>Feature sequence001 1209 439 gene locus_tag LOCUS_00010 1209 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2618 1245 gene locus_tag LOCUS_00020 gene glmM 2618 1245 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839748.1 protein_id gnl|my_center|LOCUS_00020 3970 2615 gene locus_tag LOCUS_00030 gene glmM 3970 2615 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839748.1 protein_id gnl|my_center|LOCUS_00030 4652 3978 gene locus_tag LOCUS_00040 4652 3978 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405492.1 protein_id gnl|my_center|LOCUS_00040 4887 5873 gene locus_tag LOCUS_00050 4887 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6634 5876 gene locus_tag LOCUS_00060 gene surE 6634 5876 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404579.1 protein_id gnl|my_center|LOCUS_00060 7245 8249 gene locus_tag LOCUS_00070 7245 8249 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763609.1 protein_id gnl|my_center|LOCUS_00070 9174 8233 gene locus_tag LOCUS_00080 9174 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9893 9354 gene locus_tag LOCUS_00090 9893 9354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10312 9893 gene locus_tag LOCUS_00100 10312 9893 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_00100 10691 10371 gene locus_tag LOCUS_00110 10691 10371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11018 11275 gene locus_tag LOCUS_00120 11018 11275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11280 13196 gene locus_tag LOCUS_00130 11280 13196 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326708.1 protein_id gnl|my_center|LOCUS_00130 13427 16477 gene locus_tag LOCUS_00140 13427 16477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17232 16522 gene locus_tag LOCUS_00150 gene rsmI 17232 16522 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656220.1 protein_id gnl|my_center|LOCUS_00150 18440 17232 gene locus_tag LOCUS_00160 gene tyrS 18440 17232 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_00160 19687 18482 gene locus_tag LOCUS_00170 19687 18482 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301172.1 protein_id gnl|my_center|LOCUS_00170 19862 21226 gene locus_tag LOCUS_00180 gene mgtE 19862 21226 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294561.1 protein_id gnl|my_center|LOCUS_00180 21317 21868 gene locus_tag LOCUS_00190 21317 21868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21953 24586 gene locus_tag LOCUS_00200 gene alaS 21953 24586 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_00200 25557 24646 gene locus_tag LOCUS_00210 25557 24646 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098734.1 protein_id gnl|my_center|LOCUS_00210 25902 26867 gene locus_tag LOCUS_00220 25902 26867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 27759 26878 gene locus_tag LOCUS_00230 27759 26878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 28015 28677 gene locus_tag LOCUS_00240 gene tmk 28015 28677 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886759.1 protein_id gnl|my_center|LOCUS_00240 28664 29626 gene locus_tag LOCUS_00250 28664 29626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 30302 29589 gene locus_tag LOCUS_00260 30302 29589 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121399.1 protein_id gnl|my_center|LOCUS_00260 32415 30313 gene locus_tag LOCUS_00270 32415 30313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 33583 32516 gene locus_tag LOCUS_00280 33583 32516 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399225.1 protein_id gnl|my_center|LOCUS_00280 35508 33580 gene locus_tag LOCUS_00290 35508 33580 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057141.1 protein_id gnl|my_center|LOCUS_00290 35749 36879 gene locus_tag LOCUS_00300 35749 36879 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410070.1 protein_id gnl|my_center|LOCUS_00300 37563 37039 gene locus_tag LOCUS_00310 37563 37039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 38113 37577 gene locus_tag LOCUS_00320 gene lepB 38113 37577 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392487.1 protein_id gnl|my_center|LOCUS_00320 38207 39166 gene locus_tag LOCUS_00330 38207 39166 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_00330 40329 39163 gene locus_tag LOCUS_00340 40329 39163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 41628 40654 gene locus_tag LOCUS_00350 41628 40654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 42811 42251 gene locus_tag LOCUS_00360 42811 42251 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_00360 43592 42813 gene locus_tag LOCUS_00370 43592 42813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 43972 43595 gene locus_tag LOCUS_00380 43972 43595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 45154 43985 gene locus_tag LOCUS_00390 45154 43985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 45656 45210 gene locus_tag LOCUS_00400 45656 45210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 46207 45653 gene locus_tag LOCUS_00410 46207 45653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 46371 47087 gene locus_tag LOCUS_00420 46371 47087 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036616.1 protein_id gnl|my_center|LOCUS_00420 47463 47047 gene locus_tag LOCUS_00430 47463 47047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 >Feature sequence002 473 1297 gene locus_tag LOCUS_00440 473 1297 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020663.1 protein_id gnl|my_center|LOCUS_00440 1473 5069 gene locus_tag LOCUS_00450 1473 5069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 5257 7413 gene locus_tag LOCUS_00460 5257 7413 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530052.1 protein_id gnl|my_center|LOCUS_00460 7503 8117 gene locus_tag LOCUS_00470 7503 8117 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405414.1 protein_id gnl|my_center|LOCUS_00470 8217 8873 gene locus_tag LOCUS_00480 gene gmhA 8217 8873 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_00480 9429 8845 gene locus_tag LOCUS_00490 9429 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 10852 9419 gene locus_tag LOCUS_00500 10852 9419 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791938.1 protein_id gnl|my_center|LOCUS_00500 10937 11251 gene locus_tag LOCUS_00510 10937 11251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 11267 11971 gene locus_tag LOCUS_00520 11267 11971 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_00520 12756 12091 gene locus_tag LOCUS_00530 12756 12091 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_00530 12817 14205 gene locus_tag LOCUS_00540 12817 14205 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_00540 14290 15405 gene locus_tag LOCUS_00550 gene asd 14290 15405 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705815.1 protein_id gnl|my_center|LOCUS_00550 15429 16394 gene locus_tag LOCUS_00560 15429 16394 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403373.1 protein_id gnl|my_center|LOCUS_00560 16457 16864 gene locus_tag LOCUS_00570 16457 16864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 17696 16905 gene locus_tag LOCUS_00580 17696 16905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 19392 17713 gene locus_tag LOCUS_00590 19392 17713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 19829 19389 gene locus_tag LOCUS_00600 19829 19389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 21174 19879 gene locus_tag LOCUS_00610 21174 19879 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921961.1 protein_id gnl|my_center|LOCUS_00610 21376 21591 gene locus_tag LOCUS_00620 gene rpmE 21376 21591 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943728.1 protein_id gnl|my_center|LOCUS_00620 21647 22759 gene locus_tag LOCUS_00630 gene prfA 21647 22759 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_00630 22861 23712 gene locus_tag LOCUS_00640 22861 23712 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040172.1 protein_id gnl|my_center|LOCUS_00640 23715 26852 gene locus_tag LOCUS_00650 23715 26852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 26887 27699 gene locus_tag LOCUS_00660 26887 27699 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444002.1 protein_id gnl|my_center|LOCUS_00660 27923 27696 gene locus_tag LOCUS_00670 27923 27696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 28891 27920 gene locus_tag LOCUS_00680 28891 27920 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530704.1 protein_id gnl|my_center|LOCUS_00680 30954 28888 gene locus_tag LOCUS_00690 30954 28888 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224904.1 protein_id gnl|my_center|LOCUS_00690 31619 30951 gene locus_tag LOCUS_00700 31619 30951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 31754 32626 gene locus_tag LOCUS_00710 31754 32626 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120323.1 protein_id gnl|my_center|LOCUS_00710 32647 34605 gene locus_tag LOCUS_00720 32647 34605 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258398.1 protein_id gnl|my_center|LOCUS_00720 35915 34782 gene locus_tag LOCUS_00730 35915 34782 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869868.1 protein_id gnl|my_center|LOCUS_00730 37628 35940 gene locus_tag LOCUS_00740 37628 35940 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_00740 38643 37726 gene locus_tag LOCUS_00750 38643 37726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 39020 38640 gene locus_tag LOCUS_00760 39020 38640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 39611 39237 gene locus_tag LOCUS_00770 39611 39237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 41100 39808 gene locus_tag LOCUS_00780 gene murA 41100 39808 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083644.1 protein_id gnl|my_center|LOCUS_00780 42288 41110 gene locus_tag LOCUS_00790 42288 41110 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968069.1 protein_id gnl|my_center|LOCUS_00790 42649 42257 gene locus_tag LOCUS_00800 42649 42257 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00800 42805 43947 gene locus_tag LOCUS_00810 42805 43947 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_00810 44453 43944 gene locus_tag LOCUS_00820 gene tpx 44453 43944 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439256.1 protein_id gnl|my_center|LOCUS_00820 45349 47529 gene locus_tag LOCUS_00830 45349 47529 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_00830 >Feature sequence003 320 1711 gene locus_tag LOCUS_00840 320 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 1756 3078 gene locus_tag LOCUS_00850 1756 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 3476 4657 gene locus_tag LOCUS_00860 3476 4657 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324953.1 protein_id gnl|my_center|LOCUS_00860 4722 5369 gene locus_tag LOCUS_00870 4722 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 5393 6025 gene locus_tag LOCUS_00880 5393 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 6044 7231 gene locus_tag LOCUS_00890 6044 7231 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_00890 7201 7818 gene locus_tag LOCUS_00900 7201 7818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 8611 8871 gene locus_tag LOCUS_00910 8611 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 9363 9554 gene locus_tag LOCUS_00920 9363 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 9556 9945 gene locus_tag LOCUS_00930 9556 9945 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546499.1 protein_id gnl|my_center|LOCUS_00930 10071 10325 gene locus_tag LOCUS_00940 10071 10325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 10654 12024 gene locus_tag LOCUS_00950 10654 12024 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295834.1 protein_id gnl|my_center|LOCUS_00950 12316 12684 gene locus_tag LOCUS_00960 12316 12684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 12980 15535 gene locus_tag LOCUS_00970 12980 15535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 15539 18040 gene locus_tag LOCUS_00980 gene gyrA 15539 18040 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931835.1 protein_id gnl|my_center|LOCUS_00980 18098 19258 gene locus_tag LOCUS_00990 gene lpxK 18098 19258 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_00990 19266 20270 gene locus_tag LOCUS_01000 gene waaF 19266 20270 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530068.1 protein_id gnl|my_center|LOCUS_01000 20905 20276 gene locus_tag LOCUS_01010 20905 20276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 22558 20909 gene locus_tag LOCUS_01020 22558 20909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 23478 22561 gene locus_tag LOCUS_01030 23478 22561 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_01030 24300 23500 gene locus_tag LOCUS_01040 24300 23500 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_01040 24759 24544 gene locus_tag LOCUS_01050 24759 24544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 27062 24825 gene locus_tag LOCUS_01060 27062 24825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 28037 27327 gene locus_tag LOCUS_01070 28037 27327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 28201 28013 gene locus_tag LOCUS_01080 28201 28013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 28589 28194 gene locus_tag LOCUS_01090 28589 28194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 29802 28660 gene locus_tag LOCUS_01100 29802 28660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 30723 29806 gene locus_tag LOCUS_01110 30723 29806 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229053.1 protein_id gnl|my_center|LOCUS_01110 30873 30949 gene locus_tag LOCUS_t00010 30873 30949 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 32644 31040 gene locus_tag LOCUS_01120 32644 31040 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921665.1 protein_id gnl|my_center|LOCUS_01120 34354 36702 gene locus_tag LOCUS_01130 34354 36702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 36689 37363 gene locus_tag LOCUS_01140 36689 37363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 37387 38808 gene locus_tag LOCUS_01150 37387 38808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 39001 38816 gene locus_tag LOCUS_01160 39001 38816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 40479 39001 gene locus_tag LOCUS_01170 40479 39001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921337.1 protein_id gnl|my_center|LOCUS_01170 41870 40626 gene locus_tag LOCUS_01180 41870 40626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 44052 41881 gene locus_tag LOCUS_01190 44052 41881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 44912 44049 gene locus_tag LOCUS_01200 44912 44049 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044966.1 protein_id gnl|my_center|LOCUS_01200 >Feature sequence004 <1 653 gene locus_tag LOCUS_01210 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006309960.1:phosphopentomutase 692 1768 gene locus_tag LOCUS_01220 692 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 1839 2489 gene locus_tag LOCUS_01230 1839 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 2499 2762 gene locus_tag LOCUS_01240 2499 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 3623 2802 gene locus_tag LOCUS_01250 3623 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 4362 3640 gene locus_tag LOCUS_01260 4362 3640 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_01260 4674 4378 gene locus_tag LOCUS_01270 4674 4378 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404796.1 protein_id gnl|my_center|LOCUS_01270 6691 4718 gene locus_tag LOCUS_01280 6691 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 7451 6807 gene locus_tag LOCUS_01290 7451 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 7640 8092 gene locus_tag LOCUS_01300 7640 8092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 8700 8089 gene locus_tag LOCUS_01310 gene recR 8700 8089 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391578.1 protein_id gnl|my_center|LOCUS_01310 9505 8702 gene locus_tag LOCUS_01320 9505 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 9770 11716 gene locus_tag LOCUS_01330 9770 11716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 11738 13306 gene locus_tag LOCUS_01340 11738 13306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 13303 14154 gene locus_tag LOCUS_01350 13303 14154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 14194 14766 gene locus_tag LOCUS_01360 14194 14766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 14763 16481 gene locus_tag LOCUS_01370 14763 16481 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_01370 16888 16517 gene locus_tag LOCUS_01380 16888 16517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 17818 16904 gene locus_tag LOCUS_01390 17818 16904 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_01390 18362 17805 gene locus_tag LOCUS_01400 18362 17805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 19777 18404 gene locus_tag LOCUS_01410 gene accC 19777 18404 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592870.1 protein_id gnl|my_center|LOCUS_01410 20234 19785 gene locus_tag LOCUS_01420 gene accB 20234 19785 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228456.1 protein_id gnl|my_center|LOCUS_01420 20384 20836 gene locus_tag LOCUS_01430 gene gspG 20384 20836 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202879.1 protein_id gnl|my_center|LOCUS_01430 21636 20851 gene locus_tag LOCUS_01440 21636 20851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 22645 21713 gene locus_tag LOCUS_01450 22645 21713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 23565 22651 gene locus_tag LOCUS_01460 23565 22651 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_01460 23921 23565 gene locus_tag LOCUS_01470 gene rplT 23921 23565 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872222.1 protein_id gnl|my_center|LOCUS_01470 24133 23939 gene locus_tag LOCUS_01480 gene rpmI 24133 23939 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125945.1 protein_id gnl|my_center|LOCUS_01480 24415 24753 gene locus_tag LOCUS_01490 24415 24753 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533029.1 protein_id gnl|my_center|LOCUS_01490 26785 24917 gene locus_tag LOCUS_01500 26785 24917 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930674.1 protein_id gnl|my_center|LOCUS_01500 28407 26788 gene locus_tag LOCUS_01510 gene nadB 28407 26788 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 protein_id gnl|my_center|LOCUS_01510 29279 28479 gene locus_tag LOCUS_01520 29279 28479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 30908 29337 gene locus_tag LOCUS_01530 30908 29337 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841463.1 protein_id gnl|my_center|LOCUS_01530 31291 32805 gene locus_tag LOCUS_01540 31291 32805 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_01540 33107 32916 gene locus_tag LOCUS_01550 33107 32916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 35782 33416 gene locus_tag LOCUS_01560 35782 33416 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765808.1 protein_id gnl|my_center|LOCUS_01560 >Feature sequence005 2263 1691 gene locus_tag LOCUS_01570 2263 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 3310 2327 gene locus_tag LOCUS_01580 gene folE2 3310 2327 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722743.1 protein_id gnl|my_center|LOCUS_01580 3565 4863 gene locus_tag LOCUS_01590 gene fucP 3565 4863 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921904.1 protein_id gnl|my_center|LOCUS_01590 6428 4860 gene locus_tag LOCUS_01600 6428 4860 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727481.1 protein_id gnl|my_center|LOCUS_01600 6932 6432 gene locus_tag LOCUS_01610 gene folK 6932 6432 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943608.1 protein_id gnl|my_center|LOCUS_01610 7841 7014 gene locus_tag LOCUS_01620 gene dapB 7841 7014 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387915.1 protein_id gnl|my_center|LOCUS_01620 7952 8836 gene locus_tag LOCUS_01630 7952 8836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 8863 9747 gene locus_tag LOCUS_01640 8863 9747 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_01640 10810 9944 gene locus_tag LOCUS_01650 10810 9944 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814526.1 protein_id gnl|my_center|LOCUS_01650 11702 10851 gene locus_tag LOCUS_01660 11702 10851 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763296.1 protein_id gnl|my_center|LOCUS_01660 12901 11699 gene locus_tag LOCUS_01670 12901 11699 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172728.1 protein_id gnl|my_center|LOCUS_01670 14118 12910 gene locus_tag LOCUS_01680 14118 12910 CDS product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 protein_id gnl|my_center|LOCUS_01680 15385 14327 gene locus_tag LOCUS_01690 15385 14327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 15468 15854 gene locus_tag LOCUS_01700 15468 15854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01700 16393 15902 gene locus_tag LOCUS_01710 16393 15902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 17122 16409 gene locus_tag LOCUS_01720 17122 16409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 17914 17153 gene locus_tag LOCUS_01730 17914 17153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 18257 17946 gene locus_tag LOCUS_01740 18257 17946 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986755.1 protein_id gnl|my_center|LOCUS_01740 18422 19258 gene locus_tag LOCUS_01750 gene thyX 18422 19258 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681263.1 protein_id gnl|my_center|LOCUS_01750 19756 19250 gene locus_tag LOCUS_01760 19756 19250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 20001 21188 gene locus_tag LOCUS_01770 20001 21188 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056064.1 protein_id gnl|my_center|LOCUS_01770 22816 21185 gene locus_tag LOCUS_01780 22816 21185 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390860.1 protein_id gnl|my_center|LOCUS_01780 23977 22817 gene locus_tag LOCUS_01790 23977 22817 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085770.1 protein_id gnl|my_center|LOCUS_01790 25236 23980 gene locus_tag LOCUS_01800 25236 23980 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463934.1 protein_id gnl|my_center|LOCUS_01800 25439 26650 gene locus_tag LOCUS_01810 gene fabF 25439 26650 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_01810 26652 29147 gene locus_tag LOCUS_01820 26652 29147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 29144 31153 gene locus_tag LOCUS_01830 29144 31153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 31162 31851 gene locus_tag LOCUS_01840 31162 31851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 31891 32148 gene locus_tag LOCUS_01850 31891 32148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 32145 32582 gene locus_tag LOCUS_01860 32145 32582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 33096 32512 gene locus_tag LOCUS_01870 33096 32512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 33251 33460 gene locus_tag LOCUS_01880 33251 33460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 34191 33697 gene locus_tag LOCUS_01890 34191 33697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 34696 34202 gene locus_tag LOCUS_01900 34696 34202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 34833 35279 gene locus_tag LOCUS_01910 34833 35279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 >Feature sequence006 767 15 gene locus_tag LOCUS_01920 767 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 1836 1030 gene locus_tag LOCUS_01930 1836 1030 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_01930 2822 1833 gene locus_tag LOCUS_01940 2822 1833 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_01940 3017 2874 gene locus_tag LOCUS_01950 3017 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 3460 3122 gene locus_tag LOCUS_01960 gene mazF 3460 3122 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_01960 3702 3460 gene locus_tag LOCUS_01970 3702 3460 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443825.1 protein_id gnl|my_center|LOCUS_01970 4414 5790 gene locus_tag LOCUS_01980 4414 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 5787 6674 gene locus_tag LOCUS_01990 5787 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 6674 7462 gene locus_tag LOCUS_02000 gene nagB 6674 7462 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030128.1 protein_id gnl|my_center|LOCUS_02000 10139 7683 gene locus_tag LOCUS_02010 10139 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 10585 12321 gene locus_tag LOCUS_02020 10585 12321 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119625.1 protein_id gnl|my_center|LOCUS_02020 12449 13858 gene locus_tag LOCUS_02030 12449 13858 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_02030 15330 14008 gene locus_tag LOCUS_02040 15330 14008 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919501.1 protein_id gnl|my_center|LOCUS_02040 15552 16643 gene locus_tag LOCUS_02050 15552 16643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 16771 18132 gene locus_tag LOCUS_02060 16771 18132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 18142 18984 gene locus_tag LOCUS_02070 18142 18984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 18981 19955 gene locus_tag LOCUS_02080 18981 19955 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922127.1 protein_id gnl|my_center|LOCUS_02080 19965 22133 gene locus_tag LOCUS_02090 19965 22133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 22130 24340 gene locus_tag LOCUS_02100 22130 24340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 25069 24590 gene locus_tag LOCUS_02110 25069 24590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 25299 25066 gene locus_tag LOCUS_02120 25299 25066 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986787.1 protein_id gnl|my_center|LOCUS_02120 25627 28008 gene locus_tag LOCUS_02130 25627 28008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 28603 27947 gene locus_tag LOCUS_02140 28603 27947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 29280 29870 gene locus_tag LOCUS_02150 29280 29870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 >Feature sequence007 565 2073 gene locus_tag LOCUS_02160 565 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 2060 5218 gene locus_tag LOCUS_02170 2060 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 5308 6675 gene locus_tag LOCUS_02180 5308 6675 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 protein_id gnl|my_center|LOCUS_02180 7411 6584 gene locus_tag LOCUS_02190 7411 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 7526 7678 gene locus_tag LOCUS_02200 gene rpmG 7526 7678 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014820.1 protein_id gnl|my_center|LOCUS_02200 8357 7743 gene locus_tag LOCUS_02210 8357 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 9724 9080 gene locus_tag LOCUS_02220 gene pdxH 9724 9080 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522643.1 protein_id gnl|my_center|LOCUS_02220 10176 9733 gene locus_tag LOCUS_02230 10176 9733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 10631 10188 gene locus_tag LOCUS_02240 10631 10188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 14598 10750 gene locus_tag LOCUS_02250 14598 10750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 15330 14689 gene locus_tag LOCUS_02260 gene upp 15330 14689 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257403.1 protein_id gnl|my_center|LOCUS_02260 15703 15909 gene locus_tag LOCUS_02270 15703 15909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 15906 16280 gene locus_tag LOCUS_02280 15906 16280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 18221 16872 gene locus_tag LOCUS_02290 gene mgtE 18221 16872 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259555.1 protein_id gnl|my_center|LOCUS_02290 18677 18318 gene locus_tag LOCUS_02300 18677 18318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 19120 18674 gene locus_tag LOCUS_02310 gene gspG 19120 18674 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_02310 21621 19147 gene locus_tag LOCUS_02320 21621 19147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 22541 21684 gene locus_tag LOCUS_02330 22541 21684 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_02330 23581 22505 gene locus_tag LOCUS_02340 23581 22505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 23722 24147 gene locus_tag LOCUS_02350 23722 24147 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_02350 24193 25698 gene locus_tag LOCUS_02360 24193 25698 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387048.1 protein_id gnl|my_center|LOCUS_02360 26032 25766 gene locus_tag LOCUS_02370 26032 25766 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389752.1 protein_id gnl|my_center|LOCUS_02370 26276 25995 gene locus_tag LOCUS_02380 26276 25995 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 protein_id gnl|my_center|LOCUS_02380 27200 26376 gene locus_tag LOCUS_02390 27200 26376 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421593.1 protein_id gnl|my_center|LOCUS_02390 28357 27248 gene locus_tag LOCUS_02400 gene aroG 28357 27248 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_02400 29049 28354 gene locus_tag LOCUS_02410 29049 28354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 29513 29058 gene locus_tag LOCUS_02420 gene nrdR 29513 29058 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_02420 >Feature sequence008 1115 603 gene locus_tag LOCUS_02430 1115 603 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980098.1 protein_id gnl|my_center|LOCUS_02430 2148 1273 gene locus_tag LOCUS_02440 gene rsmA 2148 1273 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_02440 3140 2133 gene locus_tag LOCUS_02450 gene pdxA 3140 2133 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813085.1 protein_id gnl|my_center|LOCUS_02450 4133 3144 gene locus_tag LOCUS_02460 4133 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 5655 4303 gene locus_tag LOCUS_02470 5655 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 7573 5672 gene locus_tag LOCUS_02480 7573 5672 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871983.1 protein_id gnl|my_center|LOCUS_02480 10105 7682 gene locus_tag LOCUS_02490 10105 7682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 10815 10189 gene locus_tag LOCUS_02500 10815 10189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 10711 11193 gene locus_tag LOCUS_02510 10711 11193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 12235 11276 gene locus_tag LOCUS_02520 gene metF 12235 11276 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_02520 13086 12232 gene locus_tag LOCUS_02530 13086 12232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 14930 13083 gene locus_tag LOCUS_02540 14930 13083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 16134 14920 gene locus_tag LOCUS_02550 gene metK 16134 14920 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053346.1 protein_id gnl|my_center|LOCUS_02550 16427 16351 gene locus_tag LOCUS_t00020 16427 16351 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 16465 17070 gene locus_tag LOCUS_02560 gene rsmD 16465 17070 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064430360.1 protein_id gnl|my_center|LOCUS_02560 17073 17558 gene locus_tag LOCUS_02570 gene coaD 17073 17558 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084466.1 protein_id gnl|my_center|LOCUS_02570 17591 18055 gene locus_tag LOCUS_02580 17591 18055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 18340 19347 gene locus_tag LOCUS_02590 gene plsX 18340 19347 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_02590 19344 20366 gene locus_tag LOCUS_02600 19344 20366 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460503.1 protein_id gnl|my_center|LOCUS_02600 20422 21348 gene locus_tag LOCUS_02610 gene fabD 20422 21348 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_02610 21369 22112 gene locus_tag LOCUS_02620 gene fabG 21369 22112 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933770.1 protein_id gnl|my_center|LOCUS_02620 22141 22383 gene locus_tag LOCUS_02630 gene acpP 22141 22383 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_02630 22516 23727 gene locus_tag LOCUS_02640 gene fabF 22516 23727 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_02640 24903 23764 gene locus_tag LOCUS_02650 24903 23764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 25222 25297 gene locus_tag LOCUS_t00030 25222 25297 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 25364 26572 gene locus_tag LOCUS_02660 gene tuf 25364 26572 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_02660 26719 26795 gene locus_tag LOCUS_t00040 26719 26795 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 26854 27057 gene locus_tag LOCUS_02670 26854 27057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 27084 27635 gene locus_tag LOCUS_02680 gene nusG 27084 27635 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_02680 27651 28076 gene locus_tag LOCUS_02690 gene rplK 27651 28076 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074682.1 protein_id gnl|my_center|LOCUS_02690 28076 28771 gene locus_tag LOCUS_02700 gene rplA 28076 28771 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545797.1 protein_id gnl|my_center|LOCUS_02700 >Feature sequence009 <1 1136 gene locus_tag LOCUS_02710 <1 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027323.1:Gfo/Idh/MocA family oxidoreductase 1244 1693 gene locus_tag LOCUS_02720 1244 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809638.1 protein_id gnl|my_center|LOCUS_02720 2457 2287 gene locus_tag LOCUS_02730 2457 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 2650 2835 gene locus_tag LOCUS_02740 2650 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 2849 4051 gene locus_tag LOCUS_02750 2849 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 4048 5406 gene locus_tag LOCUS_02760 gene glmM 4048 5406 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_02760 5451 6881 gene locus_tag LOCUS_02770 5451 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942546.1 protein_id gnl|my_center|LOCUS_02770 6932 7690 gene locus_tag LOCUS_02780 6932 7690 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147518.1 protein_id gnl|my_center|LOCUS_02780 7687 8454 gene locus_tag LOCUS_02790 7687 8454 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433117.1 protein_id gnl|my_center|LOCUS_02790 8451 9338 gene locus_tag LOCUS_02800 8451 9338 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942544.1 protein_id gnl|my_center|LOCUS_02800 9352 11754 gene locus_tag LOCUS_02810 gene pheT 9352 11754 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_02810 12232 13629 gene locus_tag LOCUS_02820 12232 13629 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_02820 13622 14233 gene locus_tag LOCUS_02830 13622 14233 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262563.1 protein_id gnl|my_center|LOCUS_02830 14245 15195 gene locus_tag LOCUS_02840 14245 15195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02840 15196 15804 gene locus_tag LOCUS_02850 15196 15804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02850 15992 15917 gene locus_tag LOCUS_t00050 15992 15917 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 16182 16787 gene locus_tag LOCUS_02860 gene pgsA 16182 16787 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392589.1 protein_id gnl|my_center|LOCUS_02860 16788 18167 gene locus_tag LOCUS_02870 gene der 16788 18167 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_02870 18351 18842 gene locus_tag LOCUS_02880 18351 18842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 18863 19120 gene locus_tag LOCUS_02890 18863 19120 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_02890 19662 19117 gene locus_tag LOCUS_02900 19662 19117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 20267 19659 gene locus_tag LOCUS_02910 20267 19659 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143573.1 protein_id gnl|my_center|LOCUS_02910 20685 21623 gene locus_tag LOCUS_02920 20685 21623 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392391.1 protein_id gnl|my_center|LOCUS_02920 21660 23216 gene locus_tag LOCUS_02930 21660 23216 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869758.1 protein_id gnl|my_center|LOCUS_02930 24999 23170 gene locus_tag LOCUS_02940 24999 23170 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066516.1 protein_id gnl|my_center|LOCUS_02940 26143 25109 gene locus_tag LOCUS_02950 26143 25109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 27074 26163 gene locus_tag LOCUS_02960 27074 26163 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113077.1 protein_id gnl|my_center|LOCUS_02960 <28617 27071 gene locus_tag LOCUS_02970 <28617 27071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930788.1:FtsH protease activity modulator HflK >Feature sequence010 212 478 gene locus_tag LOCUS_02980 212 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 1317 475 gene locus_tag LOCUS_02990 1317 475 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257864.1 protein_id gnl|my_center|LOCUS_02990 2159 1314 gene locus_tag LOCUS_03000 2159 1314 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257863.1 protein_id gnl|my_center|LOCUS_03000 3103 2156 gene locus_tag LOCUS_03010 gene aztC 3103 2156 CDS product zinc ABC transporter substrate-binding protein AztC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731003.1 protein_id gnl|my_center|LOCUS_03010 3288 7871 gene locus_tag LOCUS_03020 gene gltB 3288 7871 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_03020 7882 9348 gene locus_tag LOCUS_03030 7882 9348 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897870.1 protein_id gnl|my_center|LOCUS_03030 9494 9697 gene locus_tag LOCUS_03040 9494 9697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 10339 11418 gene locus_tag LOCUS_03050 10339 11418 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184876.1 protein_id gnl|my_center|LOCUS_03050 11415 14537 gene locus_tag LOCUS_03060 11415 14537 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529195.1 protein_id gnl|my_center|LOCUS_03060 14671 15642 gene locus_tag LOCUS_03070 14671 15642 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838981.1 protein_id gnl|my_center|LOCUS_03070 16860 16006 gene locus_tag LOCUS_03080 16860 16006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 17345 17016 gene locus_tag LOCUS_03090 17345 17016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 17682 17338 gene locus_tag LOCUS_03100 17682 17338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 18473 17721 gene locus_tag LOCUS_03110 18473 17721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 19739 18813 gene locus_tag LOCUS_03120 19739 18813 CDS product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929312.1 protein_id gnl|my_center|LOCUS_03120 20680 19715 gene locus_tag LOCUS_03130 20680 19715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 21649 20777 gene locus_tag LOCUS_03140 gene dapA 21649 20777 