LOCUS_44340 3600 2698 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037249854.1 protein_id gnl|my_center|LOCUS_44340 3772 4770 gene locus_tag LOCUS_44350 3772 4770 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118196.1 protein_id gnl|my_center|LOCUS_44350 >Feature sequence317 1445 336 gene locus_tag LOCUS_44360 gene ald 1445 336 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118338.1 protein_id gnl|my_center|LOCUS_44360 2143 1520 gene locus_tag LOCUS_44370 2143 1520 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560301.1 protein_id gnl|my_center|LOCUS_44370 3414 2284 gene locus_tag LOCUS_44380 3414 2284 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335445.1 protein_id gnl|my_center|LOCUS_44380 3609 3773 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4000 3806 gene locus_tag LOCUS_44390 4000 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 4019 4124 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4406 4560 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence318 166 425 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 602 734 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1352 1418 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1866 3020 gene locus_tag LOCUS_44400 gene ftsW 1866 3020 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791803.1 protein_id gnl|my_center|LOCUS_44400 3997 3017 gene locus_tag LOCUS_44410 3997 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 <4746 4058 gene locus_tag LOCUS_44420 <4746 4058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225422.1:TetR/AcrR family transcriptional regulator >Feature sequence319 139 412 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 491 1243 gene locus_tag LOCUS_44430 491 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 1674 1753 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1866 2813 gene locus_tag LOCUS_44440 1866 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 4428 2962 gene locus_tag LOCUS_44450 4428 2962 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_44450 >Feature sequence320 191 310 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 734 905 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1941 1084 gene locus_tag LOCUS_44460 1941 1084 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887476.1 protein_id gnl|my_center|LOCUS_44460 3152 2112 gene locus_tag LOCUS_44470 3152 2112 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118761.1 protein_id gnl|my_center|LOCUS_44470 3612 4625 gene locus_tag LOCUS_44480 3612 4625 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404555.1 protein_id gnl|my_center|LOCUS_44480 >Feature sequence321 1885 968 gene locus_tag LOCUS_44490 1885 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 2604 2371 gene locus_tag LOCUS_44500 2604 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 4347 3727 gene locus_tag LOCUS_44510 4347 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 >Feature sequence322 279 644 gene locus_tag LOCUS_44520 279 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 2241 1258 gene locus_tag LOCUS_44530 2241 1258 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208224.1 protein_id gnl|my_center|LOCUS_44530 >Feature sequence323 433 53 gene locus_tag LOCUS_44540 433 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 488 603 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1232 690 gene locus_tag LOCUS_44550 1232 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 1662 1381 gene locus_tag LOCUS_44560 1662 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 1753 1892 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2342 1929 gene locus_tag LOCUS_44570 2342 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 2787 3527 gene locus_tag LOCUS_44580 2787 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 3520 4092 gene locus_tag LOCUS_44590 3520 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 >Feature sequence324 159 1205 gene locus_tag LOCUS_44600 159 1205 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615578.1 protein_id gnl|my_center|LOCUS_44600 2127 2274 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3114 4157 gene locus_tag LOCUS_44610 3114 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 4051 4154 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence325 176 892 gene locus_tag LOCUS_44620 176 892 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037253881.1 protein_id gnl|my_center|LOCUS_44620 2419 962 gene locus_tag LOCUS_44630 2419 962 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120139.1 protein_id gnl|my_center|LOCUS_44630 2574 2990 gene locus_tag LOCUS_44640 2574 2990 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123553.1 protein_id gnl|my_center|LOCUS_44640 3362 3488 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4025 4156 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence326 170 451 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 901 1098 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2377 1166 gene locus_tag LOCUS_44650 2377 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 3058 2795 gene locus_tag LOCUS_44660 3058 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 3103 3116 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3724 3416 gene locus_tag LOCUS_44670 3724 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 3785 3945 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence327 1744 32 gene locus_tag LOCUS_44680 1744 32 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260568.1 protein_id gnl|my_center|LOCUS_44680 2161 2937 gene locus_tag LOCUS_44690 2161 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 3037 3993 gene locus_tag LOCUS_44700 3037 3993 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183508.1 protein_id gnl|my_center|LOCUS_44700 4058 4278 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence328 995 1141 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2724 2887 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3119 3211 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3655 3341 gene locus_tag LOCUS_44710 3655 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 3750 3847 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence329 1166 1252 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1607 1834 gene locus_tag LOCUS_44720 1607 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 1905 2912 gene locus_tag LOCUS_44730 gene rnz 1905 2912 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080741.1 protein_id