>Feature sequence01 926 2002 gene locus_tag LOCUS_0010 gene prfA 926 2002 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880532.1 protein_id gnl|my_center|LOCUS_0010 3366 2020 gene locus_tag LOCUS_0020 3366 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0020 4058 3372 gene locus_tag LOCUS_0030 4058 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0030 4289 4071 gene locus_tag LOCUS_0040 4289 4071 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080635.1 protein_id gnl|my_center|LOCUS_0040 5142 4282 gene locus_tag LOCUS_0050 gene fba 5142 4282 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392146.1 protein_id gnl|my_center|LOCUS_0050 6110 5139 gene locus_tag LOCUS_0060 6110 5139 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231023.1 protein_id gnl|my_center|LOCUS_0060 8531 6159 gene locus_tag LOCUS_0070 gene ppsA 8531 6159 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_0070 9464 8535 gene locus_tag LOCUS_0080 gene ppaC 9464 8535 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416849.1 protein_id gnl|my_center|LOCUS_0080 <10506 9473 gene locus_tag LOCUS_0090 <10506 9473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707110.1:acetate--CoA ligase >Feature sequence02 490 822 gene locus_tag LOCUS_0100 490 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0100 904 1254 gene locus_tag LOCUS_0110 904 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0110 2175 2921 gene locus_tag LOCUS_0120 2175 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0120 2905 3480 gene locus_tag LOCUS_0130 2905 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0130 3679 5184 gene locus_tag LOCUS_0140 3679 5184 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626412.1 protein_id gnl|my_center|LOCUS_0140 5201 7504 gene locus_tag LOCUS_0150 5201 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0150 7699 9132 gene locus_tag LOCUS_0160 7699 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0160 >Feature sequence03 741 1409 gene locus_tag LOCUS_0170 741 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0170 1517 2662 gene locus_tag LOCUS_0180 1517 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0180 3592 2615 gene locus_tag LOCUS_0190 gene pbpG 3592 2615 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707427.1 protein_id gnl|my_center|LOCUS_0190 3705 4610 gene locus_tag LOCUS_0200 3705 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0200 4615 5871 gene locus_tag LOCUS_0210 4615 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0210 5878 6288 gene locus_tag LOCUS_0220 5878 6288 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048271.1 protein_id gnl|my_center|LOCUS_0220 6278 7327 gene locus_tag LOCUS_0230 gene ychF 6278 7327 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_0230 7328 7549 gene locus_tag LOCUS_0240 7328 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0240 7546 8067 gene locus_tag LOCUS_0250 7546 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0250 8064 8513 gene locus_tag LOCUS_0260 8064 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0260 >Feature sequence04 324 4445 gene locus_tag LOCUS_0270 324 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0270 4512 4745 gene locus_tag LOCUS_0280 4512 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0280 4859 6091 gene locus_tag LOCUS_0290 4859 6091 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_0290 6590 6988 gene locus_tag LOCUS_0300 6590 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0300 7535 7017 gene locus_tag LOCUS_0310 7535 7017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0310 7673 8347 gene locus_tag LOCUS_0320 7673 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0320 8369 9061 gene locus_tag LOCUS_0330 8369 9061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0330 >Feature sequence05 1894 2424 gene locus_tag LOCUS_0340 1894 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0340 2427 3464 gene locus_tag LOCUS_0350 2427 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0350 3467 3820 gene locus_tag LOCUS_0360 3467 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0360 4845 3868 gene locus_tag LOCUS_0370 4845 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0370 5019 5852 gene locus_tag LOCUS_0380 gene rsmA 5019 5852 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 protein_id gnl|my_center|LOCUS_0380 5819 6544 gene locus_tag LOCUS_0390 5819 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0390 6656 7402 gene locus_tag LOCUS_0400 6656 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0400 >Feature sequence06 1200 148 gene locus_tag LOCUS_0410 1200 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0410 4756 1202 gene locus_tag LOCUS_0420 4756 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0420 5881 4799 gene locus_tag LOCUS_0430 5881 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0430 >Feature sequence07 <1 783 gene locus_tag LOCUS_0440 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957648.1:NAD-dependent DNA ligase LigA 1070 1873 