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921565.1 protein_id gnl|my_center|LOCUS_03140 22943 21678 gene locus_tag LOCUS_03150 gene lysA 22943 21678 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_03150 24146 22959 gene locus_tag LOCUS_03160 24146 22959 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_03160 24407 24652 gene locus_tag LOCUS_03170 24407 24652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 24798 25703 gene locus_tag LOCUS_03180 24798 25703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 26382 26558 gene locus_tag LOCUS_03190 26382 26558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 >Feature sequence011 184 1761 gene locus_tag LOCUS_03200 gene serA 184 1761 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061266.1 protein_id gnl|my_center|LOCUS_03200 1798 2295 gene locus_tag LOCUS_03210 1798 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 2324 3532 gene locus_tag LOCUS_03220 2324 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 3613 4257 gene locus_tag LOCUS_03230 3613 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 4279 5337 gene locus_tag LOCUS_03240 gene argC 4279 5337 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_03240 5354 6247 gene locus_tag LOCUS_03250 gene lipA 5354 6247 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946482.1 protein_id gnl|my_center|LOCUS_03250 6264 7439 gene locus_tag LOCUS_03260 gene nspC 6264 7439 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943174.1 protein_id gnl|my_center|LOCUS_03260 7534 8295 gene locus_tag LOCUS_03270 gene speB 7534 8295 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937728.1 protein_id gnl|my_center|LOCUS_03270 9509 8292 gene locus_tag LOCUS_03280 gene fabB 9509 8292 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_03280 10027 9512 gene locus_tag LOCUS_03290 gene fabA 10027 9512 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087475.1 protein_id gnl|my_center|LOCUS_03290 10149 10388 gene locus_tag LOCUS_03300 10149 10388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 10626 10453 gene locus_tag LOCUS_03310 10626 10453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 11792 11142 gene locus_tag LOCUS_03320 11792 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 14448 11923 gene locus_tag LOCUS_03330 gene mutS 14448 11923 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_03330 15823 14525 gene locus_tag LOCUS_03340 15823 14525 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037784.1 protein_id gnl|my_center|LOCUS_03340 17459 15870 gene locus_tag LOCUS_03350 gene cimA 17459 15870 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081335.1 protein_id gnl|my_center|LOCUS_03350 18688 17456 gene locus_tag LOCUS_03360 18688 17456 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545682.1 protein_id gnl|my_center|LOCUS_03360 20023 18719 gene locus_tag LOCUS_03370 20023 18719 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_03370 20701 20066 gene locus_tag LOCUS_03380 20701 20066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 20862 22952 gene locus_tag LOCUS_03390 gene fusA 20862 22952 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_03390 22995 23639 gene locus_tag LOCUS_03400 22995 23639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 24968 23643 gene locus_tag LOCUS_03410 24968 23643 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_03410 25175 25402 gene locus_tag LOCUS_03420 25175 25402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 25406 26005 gene locus_tag LOCUS_03430 25406 26005 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_03430 25987 26808 gene locus_tag LOCUS_03440 25987 26808 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227823.1 protein_id gnl|my_center|LOCUS_03440 >Feature sequence012 386 1798 gene locus_tag LOCUS_03450 gene leuC 386 1798 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340234.1 protein_id gnl|my_center|LOCUS_03450 1836 2480 gene locus_tag LOCUS_03460 gene leuD 1836 2480 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330456.1 protein_id gnl|my_center|LOCUS_03460 2502 3182 gene locus_tag LOCUS_03470 gene rpe 2502 3182 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992061.1 protein_id gnl|my_center|LOCUS_03470 3183 4985 gene locus_tag LOCUS_03480 gene lepA 3183 4985 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933118.1 protein_id gnl|my_center|LOCUS_03480 5002 6093 gene locus_tag LOCUS_03490 5002 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 7607 6111 gene locus_tag LOCUS_03500 gene guaB 7607 6111 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081543.1 protein_id gnl|my_center|LOCUS_03500 7804 7622 gene locus_tag LOCUS_03510 7804 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 7917 9854 gene locus_tag LOCUS_03520 7917 9854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 9875 11356 gene locus_tag LOCUS_03530 gene tilS 9875 11356 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404456.1 protein_id gnl|my_center|LOCUS_03530 11947 11435 gene locus_tag LOCUS_03540 11947 11435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 12852 12022 gene locus_tag LOCUS_03550 12852 12022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 13124 14464 gene locus_tag LOCUS_03560 13124 14464 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_03560 16368 15073 gene locus_tag LOCUS_03570 gene argA 16368 15073 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 protein_id gnl|my_center|LOCUS_03570 16471 16626 gene locus_tag LOCUS_03580 16471 16626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 16595 17347 gene locus_tag LOCUS_03590 16595 17347 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_03590 17751 19715 gene locus_tag LOCUS_03600 gene ftsH 17751 19715 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938574.1 protein_id gnl|my_center|LOCUS_03600 19715 20623 gene locus_tag LOCUS_03610 gene folP 19715 20623 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921057.1 protein_id gnl|my_center|LOCUS_03610 20617 21489 gene locus_tag LOCUS_03620 gene cdaA 20617 21489 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_03620 21473 22456 gene locus_tag LOCUS_03630 21473 22456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 22453 23109 gene locus_tag LOCUS_03640 22453 23109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 26321 23106 gene locus_tag LOCUS_03650 gene carB 26321 23106 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_03650 27080 26403 gene locus_tag LOCUS_03660 27080 26403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence013 62 137 gene locus_tag LOCUS_t00060 62 137 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1182 100 gene locus_tag LOCUS_03670 1182 100 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 protein_id gnl|my_center|LOCUS_03670 1863 2996 gene locus_tag LOCUS_03680 gene prfB 1863 2996 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_03680 2965 3750 gene locus_tag LOCUS_03690 gene trpC 2965 3750 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765048.1 protein_id gnl|my_center|LOCUS_03690 3758 4474 gene locus_tag LOCUS_03700 gene gloB 3758 4474 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038147181.1 protein_id gnl|my_center|LOCUS_03700 4485 5888 gene locus_tag LOCUS_03710 gene uxaC 4485 5888 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_03710 6069 7226 gene locus_tag LOCUS_03720 6069 7226 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_03720 7260 7493 gene locus_tag LOCUS_03730 7260 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 7571 8434 gene locus_tag LOCUS_03740 7571 8434 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947409.1 protein_id gnl|my_center|LOCUS_03740 8977 8399 gene locus_tag LOCUS_03750 8977 8399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 9285 9028 gene locus_tag LOCUS_03760 9285 9028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 10447 9383 gene locus_tag LOCUS_03770 10447 9383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 10606 14223 gene locus_tag LOCUS_03780 gene smc 10606 14223 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_03780 14223 15554 gene locus_tag LOCUS_03790 14223 15554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 15597 17381 gene locus_tag LOCUS_03800 15597 17381 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 protein_id gnl|my_center|LOCUS_03800 17384 19108 gene locus_tag LOCUS_03810 gene cysI 17384 19108 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470366.1 protein_id gnl|my_center|LOCUS_03810 19205 19696 gene locus_tag LOCUS_03820 19205 19696 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615909.1 protein_id gnl|my_center|LOCUS_03820 19742 20332 gene locus_tag LOCUS_03830 gene def 19742 20332 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404043.1 protein_id gnl|my_center|LOCUS_03830 20381 21004 gene locus_tag LOCUS_03840 20381 21004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 21014 22276 gene locus_tag LOCUS_03850 21014 22276 CDS product COG3014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930348.1 protein_id gnl|my_center|LOCUS_03850 22802 24265 gene locus_tag LOCUS_03860 22802 24265 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_03860 25064 24726 gene locus_tag LOCUS_03870 25064 24726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 >Feature sequence014 <1 1229 gene locus_tag LOCUS_03880 <1 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404996.1:cation:proton antiporter 1226 2806 gene locus_tag LOCUS_03890 1226 2806 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404997.1 protein_id gnl|my_center|LOCUS_03890 2858 3694 gene locus_tag LOCUS_03900 2858 3694 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729761.1 protein_id gnl|my_center|LOCUS_03900 3691 4680 gene locus_tag LOCUS_03910 3691 4680 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_03910 4677 5618 gene locus_tag LOCUS_03920 4677 5618 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_03920 6111 6473 gene locus_tag LOCUS_03930 6111 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 6599 7675 gene locus_tag LOCUS_03940 6599 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 7679 8407 gene locus_tag LOCUS_03950 7679 8407 CDS product PhoP regulatory network YrbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930885.1 protein_id gnl|my_center|LOCUS_03950 8401 10224 gene locus_tag LOCUS_03960 8401 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046859776.1 protein_id gnl|my_center|LOCUS_03960 10215 11078 gene locus_tag LOCUS_03970 10215 11078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 11476 11090 gene locus_tag LOCUS_03980 11476 11090 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_03980 11712 11473 gene locus_tag LOCUS_03990 11712 11473 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_03990 12684 11758 gene locus_tag LOCUS_04000 12684 11758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 13585 12677 gene locus_tag LOCUS_04010 13585 12677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 14850 13915 gene locus_tag LOCUS_04020 gene ribF 14850 13915 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102619.1 protein_id gnl|my_center|LOCUS_04020 15630 14857 gene locus_tag LOCUS_04030 15630 14857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 16012 15605 gene locus_tag LOCUS_04040 gene rbfA 16012 15605 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882966.1 protein_id gnl|my_center|LOCUS_04040 18143 16086 gene locus_tag LOCUS_04050 18143 16086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 19405 18140 gene locus_tag LOCUS_04060 gene nusA 19405 18140 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527896.1 protein_id gnl|my_center|LOCUS_04060 20712 19606 gene locus_tag LOCUS_04070 20712 19606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 23024 20712 gene locus_tag LOCUS_04080 23024 20712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 23832 23074 gene locus_tag LOCUS_04090 23832 23074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 25091 23829 gene locus_tag LOCUS_04100 25091 23829 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250670.1 protein_id gnl|my_center|LOCUS_04100 >Feature sequence015 2110 998 gene locus_tag LOCUS_04110 2110 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 2238 2648 gene locus_tag LOCUS_04120 2238 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 3638 2658 gene locus_tag LOCUS_04130 3638 2658 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257709.1 protein_id gnl|my_center|LOCUS_04130 4467 3625 gene locus_tag LOCUS_04140 gene mazG 4467 3625 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_04140 5202 4495 gene locus_tag LOCUS_04150 5202 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 5907 7814 gene locus_tag LOCUS_04160 5907 7814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 8721 7798 gene locus_tag LOCUS_04170 8721 7798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 8863 9768 gene locus_tag LOCUS_04180 8863 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 9827 10594 gene locus_tag LOCUS_04190 9827 10594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 11140 10625 gene locus_tag LOCUS_04200 11140 10625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 11774 11424 gene locus_tag LOCUS_04210 11774 11424 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 protein_id gnl|my_center|LOCUS_04210 12270 14315 gene locus_tag LOCUS_04220 gene uvrB 12270 14315 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330366.1 protein_id gnl|my_center|LOCUS_04220 14347 14422 gene locus_tag LOCUS_t00070 14347 14422 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 16181 14442 gene locus_tag LOCUS_04230 gene argS 16181 14442 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016438.1 protein_id gnl|my_center|LOCUS_04230 16263 16577 gene locus_tag LOCUS_04240 16263 16577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 16642 16716 gene locus_tag LOCUS_t00080 16642 16716 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 16766 17563 gene locus_tag LOCUS_04250 16766 17563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 17560 18753 gene locus_tag LOCUS_04260 17560 18753 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_04260 18756 20198 gene locus_tag LOCUS_04270 18756 20198 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077027088.1 protein_id gnl|my_center|LOCUS_04270 20789 20223 gene locus_tag LOCUS_04280 20789 20223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457036.1 protein_id gnl|my_center|LOCUS_04280 20937 21836 gene locus_tag LOCUS_04290 20937 21836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 <24271 21960 gene locus_tag LOCUS_04300 <24271 21960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092464.1:multidrug efflux RND transporter permease subunit MexK >Feature sequence016 2526 1312 gene locus_tag LOCUS_04310 2526 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 3641 2637 gene locus_tag LOCUS_04320 3641 2637 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_04320 6085 3650 gene locus_tag LOCUS_04330 6085 3650 CDS product sucrose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056890.1 protein_id gnl|my_center|LOCUS_04330 6762 6118 gene locus_tag LOCUS_04340 6762 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 6761 7399 gene locus_tag LOCUS_04350 6761 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 7406 8815 gene locus_tag LOCUS_04360 7406 8815 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_04360 8949 9872 gene locus_tag LOCUS_04370 8949 9872 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382910.1 protein_id gnl|my_center|LOCUS_04370 9879 11096 gene locus_tag LOCUS_04380 9879 11096 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382911.1 protein_id gnl|my_center|LOCUS_04380 11096 13108 gene locus_tag LOCUS_04390 11096 13108 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404295.1 protein_id gnl|my_center|LOCUS_04390 13181 14614 gene locus_tag LOCUS_04400 13181 14614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 14627 15970 gene locus_tag LOCUS_04410 14627 15970 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_04410 17251 15953 gene locus_tag LOCUS_04420 17251 15953 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_04420 18842 17352 gene locus_tag LOCUS_04430 18842 17352 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_04430 19045 21078 gene locus_tag LOCUS_04440 gene fusA 19045 21078 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583197.1 protein_id gnl|my_center|LOCUS_04440 21085 21846 gene locus_tag LOCUS_04450 21085 21846 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668967.1 protein_id gnl|my_center|LOCUS_04450 22057 22560 gene locus_tag LOCUS_04460 gene ruvC 22057 22560 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_04460 >Feature sequence017 387 656 gene locus_tag LOCUS_04470 387 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 644 892 gene locus_tag LOCUS_04480 644 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 2086 1199 gene locus_tag LOCUS_04490 2086 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 2195 2746 gene locus_tag LOCUS_04500 2195 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 2976 3719 gene locus_tag LOCUS_04510 2976 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 3839 4402 gene locus_tag LOCUS_04520 3839 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 4519 4851 gene locus_tag LOCUS_04530 4519 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 5317 5673 gene locus_tag LOCUS_04540 5317 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04540 6364 7155 gene locus_tag LOCUS_04550 6364 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 7179 7964 gene locus_tag LOCUS_04560 7179 7964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 9451 8699 gene locus_tag LOCUS_04570 9451 8699 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867247.1 protein_id gnl|my_center|LOCUS_04570 10271 9834 gene locus_tag LOCUS_04580 10271 9834 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_04580 10942 11295 gene locus_tag LOCUS_04590 gene rsfS 10942 11295 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880811.1 protein_id gnl|my_center|LOCUS_04590 11310 11963 gene locus_tag LOCUS_04600 11310 11963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 11947 12330 gene locus_tag LOCUS_04610 11947 12330 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965183.1 protein_id gnl|my_center|LOCUS_04610 12414 13646 gene locus_tag LOCUS_04620 12414 13646 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732325.1 protein_id gnl|my_center|LOCUS_04620 14460 13651 gene locus_tag LOCUS_04630 14460 13651 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339288.1 protein_id gnl|my_center|LOCUS_04630 15398 14457 gene locus_tag LOCUS_04640 15398 14457 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926960.1 protein_id gnl|my_center|LOCUS_04640 15902 17785 gene locus_tag LOCUS_04650 gene dnaX 15902 17785 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_04650 17804 18124 gene locus_tag LOCUS_04660 17804 18124 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_04660 18133 19428 gene locus_tag LOCUS_04670 gene hemL 18133 19428 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460175.1 protein_id gnl|my_center|LOCUS_04670 19425 20147 gene locus_tag LOCUS_04680 19425 20147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 20144 21193 gene locus_tag LOCUS_04690 gene hemE 20144 21193 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258456.1 protein_id gnl|my_center|LOCUS_04690 21190 22578 gene locus_tag LOCUS_04700 gene hemY 21190 22578 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245394.1 protein_id gnl|my_center|LOCUS_04700 >Feature sequence018 1879 50 gene locus_tag LOCUS_04710 1879 50 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113792.1 protein_id gnl|my_center|LOCUS_04710 2009 3145 gene locus_tag LOCUS_04720 2009 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04720 3138 4493 gene locus_tag LOCUS_04730 3138 4493 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_04730 4914 6293 gene locus_tag LOCUS_04740 4914 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 6318 6728 gene locus_tag LOCUS_04750 6318 6728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 6792 7187 gene locus_tag LOCUS_04760 6792 7187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 9146 7323 gene locus_tag LOCUS_04770 gene recD 9146 7323 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942182.1 protein_id gnl|my_center|LOCUS_04770 12937 9143 gene locus_tag LOCUS_04780 gene recB 12937 9143 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707657.1 protein_id gnl|my_center|LOCUS_04780 16389 12934 gene locus_tag LOCUS_04790 gene recC 16389 12934 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482351.1 protein_id gnl|my_center|LOCUS_04790 18394 16376 gene locus_tag LOCUS_04800 18394 16376 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_04800 18480 20807 gene locus_tag LOCUS_04810 gene hypF 18480 20807 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_04810 21557 20775 gene locus_tag LOCUS_04820 21557 20775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 <22709 21554 gene locus_tag LOCUS_04830 <22709 21554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943267.1:8-amino-7-oxononanoate synthase >Feature sequence019 6441 409 gene locus_tag LOCUS_04840 6441 409 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_04840 6857 6456 gene locus_tag LOCUS_04850 6857 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 7177 7776 gene locus_tag LOCUS_04860 7177 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 8175 8975 gene locus_tag LOCUS_04870 gene thiM 8175 8975 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939636.1 protein_id gnl|my_center|LOCUS_04870 8972 9622 gene locus_tag LOCUS_04880 gene thiE 8972 9622 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006557.1 protein_id gnl|my_center|LOCUS_04880 9619 10620 gene locus_tag LOCUS_04890 gene thiL 9619 10620 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_04890 10617 11426 gene locus_tag LOCUS_04900 gene thiD 10617 11426 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256279.1 protein_id gnl|my_center|LOCUS_04900 11441 11746 gene locus_tag LOCUS_04910 11441 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 12099 12500 gene locus_tag LOCUS_04920 12099 12500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 13605 12538 gene locus_tag LOCUS_04930 gene lpxD 13605 12538 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055887.1 protein_id gnl|my_center|LOCUS_04930 14171 13605 gene locus_tag LOCUS_04940 14171 13605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 16638 14332 gene locus_tag LOCUS_04950 gene bamA 16638 14332 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_04950 18074 16635 gene locus_tag LOCUS_04960 gene dnaB 18074 16635 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_04960 18530 18081 gene locus_tag LOCUS_04970 gene rplI 18530 18081 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881335.1 protein_id gnl|my_center|LOCUS_04970 18795 18550 gene locus_tag LOCUS_04980 18795 18550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 19310 18852 gene locus_tag LOCUS_04990 19310 18852 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339883.1 protein_id gnl|my_center|LOCUS_04990 19642 19313 gene locus_tag LOCUS_05000 gene rpsF 19642 19313 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583717.1 protein_id gnl|my_center|LOCUS_05000 20237 19674 gene locus_tag LOCUS_05010 gene pth 20237 19674 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_05010 20936 20271 gene locus_tag LOCUS_05020 20936 20271 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_05020 21885 20956 gene locus_tag LOCUS_05030 21885 20956 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_05030 22001 21928 gene locus_tag LOCUS_t00090 22001 21928 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence020 752 516 gene locus_tag LOCUS_05040 752 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 727 909 gene locus_tag LOCUS_05050 727 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 926 1336 gene locus_tag LOCUS_05060 gene nikR 926 1336 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932159.1 protein_id gnl|my_center|LOCUS_05060 1439 2533 gene locus_tag LOCUS_05070 gene dnaN 1439 2533 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725022.1 protein_id gnl|my_center|LOCUS_05070 2715 5477 gene locus_tag LOCUS_05080 gene ppdK 2715 5477 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082976.1 protein_id gnl|my_center|LOCUS_05080 5968 5660 gene locus_tag LOCUS_05090 5968 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 6302 6595 gene locus_tag LOCUS_05100 6302 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 6592 7644 gene locus_tag LOCUS_05110 6592 7644 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839428.1 protein_id gnl|my_center|LOCUS_05110 7631 10879 gene locus_tag LOCUS_05120 7631 10879 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479332.1 protein_id gnl|my_center|LOCUS_05120 10987 11151 gene locus_tag LOCUS_05130 10987 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 11310 11828 gene locus_tag LOCUS_05140 11310 11828 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938826.1 protein_id gnl|my_center|LOCUS_05140 11828 12352 gene locus_tag LOCUS_05150 11828 12352 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938827.1 protein_id gnl|my_center|LOCUS_05150 12743 12414 gene locus_tag LOCUS_05160 12743 12414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 12992 13864 gene locus_tag LOCUS_05170 gene hisG 12992 13864 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_05170 14258 16396 gene locus_tag LOCUS_05180 14258 16396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 16393 17874 gene locus_tag LOCUS_05190 16393 17874 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230024.1 protein_id gnl|my_center|LOCUS_05190 17892 18407 gene locus_tag LOCUS_05200 17892 18407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 18518 18895 gene locus_tag LOCUS_05210 18518 18895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 19381 18905 gene locus_tag LOCUS_05220 19381 18905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 19435 19623 gene locus_tag LOCUS_05230 19435 19623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence021 1282 386 gene locus_tag LOCUS_05240 1282 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 2611 1517 gene locus_tag LOCUS_05250 gene hisC 2611 1517 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943720.1 protein_id gnl|my_center|LOCUS_05250 3936 2608 gene locus_tag LOCUS_05260 gene hisD 3936 2608 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461463.1 protein_id gnl|my_center|LOCUS_05260 4214 3984 gene locus_tag LOCUS_05270 4214 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 5002 4211 gene locus_tag LOCUS_05280 5002 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 5475 4999 gene locus_tag LOCUS_05290 5475 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 6104 5472 gene locus_tag LOCUS_05300 6104 5472 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_05300 8670 6097 gene locus_tag LOCUS_05310 8670 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 9512 8679 gene locus_tag LOCUS_05320 9512 8679 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145885.1 protein_id gnl|my_center|LOCUS_05320 9569 10372 gene locus_tag LOCUS_05330 9569 10372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 10369 11310 gene locus_tag LOCUS_05340 10369 11310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 11336 12367 gene locus_tag LOCUS_05350 11336 12367 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_05350 12381 13523 gene locus_tag LOCUS_05360 12381 13523 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880493.1 protein_id gnl|my_center|LOCUS_05360 14903 14421 gene locus_tag LOCUS_05370 14903 14421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 16410 15166 gene locus_tag LOCUS_05380 gene ftsZ 16410 15166 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888984.1 protein_id gnl|my_center|LOCUS_05380 17620 16421 gene locus_tag LOCUS_05390 gene ftsA 17620 16421 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939770.1 protein_id gnl|my_center|LOCUS_05390 18512 17640 gene locus_tag LOCUS_05400 18512 17640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 19473 18532 gene locus_tag LOCUS_05410 19473 18532 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814571.1 protein_id gnl|my_center|LOCUS_05410 20881 19460 gene locus_tag LOCUS_05420 gene murC 20881 19460 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392363.1 protein_id gnl|my_center|LOCUS_05420 20983 21059 gene locus_tag LOCUS_t00100 20983 21059 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 21233 21484 gene locus_tag LOCUS_05430 21233 21484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 >Feature sequence022 47 289 gene locus_tag LOCUS_05440 47 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 286 981 gene locus_tag LOCUS_05450 gene purQ 286 981 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880691.1 protein_id gnl|my_center|LOCUS_05450 972 3230 gene locus_tag LOCUS_05460 gene purL 972 3230 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_05460 3251 4642 gene locus_tag LOCUS_05470 gene purF 3251 4642 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_05470 4635 5681 gene locus_tag LOCUS_05480 gene purM 4635 5681 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337122.1 protein_id gnl|my_center|LOCUS_05480 5883 6293 gene locus_tag LOCUS_05490 5883 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 6290 6604 gene locus_tag LOCUS_05500 6290 6604 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213210.1 protein_id gnl|my_center|LOCUS_05500 6631 7404 gene locus_tag LOCUS_05510 gene sufC 6631 7404 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259318.1 protein_id gnl|my_center|LOCUS_05510 7417 8844 gene locus_tag LOCUS_05520 gene sufB 7417 8844 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772922.1 protein_id gnl|my_center|LOCUS_05520 8864 10183 gene locus_tag LOCUS_05530 gene sufD 8864 10183 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_05530 10187 10513 gene locus_tag LOCUS_05540 10187 10513 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_05540 10517 11779 gene locus_tag LOCUS_05550 10517 11779 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_05550 11772 12206 gene locus_tag LOCUS_05560 11772 12206 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946342.1 protein_id gnl|my_center|LOCUS_05560 12206 13522 gene locus_tag LOCUS_05570 gene purD 12206 13522 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_05570 14338 13541 gene locus_tag LOCUS_05580 14338 13541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 14639 14340 gene locus_tag LOCUS_05590 14639 14340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 15480 14767 gene locus_tag LOCUS_05600 15480 14767 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_05600 15638 16186 gene locus_tag LOCUS_05610 15638 16186 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404046.1 protein_id gnl|my_center|LOCUS_05610 16190 17110 gene locus_tag LOCUS_05620 gene murB 16190 17110 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_05620 17139 17810 gene locus_tag LOCUS_05630 17139 17810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 18070 20769 gene locus_tag LOCUS_05640 18070 20769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 >Feature sequence023 1322 834 gene locus_tag LOCUS_05650 1322 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 3166 1319 gene locus_tag LOCUS_05660 3166 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 4554 3166 gene locus_tag LOCUS_05670 4554 3166 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928917.1 protein_id gnl|my_center|LOCUS_05670 5185 4646 gene locus_tag LOCUS_05680 5185 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 5694 5212 gene locus_tag LOCUS_05690 5694 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 6045 5695 gene locus_tag LOCUS_05700 6045 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 6328 6882 gene locus_tag LOCUS_05710 6328 6882 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133795409.1 protein_id gnl|my_center|LOCUS_05710 6955 7332 gene locus_tag LOCUS_05720 6955 7332 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080935.1 protein_id gnl|my_center|LOCUS_05720 7341 7865 gene locus_tag LOCUS_05730 7341 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 9290 7995 gene locus_tag LOCUS_05740 9290 7995 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_05740 11024 9453 gene locus_tag LOCUS_05750 gene cysS 11024 9453 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869759.1 protein_id gnl|my_center|LOCUS_05750 11025 11765 gene locus_tag LOCUS_05760 gene tolQ 11025 11765 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940358.1 protein_id gnl|my_center|LOCUS_05760 11781 12191 gene locus_tag LOCUS_05770 11781 12191 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010438282.1 protein_id gnl|my_center|LOCUS_05770 12188 12886 gene locus_tag LOCUS_05780 12188 12886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 12883 14118 gene locus_tag LOCUS_05790 gene tolB 12883 14118 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_05790 14196 14720 gene locus_tag LOCUS_05800 gene pal 14196 14720 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932322.1 protein_id gnl|my_center|LOCUS_05800 14734 15126 gene locus_tag LOCUS_05810 14734 15126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 15123 15923 gene locus_tag LOCUS_05820 15123 15923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 15996 17135 gene locus_tag LOCUS_05830 15996 17135 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958509.1 protein_id gnl|my_center|LOCUS_05830 17866 17132 gene locus_tag LOCUS_05840 gene trmJ 17866 17132 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 protein_id gnl|my_center|LOCUS_05840 18940 17873 gene locus_tag LOCUS_05850 18940 17873 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257568.1 protein_id gnl|my_center|LOCUS_05850 19475 18960 gene locus_tag LOCUS_05860 19475 18960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 19632 20015 gene locus_tag LOCUS_05870 gene gcvH 19632 20015 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228002.1 protein_id gnl|my_center|LOCUS_05870 20036 20728 gene locus_tag LOCUS_05880 gene lipB 20036 20728 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258689.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence024 43 957 gene locus_tag LOCUS_05890 43 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 1751 981 gene locus_tag LOCUS_05900 gene rph 1751 981 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460930.1 protein_id gnl|my_center|LOCUS_05900 2884 1763 gene locus_tag LOCUS_05910 gene lptF 2884 1763 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_05910 3782 2892 gene locus_tag LOCUS_05920 gene folD 3782 2892 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404576.1 protein_id gnl|my_center|LOCUS_05920 4803 3811 gene locus_tag LOCUS_05930 4803 3811 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028402987.1 protein_id gnl|my_center|LOCUS_05930 5867 4800 gene locus_tag LOCUS_05940 gene pheA 5867 4800 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_05940 6698 5883 gene locus_tag LOCUS_05950 6698 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 7432 6695 gene locus_tag LOCUS_05960 7432 6695 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_05960 8397 7429 gene locus_tag LOCUS_05970 gene trpS 8397 7429 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120916.1 protein_id gnl|my_center|LOCUS_05970 8659 9669 gene locus_tag LOCUS_05980 gene gapA 8659 9669 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097053.1 protein_id gnl|my_center|LOCUS_05980 9739 10992 gene locus_tag LOCUS_05990 9739 10992 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933875.1 protein_id gnl|my_center|LOCUS_05990 11071 11793 gene locus_tag LOCUS_06000 gene tpiA 11071 11793 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_06000 11832 12275 gene locus_tag LOCUS_06010 11832 12275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 12289 12633 gene locus_tag LOCUS_06020 12289 12633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 12643 13746 gene locus_tag LOCUS_06030 12643 13746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 14325 13945 gene locus_tag LOCUS_06040 14325 13945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 16376 14334 gene locus_tag LOCUS_06050 16376 14334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 17757 16378 gene locus_tag LOCUS_06060 17757 16378 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_06060 18860 17763 gene locus_tag LOCUS_06070 18860 17763 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 protein_id gnl|my_center|LOCUS_06070 20590 18863 gene locus_tag LOCUS_06080 gene pilB 20590 18863 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence025 1012 143 gene locus_tag LOCUS_06090 1012 143 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_06090 1517 993 gene locus_tag LOCUS_06100 1517 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 4245 1906 gene locus_tag LOCUS_06110 4245 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099150691.1 protein_id gnl|my_center|LOCUS_06110 4658 4921 gene locus_tag LOCUS_06120 4658 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 5694 6650 gene locus_tag LOCUS_06130 5694 6650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 6759 8174 gene locus_tag LOCUS_06140 6759 8174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 8240 8569 gene locus_tag LOCUS_06150 gene trxA 8240 8569 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280776.1 protein_id gnl|my_center|LOCUS_06150 8587 9360 gene locus_tag LOCUS_06160 8587 9360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 9388 10218 gene locus_tag LOCUS_06170 9388 10218 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403573.1 protein_id gnl|my_center|LOCUS_06170 10230 11336 gene locus_tag LOCUS_06180 gene aroC 10230 11336 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124408.1 protein_id gnl|my_center|LOCUS_06180 11355 12473 gene locus_tag LOCUS_06190 11355 12473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 12473 12931 gene locus_tag LOCUS_06200 gene ruvX 12473 12931 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837635.1 protein_id gnl|my_center|LOCUS_06200 12928 13695 gene locus_tag LOCUS_06210 gene truA 12928 13695 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_06210 13742 15190 gene locus_tag LOCUS_06220 13742 15190 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_06220 15215 16252 gene locus_tag LOCUS_06230 15215 16252 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082991.1 protein_id gnl|my_center|LOCUS_06230 16265 17083 gene locus_tag LOCUS_06240 gene menB 16265 17083 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927101.1 protein_id gnl|my_center|LOCUS_06240 17080 17970 gene locus_tag LOCUS_06250 17080 17970 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404105.1 protein_id gnl|my_center|LOCUS_06250 17974 18978 gene locus_tag LOCUS_06260 gene menC 17974 18978 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704501.1 protein_id gnl|my_center|LOCUS_06260 18984 20462 gene locus_tag LOCUS_06270 gene menE 18984 20462 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404107.