gnl|my_center|LOCUS_44730 2314 2408 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3028 3207 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3497 3758 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence330 <1 1007 gene locus_tag LOCUS_44740 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328624.1:DUF1552 domain-containing protein 1111 2280 gene locus_tag LOCUS_44750 1111 2280 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261129.1 protein_id gnl|my_center|LOCUS_44750 2346 3140 gene locus_tag LOCUS_44760 2346 3140 CDS product DUF455 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174163.1 protein_id gnl|my_center|LOCUS_44760 >Feature sequence331 <1 612 gene locus_tag LOCUS_44770 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122091.1:molecular chaperone DnaJ 796 1401 gene locus_tag LOCUS_44780 gene grpE 796 1401 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101637.1 protein_id gnl|my_center|LOCUS_44780 1593 1910 gene locus_tag LOCUS_44790 1593 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 1926 2168 gene locus_tag LOCUS_44800 1926 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 2190 2966 gene locus_tag LOCUS_44810 2190 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 3185 4063 gene locus_tag LOCUS_44820 3185 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 >Feature sequence332 <1 789 gene locus_tag LOCUS_44830 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921746.1:cytochrome c oxidase subunit II 797 3337 gene locus_tag LOCUS_44840 gene ctaD 797 3337 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119895.1 protein_id gnl|my_center|LOCUS_44840 3577 3726 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3874 4278 gene locus_tag LOCUS_44850 3874 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 >Feature sequence333 138 424 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 807 1337 gene locus_tag LOCUS_44860 gene fae 807 1337 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122249.1 protein_id gnl|my_center|LOCUS_44860 1456 2493 gene locus_tag LOCUS_44870 1456 2493 CDS product nucleoside monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121910.1 protein_id gnl|my_center|LOCUS_44870 3434 2634 gene locus_tag LOCUS_44880 3434 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 3815 3534 gene locus_tag LOCUS_44890 3815 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 3965 4128 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence334 551 2080 gene locus_tag LOCUS_44900 551 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44900 1979 2033 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3749 3939 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4028 4261 gene locus_tag LOCUS_44910 4028 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 >Feature sequence335 229 487 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 862 1072 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1898 2034 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2409 2582 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2782 2939 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3664 3711 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence336 1627 1073 gene locus_tag LOCUS_44920 1627 1073 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_44920 <4194 2022 gene locus_tag LOCUS_44930 <4194 2022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099262126.1:serine/threonine-protein kinase >Feature sequence337 1112 201 gene locus_tag LOCUS_44940 1112 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 2213 1362 gene locus_tag LOCUS_44950 2213 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 2466 2607 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2848 2987 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3062 3841 gene locus_tag LOCUS_44960 gene nfi 3062 3841 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258210.1 protein_id gnl|my_center|LOCUS_44960 >Feature sequence338 445 620 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1286 1358 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3304 3438 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3595 3819 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence339 217 369 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3452 2787 gene locus_tag LOCUS_44970 3452 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 >Feature sequence340 <1 2362 gene locus_tag LOCUS_44980 <1 2362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404233.1:DNA topoisomerase IV subunit A 198 373 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence341 185 1096 gene locus_tag LOCUS_44990 185 1096 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121783.1 protein_id gnl|my_center|LOCUS_44990 1285 2793 gene locus_tag LOCUS_45000 1285 2793 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037250650.1 protein_id gnl|my_center|LOCUS_45000 2896 3495 gene locus_tag LOCUS_45010 2896 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 3964 3518 gene locus_tag LOCUS_45020 3964 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 >Feature sequence342 267 461 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 680 891 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2419 2597 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2947 3101 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3331 3780 gene locus_tag LOCUS_45030 3331 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 >Feature sequence343 561 762 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1286 1424 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1495 1809 gene locus_tag LOCUS_45040 1495 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 1945 3813 gene locus_tag LOCUS_45050 1945 3813 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_45050 3493 3658 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence344 1803 1033 gene locus_tag LOCUS_45060 1803 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 3454 1859 gene locus_tag LOCUS_45070 gene guaA 3454 1859 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778965.1 protein_id gnl|my_center|LOCUS_45070 >Feature sequence345 369 52 gene locus_tag LOCUS_45080 369 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 421 562 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 943 1080 gene locus_tag LOCUS_45090 943 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 1114 1207 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1491 1667 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1727 2371 gene