gene locus_tag LOCUS_0450 1070 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0450 2075 5293 gene locus_tag LOCUS_0460 gene rpoB 2075 5293 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393945.1 protein_id gnl|my_center|LOCUS_0460 >Feature sequence08 <1 2110 gene locus_tag LOCUS_0470 <1 2110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583781.1:isoleucine--tRNA ligase 2120 2740 gene locus_tag LOCUS_0480 2120 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0480 2737 4443 gene locus_tag LOCUS_0490 2737 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0490 4440 5849 gene locus_tag LOCUS_0500 4440 5849 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_0500 >Feature sequence09 369 443 gene locus_tag LOCUS_t0010 369 443 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 469 837 gene locus_tag LOCUS_0510 469 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0510 821 2317 gene locus_tag LOCUS_0520 821 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0520 2327 2400 gene locus_tag LOCUS_t0020 2327 2400 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2409 2492 gene locus_tag LOCUS_t0030 2409 2492 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3063 2557 gene locus_tag LOCUS_0530 3063 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0530 3346 3274 gene locus_tag LOCUS_t0040 3346 3274 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3495 3423 gene locus_tag LOCUS_t0050 3495 3423 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3577 3502 gene locus_tag LOCUS_t0060 3577 3502 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3765 3677 gene locus_tag LOCUS_t0070 3765 3677 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4103 3774 gene locus_tag LOCUS_0540 4103 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0540 4773 4093 gene locus_tag LOCUS_0550 4773 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0550 4880 4806 gene locus_tag LOCUS_t0080 4880 4806 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5030 4956 gene locus_tag LOCUS_t0090 5030 4956 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 <6262 5110 gene locus_tag LOCUS_0560 <6262 5110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391653.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence10 1357 221 gene locus_tag LOCUS_0570 1357 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0570 2504 1536 gene locus_tag LOCUS_0580 2504 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0580 3465 2572 gene locus_tag LOCUS_0590 gene secF 3465 2572 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144153.1 protein_id gnl|my_center|LOCUS_0590 4887 3478 gene locus_tag LOCUS_0600 gene secD 4887 3478 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869961.1 protein_id gnl|my_center|LOCUS_0600 <6166 4929 gene locus_tag LOCUS_0610 <6166 4929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015945439.1:preprotein translocase subunit SecA >Feature sequence11 744 160 gene locus_tag LOCUS_0620 744 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0620 1550 1113 gene locus_tag LOCUS_0630 1550 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0630 1696 2700 gene locus_tag LOCUS_0640 1696 2700 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940714.1 protein_id gnl|my_center|LOCUS_0640 3615 4514 gene locus_tag LOCUS_0650 3615 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0650 4714 5241 gene locus_tag LOCUS_0660 4714 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0660 >Feature sequence12 1564 296 gene locus_tag LOCUS_0670 gene ftsA 1564 296 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_0670 2068 1616 gene locus_tag LOCUS_0680 gene ybeY 2068 1616 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081854.1 protein_id gnl|my_center|LOCUS_0680 2262 2041 gene locus_tag LOCUS_0690 2262 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0690 2609 2280 gene locus_tag LOCUS_0700 2609 2280 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_0700 3880 2612 gene locus_tag LOCUS_0710 gene hisS 3880 2612 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545147.1 protein_id gnl|my_center|LOCUS_0710 4465 3905 gene locus_tag LOCUS_0720 gene lepB 4465 3905 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583882.1 protein_id gnl|my_center|LOCUS_0720 4543 5139 gene locus_tag LOCUS_0730 gene pth 4543 5139 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583861.1 protein_id gnl|my_center|LOCUS_0730 5649 5167 gene locus_tag LOCUS_0740 5649 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0740 >Feature sequence13 1347 1027 gene locus_tag LOCUS_0750 1347 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0750 1706 1416 gene locus_tag LOCUS_0760 1706 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0760 2700 2140 gene locus_tag LOCUS_0770 2700 2140 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932189.1 protein_id gnl|my_center|LOCUS_0770 2926 2855 gene locus_tag LOCUS_t0100 2926 2855 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4096 2954 gene locus_tag LOCUS_0780 4096 