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence026 2336 864 gene locus_tag LOCUS_06280 2336 864 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_06280 3483 6008 gene locus_tag LOCUS_06290 3483 6008 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_06290 6089 6838 gene locus_tag LOCUS_06300 6089 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 6876 8207 gene locus_tag LOCUS_06310 6876 8207 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767660.1 protein_id gnl|my_center|LOCUS_06310 8231 8896 gene locus_tag LOCUS_06320 8231 8896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 8910 10466 gene locus_tag LOCUS_06330 8910 10466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 10468 11103 gene locus_tag LOCUS_06340 10468 11103 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391430.1 protein_id gnl|my_center|LOCUS_06340 11116 11949 gene locus_tag LOCUS_06350 11116 11949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 12883 11960 gene locus_tag LOCUS_06360 12883 11960 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_06360 13775 12897 gene locus_tag LOCUS_06370 13775 12897 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136348290.1 protein_id gnl|my_center|LOCUS_06370 15544 13772 gene locus_tag LOCUS_06380 15544 13772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 16346 15564 gene locus_tag LOCUS_06390 gene cpaB 16346 15564 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456561.1 protein_id gnl|my_center|LOCUS_06390 17146 16382 gene locus_tag LOCUS_06400 17146 16382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 17682 17143 gene locus_tag LOCUS_06410 17682 17143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 19057 17672 gene locus_tag LOCUS_06420 19057 17672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 19725 19102 gene locus_tag LOCUS_06430 19725 19102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 19989 19744 gene locus_tag LOCUS_06440 19989 19744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 20197 20015 gene locus_tag LOCUS_06450 20197 20015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 >Feature sequence027 583 1038 gene locus_tag LOCUS_06460 583 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 1070 1309 gene locus_tag LOCUS_06470 1070 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 1306 1506 gene locus_tag LOCUS_06480 1306 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 2516 1560 gene locus_tag LOCUS_06490 2516 1560 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_06490 4991 2775 gene locus_tag LOCUS_06500 4991 2775 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933069.1 protein_id gnl|my_center|LOCUS_06500 5081 5404 gene locus_tag LOCUS_06510 5081 5404 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037236.1 protein_id gnl|my_center|LOCUS_06510 5710 6732 gene locus_tag LOCUS_06520 5710 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 7222 6827 gene locus_tag LOCUS_06530 7222 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 10024 7229 gene locus_tag LOCUS_06540 10024 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 11883 10024 gene locus_tag LOCUS_06550 11883 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 12010 12798 gene locus_tag LOCUS_06560 12010 12798 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545754.1 protein_id gnl|my_center|LOCUS_06560 12807 13490 gene locus_tag LOCUS_06570 12807 13490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 13448 14443 gene locus_tag LOCUS_06580 13448 14443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 14533 15384 gene locus_tag LOCUS_06590 14533 15384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 15377 15853 gene locus_tag LOCUS_06600 15377 15853 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545293.1 protein_id gnl|my_center|LOCUS_06600 15850 16794 gene locus_tag LOCUS_06610 15850 16794 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546256.1 protein_id gnl|my_center|LOCUS_06610 16802 18937 gene locus_tag LOCUS_06620 16802 18937 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681441.1 protein_id gnl|my_center|LOCUS_06620 18948 19805 gene locus_tag LOCUS_06630 18948 19805 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389564.1 protein_id gnl|my_center|LOCUS_06630 >Feature sequence028 1450 224 gene locus_tag LOCUS_06640 1450 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 3450 1552 gene locus_tag LOCUS_06650 3450 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 4304 4645 gene locus_tag LOCUS_06660 4304 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 4642 5376 gene locus_tag LOCUS_06670 4642 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 5506 6378 gene locus_tag LOCUS_06680 5506 6378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 7166 6336 gene locus_tag LOCUS_06690 7166 6336 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_06690 7391 7999 gene locus_tag LOCUS_06700 7391 7999 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 protein_id gnl|my_center|LOCUS_06700 9367 8135 gene locus_tag LOCUS_06710 gene eboE 9367 8135 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_06710 10671 9364 gene locus_tag LOCUS_06720 gene guaD 10671 9364 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104657.1 protein_id gnl|my_center|LOCUS_06720 11523 10711 gene locus_tag LOCUS_06730 11523 10711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 11918 12892 gene locus_tag LOCUS_06740 11918 12892 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_06740 12868 13806 gene locus_tag LOCUS_06750 12868 13806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 15015 13891 gene locus_tag LOCUS_06760 gene lpxC 15015 13891 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976203.1 protein_id gnl|my_center|LOCUS_06760 15866 15012 gene locus_tag LOCUS_06770 15866 15012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 16339 15890 gene locus_tag LOCUS_06780 16339 15890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 19612 16367 gene locus_tag LOCUS_06790 19612 16367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 >Feature sequence029 1239 133 gene locus_tag LOCUS_06800 1239 133 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257578.1 protein_id gnl|my_center|LOCUS_06800 2057 1236 gene locus_tag LOCUS_06810 2057 1236 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943077.1 protein_id gnl|my_center|LOCUS_06810 2488 4281 gene locus_tag LOCUS_06820 2488 4281 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001970104.1 protein_id gnl|my_center|LOCUS_06820 4298 5332 gene locus_tag LOCUS_06830 4298 5332 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121766.1 protein_id gnl|my_center|LOCUS_06830 5486 5229 gene locus_tag LOCUS_06840 5486 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 6010 5483 gene locus_tag LOCUS_06850 6010 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 7323 6007 gene locus_tag LOCUS_06860 7323 6007 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_06860 7826 7332 gene locus_tag LOCUS_06870 7826 7332 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031962.1 protein_id gnl|my_center|LOCUS_06870 9309 7834 gene locus_tag LOCUS_06880 9309 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 10788 9376 gene locus_tag LOCUS_06890 10788 9376 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482205.1 protein_id gnl|my_center|LOCUS_06890 10933 11496 gene locus_tag LOCUS_06900 gene pyrE 10933 11496 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_06900 11612 12217 gene locus_tag LOCUS_06910 gene ppiA 11612 12217 CDS product peptidylprolyl isomerase PpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114812.1 protein_id gnl|my_center|LOCUS_06910 12204 13055 gene locus_tag LOCUS_06920 gene larE 12204 13055 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_06920 13341 14225 gene locus_tag LOCUS_06930 13341 14225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 14229 15233 gene locus_tag LOCUS_06940 14229 15233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 15242 16372 gene locus_tag LOCUS_06950 15242 16372 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870430.1 protein_id gnl|my_center|LOCUS_06950 17827 16526 gene locus_tag LOCUS_06960 17827 16526 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378953.1 protein_id gnl|my_center|LOCUS_06960 18394 17831 gene locus_tag LOCUS_06970 18394 17831 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461368.1 protein_id gnl|my_center|LOCUS_06970 19404 18391 gene locus_tag LOCUS_06980 19404 18391 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_06980 >Feature sequence030 584 405 gene locus_tag LOCUS_06990 584 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 540 2117 gene locus_tag LOCUS_07000 540 2117 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813188.1 protein_id gnl|my_center|LOCUS_07000 4506 2059 gene locus_tag LOCUS_07010 4506 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 4702 6918 gene locus_tag LOCUS_07020 4702 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 6906 9077 gene locus_tag LOCUS_07030 6906 9077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 9096 11003 gene locus_tag LOCUS_07040 9096 11003 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227769.1 protein_id gnl|my_center|LOCUS_07040 14141 11028 gene locus_tag LOCUS_07050 14141 11028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 14827 14138 gene locus_tag LOCUS_07060 14827 14138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 15054 16247 gene locus_tag LOCUS_07070 15054 16247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490227.1 protein_id gnl|my_center|LOCUS_07070 16361 16435 gene locus_tag LOCUS_t00110 16361 16435 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 16654 17301 gene locus_tag LOCUS_07080 16654 17301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 17301 18515 gene locus_tag LOCUS_07090 gene dnaJ 17301 18515 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_07090 18538 19311 gene locus_tag LOCUS_07100 gene rsmE 18538 19311 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222501.1 protein_id gnl|my_center|LOCUS_07100 >Feature sequence031 <1 1026 gene locus_tag LOCUS_07110 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966352.1:glycosyltransferase family 4 protein 1019 1456 gene locus_tag LOCUS_07120 gene tsaE 1019 1456 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_07120 1453 2127 gene locus_tag LOCUS_07130 1453 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 3624 2146 gene locus_tag LOCUS_07140 3624 2146 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_07140 7442 3753 gene locus_tag LOCUS_07150 gene metH 7442 3753 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113602.1 protein_id gnl|my_center|LOCUS_07150 8338 7571 gene locus_tag LOCUS_07160 8338 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 8428 9072 gene locus_tag LOCUS_07170 gene eda 8428 9072 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_07170 9084 9160 gene locus_tag LOCUS_t00120 9084 9160 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9272 10456 gene locus_tag LOCUS_07180 9272 10456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 12068 10578 gene locus_tag LOCUS_07190 12068 10578 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462181.1 protein_id gnl|my_center|LOCUS_07190 12484 14199 gene locus_tag LOCUS_07200 12484 14199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 14202 15200 gene locus_tag LOCUS_07210 14202 15200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 15197 16276 gene locus_tag LOCUS_07220 15197 16276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 >Feature sequence032 740 1090 gene locus_tag LOCUS_07230 740 1090 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920612.1 protein_id gnl|my_center|LOCUS_07230 1133 2137 gene locus_tag LOCUS_07240 1133 2137 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_07240 3634 2477 gene locus_tag LOCUS_07250 3634 2477 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388806.1 protein_id gnl|my_center|LOCUS_07250 4128 3631 gene locus_tag LOCUS_07260 gene purE 4128 3631 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_07260 5116 4130 gene locus_tag LOCUS_07270 gene rnhC 5116 4130 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883701.1 protein_id gnl|my_center|LOCUS_07270 6832 5132 gene locus_tag LOCUS_07280 6832 5132 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329982.1 protein_id gnl|my_center|LOCUS_07280 6985 7962 gene locus_tag LOCUS_07290 6985 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 7959 8414 gene locus_tag LOCUS_07300 7959 8414 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124736.1 protein_id gnl|my_center|LOCUS_07300 8411 9121 gene locus_tag LOCUS_07310 8411 9121 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126003.1 protein_id gnl|my_center|LOCUS_07310 9281 9703 gene locus_tag LOCUS_07320 9281 9703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 10645 9722 gene locus_tag LOCUS_07330 10645 9722 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_07330 11726 10752 gene locus_tag LOCUS_07340 11726 10752 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_07340 12997 11795 gene locus_tag LOCUS_07350 12997 11795 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368549.1 protein_id gnl|my_center|LOCUS_07350 13444 13010 gene locus_tag LOCUS_07360 13444 13010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 13940 13527 gene locus_tag LOCUS_07370 13940 13527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 14164 13937 gene locus_tag LOCUS_07380 14164 13937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 14314 16635 gene locus_tag LOCUS_07390 14314 16635 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869185.1 protein_id gnl|my_center|LOCUS_07390 16656 17150 gene locus_tag LOCUS_07400 16656 17150 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_07400 17150 18031 gene locus_tag LOCUS_07410 17150 18031 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393454.1 protein_id gnl|my_center|LOCUS_07410 >Feature sequence033 797 1324 gene locus_tag LOCUS_07420 797 1324 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902865.1 protein_id gnl|my_center|LOCUS_07420 1378 2100 gene locus_tag LOCUS_07430 1378 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 2100 3116 gene locus_tag LOCUS_07440 2100 3116 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122039.1 protein_id gnl|my_center|LOCUS_07440 3140 4534 gene locus_tag LOCUS_07450 3140 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 4870 5181 gene locus_tag LOCUS_07460 4870 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 5178 5447 gene locus_tag LOCUS_07470 5178 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 5885 5502 gene locus_tag LOCUS_07480 5885 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 6075 7064 gene locus_tag LOCUS_07490 6075 7064 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 protein_id gnl|my_center|LOCUS_07490 9679 7061 gene locus_tag LOCUS_07500 gene clpB 9679 7061 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_07500 9804 10493 gene locus_tag LOCUS_07510 9804 10493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 10691 12034 gene locus_tag LOCUS_07520 10691 12034 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294624.1 protein_id gnl|my_center|LOCUS_07520 12039 14264 gene locus_tag LOCUS_07530 12039 14264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 14261 14803 gene locus_tag LOCUS_07540 14261 14803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 14868 14953 gene locus_tag LOCUS_t00130 14868 14953 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 16094 15210 gene locus_tag LOCUS_07550 16094 15210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 16578 16453 gene locus_tag LOCUS_07560 16578 16453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 16912 17166 gene locus_tag LOCUS_07570 16912 17166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 17583 17230 gene locus_tag LOCUS_07580 17583 17230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 <18241 17648 gene locus_tag LOCUS_07590 <18241 17648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015670.1:ATP/GTP-binding protein >Feature sequence034 89 4 gene locus_tag LOCUS_t00140 89 4 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 202 795 gene locus_tag LOCUS_07600 202 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 792 1334 gene locus_tag LOCUS_07610 792 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 1354 2679 gene locus_tag LOCUS_07620 gene xylA 1354 2679 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039169.1 protein_id gnl|my_center|LOCUS_07620 3484 2714 gene locus_tag LOCUS_07630 3484 2714 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067370.1 protein_id gnl|my_center|LOCUS_07630 4662 3481 gene locus_tag LOCUS_07640 4662 3481 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393241.1 protein_id gnl|my_center|LOCUS_07640 5167 4712 gene locus_tag LOCUS_07650 5167 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 6567 5164 gene locus_tag LOCUS_07660 6567 5164 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107138.1 protein_id gnl|my_center|LOCUS_07660 6693 7319 gene locus_tag LOCUS_07670 gene hisB 6693 7319 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_07670 7376 8032 gene locus_tag LOCUS_07680 gene hisH 7376 8032 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817212.1 protein_id gnl|my_center|LOCUS_07680 8004 8750 gene locus_tag LOCUS_07690 gene hisA 8004 8750 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_07690 8747 10039 gene locus_tag LOCUS_07700 8747 10039 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392573.1 protein_id gnl|my_center|LOCUS_07700 11043 10036 gene locus_tag LOCUS_07710 11043 10036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062194302.1 protein_id gnl|my_center|LOCUS_07710 11229 11153 gene locus_tag LOCUS_t00150 11229 11153 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 11981 11298 gene locus_tag LOCUS_07720 11981 11298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 12486 11989 gene locus_tag LOCUS_07730 12486 11989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 13830 12532 gene locus_tag LOCUS_07740 13830 12532 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460659.1 protein_id gnl|my_center|LOCUS_07740 17063 13860 gene locus_tag LOCUS_07750 17063 13860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 >Feature sequence035 299 988 gene locus_tag LOCUS_07760 299 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 1033 1857 gene locus_tag LOCUS_07770 1033 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 4242 1981 gene locus_tag LOCUS_07780 4242 1981 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_07780 4462 5241 gene locus_tag LOCUS_07790 4462 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 5245 5892 gene locus_tag LOCUS_07800 5245 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 5899 6357 gene locus_tag LOCUS_07810 5899 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938247.1 protein_id gnl|my_center|LOCUS_07810 6357 6971 gene locus_tag LOCUS_07820 gene cbiM 6357 6971 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938357.1 protein_id gnl|my_center|LOCUS_07820 6968 7708 gene locus_tag LOCUS_07830 gene cbiQ 6968 7708 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626426.1 protein_id gnl|my_center|LOCUS_07830 7705 8364 gene locus_tag LOCUS_07840 7705 8364 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546570.1 protein_id gnl|my_center|LOCUS_07840 9184 10725 gene locus_tag LOCUS_07850 9184 10725 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964653.1 protein_id gnl|my_center|LOCUS_07850 10741 11646 gene locus_tag LOCUS_07860 10741 11646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 12758 11628 gene locus_tag LOCUS_07870 12758 11628 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926965.1 protein_id gnl|my_center|LOCUS_07870 13956 12760 gene locus_tag LOCUS_07880 13956 12760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 14069 14617 gene locus_tag LOCUS_07890 gene mog 14069 14617 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140668.1 protein_id gnl|my_center|LOCUS_07890 14614 15003 gene locus_tag LOCUS_07900 14614 15003 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964456.1 protein_id gnl|my_center|LOCUS_07900 15344 15000 gene locus_tag LOCUS_07910 15344 15000 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294592.1 protein_id gnl|my_center|LOCUS_07910 15382 16692 gene locus_tag LOCUS_07920 15382 16692 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242311.1 protein_id gnl|my_center|LOCUS_07920 16703 17533 gene locus_tag LOCUS_07930 16703 17533 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289198.1 protein_id gnl|my_center|LOCUS_07930 17523 17927 gene locus_tag LOCUS_07940 17523 17927 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence036 1108 203 gene locus_tag LOCUS_07950 1108 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 1340 1867 gene locus_tag LOCUS_07960 1340 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 3051 1864 gene locus_tag LOCUS_07970 gene ygeW 3051 1864 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303128.1 protein_id gnl|my_center|LOCUS_07970 4040 3054 gene locus_tag LOCUS_07980 4040 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 4210 4788 gene locus_tag LOCUS_07990 4210 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 4819 5823 gene locus_tag LOCUS_08000 4819 5823 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729221.1 protein_id gnl|my_center|LOCUS_08000 5965 7518 gene locus_tag LOCUS_08010 5965 7518 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840173.1 protein_id gnl|my_center|LOCUS_08010 7515 8576 gene locus_tag LOCUS_08020 7515 8576 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228819.1 protein_id gnl|my_center|LOCUS_08020 8834 8598 gene locus_tag LOCUS_08030 8834 8598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 9429 10301 gene locus_tag LOCUS_08040 gene nadC 9429 10301 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_08040 10298 11083 gene locus_tag LOCUS_08050 10298 11083 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869867.1 protein_id gnl|my_center|LOCUS_08050 11094 11903 gene locus_tag LOCUS_08060 gene trpA 11094 11903 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338525.1 protein_id gnl|my_center|LOCUS_08060 11900 12988 gene locus_tag LOCUS_08070 11900 12988 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006523900.1 protein_id gnl|my_center|LOCUS_08070 13225 14655 gene locus_tag LOCUS_08080 gene gndA 13225 14655 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056424.1 protein_id gnl|my_center|LOCUS_08080 14831 16948 gene locus_tag LOCUS_08090 14831 16948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 >Feature sequence037 2726 513 gene locus_tag LOCUS_08100 gene glgB 2726 513 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_08100 2791 3957 gene locus_tag LOCUS_08110 gene proB 2791 3957 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 protein_id gnl|my_center|LOCUS_08110 3944 5200 gene locus_tag LOCUS_08120 3944 5200 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_08120 8176 5339 gene locus_tag LOCUS_08130 gene uvrA 8176 5339 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_08130 9351 8173 gene locus_tag LOCUS_08140 gene metK 9351 8173 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_08140 11163 9394 gene locus_tag LOCUS_08150 gene ptsP 11163 9394 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_08150 11489 11187 gene locus_tag LOCUS_08160 11489 11187 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844956.1 protein_id gnl|my_center|LOCUS_08160 12427 11486 gene locus_tag LOCUS_08170 gene hprK 12427 11486 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 protein_id gnl|my_center|LOCUS_08170 12801 12448 gene locus_tag LOCUS_08180 gene hpf 12801 12448 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162480.1 protein_id gnl|my_center|LOCUS_08180 13590 12826 gene locus_tag LOCUS_08190 gene lptB 13590 12826 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047473.1 protein_id gnl|my_center|LOCUS_08190 14098 13568 gene locus_tag LOCUS_08200 14098 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 14599 14102 gene locus_tag LOCUS_08210 14599 14102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 15429 14596 gene locus_tag LOCUS_08220 gene kdsA 15429 14596 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_08220 16210 15443 gene locus_tag LOCUS_08230 gene kdsB 16210 15443 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_08230 <17228 16207 gene locus_tag LOCUS_08240 <17228 16207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921467.1:D-glycero-beta-D-manno-heptose-7-phosphate kinase >Feature sequence038 986 432 gene locus_tag LOCUS_08250 986 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 1185 1760 gene locus_tag LOCUS_08260 1185 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1766 3037 gene locus_tag LOCUS_08270 gene serS 1766 3037 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391570.1 protein_id gnl|my_center|LOCUS_08270 3872 3456 gene locus_tag LOCUS_08280 3872 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 4069 3869 gene locus_tag LOCUS_08290 4069 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 5873 4164 gene locus_tag LOCUS_08300 5873 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 6410 5877 gene locus_tag LOCUS_08310 6410 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 7389 6937 gene locus_tag LOCUS_08320 7389 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 7945 7490 gene locus_tag LOCUS_08330 7945 7490 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_08330 8983 8141 gene locus_tag LOCUS_08340 8983 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 11708 8976 gene locus_tag LOCUS_08350 gene mksF 11708 8976 CDS product Mks condensin complex protein MksF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113519.1 protein_id gnl|my_center|LOCUS_08350 12295 11705 gene locus_tag LOCUS_08360 gene mksE 12295 11705 CDS product Mks condensin complex protein MksE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095041.1 protein_id gnl|my_center|LOCUS_08360 13259 12288 gene locus_tag LOCUS_08370 13259 12288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 13767 13354 gene locus_tag LOCUS_08380 13767 13354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 13967 13764 gene locus_tag LOCUS_08390 13967 13764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 15518 14244 gene locus_tag LOCUS_08400 15518 14244 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071740.1 protein_id gnl|my_center|LOCUS_08400 15682 16725 gene locus_tag LOCUS_08410 15682 16725 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257479.1 protein_id gnl|my_center|LOCUS_08410 16952 16876 gene locus_tag LOCUS_t00160 16952 16876 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence039 615 208 gene locus_tag LOCUS_08420 615 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 2434 620 gene locus_tag LOCUS_08430 2434 620 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332193.1 protein_id gnl|my_center|LOCUS_08430 3441 2467 gene locus_tag LOCUS_08440 3441 2467 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_08440 4592 3528 gene locus_tag LOCUS_08450 4592 3528 CDS product agarase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189932637.1 protein_id gnl|my_center|LOCUS_08450 5802 5206 gene locus_tag LOCUS_08460 gene orn 5802 5206 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095280.1 protein_id gnl|my_center|LOCUS_08460 5904 7010 gene locus_tag LOCUS_08470 gene alr 5904 7010 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_08470 7266 7048 gene locus_tag LOCUS_08480 7266 7048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 8106 7351 gene locus_tag LOCUS_08490 8106 7351 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405277.1 protein_id gnl|my_center|LOCUS_08490 9911 8103 gene locus_tag LOCUS_08500 9911 8103 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099968.1 protein_id gnl|my_center|LOCUS_08500 11782 9923 gene locus_tag LOCUS_08510 11782 9923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 12774 11779 gene locus_tag LOCUS_08520 12774 11779 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_08520 13769 12771 gene locus_tag LOCUS_08530 13769 12771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 14653 13769 gene locus_tag LOCUS_08540 14653 13769 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_08540 15651 14653 gene locus_tag LOCUS_08550 15651 14653 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761573.1 protein_id gnl|my_center|LOCUS_08550 16181 16435 gene locus_tag LOCUS_08560 16181 16435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence040 1546 407 gene locus_tag LOCUS_08570 1546 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 2365 4005 gene locus_tag LOCUS_08580 gene purH 2365 4005 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023907.1 protein_id gnl|my_center|LOCUS_08580 4747 4025 gene locus_tag LOCUS_08590 4747 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 5591 4755 gene locus_tag LOCUS_08600 gene proC 5591 4755 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694358.1 protein_id gnl|my_center|LOCUS_08600 6307 5588 gene locus_tag LOCUS_08610 6307 5588 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546351.1 protein_id gnl|my_center|LOCUS_08610 6363 6653 gene locus_tag LOCUS_08620 6363 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 7450 6755 gene locus_tag LOCUS_08630 7450 6755 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_08630 9988 7562 gene locus_tag LOCUS_08640 9988 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 10505 10233 gene locus_tag LOCUS_08650 10505 10233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 10696 10944 gene locus_tag LOCUS_08660 10696 10944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 10928 11332 gene locus_tag LOCUS_08670 10928 11332 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879504.1 protein_id gnl|my_center|LOCUS_08670 11577 13136 gene locus_tag LOCUS_08680 11577 13136 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393174.1 protein_id gnl|my_center|LOCUS_08680 13235 13681 gene locus_tag LOCUS_08690 13235 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 13671 14114 gene locus_tag LOCUS_08700 13671 14114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 14095 14523 gene locus_tag LOCUS_08710 14095 14523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 15290 16072 gene locus_tag LOCUS_08720 15290 16072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 16072 16212 gene locus_tag LOCUS_08730 16072 16212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 >Feature sequence041 149 73 gene locus_tag LOCUS_t00170 149 73 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 286 2064 gene locus_tag LOCUS_08740 gene aspS 286 2064 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_08740 2061 3152 gene locus_tag LOCUS_08750 gene murG 2061 3152 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931257.1 protein_id gnl|my_center|LOCUS_08750 4447 3149 gene locus_tag LOCUS_08760 4447 3149 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976064.1 protein_id gnl|my_center|LOCUS_08760 4739 4509 gene locus_tag LOCUS_08770 4739 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 4901 5380 gene locus_tag LOCUS_08780 4901 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 5421 5627 gene locus_tag LOCUS_08790 5421 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 5624 6598 gene locus_tag LOCUS_08800 gene rsmH 5624 6598 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_08800 6595 6969 gene locus_tag LOCUS_08810 6595 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 6981 8711 gene locus_tag LOCUS_08820 6981 8711 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545621.1 protein_id gnl|my_center|LOCUS_08820 8690 10192 gene locus_tag LOCUS_08830 8690 10192 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_08830 10189 11583 gene locus_tag LOCUS_08840 10189 11583 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_08840 11585 12721 gene locus_tag LOCUS_08850 gene mraY 11585 12721 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204335.1 protein_id gnl|my_center|LOCUS_08850 12726 14087 gene locus_tag LOCUS_08860 gene murD 12726 14087 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939776.1 protein_id gnl|my_center|LOCUS_08860 14084 14992 gene locus_tag LOCUS_08870 14084 14992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 14999 16150 gene locus_tag LOCUS_08880 gene spoVE 14999 16150 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence042 458 1138 gene locus_tag LOCUS_08890 458 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 1138 1395 gene locus_tag LOCUS_08900 1138 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 2244 1882 gene locus_tag LOCUS_08910 2244 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 4657 2306 gene locus_tag LOCUS_08920 4657 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 6207 4654 gene locus_tag LOCUS_08930 6207 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 8334 6214 gene locus_tag LOCUS_08940 8334 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 10093 8309 gene locus_tag LOCUS_08950 10093 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 13175 10065 gene locus_tag LOCUS_08960 13175 10065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 14401 13376 gene locus_tag LOCUS_08970 14401 13376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 <15953 14476 gene locus_tag LOCUS_08980 <15953 14476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036269.1:3'-5' exonuclease >Feature sequence043 713 273 gene locus_tag LOCUS_08990 713 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1785 742 gene locus_tag LOCUS_09000 gene nadA 1785 742 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404647.1 protein_id gnl|my_center|LOCUS_09000 2058 2975 gene locus_tag LOCUS_09010 2058 2975 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869059.1 protein_id gnl|my_center|LOCUS_09010 3026 5593 gene locus_tag LOCUS_09020 3026 5593 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272644.1 protein_id gnl|my_center|LOCUS_09020 6570 5590 gene locus_tag LOCUS_09030 6570 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 7472 6603 gene locus_tag LOCUS_09040 7472 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 8872 7490 gene locus_tag LOCUS_09050 gene hydA 8872 7490 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_09050 9546 8869 gene locus_tag LOCUS_09060 9546 8869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 10326 9565 gene locus_tag LOCUS_09070 10326 9565 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_09070 11681 10773 gene locus_tag LOCUS_09080 11681 10773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 12394 11681 gene locus_tag LOCUS_09090 12394 11681 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089397.1 protein_id gnl|my_center|LOCUS_09090 12672 12472 gene locus_tag LOCUS_09100 gene thiS 12672 12472 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005357774.1 protein_id gnl|my_center|LOCUS_09100 13751 12669 gene locus_tag LOCUS_09110 gene thiO 13751 12669 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957508.1 protein_id gnl|my_center|LOCUS_09110 15640 13748 gene locus_tag LOCUS_09120 gene thiC 15640 13748 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929683.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence044 793 551 gene locus_tag LOCUS_09130 793 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 689 2275 gene locus_tag LOCUS_09140 689 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 2372 4522 gene locus_tag LOCUS_09150 2372 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 5327 6721 gene locus_tag LOCUS_09160 5327 6721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 6761 7720 gene locus_tag LOCUS_09170 6761 7720 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_09170 8472 7840 gene locus_tag LOCUS_09180 8472 7840 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228051.1 protein_id gnl|my_center|LOCUS_09180 10032 8968 gene locus_tag LOCUS_09190 10032 8968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 10823 10047 gene locus_tag LOCUS_09200 gene recO 10823 10047 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392138.1 protein_id gnl|my_center|LOCUS_09200 11605 10820 gene locus_tag LOCUS_09210 11605 10820 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531909.1 protein_id gnl|my_center|LOCUS_09210 11894 11598 gene locus_tag LOCUS_09220 11894 11598 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333249.1 protein_id gnl|my_center|LOCUS_09220 12083 12910 gene locus_tag LOCUS_09230 12083 12910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 12993 14207 gene locus_tag LOCUS_09240 12993 14207 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391154.1 protein_id gnl|my_center|LOCUS_09240 14237 14325 gene locus_tag LOCUS_t00180 14237 14325 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 14465 15262 gene locus_tag LOCUS_09250 14465 15262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 15259 15750 gene locus_tag LOCUS_09260 15259 15750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence045 378 1748 gene locus_tag LOCUS_09270 378 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 1748 3076 gene locus_tag LOCUS_09280 1748 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 3114 3524 gene locus_tag LOCUS_09290 3114 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 3521 5395 gene locus_tag LOCUS_09300 3521 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 5844 5416 gene locus_tag LOCUS_09310 5844 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 6701 5841 gene locus_tag LOCUS_09320 6701 5841 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_09320 7558 6704 gene locus_tag LOCUS_09330 7558 6704 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146498.1 protein_id gnl|my_center|LOCUS_09330 7933 9456 gene locus_tag LOCUS_09340 7933 9456 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726975.1 protein_id gnl|my_center|LOCUS_09340 9456 13406 gene locus_tag LOCUS_09350 9456 13406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 13381 13575 gene locus_tag LOCUS_09360 13381 13575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 14278 13583 gene locus_tag LOCUS_09370 14278 13583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence046 1095 259 gene locus_tag LOCUS_09380 1095 259 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532353.1 protein_id gnl|my_center|LOCUS_09380 3821 1092 gene locus_tag LOCUS_09390 3821 1092 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880620.1 protein_id gnl|my_center|LOCUS_09390 4927 3839 gene locus_tag LOCUS_09400 4927 3839 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930937.1 protein_id gnl|my_center|LOCUS_09400 5063 6163 gene locus_tag LOCUS_09410 gene ilvC 5063 6163 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761037.1 protein_id gnl|my_center|LOCUS_09410 6264 6692 gene locus_tag LOCUS_09420 gene rplM 6264 6692 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583377.1 protein_id gnl|my_center|LOCUS_09420 6725 7126 gene locus_tag LOCUS_09430 gene rpsI 6725 7126 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254378.1 protein_id gnl|my_center|LOCUS_09430 8154 7189 gene locus_tag LOCUS_09440 8154 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 8888 8151 gene locus_tag LOCUS_09450 8888 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 9670 8885 gene locus_tag LOCUS_09460 9670 8885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 10407 9667 gene locus_tag LOCUS_09470 10407 9667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 10541 11713 gene locus_tag LOCUS_09480 10541 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 11834 12097 gene locus_tag LOCUS_09490 gene rpsO 11834 12097 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 protein_id gnl|my_center|LOCUS_09490 12313 14409 gene locus_tag LOCUS_09500 gene pnp 12313 14409 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_09500 15255 14497 gene locus_tag LOCUS_09510 15255 14497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence047 2188 1730 gene locus_tag LOCUS_09520 2188 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 2398 4008 gene locus_tag LOCUS_09530 2398 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 7745 4431 gene locus_tag LOCUS_09540 gene mfd 7745 4431 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391629.1 protein_id gnl|my_center|LOCUS_09540 8656 7745 gene locus_tag LOCUS_09550 gene cysD 8656 7745 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073513.1 protein_id gnl|my_center|LOCUS_09550 9525 8653 gene locus_tag LOCUS_09560 gene cysQ 9525 8653 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 protein_id gnl|my_center|LOCUS_09560 11435 9522 gene locus_tag LOCUS_09570 gene cysN 11435 9522 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121644.1 protein_id gnl|my_center|LOCUS_09570 12297 11527 gene locus_tag LOCUS_09580 12297 11527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 13924 12398 gene locus_tag LOCUS_09590 13924 12398 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_09590 15194 13896 gene locus_tag LOCUS_09600 15194 13896 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258147.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence048 3 233 gene locus_tag LOCUS_09610 3 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 514 1854 gene locus_tag LOCUS_09620 514 1854 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057322.1 protein_id gnl|my_center|LOCUS_09620 1874 2233 gene locus_tag LOCUS_09630 1874 2233 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_09630 2230 2460 gene locus_tag LOCUS_09640 2230 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 2590 2748 gene locus_tag LOCUS_09650 2590 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 3677 2781 gene locus_tag LOCUS_09660 3677 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 4760 4320 gene locus_tag LOCUS_09670 4760 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 5164 4757 gene locus_tag LOCUS_09680 5164 4757 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328825.1 protein_id gnl|my_center|LOCUS_09680 6755 5175 gene locus_tag LOCUS_09690 gene rng 6755 5175 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_09690 7880 6765 gene locus_tag LOCUS_09700 gene rodA 7880 6765 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938086.1 protein_id gnl|my_center|LOCUS_09700 9634 7877 gene locus_tag LOCUS_09710 gene mrdA 9634 7877 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_09710 10194 9673 gene locus_tag LOCUS_09720 10194 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 11054 10191 gene locus_tag LOCUS_09730 gene mreC 11054 10191 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_09730 12289 11255 gene locus_tag LOCUS_09740 12289 11255 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_09740 12484 12305 gene locus_tag LOCUS_09750 12484 12305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 12485 13561 gene locus_tag LOCUS_09760 12485 13561 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957686.1 protein_id gnl|my_center|LOCUS_09760 13558 14604 gene locus_tag LOCUS_09770 gene fni 13558 14604 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259707.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence049 1028 609 gene locus_tag LOCUS_09780 1028 609 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972683.1 protein_id gnl|my_center|LOCUS_09780 1390 2541 gene locus_tag LOCUS_09790 1390 2541 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063838431.1 protein_id gnl|my_center|LOCUS_09790 2538 3224 gene locus_tag LOCUS_09800 2538 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 3226 4590 gene locus_tag LOCUS_09810 3226 4590 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325301.1 protein_id gnl|my_center|LOCUS_09810 4633 5202 gene locus_tag LOCUS_09820 gene efp 4633 5202 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938955.1 protein_id gnl|my_center|LOCUS_09820 5199 6113 gene locus_tag LOCUS_09830 gene epmA 5199 6113 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_09830 7336 6110 gene locus_tag LOCUS_09840 7336 6110 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121115.1 protein_id gnl|my_center|LOCUS_09840 7537 7731 gene locus_tag LOCUS_09850 7537 7731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 7813 8772 gene locus_tag LOCUS_09860 7813 8772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 8769 9734 gene locus_tag LOCUS_09870 gene gmd 8769 9734 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_09870 9740 10666 gene locus_tag LOCUS_09880 9740 10666 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649925.1 protein_id gnl|my_center|LOCUS_09880 11372 11034 gene locus_tag LOCUS_09890 11372 11034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 11701 12726 gene locus_tag LOCUS_09900 11701 12726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 12763 13215 gene locus_tag LOCUS_09910 12763 13215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 13256 14467 gene locus_tag LOCUS_09920 gene larC 13256 14467 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438754.1 protein_id gnl|my_center|LOCUS_09920 15021 14449 gene locus_tag LOCUS_09930 15021 14449 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048036.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence050 <1 2780 gene locus_tag LOCUS_09940 <1 2780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268673.1:glycosyl hydrolase family 28-related protein 3947 2817 gene locus_tag LOCUS_09950 gene mutY 3947 2817 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404847.1 protein_id gnl|my_center|LOCUS_09950 7456 3944 gene locus_tag LOCUS_09960 7456 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 7649 7440 gene locus_tag LOCUS_09970 7649 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 7850 7653 gene locus_tag LOCUS_09980 7850 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 8626 7847 gene locus_tag LOCUS_09990 8626 7847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 9323 8655 gene locus_tag LOCUS_10000 9323 8655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 10259 9342 gene locus_tag LOCUS_10010 10259 9342 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393491.1 protein_id gnl|my_center|LOCUS_10010 10426 12174 gene locus_tag LOCUS_10020 10426 12174 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_10020 13063 12185 gene locus_tag LOCUS_10030 13063 12185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 14129 13086 gene locus_tag LOCUS_10040 14129 13086 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence051 117 542 gene locus_tag LOCUS_10050 117 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 668 743 gene locus_tag LOCUS_t00190 668 743 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1056 1841 gene locus_tag LOCUS_10060 gene hisF 1056 1841 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_10060 1808 2224 gene locus_tag LOCUS_10070 gene hisI 1808 2224 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263181.1 protein_id gnl|my_center|LOCUS_10070 2237 3757 gene locus_tag LOCUS_10080 gene trpE 2237 3757 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_10080 3754 4317 gene locus_tag LOCUS_10090 3754 4317 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_10090 5459 4314 gene locus_tag LOCUS_10100 5459 4314 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257269.1 protein_id gnl|my_center|LOCUS_10100 6571 5456 gene locus_tag LOCUS_10110 6571 5456 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259094.1 protein_id gnl|my_center|LOCUS_10110 6672 8390 gene locus_tag LOCUS_10120 6672 8390 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_10120 8402 9670 gene locus_tag LOCUS_10130 8402 9670 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546785.1 protein_id gnl|my_center|LOCUS_10130 9686 10087 gene locus_tag LOCUS_10140 gene xcpT 9686 10087 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_10140 10096 10647 gene locus_tag LOCUS_10150 10096 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 10673 11218 gene locus_tag LOCUS_10160 10673 11218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 11113 11730 gene locus_tag LOCUS_10170 11113 11730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 11727 12866 gene locus_tag LOCUS_10180 11727 12866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 12871 14259 gene locus_tag LOCUS_10190 12871 14259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 14256 14789 gene locus_tag LOCUS_10200 14256 14789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence052 2916 2290 gene locus_tag LOCUS_10210 2916 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 3284 2931 gene locus_tag LOCUS_10220 gene rplS 3284 2931 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_10220 4057 3365 gene locus_tag LOCUS_10230 gene trmD 4057 3365 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_10230 4298 4068 gene locus_tag LOCUS_10240 4298 4068 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232017.1 protein_id gnl|my_center|LOCUS_10240 4693 4295 gene locus_tag LOCUS_10250 4693 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 6114 4786 gene locus_tag LOCUS_10260 gene ffh 6114 4786 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_10260 7032 6151 gene locus_tag LOCUS_10270 gene prmC 7032 6151 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_10270 8340 7045 gene locus_tag LOCUS_10280 8340 7045 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_10280 8576 9421 gene locus_tag LOCUS_10290 gene lpxI 8576 9421 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_10290 9411 10364 gene locus_tag LOCUS_10300 9411 10364 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_10300 10361 11506 gene locus_tag LOCUS_10310 gene lpxB 10361 11506 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_10310 11972 12640 gene locus_tag LOCUS_10320 11972 12640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 12621 13274 gene locus_tag LOCUS_10330 12621 13274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence053 2109 1336 gene locus_tag LOCUS_10340 gene lpxA 2109 1336 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921002.1 protein_id gnl|my_center|LOCUS_10340 2904 2137 gene locus_tag LOCUS_10350 gene radC 2904 2137 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021974.1 protein_id gnl|my_center|LOCUS_10350 4186 2879 gene locus_tag LOCUS_10360 gene hflX 4186 2879 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016249.1 protein_id gnl|my_center|LOCUS_10360 5108 4161 gene locus_tag LOCUS_10370 gene miaA 5108 4161 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888325.1 protein_id gnl|my_center|LOCUS_10370 5590 5105 gene locus_tag LOCUS_10380 gene lspA 5590 5105 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_10380 6578 5607 gene locus_tag LOCUS_10390 6578 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 7981 6635 gene locus_tag LOCUS_10400 7981 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 10854 8407 gene locus_tag LOCUS_10410 10854 8407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 13369 10943 gene locus_tag LOCUS_10420 13369 10943 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942301.1 protein_id gnl|my_center|LOCUS_10420 14276 13407 gene locus_tag LOCUS_10430 gene thiD 14276 13407 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368307.1 protein_id gnl|my_center|LOCUS_10430 14494 14273 gene locus_tag LOCUS_10440 14494 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence054 1037 324 gene locus_tag LOCUS_10450 gene hoxU 1037 324 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943355.1 protein_id gnl|my_center|LOCUS_10450 4227 1030 gene locus_tag LOCUS_10460 4227 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 4748 4224 gene locus_tag LOCUS_10470 gene nuoE 4748 4224 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766748.1 protein_id gnl|my_center|LOCUS_10470 5299 4745 gene locus_tag LOCUS_10480 5299 4745 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257075.1 protein_id gnl|my_center|LOCUS_10480 6707 5280 gene locus_tag LOCUS_10490 6707 5280 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_10490 7255 6725 gene locus_tag LOCUS_10500 7255 6725 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_10500 9166 7412 gene locus_tag LOCUS_10510 9166 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 10592 9171 gene locus_tag LOCUS_10520 gene rho 10592 9171 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883248.1 protein_id gnl|my_center|LOCUS_10520 11205 10567 gene locus_tag LOCUS_10530 gene coaE 11205 10567 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056742.1 protein_id gnl|my_center|LOCUS_10530 13256 11202 gene locus_tag LOCUS_10540 13256 11202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 14209 13334 gene locus_tag LOCUS_10550 14209 13334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 14526 14266 gene locus_tag LOCUS_10560 14526 14266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence055 953 1990 gene locus_tag LOCUS_10570 953 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 3109 4014 gene locus_tag LOCUS_10580 3109 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 5098 4037 gene locus_tag LOCUS_10590 gene hypE 5098 4037 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940978.1 protein_id gnl|my_center|LOCUS_10590 6201 5095 gene locus_tag LOCUS_10600 gene hypD 6201 5095 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_10600 7459 6203 gene locus_tag LOCUS_10610 7459 6203 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_10610 8344 7472 gene locus_tag LOCUS_10620 gene argB 8344 7472 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_10620 9583 8372 gene locus_tag LOCUS_10630 gene argJ 9583 8372 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259189.1 protein_id gnl|my_center|LOCUS_10630 10911 9808 gene locus_tag LOCUS_10640 gene mnmA 10911 9808 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268273.1 protein_id gnl|my_center|LOCUS_10640 11171 12307 gene locus_tag LOCUS_10650 11171 12307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 12327 14006 gene locus_tag LOCUS_10660 12327 14006 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005492070.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence056 <1 1958 gene locus_tag LOCUS_10670 <1 1958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707763.1:beta-galactosidase 3648 3121 gene locus_tag LOCUS_10680 3648 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 5801 3645 gene locus_tag LOCUS_10690 5801 3645 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_10690 7392 5791 gene locus_tag LOCUS_10700 7392 5791 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_10700 8439 7471 gene locus_tag LOCUS_10710 8439 7471 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329644.1 protein_id gnl|my_center|LOCUS_10710 10337 8457 gene locus_tag LOCUS_10720 10337 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 10531 11274 gene locus_tag LOCUS_10730 gene pgl 10531 11274 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_10730 11271 12749 gene locus_tag LOCUS_10740 gene zwf 11271 12749 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_10740 13830 13075 gene locus_tag LOCUS_10750 13830 13075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence057 2365 128 gene locus_tag LOCUS_10760 gene priA 2365 128 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_10760 2774 2358 gene locus_tag LOCUS_10770 2774 2358 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582698.1 protein_id gnl|my_center|LOCUS_10770 3114 2836 gene locus_tag LOCUS_10780 3114 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 3700 3101 gene locus_tag LOCUS_10790 3700 3101 CDS product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194486.1 protein_id gnl|my_center|LOCUS_10790 4055 4441 gene locus_tag LOCUS_10800 4055 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 4438 5286 gene locus_tag LOCUS_10810 4438 5286 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259049.1 protein_id gnl|my_center|LOCUS_10810 5292 8618 gene locus_tag LOCUS_10820 5292 8618 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616068.1 protein_id gnl|my_center|LOCUS_10820 9025 8786 gene locus_tag LOCUS_10830 9025 8786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 9515 11032 gene locus_tag LOCUS_10840 9515 11032 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839239.1 protein_id gnl|my_center|LOCUS_10840 11067 12203 gene locus_tag LOCUS_10850 11067 12203 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_10850 13165 12230 gene locus_tag LOCUS_10860 13165 12230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence058 2 217 gene locus_tag LOCUS_10870 2 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 282 358 gene locus_tag LOCUS_t00200 282 358 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 395 1348 gene locus_tag LOCUS_10880 395 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1488 3200 gene locus_tag LOCUS_10890 gene gspE 1488 3200 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_10890 3187 4395 gene locus_tag LOCUS_10900 gene xcpS 3187 4395 CDS product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 protein_id gnl|my_center|LOCUS_10900 4539 5192 gene locus_tag LOCUS_10910 4539 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 6123 5200 gene locus_tag LOCUS_10920 gene era 6123 5200 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144405.1 protein_id gnl|my_center|LOCUS_10920 6773 6120 gene locus_tag LOCUS_10930 6773 6120 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524311.1 protein_id gnl|my_center|LOCUS_10930 6981 7244 gene locus_tag LOCUS_10940 6981 7244 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_10940 7335 8480 gene locus_tag LOCUS_10950 gene tgt 7335 8480 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393196.1 protein_id gnl|my_center|LOCUS_10950 8498 8857 gene locus_tag LOCUS_10960 8498 8857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 8968 11430 gene locus_tag LOCUS_10970 gene secD 8968 11430 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172795.1 protein_id gnl|my_center|LOCUS_10970 12661 11651 gene locus_tag LOCUS_10980 gene trpD 12661 11651 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_10980 13135 12689 gene locus_tag LOCUS_10990 13135 12689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 14012 13152 gene locus_tag LOCUS_11000 14012 13152 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142292.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence059 4 594 gene locus_tag LOCUS_11010 4 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 597 1022 gene locus_tag LOCUS_11020 597 1022 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938935.1 protein_id gnl|my_center|LOCUS_11020 1835 1686 gene locus_tag LOCUS_11030 1835 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 3827 2229 gene locus_tag LOCUS_11040 3827 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 4555 3893 gene locus_tag LOCUS_11050 4555 3893 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_11050 4805 4548 gene locus_tag LOCUS_11060 gene xseB 4805 4548 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503331.1 protein_id gnl|my_center|LOCUS_11060 6093 4795 gene locus_tag LOCUS_11070 gene xseA 6093 4795 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705853.1 protein_id gnl|my_center|LOCUS_11070 6869 6090 gene locus_tag LOCUS_11080 6869 6090 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_11080 7627 6866 gene locus_tag LOCUS_11090 7627 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 7918 10833 gene locus_tag LOCUS_11100 7918 10833 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444795.1 protein_id gnl|my_center|LOCUS_11100 10837 12225 gene locus_tag LOCUS_11110 gene odhB 10837 12225 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946280.1 protein_id gnl|my_center|LOCUS_11110 12371 13129 gene locus_tag LOCUS_11120 12371 13129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence060 1084 566 gene locus_tag LOCUS_11130 1084 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 2195 1209 gene locus_tag LOCUS_11140 2195 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 4777 2375 gene locus_tag LOCUS_11150 4777 2375 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620752.1 protein_id gnl|my_center|LOCUS_11150 5231 7108 gene locus_tag LOCUS_11160 5231 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 8722 7031 gene locus_tag LOCUS_11170 gene lnt 8722 7031 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_11170 11817 8758 gene locus_tag LOCUS_11180 gene secA 11817 8758 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_11180 12126 12419 gene locus_tag LOCUS_11190 12126 12419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 12454 12663 gene locus_tag LOCUS_11200 12454 12663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence061 15 1961 gene locus_tag LOCUS_11210 15 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1958 2926 gene locus_tag LOCUS_11220 1958 2926 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_11220 2923 4614 gene locus_tag LOCUS_11230 2923 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 4630 6546 gene locus_tag LOCUS_11240 4630 6546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 8286 6553 gene locus_tag LOCUS_11250 gene nagZ 8286 6553 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963506.1 protein_id gnl|my_center|LOCUS_11250 9234 8359 gene locus_tag LOCUS_11260 9234 8359 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027122.1 protein_id gnl|my_center|LOCUS_11260 9970 9248 gene locus_tag LOCUS_11270 9970 9248 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_11270 11195 9963 gene locus_tag LOCUS_11280 11195 9963 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816839.1 protein_id gnl|my_center|LOCUS_11280 12700 11258 gene locus_tag LOCUS_11290 gene lysS 12700 11258 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_11290 13029 13763 gene locus_tag LOCUS_11300 13029 13763 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461288.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence062 397 113 gene locus_tag LOCUS_11310 397 113 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140091.1 protein_id gnl|my_center|LOCUS_11310 1038 394 gene locus_tag LOCUS_11320 gene rplD 1038 394 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_11320 1646 1035 gene locus_tag LOCUS_11330 gene rplC 1646 1035 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173714.1 protein_id gnl|my_center|LOCUS_11330 1990 1682 gene locus_tag LOCUS_11340 gene rpsJ 1990 1682 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002712302.1 protein_id gnl|my_center|LOCUS_11340 4137 2002 gene locus_tag LOCUS_11350 gene fusA 4137 2002 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_11350 4626 4156 gene locus_tag LOCUS_11360 gene rpsG 4626 4156 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638057.1 protein_id gnl|my_center|LOCUS_11360 5014 4640 gene locus_tag LOCUS_11370 gene rpsL 5014 4640 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670535.1 protein_id gnl|my_center|LOCUS_11370 9247 5093 gene locus_tag LOCUS_11380 gene rpoC 9247 5093 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871661.1 protein_id gnl|my_center|LOCUS_11380 13034 9288 gene locus_tag LOCUS_11390 gene rpoB 13034 9288 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012263639.1 protein_id gnl|my_center|LOCUS_11390 13570 13130 gene locus_tag LOCUS_11400 gene rplL 13570 13130 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806889.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence063 31 462 gene locus_tag LOCUS_11410 31 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1656 727 gene locus_tag LOCUS_11420 1656 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 2801 1716 gene locus_tag LOCUS_11430 2801 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 3730 2789 gene locus_tag LOCUS_11440 3730 2789 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 protein_id gnl|my_center|LOCUS_11440 4596 3727 gene locus_tag LOCUS_11450 4596 3727 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_11450 4714 5265 gene locus_tag LOCUS_11460 4714 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 5281 6810 gene locus_tag LOCUS_11470 gene malQ 5281 6810 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_11470 6823 7428 gene locus_tag LOCUS_11480 6823 7428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 7425 7943 gene locus_tag LOCUS_11490 7425 7943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 7933 8388 gene locus_tag LOCUS_11500 7933 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 8469 9641 gene locus_tag LOCUS_11510 8469 9641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 9678 10883 gene locus_tag LOCUS_11520 gene aspC 9678 10883 CDS product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462648.1 protein_id gnl|my_center|LOCUS_11520 12723 10867 gene locus_tag LOCUS_11530 12723 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 13419 12877 gene locus_tag LOCUS_11540 13419 12877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence064 1358 171 gene locus_tag LOCUS_11550 1358 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 4843 1448 gene locus_tag LOCUS_11560 4843 1448 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804172.1 protein_id gnl|my_center|LOCUS_11560 6663 4843 gene locus_tag LOCUS_11570 6663 4843 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804171.1 protein_id gnl|my_center|LOCUS_11570 7924 6656 gene locus_tag LOCUS_11580 7924 6656 CDS product DUF6361 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804170.1 protein_id gnl|my_center|LOCUS_11580 11255 7926 gene locus_tag LOCUS_11590 11255 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 13044 11395 gene locus_tag LOCUS_11600 13044 11395 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227677.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence065 130 1044 gene locus_tag LOCUS_11610 130 1044 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_11610 1016 3985 gene locus_tag LOCUS_11620 1016 3985 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393172.1 protein_id gnl|my_center|LOCUS_11620 3990 4295 gene locus_tag LOCUS_11630 3990 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 4423 5712 gene locus_tag LOCUS_11640 4423 5712 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768840.1 protein_id gnl|my_center|LOCUS_11640 5712 7697 gene locus_tag LOCUS_11650 5712 7697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 8444 7701 gene locus_tag LOCUS_11660 8444 7701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 9207 8467 gene locus_tag LOCUS_11670 9207 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 12100 9224 gene locus_tag LOCUS_11680 gene xdh 12100 9224 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393495.1 protein_id gnl|my_center|LOCUS_11680 13026 12121 gene locus_tag LOCUS_11690 13026 12121 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393454.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence066 277 1107 gene locus_tag LOCUS_11700 277 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1914 1129 gene locus_tag LOCUS_11710 1914 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 2735 1911 gene locus_tag LOCUS_11720 2735 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 2882 3910 gene locus_tag LOCUS_11730 2882 3910 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127350626.1 protein_id gnl|my_center|LOCUS_11730 3922 6555 gene locus_tag LOCUS_11740 gene hrpB 3922 6555 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_11740 8806 6590 gene locus_tag LOCUS_11750 gene katG 8806 6590 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942744.1 protein_id gnl|my_center|LOCUS_11750 9044 12649 gene locus_tag LOCUS_11760 9044 12649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence067 724 35 gene locus_tag LOCUS_11770 724 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1831 770 gene locus_tag LOCUS_11780 1831 770 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_11780 2650 2315 gene locus_tag LOCUS_11790 2650 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 4014 2884 gene locus_tag LOCUS_11800 gene hemW 4014 2884 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_11800 5128 4028 gene locus_tag LOCUS_11810 gene leuB 5128 4028 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839602.1 protein_id gnl|my_center|LOCUS_11810 5658 5140 gene locus_tag LOCUS_11820 5658 5140 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272425.1 protein_id gnl|my_center|LOCUS_11820 6485 5661 gene locus_tag LOCUS_11830 6485 5661 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_11830 7345 6482 gene locus_tag LOCUS_11840 7345 6482 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892481.1 protein_id gnl|my_center|LOCUS_11840 8952 7342 gene locus_tag LOCUS_11850 8952 7342 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_11850 9906 9337 gene locus_tag LOCUS_11860 9906 9337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 10084 9893 gene locus_tag LOCUS_11870 10084 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 10892 10227 gene locus_tag LOCUS_11880 10892 10227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 12062 10959 gene locus_tag LOCUS_11890 12062 10959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057110.1 protein_id gnl|my_center|LOCUS_11890 12531 12070 gene locus_tag LOCUS_11900 12531 12070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence068 901 590 gene locus_tag LOCUS_11910 901 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1821 1003 gene locus_tag LOCUS_11920 gene rluD 1821 1003 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957782.1 protein_id gnl|my_center|LOCUS_11920 1880 4066 gene locus_tag LOCUS_11930 1880 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 4066 4593 gene locus_tag LOCUS_11940 4066 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 4616 7294 gene locus_tag LOCUS_11950 4616 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 7385 8683 gene locus_tag LOCUS_11960 7385 8683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 8732 10294 gene locus_tag LOCUS_11970 8732 10294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 10312 11124 gene locus_tag LOCUS_11980 gene srlD 10312 11124 CDS product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582810.1 protein_id gnl|my_center|LOCUS_11980 11720 11121 gene locus_tag LOCUS_11990 gene purN 11720 11121 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942403.1 protein_id gnl|my_center|LOCUS_11990 12796 11765 gene locus_tag LOCUS_12000 12796 11765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence069 913 1284 gene locus_tag LOCUS_12010 913 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 3044 1632 gene locus_tag LOCUS_12020 3044 1632 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405167.1 protein_id gnl|my_center|LOCUS_12020 3283 4026 gene locus_tag LOCUS_12030 3283 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 5271 4042 gene locus_tag LOCUS_12040 5271 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 6427 5264 gene locus_tag LOCUS_12050 6427 5264 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_12050 7403 6507 gene locus_tag LOCUS_12060 7403 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 7630 8019 gene locus_tag LOCUS_12070 7630 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 8057 8503 gene locus_tag LOCUS_12080 8057 8503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 8596 11109 gene locus_tag LOCUS_12090 8596 11109 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_12090 11524 11111 gene locus_tag LOCUS_12100 11524 11111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 11899 11546 gene locus_tag LOCUS_12110 gene frdD 11899 11546 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407771.1 protein_id gnl|my_center|LOCUS_12110 12367 11924 gene locus_tag LOCUS_12120 12367 11924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence070 75 320 gene locus_tag LOCUS_12130 75 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1399 371 gene locus_tag LOCUS_12140 1399 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 2387 1428 gene locus_tag LOCUS_12150 gene argF 2387 1428 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_12150 3501 2416 gene locus_tag LOCUS_12160 gene pyrB 3501 2416 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478824.1 protein_id gnl|my_center|LOCUS_12160 4809 3583 gene locus_tag LOCUS_12170 4809 3583 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920725.1 protein_id gnl|my_center|LOCUS_12170 4923 4836 gene locus_tag LOCUS_t00210 4923 4836 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5401 4958 gene locus_tag LOCUS_12180 5401 4958 CDS product D-tyrosyl-tRNA(Tyr) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266965.1 protein_id gnl|my_center|LOCUS_12180 6182 5451 gene locus_tag LOCUS_12190 6182 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 6493 6179 gene locus_tag LOCUS_12200 6493 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 6665 7894 gene locus_tag LOCUS_12210 6665 7894 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941553.1 protein_id gnl|my_center|LOCUS_12210 8621 8403 gene locus_tag LOCUS_12220 8621 8403 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932270.1 protein_id gnl|my_center|LOCUS_12220 8557 8862 gene locus_tag LOCUS_12230 8557 8862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 12553 9101 gene locus_tag LOCUS_12240 12553 9101 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence071 619 725 gene locus_tag LOCUS_r00010 619 725 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1620 844 gene locus_tag LOCUS_12250 1620 844 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762787.1 protein_id gnl|my_center|LOCUS_12250 2887 1643 gene locus_tag LOCUS_12260 gene rhlB 2887 1643 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119269.1 protein_id gnl|my_center|LOCUS_12260 3816 5102 gene locus_tag LOCUS_12270 3816 5102 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941843.1 protein_id gnl|my_center|LOCUS_12270 6283 5108 gene locus_tag LOCUS_12280 6283 5108 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529386.1 protein_id gnl|my_center|LOCUS_12280 8019 6793 gene locus_tag LOCUS_12290 8019 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 8223 8579 gene locus_tag LOCUS_12300 8223 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 8582 9511 gene locus_tag LOCUS_12310 8582 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 9536 9970 gene locus_tag LOCUS_12320 gene trxC 9536 9970 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816952.1 protein_id gnl|my_center|LOCUS_12320 9970 10572 gene locus_tag LOCUS_12330 gene ruvA 9970 10572 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406125.1 protein_id gnl|my_center|LOCUS_12330 10574 11590 gene locus_tag LOCUS_12340 gene ruvB 10574 11590 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403900.1 protein_id gnl|my_center|LOCUS_12340 11611 12480 gene locus_tag LOCUS_12350 11611 12480 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311061.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence072 475 185 gene locus_tag LOCUS_12360 gene nadS 475 185 CDS product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670672.1 protein_id gnl|my_center|LOCUS_12360 705 475 gene locus_tag LOCUS_12370 705 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12370 2658 1528 gene locus_tag LOCUS_12380 2658 1528 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_12380 2934 3710 gene locus_tag LOCUS_12390 gene gldF 2934 3710 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_12390 3718 5202 gene locus_tag LOCUS_12400 3718 5202 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_12400 5207 7012 gene locus_tag LOCUS_12410 5207 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 7009 9537 gene locus_tag LOCUS_12420 7009 9537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 9545 10399 gene locus_tag LOCUS_12430 9545 10399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 10484 11482 gene locus_tag LOCUS_12440 10484 11482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 12093 11530 gene locus_tag LOCUS_12450 12093 11530 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666808.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence073 1166 888 gene locus_tag LOCUS_12460 1166 888 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552279.1 protein_id gnl|my_center|LOCUS_12460 1795 1325 gene locus_tag LOCUS_12470 1795 1325 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921062.1 protein_id gnl|my_center|LOCUS_12470 1957 2586 gene locus_tag LOCUS_12480 1957 2586 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339235.1 protein_id gnl|my_center|LOCUS_12480 2750 3829 gene locus_tag LOCUS_12490 2750 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 3889 5178 gene locus_tag LOCUS_12500 gene dinB 3889 5178 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119785.1 protein_id gnl|my_center|LOCUS_12500 5205 5969 gene locus_tag LOCUS_12510 5205 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 6519 6103 gene locus_tag LOCUS_12520 6519 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 6659 6584 gene locus_tag LOCUS_t00220 6659 6584 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6801 7871 gene locus_tag LOCUS_12530 6801 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 7868 8614 gene locus_tag LOCUS_12540 7868 8614 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_12540 8611 9477 gene locus_tag LOCUS_12550 8611 9477 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_12550 10598 9474 gene locus_tag LOCUS_12560 10598 9474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 11913 10585 gene locus_tag LOCUS_12570 gene gltX 11913 10585 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037816.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence074 1994 1239 gene locus_tag LOCUS_12580 1994 1239 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816516.1 protein_id gnl|my_center|LOCUS_12580 2863 1991 gene locus_tag LOCUS_12590 2863 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 4356 2986 gene locus_tag LOCUS_12600 4356 2986 CDS product methanol--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392723.1 protein_id gnl|my_center|LOCUS_12600 6053 4353 gene locus_tag LOCUS_12610 6053 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 6690 6064 gene locus_tag LOCUS_12620 6690 6064 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_12620 6944 8062 gene locus_tag LOCUS_12630 6944 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 8334 9539 gene locus_tag LOCUS_12640 8334 9539 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_12640 10519 9554 gene locus_tag LOCUS_12650 10519 9554 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_12650 11478 10516 gene locus_tag LOCUS_12660 11478 10516 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_12660 <12185 11679 gene locus_tag LOCUS_12670 <12185 11679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958494.1:ABC transporter permease >Feature sequence075 1167 61 gene locus_tag LOCUS_12680 1167 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1715 1164 gene locus_tag LOCUS_12690 1715 1164 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_12690 4407 1705 gene locus_tag LOCUS_12700 4407 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 4734 4982 gene locus_tag LOCUS_12710 4734 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 5004 5339 gene locus_tag LOCUS_12720 5004 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 5601 7187 gene locus_tag LOCUS_12730 gene murJ 5601 7187 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_12730 7252 7407 gene locus_tag LOCUS_12740 7252 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 8948 7770 gene locus_tag LOCUS_12750 8948 7770 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 protein_id gnl|my_center|LOCUS_12750 10873 8951 gene locus_tag LOCUS_12760 gene speA 10873 8951 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792905.1 protein_id gnl|my_center|LOCUS_12760 11027 11344 gene locus_tag LOCUS_12770 11027 11344 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925448.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence076 531 887 gene locus_tag LOCUS_12780 531 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12780 936 1823 gene locus_tag LOCUS_12790 936 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12790 2013 4229 gene locus_tag LOCUS_12800 2013 4229 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056430.1 protein_id gnl|my_center|LOCUS_12800 4219 5088 gene locus_tag LOCUS_12810 4219 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 5124 6320 gene locus_tag LOCUS_12820 5124 6320 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_12820 6317 7900 gene locus_tag LOCUS_12830 6317 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 7905 8678 gene locus_tag LOCUS_12840 7905 8678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 9329 8715 gene locus_tag LOCUS_12850 9329 8715 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140061.1 protein_id gnl|my_center|LOCUS_12850 9600 9295 gene locus_tag LOCUS_12860 9600 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 10327 9746 gene locus_tag LOCUS_12870 10327 9746 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_12870 10509 11207 gene locus_tag LOCUS_12880 10509 11207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 12064 11345 gene locus_tag LOCUS_12890 12064 11345 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329973.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence077 3540 514 gene locus_tag LOCUS_12900 3540 514 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040502.1 protein_id gnl|my_center|LOCUS_12900 4635 3556 gene locus_tag LOCUS_12910 4635 3556 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957813.1 protein_id gnl|my_center|LOCUS_12910 5927 4638 gene locus_tag LOCUS_12920 5927 4638 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838343.1 protein_id gnl|my_center|LOCUS_12920 6243 6929 gene locus_tag LOCUS_12930 6243 6929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 9142 6935 gene locus_tag LOCUS_12940 gene rnr 9142 6935 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391817.1 protein_id gnl|my_center|LOCUS_12940 9201 10661 gene locus_tag LOCUS_12950 gene glgA 9201 10661 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_12950 11533 11333 gene locus_tag LOCUS_12960 11533 11333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence078 3232 680 gene locus_tag LOCUS_12970 3232 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 3964 3248 gene locus_tag LOCUS_12980 3964 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 4138 6849 gene locus_tag LOCUS_12990 4138 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 6839 7258 gene locus_tag LOCUS_13000 6839 7258 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060743.1 protein_id gnl|my_center|LOCUS_13000 7248 9836 gene locus_tag LOCUS_13010 7248 9836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 9937 10176 gene locus_tag LOCUS_13020 9937 10176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 10210 11343 gene locus_tag LOCUS_13030 10210 11343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence079 452 2146 gene locus_tag LOCUS_13040 452 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 3920 2169 gene locus_tag LOCUS_13050 3920 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 4506 4252 gene locus_tag LOCUS_13060 4506 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_13060 4744 4478 gene locus_tag LOCUS_13070 4744 4478 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_13070 5434 4802 gene locus_tag LOCUS_13080 5434 4802 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_13080 6111 5431 gene locus_tag LOCUS_13090 gene cmk 6111 5431 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439454.1 protein_id gnl|my_center|LOCUS_13090 7450 6113 gene locus_tag LOCUS_13100 gene aroA 7450 6113 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392845.1 protein_id gnl|my_center|LOCUS_13100 8328 7447 gene locus_tag LOCUS_13110 8328 7447 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084213.1 protein_id gnl|my_center|LOCUS_13110 9485 8325 gene locus_tag LOCUS_13120 gene hisC 9485 8325 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_13120 10563 9676 gene locus_tag LOCUS_13130 10563 9676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 10587 10808 gene locus_tag LOCUS_13140 10587 10808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence080 365 529 gene locus_tag LOCUS_13150 365 529 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023347.1 protein_id gnl|my_center|LOCUS_13150 610 1029 gene locus_tag LOCUS_13160 610 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1026 2588 gene locus_tag LOCUS_13170 1026 2588 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119512.1 protein_id gnl|my_center|LOCUS_13170 3162 2620 gene locus_tag LOCUS_13180 3162 2620 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_13180 4564 3191 gene locus_tag LOCUS_13190 gene rseP 4564 3191 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_13190 5421 4576 gene locus_tag LOCUS_13200 gene cdsA 5421 4576 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212137.1 protein_id gnl|my_center|LOCUS_13200 6137 5418 gene locus_tag LOCUS_13210 6137 5418 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_13210 7429 6134 gene locus_tag LOCUS_13220 7429 6134 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_13220 8747 7779 gene locus_tag LOCUS_13230 8747 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 9643 8768 gene locus_tag LOCUS_13240 9643 8768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 10119 9850 gene locus_tag LOCUS_13250 10119 9850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence081 51 1472 gene locus_tag LOCUS_13260 51 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1566 1796 gene locus_tag LOCUS_13270 1566 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1813 2238 gene locus_tag LOCUS_13280 1813 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 2310 2480 gene locus_tag LOCUS_13290 2310 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 3000 2509 gene locus_tag LOCUS_13300 3000 2509 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140618.1 protein_id gnl|my_center|LOCUS_13300 3229 2984 gene locus_tag LOCUS_13310 3229 2984 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202715939.1 protein_id gnl|my_center|LOCUS_13310 3445 3293 gene locus_tag LOCUS_13320 3445 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 3651 4484 gene locus_tag LOCUS_13330 3651 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 4555 5562 gene locus_tag LOCUS_13340 4555 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 5643 6299 gene locus_tag LOCUS_13350 5643 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 6277 6555 gene locus_tag LOCUS_13360 6277 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 6568 6984 gene locus_tag LOCUS_13370 6568 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 6981 7370 gene locus_tag LOCUS_13380 6981 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 7406 7609 gene locus_tag LOCUS_13390 7406 7609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 7606 7866 gene locus_tag LOCUS_13400 7606 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 7897 8409 gene locus_tag LOCUS_13410 7897 8409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 8409 8648 gene locus_tag LOCUS_13420 8409 8648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 8666 8926 gene locus_tag LOCUS_13430 8666 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 8913 9203 gene locus_tag LOCUS_13440 8913 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 9208 9585 gene locus_tag LOCUS_13450 9208 9585 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143794.1 protein_id gnl|my_center|LOCUS_13450 9585 9779 gene locus_tag LOCUS_13460 9585 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 9776 10078 gene locus_tag LOCUS_13470 9776 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 10071 10550 gene locus_tag LOCUS_13480 10071 10550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 10498 10719 gene locus_tag LOCUS_13490 10498 10719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence082 621 2333 gene locus_tag LOCUS_13500 621 2333 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938640.1 protein_id gnl|my_center|LOCUS_13500 2847 3098 gene locus_tag LOCUS_13510 2847 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 3215 3493 gene locus_tag LOCUS_13520 3215 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 3511 4785 gene locus_tag LOCUS_13530 gene hisS 3511 4785 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003161280.1 protein_id gnl|my_center|LOCUS_13530 4787 5611 gene locus_tag LOCUS_13540 4787 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 5634 7175 gene locus_tag LOCUS_13550 5634 7175 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257067.1 protein_id gnl|my_center|LOCUS_13550 7178 8041 gene locus_tag LOCUS_13560 7178 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 11205 8053 gene locus_tag LOCUS_13570 11205 8053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence083 1945 1025 gene locus_tag LOCUS_13580 1945 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 3514 2093 gene locus_tag LOCUS_13590 3514 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 3608 5320 gene locus_tag LOCUS_13600 3608 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 7139 5727 gene locus_tag LOCUS_13610 7139 5727 CDS product BNR-4 repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921364.1 protein_id gnl|my_center|LOCUS_13610 7568 8986 gene locus_tag LOCUS_13620 gene lpdA 7568 8986 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_13620 8996 9775 gene locus_tag LOCUS_13630 8996 9775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 10281 10505 gene locus_tag LOCUS_13640 10281 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 10502 10918 gene locus_tag LOCUS_13650 10502 10918 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140634.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence084 278 27 gene locus_tag LOCUS_13660 278 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1391 339 gene locus_tag LOCUS_13670 1391 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13670 1827 1462 gene locus_tag LOCUS_13680 1827 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 4087 3047 gene locus_tag LOCUS_13690 gene recA 4087 3047 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113623.1 protein_id gnl|my_center|LOCUS_13690 4694 4293 gene locus_tag LOCUS_13700 4694 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 6068 4776 gene locus_tag LOCUS_13710 6068 4776 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777076.1 protein_id gnl|my_center|LOCUS_13710 6303 7754 gene locus_tag LOCUS_13720 gene gnd 6303 7754 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675469.1 protein_id gnl|my_center|LOCUS_13720 7835 8653 gene locus_tag LOCUS_13730 7835 8653 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582612.1 protein_id gnl|my_center|LOCUS_13730 8675 9574 gene locus_tag LOCUS_13740 8675 9574 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228638.1 protein_id gnl|my_center|LOCUS_13740 9578 10576 gene locus_tag LOCUS_13750 9578 10576 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224436.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence085 169 76 gene locus_tag LOCUS_t00230 169 76 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 883 305 gene locus_tag LOCUS_13760 883 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1274 1089 gene locus_tag LOCUS_13770 1274 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 3600 2125 gene locus_tag LOCUS_13780 gene xylB 3600 2125 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_13780 4695 3628 gene locus_tag LOCUS_13790 4695 3628 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798095.1 protein_id gnl|my_center|LOCUS_13790 5844 4837 gene locus_tag LOCUS_13800 5844 4837 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964660.1 protein_id gnl|my_center|LOCUS_13800 6907 5891 gene locus_tag LOCUS_13810 6907 5891 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530262.1 protein_id gnl|my_center|LOCUS_13810 8419 6923 gene locus_tag LOCUS_13820 8419 6923 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268315.1 protein_id gnl|my_center|LOCUS_13820 9463 8492 gene locus_tag LOCUS_13830 gene rbsR 9463 8492 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104051.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence086 1765 545 gene locus_tag LOCUS_13840 1765 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 2362 1811 gene locus_tag LOCUS_13850 2362 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 2566 3435 gene locus_tag LOCUS_13860 gene ilvE 2566 3435 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870345.1 protein_id gnl|my_center|LOCUS_13860 3432 3959 gene locus_tag LOCUS_13870 3432 3959 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391707.1 protein_id gnl|my_center|LOCUS_13870 3956 5035 gene locus_tag LOCUS_13880 3956 5035 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_13880 5025 7487 gene locus_tag LOCUS_13890 5025 7487 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_13890 7679 7909 gene locus_tag LOCUS_13900 7679 7909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 7896 8216 gene locus_tag LOCUS_13910 gene mazF9 7896 8216 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_13910 10192 8474 gene locus_tag LOCUS_13920 10192 8474 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965361.1 protein_id gnl|my_center|LOCUS_13920 <10906 10242 gene locus_tag LOCUS_13930 <10906 10242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027480295.1:dihydrolipoyllysine-residue acetyltransferase >Feature sequence087 1007 2218 gene locus_tag LOCUS_13940 1007 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 2480 3184 gene locus_tag LOCUS_13950 2480 3184 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852139.1 protein_id gnl|my_center|LOCUS_13950 3216 3398 gene locus_tag LOCUS_13960 3216 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 3610 4542 gene locus_tag LOCUS_13970 3610 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 6440 4548 gene locus_tag LOCUS_13980 gene yidC 6440 4548 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927254.1 protein_id gnl|my_center|LOCUS_13980 6705 6490 gene locus_tag LOCUS_13990 gene yidD 6705 6490 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106504.1 protein_id gnl|my_center|LOCUS_13990 7088 6702 gene locus_tag LOCUS_14000 7088 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 7365 7150 gene locus_tag LOCUS_14010 7365 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 9106 7379 gene locus_tag LOCUS_14020 9106 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence088 903 1934 gene locus_tag LOCUS_14030 903 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 2578 1928 gene locus_tag LOCUS_14040 2578 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 4726 2585 gene locus_tag LOCUS_14050 gene glgP 4726 2585 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256629.1 protein_id gnl|my_center|LOCUS_14050 5891 4800 gene locus_tag LOCUS_14060 5891 4800 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_14060 6935 5967 gene locus_tag LOCUS_14070 gene rfaD 6935 5967 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546025.1 protein_id gnl|my_center|LOCUS_14070 7441 6932 gene locus_tag LOCUS_14080 7441 6932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 7538 7984 gene locus_tag LOCUS_14090 7538 7984 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887511.1 protein_id gnl|my_center|LOCUS_14090 8296 9312 gene locus_tag LOCUS_14100 gene pheS 8296 9312 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_14100 9312 10178 gene locus_tag LOCUS_14110 9312 10178 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence089 261 1283 gene locus_tag LOCUS_14120 261 1283 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_14120 1288 2658 gene locus_tag LOCUS_14130 1288 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 2655 4184 gene locus_tag LOCUS_14140 2655 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 5015 4242 gene locus_tag LOCUS_14150 5015 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 5567 5223 gene locus_tag LOCUS_14160 5567 5223 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083241.1 protein_id gnl|my_center|LOCUS_14160 6927 5599 gene locus_tag LOCUS_14170 gene amt 6927 5599 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_14170 7526 8710 gene locus_tag LOCUS_14180 7526 8710 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679701.1 protein_id gnl|my_center|LOCUS_14180 8707 10080 gene locus_tag LOCUS_14190 8707 10080 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence090 <1 1393 gene locus_tag LOCUS_14200 <1 1393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918028.1:TonB-dependent receptor family protein 1495 3102 gene locus_tag LOCUS_14210 1495 3102 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462257.1 protein_id gnl|my_center|LOCUS_14210 3723 3133 gene locus_tag LOCUS_14220 3723 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 3780 4784 gene locus_tag LOCUS_14230 gene hemB 3780 4784 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975009.1 protein_id gnl|my_center|LOCUS_14230 5773 4748 gene locus_tag LOCUS_14240 5773 4748 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 protein_id gnl|my_center|LOCUS_14240 6607 5807 gene locus_tag LOCUS_14250 6607 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 6884 6669 gene locus_tag LOCUS_14260 6884 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 7009 6857 gene locus_tag LOCUS_14270 7009 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 7208 8428 gene locus_tag LOCUS_14280 7208 8428 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_14280 8415 10397 gene locus_tag LOCUS_14290 8415 10397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence091 266 631 gene locus_tag LOCUS_14300 266 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 888 1811 gene locus_tag LOCUS_14310 888 1811 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877636.1 protein_id gnl|my_center|LOCUS_14310 1949 2371 gene locus_tag LOCUS_14320 1949 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 3014 2361 gene locus_tag LOCUS_14330 gene nth 3014 2361 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731104.1 protein_id gnl|my_center|LOCUS_14330 3986 3015 gene locus_tag LOCUS_14340 3986 3015 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933663.1 protein_id gnl|my_center|LOCUS_14340 5720 3999 gene locus_tag LOCUS_14350 5720 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 7115 5802 gene locus_tag LOCUS_14360 gene fumC 7115 5802 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707066.1 protein_id gnl|my_center|LOCUS_14360 8963 7200 gene locus_tag LOCUS_14370 gene rpsA 8963 7200 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872374.1 protein_id gnl|my_center|LOCUS_14370 10335 9094 gene locus_tag LOCUS_14380 gene coaBC 10335 9094 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175628128.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence092 1815 298 gene locus_tag LOCUS_14390 1815 298 CDS product 5'-deoxyadenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392738.1 protein_id gnl|my_center|LOCUS_14390 2726 1851 gene locus_tag LOCUS_14400 2726 1851 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892452.1 protein_id gnl|my_center|LOCUS_14400 3681 2737 gene locus_tag LOCUS_14410 3681 2737 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727399.1 protein_id gnl|my_center|LOCUS_14410 5373 3754 gene locus_tag LOCUS_14420 5373 3754 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727398.1 protein_id gnl|my_center|LOCUS_14420 6524 5370 gene locus_tag LOCUS_14430 6524 5370 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528135.1 protein_id gnl|my_center|LOCUS_14430 7504 6524 gene locus_tag LOCUS_14440 7504 6524 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257499.1 protein_id gnl|my_center|LOCUS_14440 9268 7859 gene locus_tag LOCUS_14450 9268 7859 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086065.1 protein_id gnl|my_center|LOCUS_14450 9527 9306 gene locus_tag LOCUS_14460 9527 9306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 9857 10132 gene locus_tag LOCUS_14470 9857 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence093 <1 2042 gene locus_tag LOCUS_14480 <1 2042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680710.1:isoleucine--tRNA ligase 2054 2539 gene locus_tag LOCUS_14490 2054 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 2834 4093 gene locus_tag LOCUS_14500 2834 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 4090 4917 gene locus_tag LOCUS_14510 4090 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 5022 5219 gene locus_tag LOCUS_14520 5022 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 6145 5285 gene locus_tag LOCUS_14530 6145 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 6711 6142 gene locus_tag LOCUS_14540 6711 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 7596 6712 gene locus_tag LOCUS_14550 7596 6712 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_14550 9353 7941 gene locus_tag LOCUS_14560 9353 7941 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 protein_id gnl|my_center|LOCUS_14560 10284 9445 gene locus_tag LOCUS_14570 gene lgt 10284 9445 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036022.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence094 141 2048 gene locus_tag LOCUS_14580 141 2048 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_14580 2068 3207 gene locus_tag LOCUS_14590 2068 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 3318 6644 gene locus_tag LOCUS_14600 3318 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 6650 7858 gene locus_tag LOCUS_14610 6650 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 7855 9789 gene locus_tag LOCUS_14620 7855 9789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 10149 9814 gene locus_tag LOCUS_14630 10149 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence095 402 181 gene locus_tag LOCUS_14640 gene infA 402 181 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384801.1 protein_id gnl|my_center|LOCUS_14640 1150 395 gene locus_tag LOCUS_14650 gene map 1150 395 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_14650 1815 1147 gene locus_tag LOCUS_14660 1815 1147 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810125.1 protein_id gnl|my_center|LOCUS_14660 3169 1820 gene locus_tag LOCUS_14670 gene secY 3169 1820 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_14670 3637 3191 gene locus_tag LOCUS_14680 gene rplO 3637 3191 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549043.1 protein_id gnl|my_center|LOCUS_14680 4147 3653 gene locus_tag LOCUS_14690 gene rpsE 4147 3653 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_14690 4526 4170 gene locus_tag LOCUS_14700 gene rplR 4526 4170 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 protein_id gnl|my_center|LOCUS_14700 5065 4529 gene locus_tag LOCUS_14710 gene rplF 5065 4529 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_14710 5477 5079 gene locus_tag LOCUS_14720 gene rpsH 5477 5079 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892856.1 protein_id gnl|my_center|LOCUS_14720 6248 5709 gene locus_tag LOCUS_14730 gene rplE 6248 5709 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129948.1 protein_id gnl|my_center|LOCUS_14730 6574 6278 gene locus_tag LOCUS_14740 6574 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 6939 6574 gene locus_tag LOCUS_14750 gene rplN 6939 6574 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538009.1 protein_id gnl|my_center|LOCUS_14750 7239 6964 gene locus_tag LOCUS_14760 gene rpsQ 7239 6964 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_14760 7438 7223 gene locus_tag LOCUS_14770 gene rpmC 7438 7223 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886964.1 protein_id gnl|my_center|LOCUS_14770 7869 7453 gene locus_tag LOCUS_14780 gene rplP 7869 7453 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081822.1 protein_id gnl|my_center|LOCUS_14780 8522 7890 gene locus_tag LOCUS_14790 gene rpsC 8522 7890 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088146.1 protein_id gnl|my_center|LOCUS_14790 8909 8538 gene locus_tag LOCUS_14800 gene rplV 8909 8538 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567555.1 protein_id gnl|my_center|LOCUS_14800 9398 9114 gene locus_tag LOCUS_14810 gene rpsS 9398 9114 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_14810 <10249 9399 gene locus_tag LOCUS_14820 <10249 9399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938601.1:50S ribosomal protein L2 >Feature sequence096 165 2144 gene locus_tag LOCUS_14830 165 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 2975 2640 gene locus_tag LOCUS_14840 2975 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 4019 3000 gene locus_tag LOCUS_14850 4019 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 5103 4168 gene locus_tag LOCUS_14860 5103 4168 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057378.1 protein_id gnl|my_center|LOCUS_14860 6461 5112 gene locus_tag LOCUS_14870 gene dnaA 6461 5112 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428021.1 protein_id gnl|my_center|LOCUS_14870 6983 8101 gene locus_tag LOCUS_14880 6983 8101 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902891.1 protein_id gnl|my_center|LOCUS_14880 8169 8930 gene locus_tag LOCUS_14890 8169 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 8927 9520 gene locus_tag LOCUS_14900 gene pgsA 8927 9520 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362543.1 protein_id gnl|my_center|LOCUS_14900 9770 9567 gene locus_tag LOCUS_14910 9770 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence097 2614 1841 gene locus_tag LOCUS_14920 gene lpxA 2614 1841 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_14920 3045 2623 gene locus_tag LOCUS_14930 gene fabZ 3045 2623 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071795.1 protein_id gnl|my_center|LOCUS_14930 4434 3172 gene locus_tag LOCUS_14940 gene icd 4434 3172 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090436.1 protein_id gnl|my_center|LOCUS_14940 4956 4531 gene locus_tag LOCUS_14950 4956 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 5698 5021 gene locus_tag LOCUS_14960 5698 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 7848 5926 gene locus_tag LOCUS_14970 7848 5926 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_14970 7998 9575 gene locus_tag LOCUS_14980 7998 9575 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence098 4628 1068 gene locus_tag LOCUS_14990 4628 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 5353 4628 gene locus_tag LOCUS_15000 5353 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 5628 5350 gene locus_tag LOCUS_15010 5628 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 6490 5684 gene locus_tag LOCUS_15020 6490 5684 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583927.1 protein_id gnl|my_center|LOCUS_15020 7346 6579 gene locus_tag LOCUS_15030 gene pssA 7346 6579 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073396.1 protein_id gnl|my_center|LOCUS_15030 8008 7343 gene locus_tag LOCUS_15040 8008 7343 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545974.1 protein_id gnl|my_center|LOCUS_15040 9646 8015 gene locus_tag LOCUS_15050 9646 8015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence099 1254 385 gene locus_tag LOCUS_15060 1254 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 4121 1275 gene locus_tag LOCUS_15070 4121 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 6304 4148 gene locus_tag LOCUS_15080 6304 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 6828 9578 gene locus_tag LOCUS_15090 6828 9578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence100 2305 1133 gene locus_tag LOCUS_15100 gene galK 2305 1133 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049364.1 protein_id gnl|my_center|LOCUS_15100 2370 3245 gene locus_tag LOCUS_15110 gene rfbA 2370 3245 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920694.1 protein_id gnl|my_center|LOCUS_15110 3252 4187 gene locus_tag LOCUS_15120 3252 4187 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_15120 5033 4194 gene locus_tag LOCUS_15130 gene tsf 5033 4194 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938172.1 protein_id gnl|my_center|LOCUS_15130 6221 5100 gene locus_tag LOCUS_15140 6221 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 6484 7878 gene locus_tag LOCUS_15150 gene htrA 6484 7878 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872209.1 protein_id gnl|my_center|LOCUS_15150 7920 8726 gene locus_tag LOCUS_15160 gene rlmB 7920 8726 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056885.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence101 1031 396 gene locus_tag LOCUS_15170 1031 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 2290 1241 gene locus_tag LOCUS_15180 2290 1241 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_15180 2923 2378 gene locus_tag LOCUS_15190 2923 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3479 3616 gene locus_tag LOCUS_15200 3479 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 3816 4085 gene locus_tag LOCUS_15210 3816 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 5362 4337 gene locus_tag LOCUS_15220 5362 4337 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_15220 6712 5438 gene locus_tag LOCUS_15230 6712 5438 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982280.1 protein_id gnl|my_center|LOCUS_15230 <9508 8544 gene locus_tag LOCUS_15240 <9508 8544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197524103.1:ribose-phosphate pyrophosphokinase >Feature sequence102 2 703 gene locus_tag LOCUS_15250 2 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 710 2014 gene locus_tag LOCUS_15260 710 2014 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_15260 2062 2292 gene locus_tag LOCUS_15270 2062 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 2892 4673 gene locus_tag LOCUS_15280 2892 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 4670 6187 gene locus_tag LOCUS_15290 4670 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 6184 6885 gene locus_tag LOCUS_15300 6184 6885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_15300 6878 8143 gene locus_tag LOCUS_15310 6878 8143 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_15310 8446 9003 gene locus_tag LOCUS_15320 8446 9003 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496869.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence103 969 160 gene locus_tag LOCUS_15330 969 160 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532094.1 protein_id gnl|my_center|LOCUS_15330 1752 3155 gene locus_tag LOCUS_15340 1752 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 3564 4454 gene locus_tag LOCUS_15350 gene hexR 3564 4454 CDS product DNA-binding transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056695.1 protein_id gnl|my_center|LOCUS_15350 4438 4980 gene locus_tag LOCUS_15360 4438 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 4977 6263 gene locus_tag LOCUS_15370 4977 6263 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378953.1 protein_id gnl|my_center|LOCUS_15370 6365 7426 gene locus_tag LOCUS_15380 6365 7426 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253036.1 protein_id gnl|my_center|LOCUS_15380 7460 8434 gene locus_tag LOCUS_15390 7460 8434 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_15390 8438 9097 gene locus_tag LOCUS_15400 gene eda 8438 9097 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence104 985 392 gene locus_tag LOCUS_15410 985 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1695 1144 gene locus_tag LOCUS_15420 1695 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1806 2813 gene locus_tag LOCUS_15430 1806 2813 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_15430 2880 3236 gene locus_tag LOCUS_15440 2880 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 5087 3207 gene locus_tag LOCUS_15450 5087 3207 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013192.1 protein_id gnl|my_center|LOCUS_15450 6856 5102 gene locus_tag LOCUS_15460 6856 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 7733 7047 gene locus_tag LOCUS_15470 7733 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 <9376 7751 gene locus_tag LOCUS_15480 <9376 7751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918053.1:polysaccharide biosynthesis tyrosine autokinase >Feature sequence105 2583 1504 gene locus_tag LOCUS_15490 2583 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 3189 2599 gene locus_tag LOCUS_15500 3189 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 3746 3192 gene locus_tag LOCUS_15510 gene infC 3746 3192 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_15510 5527 3758 gene locus_tag LOCUS_15520 gene thrS 5527 3758 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_15520 5682 5606 gene locus_tag LOCUS_t00240 5682 5606 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7041 5752 gene locus_tag LOCUS_15530 7041 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15530 7102 7275 gene locus_tag LOCUS_15540 7102 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 7925 7272 gene locus_tag LOCUS_15550 7925 7272 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333296.1 protein_id gnl|my_center|LOCUS_15550 8921 8442 gene locus_tag LOCUS_15560 8921 8442 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419785.1 protein_id gnl|my_center|LOCUS_15560 9160 8924 gene locus_tag LOCUS_15570 9160 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence106 55 495 gene locus_tag LOCUS_15580 55 495 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015065.1 protein_id gnl|my_center|LOCUS_15580 479 1267 gene locus_tag LOCUS_15590 479 1267 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055891.1 protein_id gnl|my_center|LOCUS_15590 1304 2089 gene locus_tag LOCUS_15600 1304 2089 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_15600 2090 2398 gene locus_tag LOCUS_15610 2090 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 3384 2944 gene locus_tag LOCUS_15620 3384 2944 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_15620 4167 3592 gene locus_tag LOCUS_15630 4167 3592 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083508.1 protein_id gnl|my_center|LOCUS_15630 4240 5190 gene locus_tag LOCUS_15640 4240 5190 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242610.1 protein_id gnl|my_center|LOCUS_15640 5285 5662 gene locus_tag LOCUS_15650 gene rplU 5285 5662 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938226.1 protein_id gnl|my_center|LOCUS_15650 5652 5906 gene locus_tag LOCUS_15660 gene rpmA 5652 5906 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327901.1 protein_id gnl|my_center|LOCUS_15660 5972 6913 gene locus_tag LOCUS_15670 5972 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 8237 7683 gene locus_tag LOCUS_15680 8237 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 <9270 8735 gene locus_tag LOCUS_15690 <9270 8735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_138390504.1:IS91 family transposase >Feature sequence107 87 2 gene locus_tag LOCUS_t00250 87 2 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1602 154 gene locus_tag LOCUS_15700 1602 154 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_15700 2970 1621 gene locus_tag LOCUS_15710 gene trkA 2970 1621 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_15710 3862 3722 gene locus_tag LOCUS_15720 3862 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 5656 3884 gene locus_tag LOCUS_15730 5656 3884 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117733.1 protein_id gnl|my_center|LOCUS_15730 7031 5694 gene locus_tag LOCUS_15740 7031 5694 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_15740 8021 7128 gene locus_tag LOCUS_15750 8021 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence108 634 1047 gene locus_tag LOCUS_15760 634 1047 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972106.1 protein_id gnl|my_center|LOCUS_15760 1088 2392 gene locus_tag LOCUS_15770 1088 2392 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093094.1 protein_id gnl|my_center|LOCUS_15770 4407 2389 gene locus_tag LOCUS_15780 4407 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 5062 4382 gene locus_tag LOCUS_15790 5062 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 6399 5071 gene locus_tag LOCUS_15800 6399 5071 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_15800 7316 6399 gene locus_tag LOCUS_15810 gene cysD 7316 6399 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002735002.1 protein_id gnl|my_center|LOCUS_15810 8058 7303 gene locus_tag LOCUS_15820 8058 7303 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942361.1 protein_id gnl|my_center|LOCUS_15820 8174 8824 gene locus_tag LOCUS_15830 8174 8824 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416612.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence109 373 53 gene locus_tag LOCUS_15840 373 53 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142103.1 protein_id gnl|my_center|LOCUS_15840 655 2373 gene locus_tag LOCUS_15850 655 2373 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_15850 2370 3452 gene locus_tag LOCUS_15860 2370 3452 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173990.1 protein_id gnl|my_center|LOCUS_15860 3463 5172 gene locus_tag LOCUS_15870 3463 5172 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_15870 5211 6506 gene locus_tag LOCUS_15880 5211 6506 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_15880 6507 7601 gene locus_tag LOCUS_15890 6507 7601 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_15890 7598 8326 gene locus_tag LOCUS_15900 gene pyrH 7598 8326 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904124.1 protein_id gnl|my_center|LOCUS_15900 8345 8908 gene locus_tag LOCUS_15910 gene frr 8345 8908 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence110 27 887 gene locus_tag LOCUS_15920 27 887 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142292.1 protein_id gnl|my_center|LOCUS_15920 902 3016 gene locus_tag LOCUS_15930 gene pta 902 3016 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_15930 3013 4227 gene locus_tag LOCUS_15940 3013 4227 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940289.1 protein_id gnl|my_center|LOCUS_15940 5511 4243 gene locus_tag LOCUS_15950 5511 4243 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 protein_id gnl|my_center|LOCUS_15950 5672 6619 gene locus_tag LOCUS_15960 5672 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 6612 7136 gene locus_tag LOCUS_15970 6612 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 7191 7267 gene locus_tag LOCUS_t00260 7191 7267 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7425 8735 gene locus_tag LOCUS_15980 7425 8735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 8914 8753 gene locus_tag LOCUS_15990 8914 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence111 808 413 gene locus_tag LOCUS_16000 808 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1143 2975 gene locus_tag LOCUS_16010 gene pepF 1143 2975 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122658.1 protein_id gnl|my_center|LOCUS_16010 3047 3721 gene locus_tag LOCUS_16020 3047 3721 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_16020 3734 4711 gene locus_tag LOCUS_16030 3734 4711 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_16030 4708 7074 gene locus_tag LOCUS_16040 4708 7074 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_16040 7118 7459 gene locus_tag LOCUS_16050 7118 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 7459 8730 gene locus_tag LOCUS_16060 7459 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence112 1425 124 gene locus_tag LOCUS_16070 1425 124 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_16070 2265 1468 gene locus_tag LOCUS_16080 gene fabI 2265 1468 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 protein_id gnl|my_center|LOCUS_16080 2541 2927 gene locus_tag LOCUS_16090 2541 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 2818 3480 gene locus_tag LOCUS_16100 2818 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 3507 5435 gene locus_tag LOCUS_16110 3507 5435 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_16110 5435 6211 gene locus_tag LOCUS_16120 5435 6211 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_16120 6412 7461 gene locus_tag LOCUS_16130 6412 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 7482 8480 gene locus_tag LOCUS_16140 7482 8480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence113 2152 245 gene locus_tag LOCUS_16150 2152 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 3718 2183 gene locus_tag LOCUS_16160 3718 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16160 4001 3627 gene locus_tag LOCUS_16170 4001 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16170 5962 4514 gene locus_tag LOCUS_16180 5962 4514 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785076.1 protein_id gnl|my_center|LOCUS_16180 8313 5986 gene locus_tag LOCUS_16190 8313 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 8676 8410 gene locus_tag LOCUS_16200 8676 8410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence114 198 1286 gene locus_tag LOCUS_16210 198 1286 CDS product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705065.1 protein_id gnl|my_center|LOCUS_16210 1283 3544 gene locus_tag LOCUS_16220 gene ptsP 1283 3544 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941826.1 protein_id gnl|my_center|LOCUS_16220 4894 3545 gene locus_tag LOCUS_16230 gene argH 4894 3545 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082327.1 protein_id gnl|my_center|LOCUS_16230 5547 7631 gene locus_tag LOCUS_16240 gene glgX 5547 7631 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_16240 7666 8466 gene locus_tag LOCUS_16250 7666 8466 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence115 951 121 gene locus_tag LOCUS_16260 951 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 1868 957 gene locus_tag LOCUS_16270 1868 957 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088169.1 protein_id gnl|my_center|LOCUS_16270 2892 1879 gene locus_tag LOCUS_16280 2892 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 6570 2971 gene locus_tag LOCUS_16290 6570 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 8496 6718 gene locus_tag LOCUS_16300 8496 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence116 2915 1455 gene locus_tag LOCUS_16310 2915 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 3348 6254 gene locus_tag LOCUS_16320 3348 6254 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123898.1 protein_id gnl|my_center|LOCUS_16320 6969 6223 gene locus_tag LOCUS_16330 gene rnc 6969 6223 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392467.1 protein_id gnl|my_center|LOCUS_16330 7853 6966 gene locus_tag LOCUS_16340 gene xerD 7853 6966 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_16340 8268 7867 gene locus_tag LOCUS_16350 8268 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence117 1098 115 gene locus_tag LOCUS_16360 1098 115 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257444.1 protein_id gnl|my_center|LOCUS_16360 1298 3460 gene locus_tag LOCUS_16370 1298 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 3495 4649 gene locus_tag LOCUS_16380 3495 4649 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_16380 5923 4760 gene locus_tag LOCUS_16390 5923 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence118 237 560 gene locus_tag LOCUS_16400 237 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 547 2859 gene locus_tag LOCUS_16410 547 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 2946 5270 gene locus_tag LOCUS_16420 2946 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 5275 6753 gene locus_tag LOCUS_16430 5275 6753 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726975.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence119 278 1027 gene locus_tag LOCUS_16440 278 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 1048 1776 gene locus_tag LOCUS_16450 gene ubiE 1048 1776 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403588.1 protein_id gnl|my_center|LOCUS_16450 1773 3233 gene locus_tag LOCUS_16460 1773 3233 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838739.1 protein_id gnl|my_center|LOCUS_16460 3230 4996 gene locus_tag LOCUS_16470 gene menD 3230 4996 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404103.1 protein_id gnl|my_center|LOCUS_16470 4999 5820 gene locus_tag LOCUS_16480 gene menH 4999 5820 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255997.1 protein_id gnl|my_center|LOCUS_16480 5953 6762 gene locus_tag LOCUS_16490 gene mutM 5953 6762 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816814.1 protein_id gnl|my_center|LOCUS_16490 8151 6787 gene locus_tag LOCUS_16500 8151 6787 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence120 258 1829 gene locus_tag LOCUS_16510 258 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 1915 3165 gene locus_tag LOCUS_16520 gene gdhA 1915 3165 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_16520 3225 4310 gene locus_tag LOCUS_16530 gene rlmN 3225 4310 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_16530 4413 5255 gene locus_tag LOCUS_16540 4413 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 5257 5784 gene locus_tag LOCUS_16550 5257 5784 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972163.1 protein_id gnl|my_center|LOCUS_16550 5799 7277 gene locus_tag LOCUS_16560 5799 7277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 7496 7284 gene locus_tag LOCUS_16570 7496 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence121 542 21 gene locus_tag LOCUS_16580 542 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2440 761 gene locus_tag LOCUS_16590 gene recN 2440 761 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_16590 3737 2454 gene locus_tag LOCUS_16600 3737 2454 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119574.1 protein_id gnl|my_center|LOCUS_16600 3932 4789 gene locus_tag LOCUS_16610 3932 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 4705 6453 gene locus_tag LOCUS_16620 4705 6453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 6453 7223 gene locus_tag LOCUS_16630 6453 7223 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294685.1 protein_id gnl|my_center|LOCUS_16630 7588 7352 gene locus_tag LOCUS_16640 7588 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 <8320 7625 gene locus_tag LOCUS_16650 <8320 7625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_210326921.1:type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein >Feature sequence122 443 892 gene locus_tag LOCUS_16660 443 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 889 1962 gene locus_tag LOCUS_16670 889 1962 CDS product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037627.1 protein_id gnl|my_center|LOCUS_16670 1996 2475 gene locus_tag LOCUS_16680 1996 2475 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704650.1 protein_id gnl|my_center|LOCUS_16680 2530 7479 gene locus_tag LOCUS_16690 2530 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 7563 8012 gene locus_tag LOCUS_16700 7563 8012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence123 163 6660 gene locus_tag LOCUS_16710 163 6660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 8166 6727 gene locus_tag LOCUS_16720 8166 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence124 323 3571 gene locus_tag LOCUS_16730 323 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 3663 4616 gene locus_tag LOCUS_16740 gene cysK 3663 4616 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222180.1 protein_id gnl|my_center|LOCUS_16740 4662 5807 gene locus_tag LOCUS_16750 4662 5807 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941612.1 protein_id gnl|my_center|LOCUS_16750 5804 6952 gene locus_tag LOCUS_16760 5804 6952 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941613.1 protein_id gnl|my_center|LOCUS_16760 6955 7953 gene locus_tag LOCUS_16770 6955 7953 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921231.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence125 179 1156 gene locus_tag LOCUS_16780 gene moaA 179 1156 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257065.1 protein_id gnl|my_center|LOCUS_16780 1153 2370 gene locus_tag LOCUS_16790 1153 2370 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_16790 2367 2855 gene locus_tag LOCUS_16800 gene moaC 2367 2855 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036201.1 protein_id gnl|my_center|LOCUS_16800 2839 3084 gene locus_tag LOCUS_16810 2839 3084 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036202.1 protein_id gnl|my_center|LOCUS_16810 3087 3497 gene locus_tag LOCUS_16820 3087 3497 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036203.1 protein_id gnl|my_center|LOCUS_16820 3671 5536 gene locus_tag LOCUS_16830 3671 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 6576 5587 gene locus_tag LOCUS_16840 6576 5587 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417210.1 protein_id gnl|my_center|LOCUS_16840 7576 6788 gene locus_tag LOCUS_16850 7576 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence126 264 2042 gene locus_tag LOCUS_16860 264 2042 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975341.1 protein_id gnl|my_center|LOCUS_16860 2057 3796 gene locus_tag LOCUS_16870 gene ngg 2057 3796 CDS product N-acetylglutaminylglutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969277.1 protein_id gnl|my_center|LOCUS_16870 3804 4946 gene locus_tag LOCUS_16880 3804 4946 CDS product osmoprotectant NAGGN system M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028053720.1 protein_id gnl|my_center|LOCUS_16880 4946 6508 gene locus_tag LOCUS_16890 4946 6508 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111397844.1 protein_id gnl|my_center|LOCUS_16890 6505 7446 gene locus_tag LOCUS_16900 6505 7446 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811980.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence127 565 655 gene locus_tag LOCUS_t00270 565 655 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 785 2092 gene locus_tag LOCUS_16910 785 2092 CDS product TIGR00529 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867137.1 protein_id gnl|my_center|LOCUS_16910 2114 3007 gene locus_tag LOCUS_16920 2114 3007 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932610.1 protein_id gnl|my_center|LOCUS_16920 3238 4170 gene locus_tag LOCUS_16930 3238 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 4241 6604 gene locus_tag LOCUS_16940 4241 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 6609 7766 gene locus_tag LOCUS_16950 gene amrS 6609 7766 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence128 272 415 gene locus_tag LOCUS_16960 272 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 611 829 gene locus_tag LOCUS_16970 611 829 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_16970 847 2535 gene locus_tag LOCUS_16980 847 2535 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_16980 3142 2519 gene locus_tag LOCUS_16990 3142 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 5233 3170 gene locus_tag LOCUS_17000 5233 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 6720 5626 gene locus_tag LOCUS_17010 6720 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 7399 6740 gene locus_tag LOCUS_17020 7399 6740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence129 439 158 gene locus_tag LOCUS_17030 439 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 583 1665 gene locus_tag LOCUS_17040 583 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 1646 2311 gene locus_tag LOCUS_17050 1646 2311 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_17050 3296 2334 gene locus_tag LOCUS_17060 3296 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 3427 4797 gene locus_tag LOCUS_17070 3427 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 4982 5872 gene locus_tag LOCUS_17080 4982 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 5877 6536 gene locus_tag LOCUS_17090 5877 6536 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393503.1 protein_id gnl|my_center|LOCUS_17090 6852 6520 gene locus_tag LOCUS_17100 6852 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 7669 6878 gene locus_tag LOCUS_17110 7669 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence130 710 246 gene locus_tag LOCUS_17120 710 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 791 1057 gene locus_tag LOCUS_17130 791 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1111 1036 gene locus_tag LOCUS_t00280 1111 1036 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2035 6426 gene locus_tag LOCUS_17140 2035 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 6452 6931 gene locus_tag LOCUS_17150 6452 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 7036 7710 gene locus_tag LOCUS_17160 7036 7710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence131 668 862 gene locus_tag LOCUS_17170 668 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1664 888 gene locus_tag LOCUS_17180 gene hypB 1664 888 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940974.1 protein_id gnl|my_center|LOCUS_17180 2007 1666 gene locus_tag LOCUS_17190 gene hypA 2007 1666 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005333346.1 protein_id gnl|my_center|LOCUS_17190 4702 2015 gene locus_tag LOCUS_17200 4702 2015 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_17200 5632 4784 gene locus_tag LOCUS_17210 5632 4784 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028849.1 protein_id gnl|my_center|LOCUS_17210 6414 5632 gene locus_tag LOCUS_17220 6414 5632 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329167.1 protein_id gnl|my_center|LOCUS_17220 6462 7562 gene locus_tag LOCUS_17230 gene gcvT 6462 7562 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938973.1 protein_id gnl|my_center|LOCUS_17230 7624 7698 gene locus_tag LOCUS_t00290 7624 7698 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence132 730 1278 gene locus_tag LOCUS_17240 730 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1397 2077 gene locus_tag LOCUS_17250 1397 2077 CDS product type III restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389842.1 protein_id gnl|my_center|LOCUS_17250 2091 3701 gene locus_tag LOCUS_17260 2091 3701 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932832.1 protein_id gnl|my_center|LOCUS_17260 3694 4551 gene locus_tag LOCUS_17270 3694 4551 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_17270 4544 5713 gene locus_tag LOCUS_17280 4544 5713 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946819.1 protein_id gnl|my_center|LOCUS_17280 5706 7649 gene locus_tag LOCUS_17290 5706 7649 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033492290.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence133 203 553 gene locus_tag LOCUS_17300 203 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 2023 794 gene locus_tag LOCUS_17310 2023 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 3060 2011 gene locus_tag LOCUS_17320 3060 2011 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_17320 4052 3057 gene locus_tag LOCUS_17330 4052 3057 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034325.1 protein_id gnl|my_center|LOCUS_17330 4934 4086 gene locus_tag LOCUS_17340 4934 4086 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538206.1 protein_id gnl|my_center|LOCUS_17340 5968 4958 gene locus_tag LOCUS_17350 5968 4958 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583224.1 protein_id gnl|my_center|LOCUS_17350 <7566 6030 gene locus_tag LOCUS_17360 <7566 6030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_224065212.1:glutathione ABC transporter substrate-binding protein >Feature sequence134 1333 440 gene locus_tag LOCUS_17370 1333 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1386 2600 gene locus_tag LOCUS_17380 gene add 1386 2600 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838307.1 protein_id gnl|my_center|LOCUS_17380 2651 3973 gene locus_tag LOCUS_17390 gene ssnA 2651 3973 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861868.1 protein_id gnl|my_center|LOCUS_17390 5156 3981 gene locus_tag LOCUS_17400 5156 3981 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876398.1 protein_id gnl|my_center|LOCUS_17400 6338 5259 gene locus_tag LOCUS_17410 6338 5259 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338792.1 protein_id gnl|my_center|LOCUS_17410 <7528 6530 gene locus_tag LOCUS_17420 <7528 6530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479718.1:KamA family radical SAM protein >Feature sequence135 2073 985 gene locus_tag LOCUS_17430 gene carA 2073 985 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921837.1 protein_id gnl|my_center|LOCUS_17430 2400 2206 gene locus_tag LOCUS_17440 2400 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 2713 2390 gene locus_tag LOCUS_17450 2713 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 3480 2893 gene locus_tag LOCUS_17460 gene lexA 3480 2893 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140711.1 protein_id gnl|my_center|LOCUS_17460 4683 3688 gene locus_tag LOCUS_17470 4683 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 4767 5624 gene locus_tag LOCUS_17480 4767 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence136 1248 2495 gene locus_tag LOCUS_17490 1248 2495 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_17490 2486 3316 gene locus_tag LOCUS_17500 2486 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 4397 3318 gene locus_tag LOCUS_17510 gene amrS 4397 3318 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899934.1 protein_id gnl|my_center|LOCUS_17510 4475 5827 gene locus_tag LOCUS_17520 gene trmFO 4475 5827 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056303.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence137 <1 3083 gene locus_tag LOCUS_17530 <1 3083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002221142.1:type I-F CRISPR-associated helicase Cas3f 3390 4718 gene locus_tag LOCUS_17540 gene csy1 3390 4718 CDS product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222491.1 protein_id gnl|my_center|LOCUS_17540 4711 5658 gene locus_tag LOCUS_17550 gene csy2 4711 5658 CDS product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211868.1 protein_id gnl|my_center|LOCUS_17550 5671 6708 gene locus_tag LOCUS_17560 gene csy3 5671 6708 CDS product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 protein_id gnl|my_center|LOCUS_17560 6712 7275 gene locus_tag LOCUS_17570 gene cas6f 6712 7275 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence138 112 885 gene locus_tag LOCUS_17580 112 885 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_17580 922 1980 gene locus_tag LOCUS_17590 gene rfbB 922 1980 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921456.1 protein_id gnl|my_center|LOCUS_17590 2433 1996 gene locus_tag LOCUS_17600 2433 1996 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945928.1 protein_id gnl|my_center|LOCUS_17600 2778 2599 gene locus_tag LOCUS_17610 2778 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 5167 3404 gene locus_tag LOCUS_17620 5167 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 5247 6578 gene locus_tag LOCUS_17630 gene miaB 5247 6578 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258276.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence139 31 909 gene locus_tag LOCUS_17640 31 909 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073864.1 protein_id gnl|my_center|LOCUS_17640 1616 1846 gene locus_tag LOCUS_17650 1616 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 2005 2601 gene locus_tag LOCUS_17660 2005 2601 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310196.1 protein_id gnl|my_center|LOCUS_17660 2652 3185 gene locus_tag LOCUS_17670 2652 3185 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723131.1 protein_id gnl|my_center|LOCUS_17670 3188 4528 gene locus_tag LOCUS_17680 3188 4528 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788563.1 protein_id gnl|my_center|LOCUS_17680 4528 6474 gene locus_tag LOCUS_17690 4528 6474 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583112.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence140 2006 303 gene locus_tag LOCUS_17700 2006 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 2508 2011 gene locus_tag LOCUS_17710 gene ilvN 2508 2011 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583549.1 protein_id gnl|my_center|LOCUS_17710 4345 2540 gene locus_tag LOCUS_17720 gene ilvB 4345 2540 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398643.1 protein_id gnl|my_center|LOCUS_17720 5000 6826 gene locus_tag LOCUS_17730 gene typA 5000 6826 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_17730 7375 6950 gene locus_tag LOCUS_17740 7375 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 >Feature sequence141 281 1429 gene locus_tag LOCUS_17750 281 1429 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189047.1 protein_id gnl|my_center|LOCUS_17750 1936 1541 gene locus_tag LOCUS_17760 1936 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17760 4140 1972 gene locus_tag LOCUS_17770 4140 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 4754 4518 gene locus_tag LOCUS_17780 4754 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17780 5184 5065 gene locus_tag LOCUS_17790 5184 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 6729 5470 gene locus_tag LOCUS_17800 6729 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence142 1023 127 gene locus_tag LOCUS_17810 1023 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 2157 1039 gene locus_tag LOCUS_17820 2157 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 4160 2154 gene locus_tag LOCUS_17830 4160 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 4596 4153 gene locus_tag LOCUS_17840 4596 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 5246 4593 gene locus_tag LOCUS_17850 5246 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 5862 5227 gene locus_tag LOCUS_17860 5862 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 6899 5859 gene locus_tag LOCUS_17870 6899 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence143 369 1709 gene locus_tag LOCUS_17880 369 1709 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_17880 1839 2759 gene locus_tag LOCUS_17890 1839 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 3145 3384 gene locus_tag LOCUS_17900 3145 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 3504 4067 gene locus_tag LOCUS_17910 3504 4067 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_17910 4049 5260 gene locus_tag LOCUS_17920 gene trpB 4049 5260 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392850.1 protein_id gnl|my_center|LOCUS_17920 5257 6144 gene locus_tag LOCUS_17930 5257 6144 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_17930 6165 6764 gene locus_tag LOCUS_17940 gene gmk 6165 6764 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008153.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence144 797 2068 gene locus_tag LOCUS_17950 797 2068 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940434.1 protein_id gnl|my_center|LOCUS_17950 2089 3228 gene locus_tag LOCUS_17960 gene sucC 2089 3228 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189251.1 protein_id gnl|my_center|LOCUS_17960 3228 4100 gene locus_tag LOCUS_17970 gene sucD 3228 4100 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787631.1 protein_id gnl|my_center|LOCUS_17970 4108 4944 gene locus_tag LOCUS_17980 gene panB 4108 4944 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939717.1 protein_id gnl|my_center|LOCUS_17980 5028 5114 gene locus_tag LOCUS_t00300 5028 5114 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5307 6167 gene locus_tag LOCUS_17990 5307 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 6164 6703 gene locus_tag LOCUS_18000 6164 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence145 <1 963 gene locus_tag LOCUS_18010 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932263.1:SDR family NAD(P)-dependent oxidoreductase 960 2129 gene locus_tag LOCUS_18020 960 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 2597 2809 gene locus_tag LOCUS_18030 2597 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 2885 3133 gene locus_tag LOCUS_18040 2885 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 4560 3190 gene locus_tag LOCUS_18050 4560 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 5342 4557 gene locus_tag LOCUS_18060 5342 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 6348 5290 gene locus_tag LOCUS_18070 6348 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence146 1070 294 gene locus_tag LOCUS_18080 gene larB 1070 294 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100884.1 protein_id gnl|my_center|LOCUS_18080 1168 2097 gene locus_tag LOCUS_18090 1168 2097 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113231.1 protein_id gnl|my_center|LOCUS_18090 2196 3656 gene locus_tag LOCUS_18100 gene ahcY 2196 3656 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931278.1 protein_id gnl|my_center|LOCUS_18100 3836 4975 gene locus_tag LOCUS_18110 3836 4975 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_18110 4968 5648 gene locus_tag LOCUS_18120 4968 5648 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_18120 6247 5678 gene locus_tag LOCUS_18130 gene actR 6247 5678 CDS product two-component system response regulator ActR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970591.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence147 4991 3951 gene locus_tag LOCUS_18140 4991 3951 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393804.1 protein_id gnl|my_center|LOCUS_18140 6301 4997 gene locus_tag LOCUS_18150 6301 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 6746 6348 gene locus_tag LOCUS_18160 6746 6348 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence148 939 2264 gene locus_tag LOCUS_18170 gene tig 939 2264 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957768.1 protein_id gnl|my_center|LOCUS_18170 2268 2900 gene locus_tag LOCUS_18180 gene clpP 2268 2900 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_18180 2912 4168 gene locus_tag LOCUS_18190 gene clpX 2912 4168 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 protein_id gnl|my_center|LOCUS_18190 4204 5802 gene locus_tag LOCUS_18200 4204 5802 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265553.1 protein_id gnl|my_center|LOCUS_18200 5772 5948 gene locus_tag LOCUS_18210 5772 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 6682 5981 gene locus_tag LOCUS_18220 6682 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence149 1860 883 gene locus_tag LOCUS_18230 gene pfkB 1860 883 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640737.1 protein_id gnl|my_center|LOCUS_18230 3421 1850 gene locus_tag LOCUS_18240 3421 1850 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_18240 5145 3418 gene locus_tag LOCUS_18250 5145 3418 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080010.1 protein_id gnl|my_center|LOCUS_18250 6582 5602 gene locus_tag LOCUS_18260 6582 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence150 787 4152 gene locus_tag LOCUS_18270 787 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 4161 4847 gene locus_tag LOCUS_18280 4161 4847 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_18280 6077 5130 gene locus_tag LOCUS_18290 6077 5130 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_18290 6405 6070 gene locus_tag LOCUS_18300 6405 6070 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_18300 6611 6402 gene locus_tag LOCUS_18310 6611 6402 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence151 1973 600 gene locus_tag LOCUS_18320 1973 600 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123736.1 protein_id gnl|my_center|LOCUS_18320 2783 1977 gene locus_tag LOCUS_18330 2783 1977 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325374.1 protein_id gnl|my_center|LOCUS_18330 3739 2780 gene locus_tag LOCUS_18340 3739 2780 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427752.1 protein_id gnl|my_center|LOCUS_18340 3843 4505 gene locus_tag LOCUS_18350 gene mntR 3843 4505 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728504.1 protein_id gnl|my_center|LOCUS_18350 5196 5480 gene locus_tag LOCUS_18360 5196 5480 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932501.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence152 1556 477 gene locus_tag LOCUS_18370 gene serC 1556 477 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256881.1 protein_id gnl|my_center|LOCUS_18370 2273 3634 gene locus_tag LOCUS_18380 2273 3634 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_18380 3792 4766 gene locus_tag LOCUS_18390 3792 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 4933 5781 gene locus_tag LOCUS_18400 4933 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 5838 6695 gene locus_tag LOCUS_18410 5838 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence153 535 158 gene locus_tag LOCUS_18420 535 158 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684748.1 protein_id gnl|my_center|LOCUS_18420 1536 1129 gene locus_tag LOCUS_18430 1536 1129 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933244.1 protein_id gnl|my_center|LOCUS_18430 2437 1769 gene locus_tag LOCUS_18440 2437 1769 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037361.1 protein_id gnl|my_center|LOCUS_18440 2351 2530 gene locus_tag LOCUS_18450 2351 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 3345 2560 gene locus_tag LOCUS_18460 3345 2560 CDS product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482770.1 protein_id gnl|my_center|LOCUS_18460 4121 3351 gene locus_tag LOCUS_18470 4121 3351 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257270.1 protein_id gnl|my_center|LOCUS_18470 6213 4135 gene locus_tag LOCUS_18480 6213 4135 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence154 <1 4584 gene locus_tag LOCUS_18490 <1 4584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994041.1:glucoamylase family protein 5726 5926 gene locus_tag LOCUS_18500 5726 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 6428 6676 gene locus_tag LOCUS_18510 gene mazE 6428 6676 CDS product type II toxin-antitoxin system antitoxin MazE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581940.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence155 1073 2425 gene locus_tag LOCUS_18520 1073 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 2759 3310 gene locus_tag LOCUS_18530 2759 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 6172 3476 gene locus_tag LOCUS_18540 6172 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence156 331 1209 gene locus_tag LOCUS_18550 331 1209 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_18550 1240 6165 gene locus_tag LOCUS_18560 1240 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence157 764 468 gene locus_tag LOCUS_18570 764 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 1255 1058 gene locus_tag LOCUS_18580 1255 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1846 1265 gene locus_tag LOCUS_18590 gene rsxA 1846 1265 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302262.1 protein_id gnl|my_center|LOCUS_18590 2480 1836 gene locus_tag LOCUS_18600 2480 1836 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 protein_id gnl|my_center|LOCUS_18600 3181 2480 gene locus_tag LOCUS_18610 3181 2480 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869097.1 protein_id gnl|my_center|LOCUS_18610 4233 3178 gene locus_tag LOCUS_18620 4233 3178 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_18620 5603 4230 gene locus_tag LOCUS_18630 gene rsxC 5603 4230 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082948.1 protein_id gnl|my_center|LOCUS_18630 6503 5607 gene locus_tag LOCUS_18640 6503 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence158 2223 874 gene locus_tag LOCUS_18650 2223 874 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616190.1 protein_id gnl|my_center|LOCUS_18650 2617 4953 gene locus_tag LOCUS_18660 2617 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence159 62 283 gene locus_tag LOCUS_18670 gene infA 62 283 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720792.1 protein_id gnl|my_center|LOCUS_18670 432 836 gene locus_tag LOCUS_18680 gene rpsM 432 836 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583368.1 protein_id gnl|my_center|LOCUS_18680 857 1435 gene locus_tag LOCUS_18690 857 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 1456 2082 gene locus_tag LOCUS_18700 gene rpsD 1456 2082 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545818.1 protein_id gnl|my_center|LOCUS_18700 2168 3139 gene locus_tag LOCUS_18710 2168 3139 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_18710 3178 3576 gene locus_tag LOCUS_18720 gene rplQ 3178 3576 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280529.1 protein_id gnl|my_center|LOCUS_18720 3577 4965 gene locus_tag LOCUS_18730 3577 4965 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963427.1 protein_id gnl|my_center|LOCUS_18730 5419 4967 gene locus_tag LOCUS_18740 5419 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence160 <1 888 gene locus_tag LOCUS_18750 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002669362.1:V-type ATP synthase subunit A 881 2188 gene locus_tag LOCUS_18760 881 2188 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669361.1 protein_id gnl|my_center|LOCUS_18760 2175 2783 gene locus_tag LOCUS_18770 2175 2783 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556694.1 protein_id gnl|my_center|LOCUS_18770 2780 4594 gene locus_tag LOCUS_18780 2780 4594 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003276.1 protein_id gnl|my_center|LOCUS_18780 4624 5094 gene locus_tag LOCUS_18790 4624 5094 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556692.1 protein_id gnl|my_center|LOCUS_18790 5173 5670 gene locus_tag LOCUS_18800 5173 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 5663 5902 gene locus_tag LOCUS_18810 5663 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence161 1615 1388 gene locus_tag LOCUS_18820 1615 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 3356 1863 gene locus_tag LOCUS_18830 3356 1863 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_18830 6062 3372 gene locus_tag LOCUS_18840 6062 3372 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227576.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence162 4736 2769 gene locus_tag LOCUS_18850 gene metG 4736 2769 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_18850 5291 5055 gene locus_tag LOCUS_18860 5291 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 5895 5530 gene locus_tag LOCUS_18870 5895 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18870 6335 6063 gene locus_tag LOCUS_18880 6335 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence163 981 1892 gene locus_tag LOCUS_18890 981 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 1893 2528 gene locus_tag LOCUS_18900 1893 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 2581 3426 gene locus_tag LOCUS_18910 2581 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 3423 5516 gene locus_tag LOCUS_18920 3423 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 5728 6117 gene locus_tag LOCUS_18930 5728 6117 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence164 278 1198 gene locus_tag LOCUS_18940 gene galE1 278 1198 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104180.1 protein_id gnl|my_center|LOCUS_18940 1195 2463 gene locus_tag LOCUS_18950 1195 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2409 2714 gene locus_tag LOCUS_18960 2409 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 3510 2758 gene locus_tag LOCUS_18970 3510 2758 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123689293.1 protein_id gnl|my_center|LOCUS_18970 3509 4831 gene locus_tag LOCUS_18980 3509 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 4828 5778 gene locus_tag LOCUS_18990 4828 5778 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence165 2172 3014 gene locus_tag LOCUS_19000 2172 3014 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_19000 3619 5943 gene locus_tag LOCUS_19010 3619 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence166 1 432 gene locus_tag LOCUS_19020 1 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 452 748 gene locus_tag LOCUS_19030 gene gatC 452 748 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219442.1 protein_id gnl|my_center|LOCUS_19030 757 2229 gene locus_tag LOCUS_19040 gene gatA 757 2229 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_19040 2226 3662 gene locus_tag LOCUS_19050 gene gatB 2226 3662 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_19050 4377 3640 gene locus_tag LOCUS_19060 gene bioD 4377 3640 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_19060 6137 4374 gene locus_tag LOCUS_19070 6137 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 >Feature sequence167 1296 259 gene locus_tag LOCUS_19080 gene fba 1296 259 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333980.1 protein_id gnl|my_center|LOCUS_19080 1624 1427 gene locus_tag LOCUS_19090 1624 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 1881 2702 gene locus_tag LOCUS_19100 gene dapF 1881 2702 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939153.1 protein_id gnl|my_center|LOCUS_19100 2722 3900 gene locus_tag LOCUS_19110 gene dinB 2722 3900 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_19110 4937 4593 gene locus_tag LOCUS_19120 gene mazF6 4937 4593 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410010.1 protein_id gnl|my_center|LOCUS_19120 5116 4931 gene locus_tag LOCUS_19130 5116 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 >Feature sequence168 427 245 gene locus_tag LOCUS_19140 427 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 998 507 gene locus_tag LOCUS_19150 gene smpB 998 507 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356550.1 protein_id gnl|my_center|LOCUS_19150 1282 1040 gene locus_tag LOCUS_19160 1282 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 3013 1367 gene locus_tag LOCUS_19170 gene groL 3013 1367 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545192.1 protein_id gnl|my_center|LOCUS_19170 3337 3050 gene locus_tag LOCUS_19180 gene groES 3337 3050 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_19180 5381 3429 gene locus_tag LOCUS_19190 gene dnaK 5381 3429 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence169 461 922 gene locus_tag LOCUS_19200 461 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 2325 1060 gene locus_tag LOCUS_19210 2325 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2551 2366 gene locus_tag LOCUS_19220 2551 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2629 2865 gene locus_tag LOCUS_19230 2629 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 3125 4066 gene locus_tag LOCUS_19240 3125 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 4338 4595 gene locus_tag LOCUS_19250 4338 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 4605 4934 gene locus_tag LOCUS_19260 4605 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 4931 5905 gene locus_tag LOCUS_19270 4931 5905 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015531930.1 protein_id gnl|my_center|LOCUS_19270 >Feature sequence170 1171 422 gene locus_tag LOCUS_19280 1171 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 1616 1278 gene locus_tag LOCUS_19290 1616 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 1981 3984 gene locus_tag LOCUS_19300 gene ligA 1981 3984 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_19300 3981 4613 gene locus_tag LOCUS_19310 3981 4613 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871236.1 protein_id gnl|my_center|LOCUS_19310 4610 5929 gene locus_tag LOCUS_19320 gene bioA 4610 5929 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896848.1 protein_id gnl|my_center|LOCUS_19320 >Feature sequence171 1401 745 gene locus_tag LOCUS_19330 1401 745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933759.1 protein_id gnl|my_center|LOCUS_19330 2318 1398 gene locus_tag LOCUS_19340 2318 1398 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057897.1 protein_id gnl|my_center|LOCUS_19340 3402 2323 gene locus_tag LOCUS_19350 3402 2323 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140538.1 protein_id gnl|my_center|LOCUS_19350 4559 3399 gene locus_tag LOCUS_19360 4559 3399 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140537.1 protein_id gnl|my_center|LOCUS_19360 4470 4766 gene locus_tag LOCUS_19370 4470 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 <5911 4775 gene locus_tag LOCUS_19380 <5911 4775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000895182.1:nucleoside recognition domain-containing protein >Feature sequence172 497 141 gene locus_tag LOCUS_19390 497 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 1645 719 gene locus_tag LOCUS_19400 1645 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2226 3101 gene locus_tag LOCUS_19410 2226 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 3129 4769 gene locus_tag LOCUS_19420 3129 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 5184 4741 gene locus_tag LOCUS_19430 gene tadA 5184 4741 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence173 1237 146 gene locus_tag LOCUS_19440 gene tsaD 1237 146 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393860.1 protein_id gnl|my_center|LOCUS_19440 2531 1203 gene locus_tag LOCUS_19450 2531 1203 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_19450 2703 3434 gene locus_tag LOCUS_19460 2703 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 5146 3452 gene locus_tag LOCUS_19470 5146 3452 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080960.1 protein_id gnl|my_center|LOCUS_19470 5610 5212 gene locus_tag LOCUS_19480 5610 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 >Feature sequence174 2301 202 gene locus_tag LOCUS_19490 2301 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 <5830 2366 gene locus_tag LOCUS_19500 <5830 2366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119870.1:choice-of-anchor Q domain-containing protein >Feature sequence175 622 140 gene locus_tag LOCUS_19510 622 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 690 765 gene locus_tag LOCUS_t00310 690 765 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1381 842 gene locus_tag LOCUS_19520 1381 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 2004 1489 gene locus_tag LOCUS_19530 2004 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 4310 2004 gene locus_tag LOCUS_19540 4310 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 4822 4409 gene locus_tag LOCUS_19550 4822 4409 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_19550 5592 4819 gene locus_tag LOCUS_19560 5592 4819 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence176 628 1434 gene locus_tag LOCUS_19570 628 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 1703 1431 gene locus_tag LOCUS_19580 1703 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2454 1696 gene locus_tag LOCUS_19590 gene moeB 2454 1696 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393468.1 protein_id gnl|my_center|LOCUS_19590 3154 2438 gene locus_tag LOCUS_19600 3154 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 4014 3157 gene locus_tag LOCUS_19610 4014 3157 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814372.1 protein_id gnl|my_center|LOCUS_19610 5600 4011 gene locus_tag LOCUS_19620 5600 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence177 1864 326 gene locus_tag LOCUS_19630 1864 326 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765644.1 protein_id gnl|my_center|LOCUS_19630 2857 1997 gene locus_tag LOCUS_19640 gene panC 2857 1997 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942350.1 protein_id gnl|my_center|LOCUS_19640 4269 2980 gene locus_tag LOCUS_19650 gene eno 4269 2980 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357098.1 protein_id gnl|my_center|LOCUS_19650 4342 4962 gene locus_tag LOCUS_19660 4342 4962 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640290.1 protein_id gnl|my_center|LOCUS_19660 >Feature sequence178 146 71 gene locus_tag LOCUS_t00320 146 71 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3080 204 gene locus_tag LOCUS_19670 3080 204 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_19670 4864 3248 gene locus_tag LOCUS_19680 gene pgi 4864 3248 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888377.1 protein_id gnl|my_center|LOCUS_19680 <5724 4873 gene locus_tag LOCUS_19690 <5724 4873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065168.1:dihydrolipoyl dehydrogenase >Feature sequence179 260 1285 gene locus_tag LOCUS_19700 gene floA 260 1285 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230026.1 protein_id gnl|my_center|LOCUS_19700 1360 2085 gene locus_tag LOCUS_19710 1360 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 2186 4861 gene locus_tag LOCUS_19720 gene aceE 2186 4861 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence180 277 573 gene locus_tag LOCUS_19730 277 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 643 1746 gene locus_tag LOCUS_19740 gene ugpC 643 1746 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_19740 1750 2928 gene locus_tag LOCUS_19750 1750 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 2950 3252 gene locus_tag LOCUS_19760 2950 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19760 3280 3693 gene locus_tag LOCUS_19770 3280 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19770 3697 4122 gene locus_tag LOCUS_19780 gene acpS 3697 4122 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933592.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence181 403 1419 gene locus_tag LOCUS_19790 403 1419 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539151.1 protein_id gnl|my_center|LOCUS_19790 1530 3935 gene locus_tag LOCUS_19800 1530 3935 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932984.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence182 748 116 gene locus_tag LOCUS_19810 748 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 2452 839 gene locus_tag LOCUS_19820 2452 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 2829 2458 gene locus_tag LOCUS_19830 2829 2458 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250172.1 protein_id gnl|my_center|LOCUS_19830 3236 2817 gene locus_tag LOCUS_19840 3236 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19840 3534 3229 gene locus_tag LOCUS_19850 3534 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 4094 3531 gene locus_tag LOCUS_19860 4094 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 4452 4087 gene locus_tag LOCUS_19870 4452 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 4712 4452 gene locus_tag LOCUS_19880 4712 4452 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080106.1 protein_id gnl|my_center|LOCUS_19880 5233 4709 gene locus_tag LOCUS_19890 5233 4709 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035696.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence183 250 1539 gene locus_tag LOCUS_19900 250 1539 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337713.1 protein_id gnl|my_center|LOCUS_19900 1539 2444 gene locus_tag LOCUS_19910 1539 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2530 2724 gene locus_tag LOCUS_19920 2530 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2758 3183 gene locus_tag LOCUS_19930 2758 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 3233 4252 gene locus_tag LOCUS_19940 3233 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence184 >Feature sequence185 <1 1431 gene locus_tag LOCUS_19950 <1 1431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051000272.1:response regulator note possible pseudo, frameshifted 1493 1870 gene locus_tag LOCUS_19960 1493 1870 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969399.1 protein_id gnl|my_center|LOCUS_19960 1867 3009 gene locus_tag LOCUS_19970 1867 3009 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_19970 3006 4562 gene locus_tag LOCUS_19980 3006 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence186 <1 4512 gene locus_tag LOCUS_19990 <1 4512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930410.1:chitobiase/beta-hexosaminidase C-terminal domain-containing protein >Feature sequence187 1478 1119 gene locus_tag LOCUS_20000 1478 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 2077 1721 gene locus_tag LOCUS_20010 2077 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 2716 2552 gene locus_tag LOCUS_20020 2716 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 3053 2898 gene locus_tag LOCUS_20030 3053 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 3543 3301 gene locus_tag LOCUS_20040 3543 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 4540 3812 gene locus_tag LOCUS_20050 gene gpmA 4540 3812 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932091.1 protein_id gnl|my_center|LOCUS_20050 4785 4576 gene locus_tag LOCUS_20060 4785 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence188 378 163 gene locus_tag LOCUS_20070 378 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 1205 885 gene locus_tag LOCUS_20080 1205 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 1562 1272 gene locus_tag LOCUS_20090 1562 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2547 1996 gene locus_tag LOCUS_20100 2547 1996 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932189.1 protein_id gnl|my_center|LOCUS_20100 3244 2897 gene locus_tag LOCUS_20110 3244 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 4061 3552 gene locus_tag LOCUS_20120 4061 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 4417 4154 gene locus_tag LOCUS_20130 4417 4154 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022822.1 protein_id gnl|my_center|LOCUS_20130 4733 4407 gene locus_tag LOCUS_20140 4733 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 <5282 4738 gene locus_tag LOCUS_20150 <5282 4738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545912.1:isoprenyl transferase >Feature sequence189 15 1118 gene locus_tag LOCUS_20160 15 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 4132 1451 gene locus_tag LOCUS_20170 4132 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 <5239 4725 gene locus_tag LOCUS_20180 <5239 4725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459848.1:GPR1/FUN34/YaaH family transporter >Feature sequence190 2 481 gene locus_tag LOCUS_20190 2 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 478 3351 gene locus_tag LOCUS_20200 478 3351 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545345.1 protein_id gnl|my_center|LOCUS_20200 3348 4637 gene locus_tag LOCUS_20210 3348 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence191 1433 411 gene locus_tag LOCUS_20220 1433 411 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776863.1 protein_id gnl|my_center|LOCUS_20220 3026 1539 gene locus_tag LOCUS_20230 3026 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 3781 3026 gene locus_tag LOCUS_20240 3781 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 4395 3781 gene locus_tag LOCUS_20250 gene hcp 4395 3781 CDS product type VI secretion system receptor/chaperone Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083670.1 protein_id gnl|my_center|LOCUS_20250 4543 5055 gene locus_tag LOCUS_20260 4543 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 >Feature sequence192 937 119 gene locus_tag LOCUS_20270 937 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 1611 934 gene locus_tag LOCUS_20280 gene lolD 1611 934 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925702.1 protein_id gnl|my_center|LOCUS_20280 2921 1617 gene locus_tag LOCUS_20290 2921 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 4043 3075 gene locus_tag LOCUS_20300 4043 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 4708 4418 gene locus_tag LOCUS_20310 4708 4418 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074235.1 protein_id gnl|my_center|LOCUS_20310 5043 4705 gene locus_tag LOCUS_20320 5043 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence193 260 1507 gene locus_tag LOCUS_20330 260 1507 CDS product adenine-specific methyltransferase EcoRI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196835716.1 protein_id gnl|my_center|LOCUS_20330 1504 2358 gene locus_tag LOCUS_20340 1504 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 3586 2336 gene locus_tag LOCUS_20350 3586 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 3759 3577 gene locus_tag LOCUS_20360 3759 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 4280 3774 gene locus_tag LOCUS_20370 4280 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 >Feature sequence194 120 305 gene locus_tag LOCUS_20380 120 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 537 1277 gene locus_tag LOCUS_20390 537 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 1274 2185 gene locus_tag LOCUS_20400 1274 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2182 3132 gene locus_tag LOCUS_20410 2182 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 3519 3707 gene locus_tag LOCUS_20420 3519 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 3877 4236 gene locus_tag LOCUS_20430 3877 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 4306 4560 gene locus_tag LOCUS_20440 4306 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence195 1 414 gene locus_tag LOCUS_20450 1 414 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642555.1 protein_id gnl|my_center|LOCUS_20450 430 2409 gene locus_tag LOCUS_20460 430 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 2399 3187 gene locus_tag LOCUS_20470 2399 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 3184 3921 gene locus_tag LOCUS_20480 3184 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 4706 3951 gene locus_tag LOCUS_20490 4706 3951 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175245.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence196 <1 756 gene locus_tag LOCUS_20500 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121854.1:sulfatase-like hydrolase/transferase 1028 1720 gene locus_tag LOCUS_20510 1028 1720 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583200.1 protein_id gnl|my_center|LOCUS_20510 1717 2961 gene locus_tag LOCUS_20520 1717 2961 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517213.1 protein_id gnl|my_center|LOCUS_20520 2942 3715 gene locus_tag LOCUS_20530 2942 3715 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095709.1 protein_id gnl|my_center|LOCUS_20530 3712 4914 gene locus_tag LOCUS_20540 3712 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence197 3143 813 gene locus_tag LOCUS_20550 3143 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 4352 4215 gene locus_tag LOCUS_20560 4352 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence198 2398 977 gene locus_tag LOCUS_20570 2398 977 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393514.1 protein_id gnl|my_center|LOCUS_20570 2916 2431 gene locus_tag LOCUS_20580 2916 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 3495 3052 gene locus_tag LOCUS_20590 3495 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 4673 3834 gene locus_tag LOCUS_20600 4673 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 >Feature sequence199 210 533 gene locus_tag LOCUS_20610 210 533 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 protein_id gnl|my_center|LOCUS_20610 538 858 gene locus_tag LOCUS_20620 538 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 1419 1344 gene locus_tag LOCUS_t00330 1419 1344 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2523 1477 gene locus_tag LOCUS_20630 gene queA 2523 1477 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830755.1 protein_id gnl|my_center|LOCUS_20630 4268 2526 gene locus_tag LOCUS_20640 gene msbA 4268 2526 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_20640 <4988 4276 gene locus_tag LOCUS_20650 <4988 4276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932523.1:thioredoxin-disulfide reductase >Feature sequence200 855 178 gene locus_tag LOCUS_20660 855 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 1441 977 gene locus_tag LOCUS_20670 1441 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 2117 1431 gene locus_tag LOCUS_20680 2117 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 2470 2267 gene locus_tag LOCUS_20690 2470 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 4617 2467 gene locus_tag LOCUS_20700 4617 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 >Feature sequence201 412 2037 gene locus_tag LOCUS_20710 412 2037 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023304.1 protein_id gnl|my_center|LOCUS_20710 3310 2291 gene locus_tag LOCUS_20720 3310 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 4141 3320 gene locus_tag LOCUS_20730 4141 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence202 1131 73 gene locus_tag LOCUS_20740 1131 73 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044885.1 protein_id gnl|my_center|LOCUS_20740 1910 1128 gene locus_tag LOCUS_20750 1910 1128 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_20750 3574 2375 gene locus_tag LOCUS_20760 gene chrA 3574 2375 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384124.1 protein_id gnl|my_center|LOCUS_20760 4249 3578 gene locus_tag LOCUS_20770 gene phoU 4249 3578 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_20770 <4940 4266 gene locus_tag LOCUS_20780 <4940 4266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096663.1:phosphate ABC transporter ATP-binding protein PstB >Feature sequence203 1323 340 gene locus_tag LOCUS_20790 gene xerC 1323 340 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_20790 3893 1320 gene locus_tag LOCUS_20800 3893 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 <4923 3890 gene locus_tag LOCUS_20810 <4923 3890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403940.1:DNA-processing protein DprA >Feature sequence204 169 94 gene locus_tag LOCUS_t00340 169 94 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1103 273 gene locus_tag LOCUS_20820 1103 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 3022 1196 gene locus_tag LOCUS_20830 gene mutL 3022 1196 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_20830 3966 3043 gene locus_tag LOCUS_20840 3966 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 4328 3963 gene locus_tag LOCUS_20850 gene folX 4328 3963 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072826.1 protein_id gnl|my_center|LOCUS_20850 <4902 4325 gene locus_tag LOCUS_20860 <4902 4325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017139980.1:SDR family oxidoreductase >Feature sequence205 288 2114 gene locus_tag LOCUS_20870 gene pabB 288 2114 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941191.1 protein_id gnl|my_center|LOCUS_20870 2317 2904 gene locus_tag LOCUS_20880 2317 2904 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_20880 2928 4820 gene locus_tag LOCUS_20890 2928 4820 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198677105.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence206 1230 10 gene locus_tag LOCUS_20900 1230 10 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254171.1 protein_id gnl|my_center|LOCUS_20900 1499 1747 gene locus_tag LOCUS_20910 1499 1747 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_20910 3301 2096 gene locus_tag LOCUS_20920 3301 2096 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179313.1 protein_id gnl|my_center|LOCUS_20920 4772 3321 gene locus_tag LOCUS_20930 gene cls 4772 3321 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943983.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence207 2417 981 gene locus_tag LOCUS_20940 2417 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 4617 2449 gene locus_tag LOCUS_20950 4617 2449 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776802.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence208 344 547 gene locus_tag LOCUS_20960 344 547 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074342.1 protein_id gnl|my_center|LOCUS_20960 585 2591 gene locus_tag LOCUS_20970 585 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 3496 2588 gene locus_tag LOCUS_20980 3496 2588 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972462.1 protein_id gnl|my_center|LOCUS_20980 4382 3489 gene locus_tag LOCUS_20990 4382 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 4587 4399 gene locus_tag LOCUS_21000 4587 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence209 1655 1843 gene locus_tag LOCUS_21010 1655 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 1981 2475 gene locus_tag LOCUS_21020 1981 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21020 2577 3572 gene locus_tag LOCUS_21030 2577 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 3569 4336 gene locus_tag LOCUS_21040 3569 4336 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937416.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence210 1397 4564 gene locus_tag LOCUS_21050 1397 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 >Feature sequence211 114 665 gene locus_tag LOCUS_21060 114 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 772 1101 gene locus_tag LOCUS_21070 772 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2349 3269 gene locus_tag LOCUS_21080 2349 3269 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence212 253 1200 gene locus_tag LOCUS_21090 253 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 1154 1342 gene locus_tag LOCUS_21100 1154 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 1475 2761 gene locus_tag LOCUS_21110 gene dnaB 1475 2761 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003018948.1 protein_id gnl|my_center|LOCUS_21110 2849 3643 gene locus_tag LOCUS_21120 2849 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 3640 4215 gene locus_tag LOCUS_21130 gene dcd 3640 4215 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404183.1 protein_id gnl|my_center|LOCUS_21130 4212 4370 gene locus_tag LOCUS_21140 4212 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 >Feature sequence213 4127 285 gene locus_tag LOCUS_21150 4127 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence214 837 10 gene locus_tag LOCUS_21160 837 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 1042 848 gene locus_tag LOCUS_21170 1042 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 4588 2834 gene locus_tag LOCUS_21180 4588 2834 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669364.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence215 765 2066 gene locus_tag LOCUS_21190 gene murC 765 2066 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080384.1 protein_id gnl|my_center|LOCUS_21190 2223 2810 gene locus_tag LOCUS_21200 2223 2810 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_21200 2814 3368 gene locus_tag LOCUS_21210 2814 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 3368 4099 gene locus_tag LOCUS_21220 3368 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence216 943 773 gene locus_tag LOCUS_21230 943 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 1352 1044 gene locus_tag LOCUS_21240 1352 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 1968 1369 gene locus_tag LOCUS_21250 1968 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 2360 2061 gene locus_tag LOCUS_21260 2360 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 <4654 2704 gene locus_tag LOCUS_21270 <4654 2704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005681492.1:FAD-dependent oxidoreductase >Feature sequence217 1052 315 gene locus_tag LOCUS_21280 1052 315 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062387006.1 protein_id gnl|my_center|LOCUS_21280 2047 1049 gene locus_tag LOCUS_21290 2047 1049 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_21290 2623 2279 gene locus_tag LOCUS_21300 2623 2279 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933318.1 protein_id gnl|my_center|LOCUS_21300 3365 3643 gene locus_tag LOCUS_21310 3365 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 3645 3884 gene locus_tag LOCUS_21320 3645 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 >Feature sequence218 279 1418 gene locus_tag LOCUS_21330 279 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 1601 1446 gene locus_tag LOCUS_21340 1601 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 1617 2450 gene locus_tag LOCUS_21350 1617 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 4097 2940 gene locus_tag LOCUS_21360 gene pdxB 4097 2940 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699116.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence219 1946 876 gene locus_tag LOCUS_21370 1946 876 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544422.1 protein_id gnl|my_center|LOCUS_21370 4267 1946 gene locus_tag LOCUS_21380 4267 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence220 2957 1386 gene locus_tag LOCUS_21390 2957 1386 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001322421.1 protein_id gnl|my_center|LOCUS_21390 3350 2961 gene locus_tag LOCUS_21400 3350 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 4399 3332 gene locus_tag LOCUS_21410 4399 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21410 >Feature sequence221 790 317 gene locus_tag LOCUS_21420 790 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 2068 1118 gene locus_tag LOCUS_21430 2068 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 3602 2196 gene locus_tag LOCUS_21440 3602 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence222 <1 664 gene locus_tag LOCUS_21450 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244059.1:acetoin dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase 661 2010 gene locus_tag LOCUS_21460 gene lpdA 661 2010 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766155.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence223 196 1554 gene locus_tag LOCUS_21470 196 1554 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707899.1 protein_id gnl|my_center|LOCUS_21470 1551 2117 gene locus_tag LOCUS_21480 1551 2117 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_21480 2110 2520 gene locus_tag LOCUS_21490 2110 2520 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_21490 2517 3182 gene locus_tag LOCUS_21500 2517 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence224 142 1119 gene locus_tag LOCUS_21510 142 1119 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940306.1 protein_id gnl|my_center|LOCUS_21510 1191 1964 gene locus_tag LOCUS_21520 1191 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 1978 3522 gene locus_tag LOCUS_21530 1978 3522 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_21530 3634 4320 gene locus_tag LOCUS_21540 3634 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 >Feature sequence225 938 1108 gene locus_tag LOCUS_21550 938 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 1099 1173 gene locus_tag LOCUS_t00350 1099 1173 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1646 1152 gene locus_tag LOCUS_21560 1646 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 1697 4225 gene locus_tag LOCUS_21570 gene leuS 1697 4225 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_21570 >Feature sequence226 1081 113 gene locus_tag LOCUS_21580 1081 113 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957586.1 protein_id gnl|my_center|LOCUS_21580 2340 1078 gene locus_tag LOCUS_21590 2340 1078 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_21590 2414 4150 gene locus_tag LOCUS_21600 gene recJ 2414 4150 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence227 3864 2281 gene locus_tag LOCUS_21610 3864 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence228 2003 1155 gene locus_tag LOCUS_21620 2003 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 2423 2749 gene locus_tag LOCUS_21630 2423 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 3661 3068 gene locus_tag LOCUS_21640 gene thpR 3661 3068 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_21640 <4314 3672 gene locus_tag LOCUS_21650 <4314 3672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013535.1:4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase >Feature sequence229 260 562 gene locus_tag LOCUS_21660 260 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 544 768 gene locus_tag LOCUS_21670 544 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 1442 2083 gene locus_tag LOCUS_21680 1442 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 3022 2057 gene locus_tag LOCUS_21690 3022 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 3135 3533 gene locus_tag LOCUS_21700 3135 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 3610 4083 gene locus_tag LOCUS_21710 3610 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 >Feature sequence230 574 44 gene locus_tag LOCUS_21720 574 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 1717 1469 gene locus_tag LOCUS_21730 1717 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 1962 3041 gene locus_tag LOCUS_21740 1962 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 <4232 3302 gene locus_tag LOCUS_21750 <4232 3302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814967.1:Fic family protein >Feature sequence231 33 118 gene locus_tag LOCUS_t00360 33 118 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 732 433 gene locus_tag LOCUS_21760 732 433 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_21760 1029 742 gene locus_tag LOCUS_21770 1029 742 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_21770 1126 2214 gene locus_tag LOCUS_21780 1126 2214 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759810.1 protein_id gnl|my_center|LOCUS_21780 2216 3814 gene locus_tag LOCUS_21790 2216 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence232 >Feature sequence233 1560 829 gene locus_tag LOCUS_21800 1560 829 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582797.1 protein_id gnl|my_center|LOCUS_21800 4173 1792 gene locus_tag LOCUS_21810 4173 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence234 76 3 gene locus_tag LOCUS_t00370 76 3 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1725 328 gene locus_tag LOCUS_21820 1725 328 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666062.1 protein_id gnl|my_center|LOCUS_21820 3004 1862 gene locus_tag LOCUS_21830 gene dusB 3004 1862 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941670.1 protein_id gnl|my_center|LOCUS_21830 4064 2979 gene locus_tag LOCUS_21840 gene fmt 4064 2979 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392417.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence235 1775 1548 gene locus_tag LOCUS_21850 1775 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2226 1810 gene locus_tag LOCUS_21860 2226 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2705 2316 gene locus_tag LOCUS_21870 2705 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976082.1 protein_id gnl|my_center|LOCUS_21870 <4114 2702 gene locus_tag LOCUS_21880 <4114 2702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071057.1:FMN-binding glutamate synthase family protein >Feature sequence236 343 191 gene locus_tag LOCUS_21890 343 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 733 1707 gene locus_tag LOCUS_21900 gene pstS 733 1707 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_21900 1694 4087 gene locus_tag LOCUS_21910 1694 4087 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706617.1 protein_id gnl|my_center|LOCUS_21910 >Feature sequence237 266 817 gene locus_tag LOCUS_21920 266 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2630 2857 gene locus_tag LOCUS_21930 2630 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 3418 3266 gene locus_tag LOCUS_21940 3418 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 >Feature sequence238 928 209 gene locus_tag LOCUS_21950 928 209 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357807.1 protein_id gnl|my_center|LOCUS_21950 2505 928 gene locus_tag LOCUS_21960 2505 928 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880885.1 protein_id gnl|my_center|LOCUS_21960 <4089 3249 gene locus_tag LOCUS_21970 <4089 3249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113214.1:multifunctional CCA addition/repair protein >Feature sequence239 234 1967 gene locus_tag LOCUS_21980 234 1967 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626303.1 protein_id gnl|my_center|LOCUS_21980 3119 2064 gene locus_tag LOCUS_21990 gene queG 3119 2064 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968507.1 protein_id gnl|my_center|LOCUS_21990 3823 3116 gene locus_tag LOCUS_22000 3823 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence240 713 30 gene locus_tag LOCUS_22010 713 30 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_22010 1987 830 gene locus_tag LOCUS_22020 1987 830 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507840.1 protein_id gnl|my_center|LOCUS_22020 3270 2125 gene locus_tag LOCUS_22030 3270 2125 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 protein_id gnl|my_center|LOCUS_22030 3496 3846 gene locus_tag LOCUS_22040 3496 3846 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence241 769 1809 gene locus_tag LOCUS_22050 769 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2597 2824 gene locus_tag LOCUS_22060 gene tatA 2597 2824 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813377.1 protein_id gnl|my_center|LOCUS_22060 2852 3448 gene locus_tag LOCUS_22070 2852 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 3559 3651 gene locus_tag LOCUS_t00380 3559 3651 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence242 <1 1884 gene locus_tag LOCUS_22080 <1 1884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256937.1:ABC-F family ATP-binding cassette domain-containing protein 2003 3229 gene locus_tag LOCUS_22090 2003 3229 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence243 <1 1710 gene locus_tag LOCUS_22100 <1 1710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002356840.1:sugar ABC transporter permease 2462 2283 gene locus_tag LOCUS_22110 2462 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 2653 3450 gene locus_tag LOCUS_22120 2653 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22120 >Feature sequence244 753 1442 gene locus_tag LOCUS_22130 753 1442 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098784.1 protein_id gnl|my_center|LOCUS_22130 1439 2473 gene locus_tag LOCUS_22140 1439 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 2960 3163 gene locus_tag LOCUS_22150 2960 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 >Feature sequence245 3130 3696 gene locus_tag LOCUS_22160 3130 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence246 1169 2215 gene locus_tag LOCUS_22170 1169 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 3413 2340 gene locus_tag LOCUS_22180 3413 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 3719 3510 gene locus_tag LOCUS_22190 3719 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 >Feature sequence247 289 2565 gene locus_tag LOCUS_22200 289 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 2717 3343 gene locus_tag LOCUS_22210 2717 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 >Feature sequence248 885 349 gene locus_tag LOCUS_22220 gene ribE 885 349 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_22220 1583 918 gene locus_tag LOCUS_22230 1583 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 3426 1933 gene locus_tag LOCUS_22240 3426 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 >Feature sequence249 94 3845 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgaactgccgcacaggcagctcagaaa >Feature sequence250 865 1059 gene locus_tag LOCUS_22250 865 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 1434 2846 gene locus_tag LOCUS_22260 1434 2846 CDS product IS66-like element ISH10B family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289081.1 protein_id gnl|my_center|LOCUS_22260 >Feature sequence251 141 836 gene locus_tag LOCUS_22270 141 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 >Feature sequence252 279 422 gene locus_tag LOCUS_22280 279 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 442 2688 gene locus_tag LOCUS_22290 442 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 >Feature sequence253 >Feature sequence254 <1 2139 gene locus_tag LOCUS_22300 <1 2139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005681492.1:FAD-dependent oxidoreductase 3279 2161 gene locus_tag LOCUS_22310 3279 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 >Feature sequence255 1496 744 gene locus_tag LOCUS_22320 gene aroD 1496 744 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870974.1 protein_id gnl|my_center|LOCUS_22320 1586 3592 gene locus_tag LOCUS_22330 1586 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence256 484 738 gene locus_tag LOCUS_22340 484 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 816 1358 gene locus_tag LOCUS_22350 816 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 3069 1453 gene locus_tag LOCUS_22360 3069 1453 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074280.1 protein_id gnl|my_center|LOCUS_22360 3424 3056 gene locus_tag LOCUS_22370 3424 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 3547 3690 gene locus_tag LOCUS_22380 3547 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 >Feature sequence257 1127 1459 gene locus_tag LOCUS_22390 1127 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 2088 3242 gene locus_tag LOCUS_22400 2088 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 3356 3478 gene locus_tag LOCUS_22410 3356 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence258 124 1284 gene locus_tag LOCUS_22420 124 1284 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919503.1 protein_id gnl|my_center|LOCUS_22420 1318 2310 gene locus_tag LOCUS_22430 1318 2310 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_22430 2343 2981 gene locus_tag LOCUS_22440 2343 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2987 3673 gene locus_tag LOCUS_22450 2987 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence259 2703 2224 gene locus_tag LOCUS_22460 2703 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 2918 2700 gene locus_tag LOCUS_22470 2918 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence260 2352 3437 gene locus_tag LOCUS_22480 gene aroB 2352 3437 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_22480 >Feature sequence261 45 119 gene locus_tag LOCUS_t00390 45 119 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1225 152 gene locus_tag LOCUS_22490 1225 152 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384001.1 protein_id gnl|my_center|LOCUS_22490 1404 1222 gene locus_tag LOCUS_22500 1404 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 1621 1406 gene locus_tag LOCUS_22510 1621 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 3243 1621 gene locus_tag LOCUS_22520 3243 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 >Feature sequence262 >Feature sequence263 <1 858 gene locus_tag LOCUS_22530 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000101814.1:elongation factor G 859 1077 gene locus_tag LOCUS_22540 859 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 1181 2380 gene locus_tag LOCUS_22550 gene tuf 1181 2380 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_22550 2524 2931 gene locus_tag LOCUS_22560 2524 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence264 627 1478 gene locus_tag LOCUS_22570 627 1478 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_22570 1689 2750 gene locus_tag LOCUS_22580 gene ychF 1689 2750 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037200879.1 protein_id gnl|my_center|LOCUS_22580 >Feature sequence265 376 149 gene locus_tag LOCUS_22590 376 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 1056 313 gene locus_tag LOCUS_22600 1056 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22600 1428 1057 gene locus_tag LOCUS_22610 1428 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22610 1655 2326 gene locus_tag LOCUS_22620 1655 2326 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544852.1 protein_id gnl|my_center|LOCUS_22620 2907 2368 gene locus_tag LOCUS_22630 2907 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 3376 2894 gene locus_tag LOCUS_22640 3376 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 3561 3394 gene locus_tag LOCUS_22650 3561 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence266 2236 299 gene locus_tag LOCUS_22660 2236 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 2821 2441 gene locus_tag LOCUS_22670 2821 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 2963 2890 gene locus_tag LOCUS_t00400 2963 2890 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence267 54 1373 gene locus_tag LOCUS_22680 54 1373 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_22680 2165 1824 gene locus_tag LOCUS_22690 2165 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 3099 2188 gene locus_tag LOCUS_22700 3099 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 >Feature sequence268 <1 909 gene locus_tag LOCUS_22710 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003426955.1:NAD(P)H-dependent glycerol-3-phosphate dehydrogenase 906 1508 gene locus_tag LOCUS_22720 906 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 2980 1766 gene locus_tag LOCUS_22730 2980 1766 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence269 861 1451 gene locus_tag LOCUS_22740 861 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 1495 2583 gene locus_tag LOCUS_22750 1495 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 >Feature sequence270 >Feature sequence271 463 5 gene locus_tag LOCUS_22760 463 5 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061381.1 protein_id gnl|my_center|LOCUS_22760 1506 463 gene locus_tag LOCUS_22770 1506 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 2229 1936 gene locus_tag LOCUS_22780 2229 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 2590 2237 gene locus_tag LOCUS_22790 2590 2237 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482886.1 protein_id gnl|my_center|LOCUS_22790 3308 2592 gene locus_tag LOCUS_22800 3308 2592 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_22800 >Feature sequence272 843 226 gene locus_tag LOCUS_22810 gene plsY 843 226 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392834.1 protein_id gnl|my_center|LOCUS_22810 978 2120 gene locus_tag LOCUS_22820 978 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence273 1209 967 gene locus_tag LOCUS_22830 1209 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 1574 2689 gene locus_tag LOCUS_22840 1574 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 >Feature sequence274 1319 696 gene locus_tag LOCUS_22850 gene nusG 1319 696 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_22850 3486 1687 gene locus_tag LOCUS_22860 gene gyrB 3486 1687 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434229.1 protein_id gnl|my_center|LOCUS_22860 >Feature sequence275 153 1325 gene locus_tag LOCUS_22870 153 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 2983 1604 gene locus_tag LOCUS_22880 2983 1604 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259685.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence276 2377 575 gene locus_tag LOCUS_22890 2377 575 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928981.1 protein_id gnl|my_center|LOCUS_22890 3468 2374 gene locus_tag LOCUS_22900 3468 2374 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202293.1 protein_id gnl|my_center|LOCUS_22900 >Feature sequence277 >Feature sequence278 291 869 gene locus_tag LOCUS_22910 291 869 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545523.1 protein_id gnl|my_center|LOCUS_22910 3053 1359 gene locus_tag LOCUS_22920 3053 1359 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258481.1 protein_id gnl|my_center|LOCUS_22920 >Feature sequence279 806 387 gene locus_tag LOCUS_22930 806 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 <3436 1569 gene locus_tag LOCUS_22940 <3436 1569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963986.1:outer membrane beta-barrel family protein >Feature sequence280 <1 1152 gene locus_tag LOCUS_22950 <1 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249918.1:Xaa-Pro dipeptidase PepQ 1275 2714 gene locus_tag LOCUS_22960 1275 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence281 942 580 gene locus_tag LOCUS_22970 942 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 3397 989 gene locus_tag LOCUS_22980 3397 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence282 476 1192 gene locus_tag LOCUS_22990 476 1192 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704472.1 protein_id gnl|my_center|LOCUS_22990 1265 1867 gene locus_tag LOCUS_23000 1265 1867 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303545.1 protein_id gnl|my_center|LOCUS_23000 1884 2498 gene locus_tag LOCUS_23010 gene nqrE 1884 2498 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208713.1 protein_id gnl|my_center|LOCUS_23010 >Feature sequence283 3 287 gene locus_tag LOCUS_23020 3 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 561 2654 gene locus_tag LOCUS_23030 561 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 >Feature sequence284 527 363 gene locus_tag LOCUS_23040 527 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 958 572 gene locus_tag LOCUS_23050 958 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 1272 1084 gene locus_tag LOCUS_23060 1272 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 1387 1313 gene locus_tag LOCUS_t00410 1387 1313 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1700 1452 gene locus_tag LOCUS_23070 1700 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2096 1770 gene locus_tag LOCUS_23080 2096 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 2422 2195 gene locus_tag LOCUS_23090 2422 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 2765 2475 gene locus_tag LOCUS_23100 2765 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 3179 2904 gene locus_tag LOCUS_23110 3179 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 >Feature sequence285 2016 640 gene locus_tag LOCUS_23120 2016 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 3173 2016 gene locus_tag LOCUS_23130 gene holA 3173 2016 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229987.1 protein_id gnl|my_center|LOCUS_23130 >Feature sequence286 1970 525 gene locus_tag LOCUS_23140 1970 525 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390653.1 protein_id gnl|my_center|LOCUS_23140 2216 2959 gene locus_tag LOCUS_23150 gene deoC 2216 2959 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017446.1 protein_id gnl|my_center|LOCUS_23150 >Feature sequence287 969 157 gene locus_tag LOCUS_23160 gene arsS 969 157 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_23160 1211 2575 gene locus_tag LOCUS_23170 1211 2575 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839765.1 protein_id gnl|my_center|LOCUS_23170 2572 3246 gene locus_tag LOCUS_23180 2572 3246 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence288 65 289 gene locus_tag LOCUS_23190 65 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence289 2861 360 gene locus_tag LOCUS_23200 gene carB 2861 360 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23200 >Feature sequence290 238 2115 gene locus_tag LOCUS_23210 238 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 2099 2347 gene locus_tag LOCUS_23220 2099 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 >Feature sequence291 191 784 gene locus_tag LOCUS_23230 191 784 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939847.1 protein_id gnl|my_center|LOCUS_23230 788 1807 gene locus_tag LOCUS_23240 788 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 >Feature sequence292 1460 1242 gene locus_tag LOCUS_23250 1460 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1924 1460 gene locus_tag LOCUS_23260 1924 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 3248 1938 gene locus_tag LOCUS_23270 3248 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 >Feature sequence293 13 102 gene locus_tag LOCUS_t00420 13 102 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 <3246 1553 gene locus_tag LOCUS_23280 <3246 1553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883927.1:DNA methyltransferase >Feature sequence294 178 92 gene locus_tag LOCUS_t00430 178 92 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 286 762 gene locus_tag LOCUS_23290 286 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 788 1759 gene locus_tag LOCUS_23300 gene galE 788 1759 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900516.1 protein_id gnl|my_center|LOCUS_23300 1749 3002 gene locus_tag LOCUS_23310 1749 3002 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_23310 >Feature sequence295 >Feature sequence296 1372 434 gene locus_tag LOCUS_23320 1372 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 1918 1541 gene locus_tag LOCUS_23330 1918 1541 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939303.1 protein_id gnl|my_center|LOCUS_23330 2036 1899 gene locus_tag LOCUS_23340 2036 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2979 2041 gene locus_tag LOCUS_23350 2979 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 >Feature sequence297 38 121 gene locus_tag LOCUS_t00440 38 121 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 298 2121 gene locus_tag LOCUS_23360 298 2121 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035434.1 protein_id gnl|my_center|LOCUS_23360 2322 3062 gene locus_tag LOCUS_23370 2322 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence298 40 690 gene locus_tag LOCUS_23380 40 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1645 2397 gene locus_tag LOCUS_23390 1645 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2412 3101 gene locus_tag LOCUS_23400 2412 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 >Feature sequence299 1027 1185 gene locus_tag LOCUS_23410 1027 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 >Feature sequence300 680 219 gene locus_tag LOCUS_23420 680 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 1124 933 gene locus_tag LOCUS_23430 1124 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 1564 1124 gene locus_tag LOCUS_23440 1564 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 3163 1586 gene locus_tag LOCUS_23450 gene glmS 3163 1586 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931824.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence301 576 349 gene locus_tag LOCUS_23460 576 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 815 2875 gene locus_tag LOCUS_23470 815 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence302 >Feature sequence303 >Feature sequence304 373 68 gene locus_tag LOCUS_23480 373 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 799 488 gene locus_tag LOCUS_23490 799 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 1325 1933 gene locus_tag LOCUS_23500 1325 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 2219 2028 gene locus_tag LOCUS_23510 2219 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 2387 2872 gene locus_tag LOCUS_23520 2387 2872 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195676.1 protein_id gnl|my_center|LOCUS_23520 >Feature sequence305 2011 2496 gene locus_tag LOCUS_23530 2011 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 >Feature sequence306 1 1680 gene locus_tag LOCUS_23540 1 1680 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720843.1 protein_id gnl|my_center|LOCUS_23540 2458 1682 gene locus_tag LOCUS_23550 gene tcdA 2458 1682 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173260.1 protein_id gnl|my_center|LOCUS_23550 3061 2471 gene locus_tag LOCUS_23560 3061 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence307 752 111 gene locus_tag LOCUS_23570 752 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 902 2170 gene locus_tag LOCUS_23580 902 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 >Feature sequence308 702 259 gene locus_tag LOCUS_23590 702 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 1418 1347 gene locus_tag LOCUS_t00450 1418 1347 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2452 1469 gene locus_tag LOCUS_23600 2452 1469 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922739.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence309 704 546 gene locus_tag LOCUS_23610 704 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 >Feature sequence310 138 1187 gene locus_tag LOCUS_23620 138 1187 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966017.1 protein_id gnl|my_center|LOCUS_23620 1230 2669 gene locus_tag LOCUS_23630 1230 2669 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090641.1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence311 673 888 gene locus_tag LOCUS_23640 673 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 1089 1301 gene locus_tag LOCUS_23650 1089 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 1563 1808 gene locus_tag LOCUS_23660 1563 1808 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence312 578 387 gene locus_tag LOCUS_23670 578 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 683 2446 gene locus_tag LOCUS_23680 gene fucI 683 2446 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_23680 >Feature sequence313 <1 2155 gene locus_tag LOCUS_23690 <1 2155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071157.1:S8 family serine peptidase 2257 3072 gene locus_tag LOCUS_23700 2257 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence314 1951 1790 gene locus_tag LOCUS_23710 1951 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 2897 2007 gene locus_tag LOCUS_23720 2897 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 >Feature sequence315 843 1580 gene locus_tag LOCUS_23730 843 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 2324 1575 gene locus_tag LOCUS_23740 2324 1575 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101593.1 protein_id gnl|my_center|LOCUS_23740 2560 2790 gene locus_tag LOCUS_23750 2560 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 >Feature sequence316 1 201 gene locus_tag LOCUS_23760 1 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 201 1097 gene locus_tag LOCUS_23770 201 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 1094 2227 gene locus_tag LOCUS_23780 gene ribD 1094 2227 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence317 1518 964 gene locus_tag LOCUS_23790 1518 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 2174 1533 gene locus_tag LOCUS_23800 2174 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 >Feature sequence318 >Feature sequence319 2613 997 gene locus_tag LOCUS_23810 2613 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence320 509 1873 gene locus_tag LOCUS_23820 509 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 1940 2140 gene locus_tag LOCUS_23830 1940 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 2299 2511 gene locus_tag LOCUS_23840 2299 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence321 >Feature sequence322 506 294 gene locus_tag LOCUS_23850 506 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 1900 1463 gene locus_tag LOCUS_23860 1900 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 >Feature sequence323 156 386 gene locus_tag LOCUS_23870 156 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 386 772 gene locus_tag LOCUS_23880 386 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 1372 1217 gene locus_tag LOCUS_23890 1372 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence324 <1 533 gene locus_tag LOCUS_23900 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141291.1:radical SAM protein 540 2234 gene locus_tag LOCUS_23910 540 2234 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249504.1 protein_id gnl|my_center|LOCUS_23910 2421 2293 gene locus_tag LOCUS_23920 2421 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence325 782 1732 gene locus_tag LOCUS_23930 782 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368614.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence326 1315 1743 gene locus_tag LOCUS_23940 1315 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 1824 2918 gene locus_tag LOCUS_23950 1824 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 >Feature sequence327 2534 348 gene locus_tag LOCUS_23960 2534 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 >Feature sequence328 <1 1037 gene locus_tag LOCUS_23970 <1 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258686.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence329 941 1924 gene locus_tag LOCUS_23980 941 1924 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939921.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence330 <1 705 gene locus_tag LOCUS_23990 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032728610.1:N-6 DNA methylase 996 1901 gene locus_tag LOCUS_24000 996 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 1898 2017 gene locus_tag LOCUS_24010 1898 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 2163 2414 gene locus_tag LOCUS_24020 2163 2414 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250181.1 protein_id gnl|my_center|LOCUS_24020 2404 2688 gene locus_tag LOCUS_24030 2404 2688 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221356.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence331 2885 1659 gene locus_tag LOCUS_24040 2885 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence332 481 56 gene locus_tag LOCUS_24050 gene nusB 481 56 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_24050 730 485 gene locus_tag LOCUS_24060 730 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 1698 1120 gene locus_tag LOCUS_24070 1698 1120 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546482.1 protein_id gnl|my_center|LOCUS_24070 1828 2292 gene locus_tag LOCUS_24080 1828 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 2276 2779 gene locus_tag LOCUS_24090 2276 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence333 <1 564 gene locus_tag LOCUS_24100 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103038490.1:protein-L-isoaspartate(D-aspartate) O-methyltransferase >Feature sequence334 1084 329 gene locus_tag LOCUS_24110 gene istB 1084 329 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064816995.1 protein_id gnl|my_center|LOCUS_24110 2550 1081 gene locus_tag LOCUS_24120 gene istA 2550 1081 CDS product IS21-like element ISBj11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084518.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence335 1375 1554 gene locus_tag LOCUS_24130 1375 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence336 652 1425 gene locus_tag LOCUS_24140 652 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 >Feature sequence337 1029 1691 gene locus_tag LOCUS_24150 1029 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 >Feature sequence338 1726 407 gene locus_tag LOCUS_24160 gene purD 1726 407 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_24160 2303 1884 gene locus_tag LOCUS_24170 2303 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 2724 2509 gene locus_tag LOCUS_24180 2724 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 >Feature sequence339 >Feature sequence340 107 1156 gene locus_tag LOCUS_24190 107 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 1197 1580 gene locus_tag LOCUS_24200 1197 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 1614 2525 gene locus_tag LOCUS_24210 1614 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 >Feature sequence341 817 554 gene locus_tag LOCUS_24220 817 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 1511 921 gene locus_tag LOCUS_24230 1511 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 2045 1584 gene locus_tag LOCUS_24240 2045 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 2799 2071 gene locus_tag LOCUS_24250 2799 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 >Feature sequence342 1765 1965 gene locus_tag LOCUS_24260 1765 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 <2843 2169 gene locus_tag LOCUS_24270 <2843 2169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226846.1:DUF4397 domain-containing protein >Feature sequence343 2370 292 gene locus_tag LOCUS_24280 2370 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence344 239 1477 gene locus_tag LOCUS_24290 239 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 1642 2139 gene locus_tag LOCUS_24300 1642 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 <2838 2132 gene locus_tag LOCUS_24310 <2838 2132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057723.1:permease >Feature sequence345 >Feature sequence346 1050 199 gene locus_tag LOCUS_24320 1050 199 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948625.1 protein_id gnl|my_center|LOCUS_24320 2365 1043 gene locus_tag LOCUS_24330 2365 1043 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926993.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence347 243 809 gene locus_tag LOCUS_24340 243 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 >Feature sequence348 685 1830 gene locus_tag LOCUS_24350 685 1830 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104921.1 protein_id gnl|my_center|LOCUS_24350 1820 2401 gene locus_tag LOCUS_24360 1820 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 2415 2534 gene locus_tag LOCUS_24370 2415 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 >Feature sequence349 362 2239 gene locus_tag LOCUS_24380 362 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 >Feature sequence350 2247 226 gene locus_tag LOCUS_24390 2247 226 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_24390 >Feature sequence351 >Feature sequence352 739 981 gene locus_tag LOCUS_24400 739 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 1245 1526 gene locus_tag LOCUS_24410 1245 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 1523 1648 gene locus_tag LOCUS_24420 1523 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 1650 2435 gene locus_tag LOCUS_24430 1650 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 2436 2756 gene locus_tag LOCUS_24440 2436 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 >Feature sequence353 187 1431 gene locus_tag LOCUS_24450 187 1431 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932205.1 protein_id gnl|my_center|LOCUS_24450 1932 1432 gene locus_tag LOCUS_24460 1932 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 >Feature sequence354 >Feature sequence355 505 765 gene locus_tag LOCUS_24470 505 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 758 1021 gene locus_tag LOCUS_24480 758 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 1018 1584 gene locus_tag LOCUS_24490 1018 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 1666 2385 gene locus_tag LOCUS_24500 1666 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 >Feature sequence356 1070 864 gene locus_tag LOCUS_24510 1070 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 1549 1067 gene locus_tag LOCUS_24520 1549 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 2397 1606 gene locus_tag LOCUS_24530 2397 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 >Feature sequence357 256 1383 gene locus_tag LOCUS_24540 256 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 1376 2215 gene locus_tag LOCUS_24550 1376 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence358 183 854 gene locus_tag LOCUS_24560 183 854 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876008.1 protein_id gnl|my_center|LOCUS_24560 847 1425 gene locus_tag LOCUS_24570 847 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 1415 2269 gene locus_tag LOCUS_24580 1415 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 2367 2723 gene locus_tag LOCUS_24590 2367 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence359 1359 2456 gene locus_tag LOCUS_24600 1359 2456 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057094.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence360 <1 2299 gene locus_tag LOCUS_24610 <1 2299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119870.1:choice-of-anchor Q domain-containing protein >Feature sequence361 414 1172 gene locus_tag LOCUS_24620 414 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 1185 1475 gene locus_tag LOCUS_24630 1185 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 1633 2286 gene locus_tag LOCUS_24640 1633 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 >Feature sequence362 1854 1336 gene locus_tag LOCUS_24650 1854 1336 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_24650 2429 1884 gene locus_tag LOCUS_24660 2429 1884 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_24660 >Feature sequence363 1714 206 gene locus_tag LOCUS_24670 1714 206 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence364 <1 1013 gene locus_tag LOCUS_24680 <1 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002674820.1:glucose-1-phosphate adenylyltransferase 1017 1718 gene locus_tag LOCUS_24690 1017 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 1782 2717 gene locus_tag LOCUS_24700 1782 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence365 1708 1187 gene locus_tag LOCUS_24710 1708 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 2335 1754 gene locus_tag LOCUS_24720 2335 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 >Feature sequence366 697 500 gene locus_tag LOCUS_24730 697 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 >Feature sequence367 2537 1287 gene locus_tag LOCUS_24740 gene pcnB 2537 1287 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943862.1 protein_id gnl|my_center|LOCUS_24740 >Feature sequence368 106 31 gene locus_tag LOCUS_t00460 106 31 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 397 1515 gene locus_tag LOCUS_24750 397 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 1827 1534 gene locus_tag LOCUS_24760 1827 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 >Feature sequence369 <1 710 gene locus_tag LOCUS_24770 <1 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719496.1:2-isopropylmalate synthase 717 1073 gene locus_tag LOCUS_24780 717 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 1093 1557 gene locus_tag LOCUS_24790 1093 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 1561 2334 gene locus_tag LOCUS_24800 1561 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023093.1 protein_id gnl|my_center|LOCUS_24800 >Feature sequence370 630 76 gene locus_tag LOCUS_24810 630 76 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087162.1 protein_id gnl|my_center|LOCUS_24810 1113 706 gene locus_tag LOCUS_24820 1113 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 1620 2282 gene locus_tag LOCUS_24830 1620 2282 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183858629.1 protein_id gnl|my_center|LOCUS_24830 >Feature sequence371 223 11 gene locus_tag LOCUS_24840 223 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 661 284 gene locus_tag LOCUS_24850 661 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 1178 954 gene locus_tag LOCUS_24860 1178 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 1688 1179 gene locus_tag LOCUS_24870 1688 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 1923 1669 gene locus_tag LOCUS_24880 1923 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 2368 1925 gene locus_tag LOCUS_24890 2368 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 >Feature sequence372 1251 985 gene locus_tag LOCUS_24900 1251 985 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391712.1 protein_id gnl|my_center|LOCUS_24900 1531 1277 gene locus_tag LOCUS_24910 1531 1277 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_24910 1782 1528 gene locus_tag LOCUS_24920 1782 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 >Feature sequence373 1242 793 gene locus_tag LOCUS_24930 1242 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 >Feature sequence374 1170 2438 gene locus_tag LOCUS_24940 1170 2438 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163760282.1 protein_id gnl|my_center|LOCUS_24940 >Feature sequence375 1762 1043 gene locus_tag LOCUS_24950 1762 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 >Feature sequence376 >Feature sequence377 1018 440 gene locus_tag LOCUS_24960 1018 440 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582959.1 protein_id gnl|my_center|LOCUS_24960 2220 1075 gene locus_tag LOCUS_24970 2220 1075 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937635.1 protein_id gnl|my_center|LOCUS_24970 2405 2217 gene locus_tag LOCUS_24980 2405 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 >Feature sequence378 >Feature sequence379 >Feature sequence380 587 2101 gene locus_tag LOCUS_24990 587 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 >Feature sequence381 >Feature sequence382 1759 536 gene locus_tag LOCUS_25000 1759 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 <2628 1904 gene locus_tag LOCUS_25010 <2628 1904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258521.1:1-phosphofructokinase family hexose kinase >Feature sequence383 619 1941 gene locus_tag LOCUS_25020 619 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 >Feature sequence384 >Feature sequence385 <1 1311 gene locus_tag LOCUS_25030 <1 1311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201778938.1:class I SAM-dependent DNA methyltransferase 1877 1758 gene locus_tag LOCUS_25040 1877 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 1998 2480 gene locus_tag LOCUS_25050 1998 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 >Feature sequence386 1310 906 gene locus_tag LOCUS_25060 1310 906 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788735.1 protein_id gnl|my_center|LOCUS_25060 1389 2000 gene locus_tag LOCUS_25070 1389 2000 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_25070 2015 2389 gene locus_tag LOCUS_25080 2015 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 >Feature sequence387 <1 707 gene locus_tag LOCUS_25090 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025385041.1:site-specific integrase 869 1903 gene locus_tag LOCUS_25100 869 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 2252 2461 gene locus_tag LOCUS_25110 2252 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 >Feature sequence388 1 1095 gene locus_tag LOCUS_25120 1 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 2357 1092 gene locus_tag LOCUS_25130 2357 1092 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_25130 >Feature sequence389 108 368 gene locus_tag LOCUS_25140 108 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 405 2537 gene locus_tag LOCUS_25150 405 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 >Feature sequence390 240 1343 gene locus_tag LOCUS_25160 240 1343 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410070.1 protein_id gnl|my_center|LOCUS_25160 >Feature sequence391 889 110 gene locus_tag LOCUS_25170 889 110 CDS product DUF4438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927126.1 protein_id gnl|my_center|LOCUS_25170 1162 1620 gene locus_tag LOCUS_25180 gene dtd 1162 1620 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941193.1 protein_id gnl|my_center|LOCUS_25180 1707 2111 gene locus_tag LOCUS_25190 1707 2111 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_25190 >Feature sequence392 518 859 gene locus_tag LOCUS_25200 518 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 1490 801 gene locus_tag LOCUS_25210 1490 801 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460218.1 protein_id gnl|my_center|LOCUS_25210 >Feature sequence393 1480 1079 gene locus_tag LOCUS_25220 1480 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 >Feature sequence394 >Feature sequence395 >Feature sequence396 165 296 gene locus_tag LOCUS_25230 165 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 815 955 gene locus_tag LOCUS_25240 815 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 989 1120 gene locus_tag LOCUS_25250 989 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 1201 1575 gene locus_tag LOCUS_25260 1201 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 1618 1779 gene locus_tag LOCUS_25270 1618 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 <2565 1955 gene locus_tag LOCUS_25280 <2565 1955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_153440448.1:IS21-like element ISRsp2 family transposase >Feature sequence397 80 295 gene locus_tag LOCUS_25290 80 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 559 2361 gene locus_tag LOCUS_25300 559 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 >Feature sequence398 1362 580 gene locus_tag LOCUS_25310 1362 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 1840 1346 gene locus_tag LOCUS_25320 1840 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 2502 1837 gene locus_tag LOCUS_25330 2502 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence399 470 1195 gene locus_tag LOCUS_25340 470 1195 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_25340 1192 1608 gene locus_tag LOCUS_25350 1192 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 >Feature sequence400 >Feature sequence401 1706 705 gene locus_tag LOCUS_25360 1706 705 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722210.1 protein_id gnl|my_center|LOCUS_25360 <2542 1875 gene locus_tag LOCUS_25370 <2542 1875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722210.1:glycosyltransferase >Feature sequence402 >Feature sequence403 886 203 gene locus_tag LOCUS_25380 gene rnc 886 203 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722419.1 protein_id gnl|my_center|LOCUS_25380 1782 883 gene locus_tag LOCUS_25390 1782 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 2489 1779 gene locus_tag LOCUS_25400 gene lepB 2489 1779 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383416.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence404 >Feature sequence405 2144 423 gene locus_tag LOCUS_25410 2144 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence406 59 418 gene locus_tag LOCUS_25420 59 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 427 1035 gene locus_tag LOCUS_25430 427 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430