locus_tag LOCUS_45100 1727 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 2479 2659 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2871 3061 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3271 3409 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence346 385 807 gene locus_tag LOCUS_45110 385 807 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_45110 855 2381 gene locus_tag LOCUS_45120 855 2381 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_45120 989 1097 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2574 3092 gene locus_tag LOCUS_45130 gene rplM 2574 3092 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_45130 >Feature sequence347 123 503 gene locus_tag LOCUS_45140 123 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 576 688 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1517 1665 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2487 2680 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2712 3752 gene locus_tag LOCUS_45150 2712 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 >Feature sequence348 <3751 1246 gene locus_tag LOCUS_45160 <3751 1246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008666716.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence349 612 280 gene locus_tag LOCUS_45170 612 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45170 979 857 gene locus_tag LOCUS_45180 979 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 2122 1049 gene locus_tag LOCUS_45190 2122 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 3480 2215 gene locus_tag LOCUS_45200 3480 2215 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922363.1 protein_id gnl|my_center|LOCUS_45200 >Feature sequence350 2029 1244 gene locus_tag LOCUS_45210 2029 1244 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395936.1 protein_id gnl|my_center|LOCUS_45210 2152 2232 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2544 2263 gene locus_tag LOCUS_45220 2544 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 2680 2843 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3219 3416 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence351 290 562 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 680 1816 gene locus_tag LOCUS_45230 680 1816 CDS product IS481-like element ISEc19 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723086.1 protein_id gnl|my_center|LOCUS_45230 2551 2723 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence352 185 349 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 986 1171 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2516 1305 gene locus_tag LOCUS_45240 2516 1305 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_45240 3273 3409 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence353 <1 608 gene locus_tag LOCUS_45250 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120799.1:sulfatase 675 1226 gene locus_tag LOCUS_45260 675 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 1243 1671 gene locus_tag LOCUS_45270 1243 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 2341 1802 gene locus_tag LOCUS_45280 2341 1802 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401881.1 protein_id gnl|my_center|LOCUS_45280 3237 2338 gene locus_tag LOCUS_45290 3237 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 3281 3415 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence354 687 796 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1115 1276 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1397 1720 gene locus_tag LOCUS_45300 1397 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 3418 2189 gene locus_tag LOCUS_45310 3418 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 >Feature sequence355 3057 2713 gene locus_tag LOCUS_45320 3057 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 3250 3317 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence356 600 196 gene locus_tag LOCUS_45330 600 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 956 1981 gene locus_tag LOCUS_45340 956 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 2306 2791 gene locus_tag LOCUS_45350 2306 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 3110 2841 gene locus_tag LOCUS_45360 gene rpsN 3110 2841 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831302.1 protein_id gnl|my_center|LOCUS_45360 >Feature sequence357 <1 2322 gene locus_tag LOCUS_45370 <1 2322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122500.1:serine/threonine-protein kinase 2182 2287 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3197 3355 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence358 477 1004 gene locus_tag LOCUS_45380 477 1004 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328411.1 protein_id gnl|my_center|LOCUS_45380 1412 1564 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1736 1973 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2055 3131 gene locus_tag LOCUS_45390 2055 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 3019 3094 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3101 3409 gene locus_tag LOCUS_45400 3101 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 >Feature sequence359 3 1184 gene locus_tag LOCUS_45410 3 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 1110 1177 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1505 1661 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2412 2518 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2773 2900 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence360 115 576 gene locus_tag LOCUS_45420 115 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 1810 542 gene locus_tag LOCUS_45430 1810 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 2197 2293 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2890 3094 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence361 153 369 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 481 714 gene locus_tag LOCUS_45440 481 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 698 946 gene locus_tag LOCUS_45450 698 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 943 1308 gene locus_tag LOCUS_45460 943 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 1436 2227 gene locus_tag LOCUS_45470 1436 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 2372 2746 gene locus_tag LOCUS_45480 2372 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 2746 3102 gene locus_tag LOCUS_45490 2746 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 >Feature sequence362 103 1668 gene locus_tag LOCUS_45500 103 