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0780 4646 4089 gene locus_tag LOCUS_0790 4646 4089 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 protein_id gnl|my_center|LOCUS_0790 >Feature sequence14 3414 1987 gene locus_tag LOCUS_0800 gene metG 3414 1987 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041424295.1 protein_id gnl|my_center|LOCUS_0800 4438 3407 gene locus_tag LOCUS_0810 4438 3407 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989612.1 protein_id gnl|my_center|LOCUS_0810 <5408 4527 gene locus_tag LOCUS_0820 <5408 4527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258489.1:pitrilysin family protein >Feature sequence15 709 137 gene locus_tag LOCUS_0830 709 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0830 824 750 gene locus_tag LOCUS_t0110 824 750 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1008 4166 gene locus_tag LOCUS_0840 1008 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0840 >Feature sequence16 2771 1641 gene locus_tag LOCUS_0850 gene tsaD 2771 1641 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131705.1 protein_id gnl|my_center|LOCUS_0850 2945 2869 gene locus_tag LOCUS_t0120 2945 2869 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 <4972 3004 gene locus_tag LOCUS_0860 <4972 3004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583501.1:ATP-dependent DNA helicase RecG >Feature sequence17 <1 1974 gene locus_tag LOCUS_0870 <1 1974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_203473432.1:type I DNA topoisomerase 3167 2031 gene locus_tag LOCUS_0880 gene tgt 3167 2031 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902330.1 protein_id gnl|my_center|LOCUS_0880 3447 3250 gene locus_tag LOCUS_0890 3447 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0890 <4758 3521 gene locus_tag LOCUS_0900 <4758 3521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783524.1:ribonuclease R >Feature sequence18 304 693 gene locus_tag LOCUS_0910 gene rpsM 304 693 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_0910 718 1167 gene locus_tag LOCUS_0920 gene rpsK 718 1167 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919150.1 protein_id gnl|my_center|LOCUS_0920 1267 1809 gene locus_tag LOCUS_0930 gene rpsD 1267 1809 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933816.1 protein_id gnl|my_center|LOCUS_0930 1829 2779 gene locus_tag LOCUS_0940 1829 2779 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_0940 2801 3148 gene locus_tag LOCUS_0950 2801 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0950 3159 3509 gene locus_tag LOCUS_0960 gene rplM 3159 3509 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_0960 >Feature sequence19 463 1725 gene locus_tag LOCUS_0970 463 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0970 1842 2510 gene locus_tag LOCUS_0980 1842 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0980 2570 3310 gene locus_tag LOCUS_0990 2570 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0990 3313 3789 gene locus_tag LOCUS_1000 3313 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1000 >Feature sequence20 <1 644 gene locus_tag LOCUS_1010 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289241.1:PHP domain-containing protein 914 684 gene locus_tag LOCUS_1020 914 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1020 1083 1406 gene locus_tag LOCUS_1030 1083 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1030 1396 2226 gene locus_tag LOCUS_1040 1396 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1040 2364 2690 gene locus_tag LOCUS_1050 2364 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1050 2776 3789 gene locus_tag LOCUS_1060 2776 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1060 >Feature sequence21 1223 2044 gene locus_tag LOCUS_1070 1223 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1070 3547 3041 gene locus_tag LOCUS_1080 3547 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1080 <4323 3567 gene locus_tag LOCUS_1090 <4323 3567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022974.1:12,18-didecarboxysiroheme deacetylase >Feature sequence22 442 524 gene locus_tag LOCUS_t0130 442 524 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 655 2319 gene locus_tag LOCUS_1100 655 2319 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_1100 2384 3370 gene locus_tag LOCUS_1110 gene trpS 2384 3370 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245134.1 protein_id gnl|my_center|LOCUS_1110 <4173 3367 gene locus_tag LOCUS_1120 <4173 3367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496482.1:phosphomannomutase/phosphoglucomutase >Feature sequence23 <1 501 gene locus_tag LOCUS_1130 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583842.1:tyrosine--tRNA ligase 961 485 gene locus_tag LOCUS_1140 gene ruvC 961 485 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_1140 1659 958 gene locus_tag LOCUS_1150 1659 958 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081500.1 protein_id gnl|my_center|LOCUS_1150 2659 1646 gene locus_tag LOCUS_1160 gene ruvB 2659 1646 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546115.1 protein_id gnl|my_center|LOCUS_1160 3975 2665 gene locus_tag LOCUS_1170 3975 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1170 >Feature sequence24 1381 902 gene locus_tag LOCUS_1180 gene rpsG 1381 902 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081843.1 protein_id gnl|my_center|LOCUS_1180 1801 1388 gene locus_tag LOCUS_1190 gene rpsL 1801 1388 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_1190 3043 1898 gene locus_tag LOCUS_1200 gene thiI 3043 1898 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878380.1 protein_id gnl|my_center|LOCUS_1200 3240 3040 gene locus_tag LOCUS_1210 3240 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1210 <4072 3268 gene locus_tag LOCUS_1220 <4072 3268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010896031.1:tRNA 2-thiouridine(34) synthase MnmA >Feature sequence25 100 936 gene locus_tag LOCUS_1230 100 936 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173830.1 protein_id gnl|my_center|LOCUS_1230 1137 2090 gene locus_tag LOCUS_1240 1137 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1240 2248 2087 gene locus_tag LOCUS_1250 2248 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1250 2619 3167 gene locus_tag LOCUS_1260 gene ruvA 2619 3167 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732588.1 protein_id gnl|my_center|LOCUS_1260 >Feature sequence26 1984 3681 gene locus_tag LOCUS_1270 gene lepA 1984 3681 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575274.1 protein_id gnl|my_center|LOCUS_1270 >Feature sequence27 3160 2114 gene locus_tag LOCUS_1280 3160 2114 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_1280 3558 3178 gene locus_tag LOCUS_1290 3558 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1290 >Feature sequence28 723 334 gene locus_tag LOCUS_1300 723 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1300 1706 777 gene locus_tag LOCUS_1310 gene murB 1706 777 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057102.1 protein_id gnl|my_center|LOCUS_1310 3033 2008 gene locus_tag LOCUS_1320 3033 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1320 >Feature sequence29 <1 1184 gene locus_tag LOCUS_1330 <1 1184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941532.1:diadenylate cyclase CdaA 1203 2723 gene locus_tag LOCUS_1340 1203 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1340 3575 2757 gene locus_tag LOCUS_1350 3575 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1350 >Feature sequence30 168 1379 gene locus_tag LOCUS_1360 168 1379 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868819.1 protein_id gnl|my_center|LOCUS_1360 1381 2277 gene locus_tag LOCUS_1370 1381 2277 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_1370 2279 3538 gene locus_tag LOCUS_1380 2279 3538 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924918.1 protein_id gnl|my_center|LOCUS_1380 >Feature sequence31 67 510 gene locus_tag LOCUS_1390 67 510 CDS product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546858.1 protein_id gnl|my_center|LOCUS_1390 1066 497 gene locus_tag LOCUS_1400 gene efp 1066 497 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564662.1 protein_id gnl|my_center|LOCUS_1400 1564 2037 gene locus_tag LOCUS_1410 1564 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1410 2192 2470 gene locus_tag LOCUS_1420 2192 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1420 >Feature sequence32 32 1108 gene locus_tag LOCUS_1430 32 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1430 1116 2354 gene locus_tag LOCUS_1440 gene miaB 1116 2354 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_1440 2321 3232 gene locus_tag LOCUS_1450 gene miaA 2321 3232 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759993.1 protein_id gnl|my_center|LOCUS_1450 >Feature sequence33 1896 1234 gene locus_tag LOCUS_1460 1896 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1460 2596 3459 gene locus_tag LOCUS_1470 2596 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1470 >Feature sequence34 <1 749 gene locus_tag LOCUS_1480 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000466737.1:cell shape-determining protein MreB 752 1630 gene locus_tag LOCUS_1490 gene holB 752 1630 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288071.1 protein_id gnl|my_center|LOCUS_1490 1642 2202 gene locus_tag LOCUS_1500 gene frr 1642 2202 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880426.1 protein_id gnl|my_center|LOCUS_1500 2298 3359 gene locus_tag LOCUS_1510 gene rseP 2298 3359 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_1510 >Feature sequence35 317 667 gene locus_tag LOCUS_tm0010 317 667 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 703 1224 gene locus_tag LOCUS_1520 gene infC 703 1224 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965658.1 protein_id gnl|my_center|LOCUS_1520 1221 1418 gene locus_tag LOCUS_1530 1221 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1530 1450 1797 gene locus_tag LOCUS_1540 gene rplT 1450 1797 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_1540 2245 1802 gene locus_tag LOCUS_1550 gene smpB 2245 1802 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_1550 >Feature sequence36 69 290 gene locus_tag LOCUS_1560 69 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1560 287 553 gene locus_tag LOCUS_1570 gene relE3 287 553 CDS product type II toxin-antitoxin system toxin RelE3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870615.1 protein_id gnl|my_center|LOCUS_1570 1000 1230 gene locus_tag LOCUS_1580 1000 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1580 2297 3025 gene locus_tag LOCUS_1590 2297 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1590 >Feature sequence37 554 856 gene locus_tag LOCUS_1600 554 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1600 853 1266 gene locus_tag LOCUS_1610 853 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1610 >Feature sequence38 581 742 gene locus_tag LOCUS_1620 581 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1620 757 975 gene locus_tag LOCUS_1630 757 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1630 1362 1060 gene locus_tag LOCUS_1640 1362 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1640 >Feature sequence39 802 1683 gene locus_tag LOCUS_1650 802 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1650 1670 2038 gene locus_tag LOCUS_1660 1670 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1660 <3173 2270 gene locus_tag LOCUS_1670 <3173 2270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546043.1:ATP-dependent chaperone ClpB >Feature sequence40 <1 689 gene locus_tag LOCUS_1680 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881240.1:bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD 1600 1788 gene locus_tag LOCUS_1690 1600 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1690 1960 1876 gene locus_tag LOCUS_t0140 1960 1876 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2062 2448 gene locus_tag LOCUS_1700 2062 2448 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943207.1 protein_id gnl|my_center|LOCUS_1700 >Feature sequence41 2284 2580 gene locus_tag LOCUS_1710 gene groES 2284 2580 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233675.1 protein_id gnl|my_center|LOCUS_1710 >Feature sequence42 719 1036 gene locus_tag LOCUS_1720 gene rplU 719 1036 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_1720 1043 1369 gene locus_tag LOCUS_1730 1043 1369 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392095.1 protein_id gnl|my_center|LOCUS_1730 1490 1792 gene locus_tag LOCUS_1740 gene rpmA 1490 1792 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816541.1 protein_id gnl|my_center|LOCUS_1740 1881 2052 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aaaggcaaggggacggttcttttgcctta >Feature sequence43 <1 945 gene locus_tag LOCUS_1750 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584045.1:ribonucleoside triphosphate reductase 956 1267 gene locus_tag LOCUS_1760 956 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1760 1272 1967 gene locus_tag LOCUS_1770 1272 1967 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_1770 2739 2620 gene locus_tag LOCUS_1780 2739 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1780 >Feature sequence44 571 1989 gene locus_tag LOCUS_1790 571 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1790 2150 2707 gene locus_tag LOCUS_1800 2150 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1800 >Feature sequence45 >Feature sequence46 1376 885 gene locus_tag LOCUS_1810 1376 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1810 2174 1392 gene locus_tag LOCUS_1820 2174 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1820 >Feature sequence47 212 760 gene locus_tag LOCUS_1830 212 760 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021659.1 protein_id gnl|my_center|LOCUS_1830 835 1383 gene locus_tag LOCUS_1840 gene rplJ 835 1383 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235042.1 protein_id gnl|my_center|LOCUS_1840 1427 1894 gene locus_tag LOCUS_1850 gene rplL 1427 1894 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931848.1 protein_id gnl|my_center|LOCUS_1850 >Feature sequence48 213 85 gene locus_tag LOCUS_1860 213 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1860 696 268 gene locus_tag LOCUS_1870 696 268 CDS product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868935.1 protein_id gnl|my_center|LOCUS_1870 1817 708 gene locus_tag LOCUS_1880 1817 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1880 <2944 1814 gene locus_tag LOCUS_1890 <2944 1814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583493.1:phosphoglycerate kinase >Feature sequence49 457 1344 gene locus_tag LOCUS_1900 457 1344 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939418.1 protein_id gnl|my_center|LOCUS_1900 >Feature sequence50 202 618 gene locus_tag LOCUS_1910 202 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1910 740 1366 gene locus_tag LOCUS_1920 740 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1920 >Feature sequence51 646 209 gene locus_tag LOCUS_1930 646 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1930 2372 717 gene locus_tag LOCUS_1940 2372 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1940 >Feature sequence52 1319 729 gene locus_tag LOCUS_1950 gene clpP 1319 729 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049165.1 protein_id gnl|my_center|LOCUS_1950 2516 1356 gene locus_tag LOCUS_1960 gene nusA 2516 1356 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428238.1 protein_id gnl|my_center|LOCUS_1960 2807 2737 gene locus_tag LOCUS_t0150 2807 2737 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence53 499 224 gene locus_tag LOCUS_1970 499 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1970 1168 761 gene locus_tag LOCUS_1980 1168 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1980 2490 1255 gene locus_tag LOCUS_1990 2490 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1990 >Feature sequence54 600 1337 gene locus_tag LOCUS_2000 600 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2000 1322 2302 gene locus_tag LOCUS_2010 gene fmt 1322 2302 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965030.1 protein_id gnl|my_center|LOCUS_2010 >Feature sequence55 484 1677 gene locus_tag LOCUS_2020 484 1677 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243051.1 protein_id gnl|my_center|LOCUS_2020 >Feature sequence56 1809 403 gene locus_tag LOCUS_2030 1809 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2030 2594 1806 gene locus_tag LOCUS_2040 2594 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2040 >Feature sequence57 134 1759 gene locus_tag LOCUS_2050 gene pyrG 134 1759 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876058.1 protein_id gnl|my_center|LOCUS_2050 2018 1746 gene locus_tag LOCUS_2060 gene rpmA 2018 1746 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081742.1 protein_id gnl|my_center|LOCUS_2060 >Feature sequence58 1615 1872 gene locus_tag LOCUS_2070 1615 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2070 2370 1942 gene locus_tag LOCUS_2080 2370 1942 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083188.1 protein_id gnl|my_center|LOCUS_2080 >Feature sequence59 2595 718 gene locus_tag LOCUS_2090 gene leuS 2595 718 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963965.1 protein_id gnl|my_center|LOCUS_2090 >Feature sequence60 926 2092 gene locus_tag LOCUS_2100 926 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2100 >Feature sequence61 156 1025 gene locus_tag LOCUS_2110 gene rsmH 156 1025 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_2110 1018 1299 gene locus_tag LOCUS_2120 1018 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2120 >Feature sequence62 >Feature sequence63 1660 1735 gene locus_tag LOCUS_t0160 1660 1735 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1942 2028 gene locus_tag LOCUS_t0170 1942 2028 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2232 2576 gene locus_tag LOCUS_2130 2232 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2130 >Feature sequence64 202 525 gene locus_tag LOCUS_2140 gene rpsJ 202 525 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389727.1 protein_id gnl|my_center|LOCUS_2140 619 1212 gene locus_tag LOCUS_2150 gene rplC 619 1212 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545966.1 protein_id gnl|my_center|LOCUS_2150 1209 1859 gene locus_tag LOCUS_2160 gene rplD 1209 1859 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 protein_id gnl|my_center|LOCUS_2160 1846 2130 gene locus_tag LOCUS_2170 gene rplW 1846 2130 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829755.1 protein_id gnl|my_center|LOCUS_2170 >Feature sequence65 <1 1354 gene locus_tag LOCUS_2180 <1 1354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002671463.1:penicillin-binding protein 2 1373 1828 gene locus_tag LOCUS_2190 gene greA 1373 1828 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_2190 >Feature sequence66 782 1657 gene locus_tag LOCUS_2200 782 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940110.1 protein_id gnl|my_center|LOCUS_2200 2184 1672 gene locus_tag LOCUS_2210 2184 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2210 >Feature sequence67 296 829 gene locus_tag LOCUS_2220 296 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2220 972 2126 gene locus_tag LOCUS_2230 972 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2230 2164 2334 gene locus_tag LOCUS_2240 2164 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2240 >Feature sequence68 792 1187 gene locus_tag LOCUS_2250 792 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2250 1200 1589 gene locus_tag LOCUS_2260 1200 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2260 1704 1937 gene locus_tag LOCUS_2270 1704 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2270 >Feature sequence69 294 1304 gene locus_tag LOCUS_2280 gene murB 294 1304 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057102.1 protein_id gnl|my_center|LOCUS_2280 1356 1748 gene locus_tag LOCUS_2290 1356 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2290