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 147 302 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1692 2789 gene locus_tag LOCUS_45510 1692 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 >Feature sequence363 823 969 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1345 1481 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1625 2101 gene locus_tag LOCUS_45520 1625 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 2311 3201 gene locus_tag LOCUS_45530 2311 3201 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891044.1 protein_id gnl|my_center|LOCUS_45530 >Feature sequence364 1426 20 gene locus_tag LOCUS_45540 1426 20 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921694.1 protein_id gnl|my_center|LOCUS_45540 2054 1443 gene locus_tag LOCUS_45550 2054 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 2441 2561 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence365 473 656 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 891 1565 gene locus_tag LOCUS_45560 891 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 2471 1866 gene locus_tag LOCUS_45570 2471 1866 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122304.1 protein_id gnl|my_center|LOCUS_45570 2708 2817 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence366 449 12 gene locus_tag LOCUS_45580 449 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 810 2504 gene locus_tag LOCUS_45590 810 2504 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117790.1 protein_id gnl|my_center|LOCUS_45590 2602 3009 gene locus_tag LOCUS_45600 2602 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 >Feature sequence367 691 563 gene locus_tag LOCUS_45610 691 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 998 1182 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1259 1459 gene locus_tag LOCUS_45620 1259 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 1912 2075 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence368 1541 273 gene locus_tag LOCUS_45630 1541 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 2056 1538 gene locus_tag LOCUS_45640 2056 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 2766 2146 gene locus_tag LOCUS_45650 2766 2146 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_45650 >Feature sequence369 <1 1187 gene locus_tag LOCUS_45660 <1 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008666047.1:PSD1 and planctomycete cytochrome C domain-containing protein 1233 2702 gene locus_tag LOCUS_45670 1233 2702 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334705.1 protein_id gnl|my_center|LOCUS_45670 >Feature sequence370 142 286 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2612 372 gene locus_tag LOCUS_45680 2612 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 2708 2857 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence371 <1 789 gene locus_tag LOCUS_45690 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003085555.1:translation elongation factor 4 1474 878 gene locus_tag LOCUS_45700 1474 878 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_45700 2832 1687 gene locus_tag LOCUS_45710 2832 1687 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766215.1 protein_id gnl|my_center|LOCUS_45710 >Feature sequence372 391 837 gene locus_tag LOCUS_45720 gene phnB 391 837 CDS product Dot/Icm type IV secretion system effector PhnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 protein_id gnl|my_center|LOCUS_45720 867 1187 gene locus_tag LOCUS_45730 867 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 1276 2886 gene locus_tag LOCUS_45740 1276 2886 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_45740 2688 2781 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence373 55 738 gene locus_tag LOCUS_45750 gene azoR1 55 738 CDS product FMN-dependent NADH-azoreductase AzoR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114189.1 protein_id gnl|my_center|LOCUS_45750 845 1315 gene locus_tag LOCUS_45760 845 1315 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122365.1 protein_id gnl|my_center|LOCUS_45760 1387 1929 gene locus_tag LOCUS_45770 1387 1929 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922248.1 protein_id gnl|my_center|LOCUS_45770 2037 2666 gene locus_tag LOCUS_45780 2037 2666 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090559.1 protein_id gnl|my_center|LOCUS_45780 >Feature sequence374 1744 923 gene locus_tag LOCUS_45790 1744 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_45790 1814 1907 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2790 2035 gene locus_tag LOCUS_45800 2790 2035 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263747.1 protein_id gnl|my_center|LOCUS_45800 >Feature sequence375 <1 1604 gene locus_tag LOCUS_45810 <1 1604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878326.1:ABC transporter ATP-binding protein 1624 1797 gene locus_tag LOCUS_45820 1624 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 >Feature sequence376 1105 23 gene locus_tag LOCUS_45830 1105 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 1617 1117 gene locus_tag LOCUS_45840 1617 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 1881 2012 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2253 2435 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence377 198 277 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2372 2558 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence378 727 350 gene locus_tag LOCUS_45850 727 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 2237 2427 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence379 465 546 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1126 1216 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1568 1338 gene locus_tag LOCUS_45860 1568 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 2041 2169 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence380 966 526 gene locus_tag LOCUS_45870 966 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 >Feature sequence381 485 595 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 843 2387 gene locus_tag LOCUS_45880 843 2387 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228236.1 protein_id gnl|my_center|LOCUS_45880 >Feature sequence382 1048 1719 gene locus_tag LOCUS_45890 1048 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 >Feature sequence383 266 435 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 531 1883 gene locus_tag LOCUS_45900 531 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 1994 2146 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends