>Feature sequence001 <1 1052 gene locus_tag LOCUS_00010 <1 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392536.1:YifB family Mg chelatase-like AAA ATPase 1330 1151 gene locus_tag LOCUS_00020 1330 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1320 1475 gene locus_tag LOCUS_00030 1320 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1631 1861 gene locus_tag LOCUS_00040 1631 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2092 2793 gene locus_tag LOCUS_00050 2092 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 2795 3256 gene locus_tag LOCUS_00060 2795 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4322 4636 gene locus_tag LOCUS_00070 4322 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 4827 6959 gene locus_tag LOCUS_00080 4827 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6996 7754 gene locus_tag LOCUS_00090 6996 7754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 7775 8209 gene locus_tag LOCUS_00100 gene fabZ 7775 8209 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975310.1 protein_id gnl|my_center|LOCUS_00100 8190 9098 gene locus_tag LOCUS_00110 gene ftcD 8190 9098 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681237.1 protein_id gnl|my_center|LOCUS_00110 9136 10413 gene locus_tag LOCUS_00120 gene murD 9136 10413 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460698.1 protein_id gnl|my_center|LOCUS_00120 10800 11891 gene locus_tag LOCUS_00130 gene spoVE 10800 11891 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753520.1 protein_id gnl|my_center|LOCUS_00130 11888 12964 gene locus_tag LOCUS_00140 gene murG 11888 12964 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460696.1 protein_id gnl|my_center|LOCUS_00140 12964 14325 gene locus_tag LOCUS_00150 gene murC 12964 14325 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392363.1 protein_id gnl|my_center|LOCUS_00150 14277 15164 gene locus_tag LOCUS_00160 gene murB 14277 15164 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392364.1 protein_id gnl|my_center|LOCUS_00160 15245 15829 gene locus_tag LOCUS_00170 15245 15829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 15846 17105 gene locus_tag LOCUS_00180 gene ftsA 15846 17105 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_00180 17108 18172 gene locus_tag LOCUS_00190 gene ftsZ 17108 18172 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_00190 19932 18295 gene locus_tag LOCUS_00200 19932 18295 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223119.1 protein_id gnl|my_center|LOCUS_00200 20076 20264 gene locus_tag LOCUS_00210 20076 20264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 20676 20266 gene locus_tag LOCUS_00220 20676 20266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 20715 23636 gene locus_tag LOCUS_00230 gene pcrA 20715 23636 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542538.1 protein_id gnl|my_center|LOCUS_00230 23681 25435 gene locus_tag LOCUS_00240 gene aspS 23681 25435 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_00240 26289 25543 gene locus_tag LOCUS_00250 26289 25543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 27602 26391 gene locus_tag LOCUS_00260 27602 26391 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_00260 28223 27729 gene locus_tag LOCUS_00270 28223 27729 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546148.1 protein_id gnl|my_center|LOCUS_00270 28379 28939 gene locus_tag LOCUS_00280 28379 28939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 29021 30394 gene locus_tag LOCUS_00290 29021 30394 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926053.1 protein_id gnl|my_center|LOCUS_00290 30391 31401 gene locus_tag LOCUS_00300 gene floA 30391 31401 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812222.1 protein_id gnl|my_center|LOCUS_00300 32909 31554 gene locus_tag LOCUS_00310 32909 31554 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_00310 34683 32911 gene locus_tag LOCUS_00320 34683 32911 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_00320 35804 34680 gene locus_tag LOCUS_00330 gene sucC 35804 34680 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_00330 35948 37858 gene locus_tag LOCUS_00340 gene gyrB 35948 37858 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391556.1 protein_id gnl|my_center|LOCUS_00340 38353 37874 gene locus_tag LOCUS_00350 38353 37874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 40205 38361 gene locus_tag LOCUS_00360 40205 38361 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986475.1 protein_id gnl|my_center|LOCUS_00360 40325 41332 gene locus_tag LOCUS_00370 40325 41332 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_00370 41416 42858 gene locus_tag LOCUS_00380 gene proS 41416 42858 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227720.1 protein_id gnl|my_center|LOCUS_00380 43115 42915 gene locus_tag LOCUS_00390 43115 42915 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_00390 43783 44055 gene locus_tag LOCUS_00400 43783 44055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 44056 44574 gene locus_tag LOCUS_00410 44056 44574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_00410 44914 44839 gene locus_tag LOCUS_t00010 44914 44839 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 45411 44923 gene locus_tag LOCUS_00420 gene hycI 45411 44923 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706332.1 protein_id gnl|my_center|LOCUS_00420 46043 45411 gene locus_tag LOCUS_00430 46043 45411 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545137.1 protein_id gnl|my_center|LOCUS_00430 47082 46126 gene locus_tag LOCUS_00440 47082 46126 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887857.1 protein_id gnl|my_center|LOCUS_00440 47926 47075 gene locus_tag LOCUS_00450 gene accD 47926 47075 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887858.1 protein_id gnl|my_center|LOCUS_00450 48581 47907 gene locus_tag LOCUS_00460 48581 47907 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189093.1 protein_id gnl|my_center|LOCUS_00460 48739 50697 gene locus_tag LOCUS_00470 gene acs 48739 50697 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140163.1 protein_id gnl|my_center|LOCUS_00470 50785 52086 gene locus_tag LOCUS_00480 50785 52086 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544926.1 protein_id gnl|my_center|LOCUS_00480 54347 52083 gene locus_tag LOCUS_00490 54347 52083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 57047 54354 gene locus_tag LOCUS_00500 57047 54354 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404851.1 protein_id gnl|my_center|LOCUS_00500 57203 57649 gene locus_tag LOCUS_00510 gene rpsI 57203 57649 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228699.1 protein_id gnl|my_center|LOCUS_00510 57657 57884 gene locus_tag LOCUS_00520 gene rpmE 57657 57884 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632496.1 protein_id gnl|my_center|LOCUS_00520 57888 58757 gene locus_tag LOCUS_00530 57888 58757 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 protein_id gnl|my_center|LOCUS_00530 59563 58709 gene locus_tag LOCUS_00540 59563 58709 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_00540 60013 59606 gene locus_tag LOCUS_00550 gene nusB 60013 59606 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_00550 60554 60021 gene locus_tag LOCUS_00560 60554 60021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 60963 60556 gene locus_tag LOCUS_00570 60963 60556 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419170.1 protein_id gnl|my_center|LOCUS_00570 61345 60956 gene locus_tag LOCUS_00580 61345 60956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 61918 61355 gene locus_tag LOCUS_00590 gene efp 61918 61355 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547948.1 protein_id gnl|my_center|LOCUS_00590 62456 62001 gene locus_tag LOCUS_00600 62456 62001 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479804.1 protein_id gnl|my_center|LOCUS_00600 62575 62847 gene locus_tag LOCUS_00610 gene groES 62575 62847 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103730.1 protein_id gnl|my_center|LOCUS_00610 62858 64480 gene locus_tag LOCUS_00620 gene groL 62858 64480 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081434.1 protein_id gnl|my_center|LOCUS_00620 64624 66840 gene locus_tag LOCUS_00630 gene topA 64624 66840 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143190.1 protein_id gnl|my_center|LOCUS_00630 67802 66837 gene locus_tag LOCUS_00640 gene rpoD 67802 66837 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_00640 68605 67979 gene locus_tag LOCUS_00650 68605 67979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 70199 68739 gene locus_tag LOCUS_00660 70199 68739 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_00660 70317 71561 gene locus_tag LOCUS_00670 gene dpaL 70317 71561 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869174.1 protein_id gnl|my_center|LOCUS_00670 71592 73025 gene locus_tag LOCUS_00680 71592 73025 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_00680 73102 73539 gene locus_tag LOCUS_00690 73102 73539 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943317.1 protein_id gnl|my_center|LOCUS_00690 73607 74539 gene locus_tag LOCUS_00700 73607 74539 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228552.1 protein_id gnl|my_center|LOCUS_00700 74539 76314 gene locus_tag LOCUS_00710 74539 76314 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_00710 76487 77461 gene locus_tag LOCUS_00720 76487 77461 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546588.1 protein_id gnl|my_center|LOCUS_00720 79193 77568 gene locus_tag LOCUS_00730 gene hcp 79193 77568 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870473.1 protein_id gnl|my_center|LOCUS_00730 79666 79244 gene locus_tag LOCUS_00740 79666 79244 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870471.1 protein_id gnl|my_center|LOCUS_00740 80019 79735 gene locus_tag LOCUS_00750 80019 79735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 81638 80016 gene locus_tag LOCUS_00760 gene xseA 81638 80016 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764150.1 protein_id gnl|my_center|LOCUS_00760 82423 81692 gene locus_tag LOCUS_00770 82423 81692 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870163.1 protein_id gnl|my_center|LOCUS_00770 82508 82595 gene locus_tag LOCUS_t00020 82508 82595 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 83189 82785 gene locus_tag LOCUS_00780 83189 82785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 83586 84140 gene locus_tag LOCUS_00790 83586 84140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 84274 84486 gene locus_tag LOCUS_00800 84274 84486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 85212 84541 gene locus_tag LOCUS_00810 85212 84541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 85889 85242 gene locus_tag LOCUS_00820 85889 85242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 85970 87913 gene locus_tag LOCUS_00830 gene fusA 85970 87913 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258549.1 protein_id gnl|my_center|LOCUS_00830 87921 88460 gene locus_tag LOCUS_00840 87921 88460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 88457 88882 gene locus_tag LOCUS_00850 88457 88882 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937805.1 protein_id gnl|my_center|LOCUS_00850 88950 89025 gene locus_tag LOCUS_t00030 88950 89025 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 89050 89136 gene locus_tag LOCUS_t00040 89050 89136 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 89179 89254 gene locus_tag LOCUS_t00050 89179 89254 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 89329 90543 gene locus_tag LOCUS_00860 gene tuf 89329 90543 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583343.1 protein_id gnl|my_center|LOCUS_00860 90716 90791 gene locus_tag LOCUS_t00060 90716 90791 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 90807 91010 gene locus_tag LOCUS_00870 gene secE 90807 91010 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081514.1 protein_id gnl|my_center|LOCUS_00870 91020 92123 gene locus_tag LOCUS_00880 gene nusG 91020 92123 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081513.1 protein_id gnl|my_center|LOCUS_00880 92133 92561 gene locus_tag LOCUS_00890 gene rplK 92133 92561 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881263.1 protein_id gnl|my_center|LOCUS_00890 92558 93262 gene locus_tag LOCUS_00900 gene rplA 92558 93262 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_00900 93272 93796 gene locus_tag LOCUS_00910 gene rplJ 93272 93796 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904072.1 protein_id gnl|my_center|LOCUS_00910 93801 94175 gene locus_tag LOCUS_00920 gene rplL 93801 94175 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081509.1 protein_id gnl|my_center|LOCUS_00920 94251 97577 gene locus_tag LOCUS_00930 gene rpoB 94251 97577 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869936.1 protein_id gnl|my_center|LOCUS_00930 97587 98024 gene locus_tag LOCUS_00940 97587 98024 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644009.1 protein_id gnl|my_center|LOCUS_00940 98062 99351 gene locus_tag LOCUS_00950 98062 99351 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249831.1 protein_id gnl|my_center|LOCUS_00950 99422 101503 gene locus_tag LOCUS_00960 99422 101503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 102509 101508 gene locus_tag LOCUS_00970 102509 101508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 103585 102551 gene locus_tag LOCUS_00980 103585 102551 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761838.1 protein_id gnl|my_center|LOCUS_00980 105255 103582 gene locus_tag LOCUS_00990 105255 103582 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053795.1 protein_id gnl|my_center|LOCUS_00990 106280 105252 gene locus_tag LOCUS_01000 106280 105252 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053820.1 protein_id gnl|my_center|LOCUS_01000 107296 106277 gene locus_tag LOCUS_01010 107296 106277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 107594 108304 gene locus_tag LOCUS_01020 107594 108304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 108307 108552 gene locus_tag LOCUS_01030 108307 108552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 108519 109553 gene locus_tag LOCUS_01040 108519 109553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 109550 110959 gene locus_tag LOCUS_01050 109550 110959 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142052.1 protein_id gnl|my_center|LOCUS_01050 110953 111732 gene locus_tag LOCUS_01060 110953 111732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 111723 112250 gene locus_tag LOCUS_01070 111723 112250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 112294 113709 gene locus_tag LOCUS_01080 gene glgA 112294 113709 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_01080 113797 114615 gene locus_tag LOCUS_01090 113797 114615 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 protein_id gnl|my_center|LOCUS_01090 114612 115982 gene locus_tag LOCUS_01100 114612 115982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 116735 115989 gene locus_tag LOCUS_01110 116735 115989 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546323.1 protein_id gnl|my_center|LOCUS_01110 >Feature sequence002 470 2443 gene locus_tag LOCUS_01120 470 2443 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927008.1 protein_id gnl|my_center|LOCUS_01120 2436 2924 gene locus_tag LOCUS_01130 2436 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 2917 3870 gene locus_tag LOCUS_01140 2917 3870 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_01140 3867 5324 gene locus_tag LOCUS_01150 3867 5324 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_01150 5293 5913 gene locus_tag LOCUS_01160 5293 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 5898 6299 gene locus_tag LOCUS_01170 5898 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 6296 7174 gene locus_tag LOCUS_01180 6296 7174 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939675.1 protein_id gnl|my_center|LOCUS_01180 7171 7854 gene locus_tag LOCUS_01190 7171 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 7864 9522 gene locus_tag LOCUS_01200 7864 9522 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061070.1 protein_id gnl|my_center|LOCUS_01200 9519 9815 gene locus_tag LOCUS_01210 9519 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 9805 10947 gene locus_tag LOCUS_01220 9805 10947 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191216118.1 protein_id gnl|my_center|LOCUS_01220 10947 11819 gene locus_tag LOCUS_01230 10947 11819 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870041.1 protein_id gnl|my_center|LOCUS_01230 11816 12676 gene locus_tag LOCUS_01240 11816 12676 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250915.1 protein_id gnl|my_center|LOCUS_01240 12729 13316 gene locus_tag LOCUS_01250 12729 13316 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240327.1 protein_id gnl|my_center|LOCUS_01250 13333 14691 gene locus_tag LOCUS_01260 13333 14691 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064444.1 protein_id gnl|my_center|LOCUS_01260 14959 14768 gene locus_tag LOCUS_01270 14959 14768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 15085 16329 gene locus_tag LOCUS_01280 15085 16329 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004137617.1 protein_id gnl|my_center|LOCUS_01280 16326 18422 gene locus_tag LOCUS_01290 16326 18422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 18419 19624 gene locus_tag LOCUS_01300 18419 19624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 19708 21837 gene locus_tag LOCUS_01310 19708 21837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 21930 24713 gene locus_tag LOCUS_01320 gene secA 21930 24713 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_01320 24790 25830 gene locus_tag LOCUS_01330 gene hrcA 24790 25830 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_01330 25827 26423 gene locus_tag LOCUS_01340 25827 26423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 26389 28239 gene locus_tag LOCUS_01350 gene dnaK 26389 28239 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869374.1 protein_id gnl|my_center|LOCUS_01350 28247 29356 gene locus_tag LOCUS_01360 gene dnaJ 28247 29356 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_01360 29976 29380 gene locus_tag LOCUS_01370 29976 29380 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_01370 31016 29973 gene locus_tag LOCUS_01380 31016 29973 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_01380 32007 31006 gene locus_tag LOCUS_01390 32007 31006 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584052.1 protein_id gnl|my_center|LOCUS_01390 32233 32018 gene locus_tag LOCUS_01400 32233 32018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 32324 33919 gene locus_tag LOCUS_01410 32324 33919 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_01410 33910 34521 gene locus_tag LOCUS_01420 33910 34521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 34496 35221 gene locus_tag LOCUS_01430 gene lptB 34496 35221 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546539.1 protein_id gnl|my_center|LOCUS_01430 36217 35408 gene locus_tag LOCUS_01440 gene lgt 36217 35408 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057991.1 protein_id gnl|my_center|LOCUS_01440 36270 37694 gene locus_tag LOCUS_01450 gene lnt 36270 37694 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391521.1 protein_id gnl|my_center|LOCUS_01450 38760 37804 gene locus_tag LOCUS_01460 38760 37804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 38935 39480 gene locus_tag LOCUS_01470 38935 39480 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_01470 39470 40006 gene locus_tag LOCUS_01480 39470 40006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 40003 40689 gene locus_tag LOCUS_01490 40003 40689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 40693 42762 gene locus_tag LOCUS_01500 40693 42762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 43303 42719 gene locus_tag LOCUS_01510 43303 42719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 43369 44697 gene locus_tag LOCUS_01520 43369 44697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 44679 45698 gene locus_tag LOCUS_01530 gene mraY 44679 45698 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052547.1 protein_id gnl|my_center|LOCUS_01530 47136 45736 gene locus_tag LOCUS_01540 gene gatA 47136 45736 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257583.1 protein_id gnl|my_center|LOCUS_01540 47226 47137 gene locus_tag LOCUS_t00070 47226 47137 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 47327 48001 gene locus_tag LOCUS_01550 47327 48001 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228770.1 protein_id gnl|my_center|LOCUS_01550 48099 49949 gene locus_tag LOCUS_01560 48099 49949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 49939 50391 gene locus_tag LOCUS_01570 49939 50391 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021290.1 protein_id gnl|my_center|LOCUS_01570 51429 50665 gene locus_tag LOCUS_01580 51429 50665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 51711 52220 gene locus_tag LOCUS_01590 51711 52220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 52225 53022 gene locus_tag LOCUS_01600 52225 53022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 53428 53183 gene locus_tag LOCUS_01610 53428 53183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 53714 53316 gene locus_tag LOCUS_01620 53714 53316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 53793 55436 gene locus_tag LOCUS_01630 53793 55436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 55466 56797 gene locus_tag LOCUS_01640 55466 56797 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_01640 57407 56820 gene locus_tag LOCUS_01650 gene clpP 57407 56820 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392065.1 protein_id gnl|my_center|LOCUS_01650 58585 57404 gene locus_tag LOCUS_01660 gene tig 58585 57404 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228070.1 protein_id gnl|my_center|LOCUS_01660 59284 58619 gene locus_tag LOCUS_01670 59284 58619 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930880.1 protein_id gnl|my_center|LOCUS_01670 60738 59284 gene locus_tag LOCUS_01680 60738 59284 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228066.1 protein_id gnl|my_center|LOCUS_01680 60872 60797 gene locus_tag LOCUS_t00080 60872 60797 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 60993 61868 gene locus_tag LOCUS_01690 gene pdxS 60993 61868 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119184.1 protein_id gnl|my_center|LOCUS_01690 61865 62431 gene locus_tag LOCUS_01700 gene pdxT 61865 62431 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081494.1 protein_id gnl|my_center|LOCUS_01700 62434 63456 gene locus_tag LOCUS_01710 gene gap 62434 63456 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_01710 63482 64162 gene locus_tag LOCUS_01720 63482 64162 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228420.1 protein_id gnl|my_center|LOCUS_01720 64152 64754 gene locus_tag LOCUS_01730 64152 64754 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211304.1 protein_id gnl|my_center|LOCUS_01730 64777 66465 gene locus_tag LOCUS_01740 gene dnaG 64777 66465 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392160.1 protein_id gnl|my_center|LOCUS_01740 66446 67537 gene locus_tag LOCUS_01750 66446 67537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 67534 68457 gene locus_tag LOCUS_01760 gene miaA 67534 68457 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_01760 68454 70016 gene locus_tag LOCUS_01770 68454 70016 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_01770 70013 70780 gene locus_tag LOCUS_01780 70013 70780 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081106.1 protein_id gnl|my_center|LOCUS_01780 71464 70844 gene locus_tag LOCUS_01790 71464 70844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 71703 72365 gene locus_tag LOCUS_01800 71703 72365 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902929.1 protein_id gnl|my_center|LOCUS_01800 72391 73845 gene locus_tag LOCUS_01810 72391 73845 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902931.1 protein_id gnl|my_center|LOCUS_01810 74134 73883 gene locus_tag LOCUS_01820 74134 73883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 74633 74136 gene locus_tag LOCUS_01830 74633 74136 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943161.1 protein_id gnl|my_center|LOCUS_01830 75652 74687 gene locus_tag LOCUS_01840 75652 74687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 76947 75658 gene locus_tag LOCUS_01850 76947 75658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 77900 77043 gene locus_tag LOCUS_01860 77900 77043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 78289 77954 gene locus_tag LOCUS_01870 gene rplS 78289 77954 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813207.1 protein_id gnl|my_center|LOCUS_01870 78830 78273 gene locus_tag LOCUS_01880 78830 78273 CDS product SPOUT family RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081987.1 protein_id gnl|my_center|LOCUS_01880 79528 78830 gene locus_tag LOCUS_01890 gene trmD 79528 78830 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545349.1 protein_id gnl|my_center|LOCUS_01890 79773 79525 gene locus_tag LOCUS_01900 79773 79525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 80023 79730 gene locus_tag LOCUS_01910 gene rpsP 80023 79730 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290274.1 protein_id gnl|my_center|LOCUS_01910 81328 80027 gene locus_tag LOCUS_01920 gene ffh 81328 80027 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081977.1 protein_id gnl|my_center|LOCUS_01920 82675 81347 gene locus_tag LOCUS_01930 gene accC 82675 81347 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546633.1 protein_id gnl|my_center|LOCUS_01930 83073 82678 gene locus_tag LOCUS_01940 gene accB 83073 82678 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930864.1 protein_id gnl|my_center|LOCUS_01940 83232 84509 gene locus_tag LOCUS_01950 83232 84509 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017189.1 protein_id gnl|my_center|LOCUS_01950 84536 87193 gene locus_tag LOCUS_01960 84536 87193 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583913.1 protein_id gnl|my_center|LOCUS_01960 87224 89560 gene locus_tag LOCUS_01970 gene pheT 87224 89560 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_01970 89561 89995 gene locus_tag LOCUS_01980 89561 89995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 91043 90102 gene locus_tag LOCUS_01990 91043 90102 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_01990 91678 91040 gene locus_tag LOCUS_02000 gene fsa 91678 91040 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_02000 91979 92572 gene locus_tag LOCUS_02010 91979 92572 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_02010 92632 93630 gene locus_tag LOCUS_02020 gene amrS 92632 93630 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_02020 >Feature sequence003 1264 719 gene locus_tag LOCUS_02030 1264 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 1776 1261 gene locus_tag LOCUS_02040 1776 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 2038 1787 gene locus_tag LOCUS_02050 2038 1787 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082074.1 protein_id gnl|my_center|LOCUS_02050 2769 2050 gene locus_tag LOCUS_02060 2769 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 3107 2772 gene locus_tag LOCUS_02070 3107 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 3679 3122 gene locus_tag LOCUS_02080 gene frr 3679 3122 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081622.1 protein_id gnl|my_center|LOCUS_02080 3780 5207 gene locus_tag LOCUS_02090 3780 5207 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 protein_id gnl|my_center|LOCUS_02090 5291 6697 gene locus_tag LOCUS_02100 5291 6697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 6930 7448 gene locus_tag LOCUS_02110 gene raiA 6930 7448 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583763.1 protein_id gnl|my_center|LOCUS_02110 7474 8529 gene locus_tag LOCUS_02120 7474 8529 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_02120 8585 8821 gene locus_tag LOCUS_02130 8585 8821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 8883 13853 gene locus_tag LOCUS_02140 8883 13853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 13899 14276 gene locus_tag LOCUS_02150 gene rpsL 13899 14276 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880443.1 protein_id gnl|my_center|LOCUS_02150 14278 14751 gene locus_tag LOCUS_02160 gene rpsG 14278 14751 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137495.1 protein_id gnl|my_center|LOCUS_02160 14776 16860 gene locus_tag LOCUS_02170 gene fusA 14776 16860 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925413.1 protein_id gnl|my_center|LOCUS_02170 16862 17170 gene locus_tag LOCUS_02180 gene rpsJ 16862 17170 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081837.1 protein_id gnl|my_center|LOCUS_02180 17180 17803 gene locus_tag LOCUS_02190 gene rplC 17180 17803 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393937.1 protein_id gnl|my_center|LOCUS_02190 17796 18440 gene locus_tag LOCUS_02200 gene rplD 17796 18440 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546805.1 protein_id gnl|my_center|LOCUS_02200 18430 18732 gene locus_tag LOCUS_02210 18430 18732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 18737 19564 gene locus_tag LOCUS_02220 gene rplB 18737 19564 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081830.1 protein_id gnl|my_center|LOCUS_02220 19567 19851 gene locus_tag LOCUS_02230 gene rpsS 19567 19851 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583349.1 protein_id gnl|my_center|LOCUS_02230 19866 20207 gene locus_tag LOCUS_02240 19866 20207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 20207 20866 gene locus_tag LOCUS_02250 gene rpsC 20207 20866 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583351.1 protein_id gnl|my_center|LOCUS_02250 20869 21297 gene locus_tag LOCUS_02260 gene rplP 20869 21297 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081822.1 protein_id gnl|my_center|LOCUS_02260 21294 21518 gene locus_tag LOCUS_02270 gene rpmC 21294 21518 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421158.1 protein_id gnl|my_center|LOCUS_02270 21511 21756 gene locus_tag LOCUS_02280 21511 21756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 21759 22121 gene locus_tag LOCUS_02290 gene rplN 21759 22121 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583355.1 protein_id gnl|my_center|LOCUS_02290 22130 22441 gene locus_tag LOCUS_02300 gene rplX 22130 22441 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_02300 22450 22983 gene locus_tag LOCUS_02310 gene rplE 22450 22983 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166900.1 protein_id gnl|my_center|LOCUS_02310 22994 23179 gene locus_tag LOCUS_02320 22994 23179 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_02320 23187 23600 gene locus_tag LOCUS_02330 gene rpsH 23187 23600 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925182.1 protein_id gnl|my_center|LOCUS_02330 23612 24154 gene locus_tag LOCUS_02340 gene rplF 23612 24154 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_02340 24154 24525 gene locus_tag LOCUS_02350 gene rplR 24154 24525 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583361.1 protein_id gnl|my_center|LOCUS_02350 24522 25043 gene locus_tag LOCUS_02360 gene rpsE 24522 25043 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288681.1 protein_id gnl|my_center|LOCUS_02360 25027 25476 gene locus_tag LOCUS_02370 gene rplO 25027 25476 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081797.1 protein_id gnl|my_center|LOCUS_02370 25478 26779 gene locus_tag LOCUS_02380 gene secY 25478 26779 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_02380 26776 27402 gene locus_tag LOCUS_02390 26776 27402 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_02390 27395 28174 gene locus_tag LOCUS_02400 gene map 27395 28174 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173700.1 protein_id gnl|my_center|LOCUS_02400 28171 28374 gene locus_tag LOCUS_02410 gene infA 28171 28374 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081789.1 protein_id gnl|my_center|LOCUS_02410 28508 28882 gene locus_tag LOCUS_02420 gene rpsM 28508 28882 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888756.1 protein_id gnl|my_center|LOCUS_02420 28886 29254 gene locus_tag LOCUS_02430 gene rpsK 28886 29254 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545788.1 protein_id gnl|my_center|LOCUS_02430 29268 29891 gene locus_tag LOCUS_02440 gene rpsD 29268 29891 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173699.1 protein_id gnl|my_center|LOCUS_02440 29896 30822 gene locus_tag LOCUS_02450 29896 30822 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_02450 30824 31174 gene locus_tag LOCUS_02460 gene rplQ 30824 31174 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851332.1 protein_id gnl|my_center|LOCUS_02460 31215 31559 gene locus_tag LOCUS_02470 31215 31559 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_02470 32572 31592 gene locus_tag LOCUS_02480 gene tdh 32572 31592 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244880.1 protein_id gnl|my_center|LOCUS_02480 32765 33940 gene locus_tag LOCUS_02490 32765 33940 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147155.1 protein_id gnl|my_center|LOCUS_02490 34508 33963 gene locus_tag LOCUS_02500 34508 33963 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583840.1 protein_id gnl|my_center|LOCUS_02500 35329 34505 gene locus_tag LOCUS_02510 35329 34505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 35358 36665 gene locus_tag LOCUS_02520 35358 36665 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256515.1 protein_id gnl|my_center|LOCUS_02520 36662 37075 gene locus_tag LOCUS_02530 36662 37075 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249520.1 protein_id gnl|my_center|LOCUS_02530 37495 37145 gene locus_tag LOCUS_02540 37495 37145 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393515.1 protein_id gnl|my_center|LOCUS_02540 38383 37595 gene locus_tag LOCUS_02550 38383 37595 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250866.1 protein_id gnl|my_center|LOCUS_02550 38510 38845 gene locus_tag LOCUS_02560 38510 38845 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705627.1 protein_id gnl|my_center|LOCUS_02560 38888 39478 gene locus_tag LOCUS_02570 38888 39478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 39468 40022 gene locus_tag LOCUS_02580 39468 40022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 40184 40738 gene locus_tag LOCUS_02590 40184 40738 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391683.1 protein_id gnl|my_center|LOCUS_02590 40745 42469 gene locus_tag LOCUS_02600 40745 42469 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791317.1 protein_id gnl|my_center|LOCUS_02600 42466 42972 gene locus_tag LOCUS_02610 42466 42972 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397668.1 protein_id gnl|my_center|LOCUS_02610 43815 43072 gene locus_tag LOCUS_02620 43815 43072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 43918 45243 gene locus_tag LOCUS_02630 gene hydA 43918 45243 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393493.1 protein_id gnl|my_center|LOCUS_02630 45251 46276 gene locus_tag LOCUS_02640 gene rlmN 45251 46276 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_02640 47097 46270 gene locus_tag LOCUS_02650 47097 46270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 49295 47094 gene locus_tag LOCUS_02660 49295 47094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 49376 51217 gene locus_tag LOCUS_02670 gene ftsH 49376 51217 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869596.1 protein_id gnl|my_center|LOCUS_02670 51214 52377 gene locus_tag LOCUS_02680 51214 52377 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188776689.1 protein_id gnl|my_center|LOCUS_02680 52388 52828 gene locus_tag LOCUS_02690 52388 52828 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172543.1 protein_id gnl|my_center|LOCUS_02690 52815 53120 gene locus_tag LOCUS_02700 52815 53120 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196984.1 protein_id gnl|my_center|LOCUS_02700 53228 53716 gene locus_tag LOCUS_02710 53228 53716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 55190 53700 gene locus_tag LOCUS_02720 gene murJ 55190 53700 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957545.1 protein_id gnl|my_center|LOCUS_02720 55647 55198 gene locus_tag LOCUS_02730 gene rplI 55647 55198 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048442.1 protein_id gnl|my_center|LOCUS_02730 55750 56589 gene locus_tag LOCUS_02740 gene folP 55750 56589 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120943.1 protein_id gnl|my_center|LOCUS_02740 56586 57062 gene locus_tag LOCUS_02750 56586 57062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 57059 57532 gene locus_tag LOCUS_02760 gene ruvC 57059 57532 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974712.1 protein_id gnl|my_center|LOCUS_02760 57505 60225 gene locus_tag LOCUS_02770 gene polA 57505 60225 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082086.1 protein_id gnl|my_center|LOCUS_02770 60332 61948 gene locus_tag LOCUS_02780 60332 61948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 62077 62802 gene locus_tag LOCUS_02790 62077 62802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 64423 62969 gene locus_tag LOCUS_02800 gene gcvPB 64423 62969 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861288.1 protein_id gnl|my_center|LOCUS_02800 65748 64426 gene locus_tag LOCUS_02810 gene gcvPA 65748 64426 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_02810 66128 65748 gene locus_tag LOCUS_02820 gene gcvH 66128 65748 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228002.1 protein_id gnl|my_center|LOCUS_02820 67304 66189 gene locus_tag LOCUS_02830 gene dnaB 67304 66189 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02830 67496 67323 gene locus_tag LOCUS_02840 67496 67323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 67687 68652 gene locus_tag LOCUS_02850 67687 68652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 68652 69245 gene locus_tag LOCUS_02860 gene tsf 68652 69245 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_02860 69242 69952 gene locus_tag LOCUS_02870 gene pyrH 69242 69952 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261659.1 protein_id gnl|my_center|LOCUS_02870 70750 69959 gene locus_tag LOCUS_02880 70750 69959 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877881.1 protein_id gnl|my_center|LOCUS_02880 70828 70919 gene locus_tag LOCUS_t00090 70828 70919 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 70920 70992 gene locus_tag LOCUS_t00100 70920 70992 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 71011 71235 gene locus_tag LOCUS_02890 71011 71235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 71266 71529 gene locus_tag LOCUS_02900 71266 71529 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249839.1 protein_id gnl|my_center|LOCUS_02900 >Feature sequence004 482 1147 gene locus_tag LOCUS_02910 482 1147 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_02910 1193 2200 gene locus_tag LOCUS_02920 1193 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 4890 2197 gene locus_tag LOCUS_02930 gene fdhF 4890 2197 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_02930 6764 4887 gene locus_tag LOCUS_02940 gene nuoF 6764 4887 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393387.1 protein_id gnl|my_center|LOCUS_02940 7221 6739 gene locus_tag LOCUS_02950 gene nuoE 7221 6739 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_02950 7443 8282 gene locus_tag LOCUS_02960 7443 8282 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339275.1 protein_id gnl|my_center|LOCUS_02960 8364 9530 gene locus_tag LOCUS_02970 gene nifS 8364 9530 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868962.1 protein_id gnl|my_center|LOCUS_02970 9520 10032 gene locus_tag LOCUS_02980 gene nifU 9520 10032 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877697.1 protein_id gnl|my_center|LOCUS_02980 10938 10093 gene locus_tag LOCUS_02990 10938 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 11089 11322 gene locus_tag LOCUS_03000 11089 11322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 11547 11471 gene locus_tag LOCUS_t00110 11547 11471 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11760 12272 gene locus_tag LOCUS_03010 11760 12272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 12755 12291 gene locus_tag LOCUS_03020 12755 12291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 12887 14098 gene locus_tag LOCUS_03030 12887 14098 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143789.1 protein_id gnl|my_center|LOCUS_03030 15054 14110 gene locus_tag LOCUS_03040 gene fmt 15054 14110 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460526.1 protein_id gnl|my_center|LOCUS_03040 15545 15051 gene locus_tag LOCUS_03050 gene def 15545 15051 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880345.1 protein_id gnl|my_center|LOCUS_03050 15601 17889 gene locus_tag LOCUS_03060 gene recG 15601 17889 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583501.1 protein_id gnl|my_center|LOCUS_03060 17893 18198 gene locus_tag LOCUS_03070 17893 18198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 18314 19582 gene locus_tag LOCUS_03080 18314 19582 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289493.1 protein_id gnl|my_center|LOCUS_03080 19587 20768 gene locus_tag LOCUS_03090 19587 20768 CDS product DUF401 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320021.1 protein_id gnl|my_center|LOCUS_03090 21826 20789 gene locus_tag LOCUS_03100 gene ychF 21826 20789 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_03100 22765 21896 gene locus_tag LOCUS_03110 gene sucD 22765 21896 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765646.1 protein_id gnl|my_center|LOCUS_03110 22863 23621 gene locus_tag LOCUS_03120 22863 23621 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971078.1 protein_id gnl|my_center|LOCUS_03120 23690 24601 gene locus_tag LOCUS_03130 gene csaB 23690 24601 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228036.1 protein_id gnl|my_center|LOCUS_03130 24570 25475 gene locus_tag LOCUS_03140 gene rsmH 24570 25475 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_03140 25524 25880 gene locus_tag LOCUS_03150 25524 25880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 25858 27567 gene locus_tag LOCUS_03160 25858 27567 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_03160 28268 27531 gene locus_tag LOCUS_03170 28268 27531 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_03170 29014 28265 gene locus_tag LOCUS_03180 29014 28265 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878917.1 protein_id gnl|my_center|LOCUS_03180 29094 29861 gene locus_tag LOCUS_03190 29094 29861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 29858 30433 gene locus_tag LOCUS_03200 gene pgsA 29858 30433 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392589.1 protein_id gnl|my_center|LOCUS_03200 33304 30449 gene locus_tag LOCUS_03210 33304 30449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 34401 33373 gene locus_tag LOCUS_03220 34401 33373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 34934 34476 gene locus_tag LOCUS_03230 34934 34476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 34852 35112 gene locus_tag LOCUS_03240 34852 35112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 35826 35167 gene locus_tag LOCUS_03250 35826 35167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 36747 35830 gene locus_tag LOCUS_03260 36747 35830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 38138 36852 gene locus_tag LOCUS_03270 38138 36852 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147002.1 protein_id gnl|my_center|LOCUS_03270 38266 38814 gene locus_tag LOCUS_03280 gene pgsA 38266 38814 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869392.1 protein_id gnl|my_center|LOCUS_03280 39484 38714 gene locus_tag LOCUS_03290 39484 38714 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101547.1 protein_id gnl|my_center|LOCUS_03290 39650 40120 gene locus_tag LOCUS_03300 gene rimP 39650 40120 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958225.1 protein_id gnl|my_center|LOCUS_03300 40117 41058 gene locus_tag LOCUS_03310 gene nusA 40117 41058 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583567.1 protein_id gnl|my_center|LOCUS_03310 41039 43831 gene locus_tag LOCUS_03320 41039 43831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 43875 45401 gene locus_tag LOCUS_03330 gene rny 43875 45401 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870004.1 protein_id gnl|my_center|LOCUS_03330 45418 45744 gene locus_tag LOCUS_03340 45418 45744 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080441.1 protein_id gnl|my_center|LOCUS_03340 45970 48519 gene locus_tag LOCUS_03350 45970 48519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 48524 49138 gene locus_tag LOCUS_03360 48524 49138 CDS product MazG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229037.1 protein_id gnl|my_center|LOCUS_03360 49135 49404 gene locus_tag LOCUS_03370 49135 49404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 49401 49889 gene locus_tag LOCUS_03380 49401 49889 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132009.1 protein_id gnl|my_center|LOCUS_03380 49946 50018 gene locus_tag LOCUS_t00120 49946 50018 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 50031 50555 gene locus_tag LOCUS_03390 50031 50555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 50555 51004 gene locus_tag LOCUS_03400 gene dtd 50555 51004 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071581519.1 protein_id gnl|my_center|LOCUS_03400 52504 51224 gene locus_tag LOCUS_03410 52504 51224 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249958.1 protein_id gnl|my_center|LOCUS_03410 53313 52501 gene locus_tag LOCUS_03420 53313 52501 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392911.1 protein_id gnl|my_center|LOCUS_03420 54052 53315 gene locus_tag LOCUS_03430 gene fabG 54052 53315 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_03430 54729 54067 gene locus_tag LOCUS_03440 gene upp 54729 54067 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583176.1 protein_id gnl|my_center|LOCUS_03440 55659 54733 gene locus_tag LOCUS_03450 55659 54733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 56944 55652 gene locus_tag LOCUS_03460 56944 55652 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140609.1 protein_id gnl|my_center|LOCUS_03460 <58291 56941 gene locus_tag LOCUS_03470 <58291 56941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582927.1:TldD/PmbA family protein >Feature sequence005 255 1286 gene locus_tag LOCUS_03480 255 1286 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869178.1 protein_id gnl|my_center|LOCUS_03480 1297 2319 gene locus_tag LOCUS_03490 gene argF 1297 2319 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393492.1 protein_id gnl|my_center|LOCUS_03490 2335 4647 gene locus_tag LOCUS_03500 2335 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 4761 5927 gene locus_tag LOCUS_03510 4761 5927 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166479973.1 protein_id gnl|my_center|LOCUS_03510 7087 5960 gene locus_tag LOCUS_03520 7087 5960 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_03520 7887 7147 gene locus_tag LOCUS_03530 7887 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 8622 7912 gene locus_tag LOCUS_03540 gene rnc 8622 7912 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460498.1 protein_id gnl|my_center|LOCUS_03540 8753 10009 gene locus_tag LOCUS_03550 8753 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 11136 10006 gene locus_tag LOCUS_03560 gene nagA 11136 10006 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292242.1 protein_id gnl|my_center|LOCUS_03560 11413 12723 gene locus_tag LOCUS_03570 11413 12723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 12726 13373 gene locus_tag LOCUS_03580 12726 13373 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889321.1 protein_id gnl|my_center|LOCUS_03580 13441 13893 gene locus_tag LOCUS_03590 13441 13893 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336791.1 protein_id gnl|my_center|LOCUS_03590 14557 13844 gene locus_tag LOCUS_03600 14557 13844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 15264 14569 gene locus_tag LOCUS_03610 15264 14569 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_03610 16432 15254 gene locus_tag LOCUS_03620 16432 15254 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021679.1 protein_id gnl|my_center|LOCUS_03620 17232 16486 gene locus_tag LOCUS_03630 17232 16486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 18433 17222 gene locus_tag LOCUS_03640 18433 17222 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_03640 19062 18433 gene locus_tag LOCUS_03650 19062 18433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 19250 20107 gene locus_tag LOCUS_03660 19250 20107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 20314 20123 gene locus_tag LOCUS_03670 20314 20123 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023998.1 protein_id gnl|my_center|LOCUS_03670 20378 21349 gene locus_tag LOCUS_03680 gene pfkA 20378 21349 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173968.1 protein_id gnl|my_center|LOCUS_03680 22240 21500 gene locus_tag LOCUS_03690 22240 21500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 24202 22469 gene locus_tag LOCUS_03700 gene dsbD 24202 22469 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197919.1 protein_id gnl|my_center|LOCUS_03700 24972 24328 gene locus_tag LOCUS_03710 24972 24328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 25183 27843 gene locus_tag LOCUS_03720 25183 27843 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460426.1 protein_id gnl|my_center|LOCUS_03720 27997 28170 gene locus_tag LOCUS_03730 27997 28170 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583928.1 protein_id gnl|my_center|LOCUS_03730 28328 28768 gene locus_tag LOCUS_03740 28328 28768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 28765 29973 gene locus_tag LOCUS_03750 28765 29973 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583929.1 protein_id gnl|my_center|LOCUS_03750 29974 30327 gene locus_tag LOCUS_03760 29974 30327 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036180.1 protein_id gnl|my_center|LOCUS_03760 30308 31468 gene locus_tag LOCUS_03770 30308 31468 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065687.1 protein_id gnl|my_center|LOCUS_03770 31468 32490 gene locus_tag LOCUS_03780 31468 32490 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_03780 32487 33032 gene locus_tag LOCUS_03790 32487 33032 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023689.1 protein_id gnl|my_center|LOCUS_03790 33668 33054 gene locus_tag LOCUS_03800 33668 33054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 33957 34424 gene locus_tag LOCUS_03810 33957 34424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 34531 35508 gene locus_tag LOCUS_03820 34531 35508 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082036.1 protein_id gnl|my_center|LOCUS_03820 36221 35505 gene locus_tag LOCUS_03830 36221 35505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 39000 36286 gene locus_tag LOCUS_03840 39000 36286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 39345 39166 gene locus_tag LOCUS_03850 39345 39166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 41169 39508 gene locus_tag LOCUS_03860 41169 39508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 41490 42464 gene locus_tag LOCUS_03870 41490 42464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 42765 44063 gene locus_tag LOCUS_03880 gene glmM 42765 44063 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521474.1 protein_id gnl|my_center|LOCUS_03880 44342 44103 gene locus_tag LOCUS_03890 44342 44103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03890 46297 44486 gene locus_tag LOCUS_03900 gene glmS 46297 44486 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393728.1 protein_id gnl|my_center|LOCUS_03900 47826 46516 gene locus_tag LOCUS_03910 gene glnA 47826 46516 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545065.1 protein_id gnl|my_center|LOCUS_03910 48209 50002 gene locus_tag LOCUS_03920 48209 50002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838546.1 protein_id gnl|my_center|LOCUS_03920 50587 51960 gene locus_tag LOCUS_03930 50587 51960 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 protein_id gnl|my_center|LOCUS_03930 52004 52207 gene locus_tag LOCUS_03940 52004 52207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 52333 52536 gene locus_tag LOCUS_03950 52333 52536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 52701 53066 gene locus_tag LOCUS_03960 52701 53066 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_03960 53168 54124 gene locus_tag LOCUS_03970 53168 54124 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403405.1 protein_id gnl|my_center|LOCUS_03970 54311 54607 gene locus_tag LOCUS_03980 54311 54607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 55223 55489 gene locus_tag LOCUS_03990 55223 55489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 >Feature sequence006 34 279 gene locus_tag LOCUS_04000 34 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 276 2750 gene locus_tag LOCUS_04010 276 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 2743 3468 gene locus_tag LOCUS_04020 2743 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 3449 3973 gene locus_tag LOCUS_04030 gene scpB 3449 3973 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879077.1 protein_id gnl|my_center|LOCUS_04030 4966 3926 gene locus_tag LOCUS_04040 4966 3926 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868718.1 protein_id gnl|my_center|LOCUS_04040 4993 5574 gene locus_tag LOCUS_04050 4993 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 7052 5571 gene locus_tag LOCUS_04060 7052 5571 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_04060 7231 9039 gene locus_tag LOCUS_04070 7231 9039 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107313.1 protein_id gnl|my_center|LOCUS_04070 9124 9891 gene locus_tag LOCUS_04080 9124 9891 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052227.1 protein_id gnl|my_center|LOCUS_04080 9885 10820 gene locus_tag LOCUS_04090 9885 10820 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460655.1 protein_id gnl|my_center|LOCUS_04090 10801 11583 gene locus_tag LOCUS_04100 gene pyrF 10801 11583 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839147.1 protein_id gnl|my_center|LOCUS_04100 11580 12170 gene locus_tag LOCUS_04110 gene pyrE 11580 12170 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583288.1 protein_id gnl|my_center|LOCUS_04110 12235 14262 gene locus_tag LOCUS_04120 12235 14262 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532458.1 protein_id gnl|my_center|LOCUS_04120 14306 16006 gene locus_tag LOCUS_04130 14306 16006 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804193.1 protein_id gnl|my_center|LOCUS_04130 16088 16249 gene locus_tag LOCUS_04140 16088 16249 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249479.1 protein_id gnl|my_center|LOCUS_04140 16253 17455 gene locus_tag LOCUS_04150 16253 17455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 17502 17906 gene locus_tag LOCUS_04160 gene perR 17502 17906 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002002038.1 protein_id gnl|my_center|LOCUS_04160 17906 18418 gene locus_tag LOCUS_04170 17906 18418 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249478.1 protein_id gnl|my_center|LOCUS_04170 18430 18903 gene locus_tag LOCUS_04180 18430 18903 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932996.1 protein_id gnl|my_center|LOCUS_04180 18926 19318 gene locus_tag LOCUS_04190 18926 19318 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081116.1 protein_id gnl|my_center|LOCUS_04190 19389 19826 gene locus_tag LOCUS_04200 19389 19826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 19844 21082 gene locus_tag LOCUS_04210 19844 21082 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871137.1 protein_id gnl|my_center|LOCUS_04210 21079 21477 gene locus_tag LOCUS_04220 21079 21477 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081551.1 protein_id gnl|my_center|LOCUS_04220 21467 21910 gene locus_tag LOCUS_04230 21467 21910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 21907 22239 gene locus_tag LOCUS_04240 21907 22239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 22236 22994 gene locus_tag LOCUS_04250 22236 22994 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_04250 22991 23458 gene locus_tag LOCUS_04260 gene nuoE 22991 23458 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583281.1 protein_id gnl|my_center|LOCUS_04260 23473 24006 gene locus_tag LOCUS_04270 23473 24006 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583282.1 protein_id gnl|my_center|LOCUS_04270 24003 24371 gene locus_tag LOCUS_04280 24003 24371 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_04280 24368 25069 gene locus_tag LOCUS_04290 gene hoxU 24368 25069 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_04290 25062 25595 gene locus_tag LOCUS_04300 25062 25595 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943354.1 protein_id gnl|my_center|LOCUS_04300 25609 27030 gene locus_tag LOCUS_04310 25609 27030 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_04310 27027 27458 gene locus_tag LOCUS_04320 27027 27458 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943352.1 protein_id gnl|my_center|LOCUS_04320 27455 29245 gene locus_tag LOCUS_04330 gene nuoF 27455 29245 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_04330 29299 29709 gene locus_tag LOCUS_04340 gene nuoE 29299 29709 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584034.1 protein_id gnl|my_center|LOCUS_04340 29706 31322 gene locus_tag LOCUS_04350 gene nuoF 29706 31322 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584033.1 protein_id gnl|my_center|LOCUS_04350 31319 32650 gene locus_tag LOCUS_04360 31319 32650 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_04360 33608 32706 gene locus_tag LOCUS_04370 33608 32706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 33730 33909 gene locus_tag LOCUS_04380 33730 33909 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080635.1 protein_id gnl|my_center|LOCUS_04380 33965 34753 gene locus_tag LOCUS_04390 33965 34753 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314342.1 protein_id gnl|my_center|LOCUS_04390 34750 35619 gene locus_tag LOCUS_04400 34750 35619 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404420.1 protein_id gnl|my_center|LOCUS_04400 35619 36848 gene locus_tag LOCUS_04410 35619 36848 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082805.1 protein_id gnl|my_center|LOCUS_04410 39270 36805 gene locus_tag LOCUS_04420 39270 36805 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922073.1 protein_id gnl|my_center|LOCUS_04420 40928 39267 gene locus_tag LOCUS_04430 40928 39267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 41797 40925 gene locus_tag LOCUS_04440 41797 40925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 42768 41794 gene locus_tag LOCUS_04450 42768 41794 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326093.1 protein_id gnl|my_center|LOCUS_04450 44198 42765 gene locus_tag LOCUS_04460 44198 42765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 44830 44156 gene locus_tag LOCUS_04470 44830 44156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 46007 44802 gene locus_tag LOCUS_04480 46007 44802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 46621 46004 gene locus_tag LOCUS_04490 46621 46004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 47512 46763 gene locus_tag LOCUS_04500 47512 46763 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496701.1 protein_id gnl|my_center|LOCUS_04500 47969 47526 gene locus_tag LOCUS_04510 47969 47526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 48067 49740 gene locus_tag LOCUS_04520 gene mutL 48067 49740 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139982.1 protein_id gnl|my_center|LOCUS_04520 50627 49752 gene locus_tag LOCUS_04530 50627 49752 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_04530 50724 51611 gene locus_tag LOCUS_04540 50724 51611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 >Feature sequence007 430 933 gene locus_tag LOCUS_04550 430 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 943 1182 gene locus_tag LOCUS_04560 943 1182 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869340.1 protein_id gnl|my_center|LOCUS_04560 1179 2234 gene locus_tag LOCUS_04570 1179 2234 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082297.1 protein_id gnl|my_center|LOCUS_04570 2221 2991 gene locus_tag LOCUS_04580 2221 2991 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_04580 2995 3552 gene locus_tag LOCUS_04590 2995 3552 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869337.1 protein_id gnl|my_center|LOCUS_04590 4586 3918 gene locus_tag LOCUS_04600 gene tsaB 4586 3918 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917948.1 protein_id gnl|my_center|LOCUS_04600 5671 4658 gene locus_tag LOCUS_04610 gene ruvB 5671 4658 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_04610 5702 6556 gene locus_tag LOCUS_04620 5702 6556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 6558 7481 gene locus_tag LOCUS_04630 6558 7481 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404517.1 protein_id gnl|my_center|LOCUS_04630 7968 7426 gene locus_tag LOCUS_04640 7968 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 10954 7994 gene locus_tag LOCUS_04650 10954 7994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 11103 12347 gene locus_tag LOCUS_04660 gene miaB 11103 12347 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942838.1 protein_id gnl|my_center|LOCUS_04660 12344 13312 gene locus_tag LOCUS_04670 12344 13312 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869572.1 protein_id gnl|my_center|LOCUS_04670 13309 13770 gene locus_tag LOCUS_04680 13309 13770 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080815.1 protein_id gnl|my_center|LOCUS_04680 13742 16321 gene locus_tag LOCUS_04690 13742 16321 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392668.1 protein_id gnl|my_center|LOCUS_04690 16407 17042 gene locus_tag LOCUS_04700 16407 17042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 17067 17501 gene locus_tag LOCUS_04710 gene rpiB 17067 17501 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_04710 17504 18478 gene locus_tag LOCUS_04720 17504 18478 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_04720 18489 19736 gene locus_tag LOCUS_04730 gene rho 18489 19736 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256183.1 protein_id gnl|my_center|LOCUS_04730 19729 20574 gene locus_tag LOCUS_04740 19729 20574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 20571 21827 gene locus_tag LOCUS_04750 gene murA 20571 21827 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143118.1 protein_id gnl|my_center|LOCUS_04750 21797 23149 gene locus_tag LOCUS_04760 gene hflX 21797 23149 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224262.1 protein_id gnl|my_center|LOCUS_04760 24029 23223 gene locus_tag LOCUS_04770 24029 23223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 24790 24011 gene locus_tag LOCUS_04780 24790 24011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 25015 25206 gene locus_tag LOCUS_04790 25015 25206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 25259 26230 gene locus_tag LOCUS_04800 25259 26230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 26313 26522 gene locus_tag LOCUS_04810 26313 26522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 26519 27733 gene locus_tag LOCUS_04820 26519 27733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 27730 28281 gene locus_tag LOCUS_04830 27730 28281 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_04830 28345 28959 gene locus_tag LOCUS_04840 28345 28959 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030451.1 protein_id gnl|my_center|LOCUS_04840 28952 29929 gene locus_tag LOCUS_04850 28952 29929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 29931 30932 gene locus_tag LOCUS_04860 gene hpnH 29931 30932 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941345.1 protein_id gnl|my_center|LOCUS_04860 30929 31486 gene locus_tag LOCUS_04870 30929 31486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 31483 32610 gene locus_tag LOCUS_04880 gene ispG 31483 32610 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 protein_id gnl|my_center|LOCUS_04880 32603 34582 gene locus_tag LOCUS_04890 gene shc 32603 34582 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_04890 34579 35430 gene locus_tag LOCUS_04900 gene ispH 34579 35430 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_04900 35432 35905 gene locus_tag LOCUS_04910 35432 35905 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868534.1 protein_id gnl|my_center|LOCUS_04910 35905 36327 gene locus_tag LOCUS_04920 35905 36327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 36459 37256 gene locus_tag LOCUS_04930 36459 37256 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_04930 37460 38740 gene locus_tag LOCUS_04940 37460 38740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 38801 40522 gene locus_tag LOCUS_04950 38801 40522 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769364.1 protein_id gnl|my_center|LOCUS_04950 40524 41618 gene locus_tag LOCUS_04960 40524 41618 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_04960 41625 41954 gene locus_tag LOCUS_04970 41625 41954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 41968 42900 gene locus_tag LOCUS_04980 41968 42900 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087084.1 protein_id gnl|my_center|LOCUS_04980 >Feature sequence008 2294 1377 gene locus_tag LOCUS_04990 gene rsmA 2294 1377 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_04990 3096 2230 gene locus_tag LOCUS_05000 3096 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 3216 3401 gene locus_tag LOCUS_05010 3216 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 3999 3421 gene locus_tag LOCUS_05020 3999 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 4089 4448 gene locus_tag LOCUS_05030 4089 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 4445 5152 gene locus_tag LOCUS_05040 4445 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 5110 5802 gene locus_tag LOCUS_05050 5110 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 5721 5960 gene locus_tag LOCUS_05060 5721 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 6180 6863 gene locus_tag LOCUS_05070 6180 6863 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583790.1 protein_id gnl|my_center|LOCUS_05070 6860 7501 gene locus_tag LOCUS_05080 gene rpe 6860 7501 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651337.1 protein_id gnl|my_center|LOCUS_05080 7513 8592 gene locus_tag LOCUS_05090 gene ribD 7513 8592 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_05090 8585 9586 gene locus_tag LOCUS_05100 8585 9586 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840950.1 protein_id gnl|my_center|LOCUS_05100 10106 9579 gene locus_tag LOCUS_05110 10106 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 10648 10040 gene locus_tag LOCUS_05120 10648 10040 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925379.1 protein_id gnl|my_center|LOCUS_05120 11705 10710 gene locus_tag LOCUS_05130 11705 10710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 11927 11852 gene locus_tag LOCUS_t00130 11927 11852 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13186 12005 gene locus_tag LOCUS_05140 13186 12005 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_05140 13282 13971 gene locus_tag LOCUS_05150 13282 13971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 14454 13975 gene locus_tag LOCUS_05160 14454 13975 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_05160 15944 14739 gene locus_tag LOCUS_05170 15944 14739 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978370.1 protein_id gnl|my_center|LOCUS_05170 17116 16031 gene locus_tag LOCUS_05180 17116 16031 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258014.1 protein_id gnl|my_center|LOCUS_05180 18093 17113 gene locus_tag LOCUS_05190 18093 17113 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258012.1 protein_id gnl|my_center|LOCUS_05190 18241 20028 gene locus_tag LOCUS_05200 18241 20028 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903944.1 protein_id gnl|my_center|LOCUS_05200 21491 20031 gene locus_tag LOCUS_05210 gene asnB 21491 20031 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_05210 22503 21802 gene locus_tag LOCUS_05220 22503 21802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 23893 22646 gene locus_tag LOCUS_05230 23893 22646 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902995.1 protein_id gnl|my_center|LOCUS_05230 24876 23890 gene locus_tag LOCUS_05240 24876 23890 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883993.1 protein_id gnl|my_center|LOCUS_05240 25805 24885 gene locus_tag LOCUS_05250 25805 24885 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249816.1 protein_id gnl|my_center|LOCUS_05250 26622 25981 gene locus_tag LOCUS_05260 26622 25981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 27503 26619 gene locus_tag LOCUS_05270 27503 26619 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808414.1 protein_id gnl|my_center|LOCUS_05270 28428 27535 gene locus_tag LOCUS_05280 gene folD 28428 27535 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_05280 28657 29286 gene locus_tag LOCUS_05290 28657 29286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 29288 30097 gene locus_tag LOCUS_05300 29288 30097 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 protein_id gnl|my_center|LOCUS_05300 30340 32559 gene locus_tag LOCUS_05310 gene acsB 30340 32559 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418359.1 protein_id gnl|my_center|LOCUS_05310 32575 33921 gene locus_tag LOCUS_05320 gene acsC 32575 33921 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392715.1 protein_id gnl|my_center|LOCUS_05320 33906 35837 gene locus_tag LOCUS_05330 33906 35837 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392714.1 protein_id gnl|my_center|LOCUS_05330 35839 36612 gene locus_tag LOCUS_05340 35839 36612 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_05340 36614 37597 gene locus_tag LOCUS_05350 gene cdhD 36614 37597 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392712.1 protein_id gnl|my_center|LOCUS_05350 37594 38394 gene locus_tag LOCUS_05360 37594 38394 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392711.1 protein_id gnl|my_center|LOCUS_05360 38406 40289 gene locus_tag LOCUS_05370 gene cooS 38406 40289 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_05370 40441 40713 gene locus_tag LOCUS_05380 40441 40713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 40706 41140 gene locus_tag LOCUS_05390 40706 41140 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140723.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence009 874 1251 gene locus_tag LOCUS_05400 874 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 1254 1619 gene locus_tag LOCUS_05410 1254 1619 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227906.1 protein_id gnl|my_center|LOCUS_05410 2452 1622 gene locus_tag LOCUS_05420 2452 1622 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948292.1 protein_id gnl|my_center|LOCUS_05420 3830 3057 gene locus_tag LOCUS_05430 3830 3057 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05430 4605 3823 gene locus_tag LOCUS_05440 4605 3823 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174408902.1 protein_id gnl|my_center|LOCUS_05440 5215 5142 gene locus_tag LOCUS_t00140 5215 5142 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5296 6144 gene locus_tag LOCUS_05450 gene amrB 5296 6144 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082616.1 protein_id gnl|my_center|LOCUS_05450 6197 6994 gene locus_tag LOCUS_05460 6197 6994 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038352.1 protein_id gnl|my_center|LOCUS_05460 6991 7644 gene locus_tag LOCUS_05470 gene gmk 6991 7644 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_05470 7632 8003 gene locus_tag LOCUS_05480 7632 8003 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173441.1 protein_id gnl|my_center|LOCUS_05480 9909 7957 gene locus_tag LOCUS_05490 9909 7957 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940408.1 protein_id gnl|my_center|LOCUS_05490 10761 10135 gene locus_tag LOCUS_05500 10761 10135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 11359 10742 gene locus_tag LOCUS_05510 gene cmk 11359 10742 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081716.1 protein_id gnl|my_center|LOCUS_05510 12201 11356 gene locus_tag LOCUS_05520 gene ispE 12201 11356 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951042.1 protein_id gnl|my_center|LOCUS_05520 13400 12165 gene locus_tag LOCUS_05530 gene hutI 13400 12165 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869661.1 protein_id gnl|my_center|LOCUS_05530 13416 14966 gene locus_tag LOCUS_05540 gene hutH 13416 14966 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631841.1 protein_id gnl|my_center|LOCUS_05540 14956 15843 gene locus_tag LOCUS_05550 gene era 14956 15843 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103711.1 protein_id gnl|my_center|LOCUS_05550 15886 18225 gene locus_tag LOCUS_05560 15886 18225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 18203 19075 gene locus_tag LOCUS_05570 18203 19075 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042382595.1 protein_id gnl|my_center|LOCUS_05570 19072 20187 gene locus_tag LOCUS_05580 gene menC 19072 20187 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_05580 20199 20870 gene locus_tag LOCUS_05590 gene deoC 20199 20870 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933101.1 protein_id gnl|my_center|LOCUS_05590 20872 21567 gene locus_tag LOCUS_05600 20872 21567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 21635 21880 gene locus_tag LOCUS_05610 21635 21880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 21870 23099 gene locus_tag LOCUS_05620 gene fabF 21870 23099 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_05620 23325 24011 gene locus_tag LOCUS_05630 23325 24011 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225398.1 protein_id gnl|my_center|LOCUS_05630 24013 25350 gene locus_tag LOCUS_05640 24013 25350 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259685.1 protein_id gnl|my_center|LOCUS_05640 25474 26163 gene locus_tag LOCUS_05650 25474 26163 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969993.1 protein_id gnl|my_center|LOCUS_05650 26160 27290 gene locus_tag LOCUS_05660 gene opuCA 26160 27290 CDS product osmoprotectant ABC transporter ATP-binding protein OpuCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243370.1 protein_id gnl|my_center|LOCUS_05660 27287 28033 gene locus_tag LOCUS_05670 27287 28033 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207649561.1 protein_id gnl|my_center|LOCUS_05670 28121 29038 gene locus_tag LOCUS_05680 28121 29038 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028669.1 protein_id gnl|my_center|LOCUS_05680 29523 29122 gene locus_tag LOCUS_05690 29523 29122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 29752 29946 gene locus_tag LOCUS_05700 29752 29946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 30178 31479 gene locus_tag LOCUS_05710 30178 31479 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229620.1 protein_id gnl|my_center|LOCUS_05710 31476 32828 gene locus_tag LOCUS_05720 31476 32828 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886532.1 protein_id gnl|my_center|LOCUS_05720 >Feature sequence010 <1 1199 gene locus_tag LOCUS_05730 <1 1199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928959.1:ABC transporter ATP-binding protein 1309 2250 gene locus_tag LOCUS_05740 1309 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2513 3787 gene locus_tag LOCUS_05750 2513 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 3840 4847 gene locus_tag LOCUS_05760 3840 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 4887 5798 gene locus_tag LOCUS_05770 4887 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 5812 6897 gene locus_tag LOCUS_05780 5812 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 6905 7759 gene locus_tag LOCUS_05790 6905 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 7774 8979 gene locus_tag LOCUS_05800 7774 8979 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392042.1 protein_id gnl|my_center|LOCUS_05800 9362 10096 gene locus_tag LOCUS_05810 9362 10096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 10175 10741 gene locus_tag LOCUS_05820 10175 10741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 11319 11146 gene locus_tag LOCUS_05830 11319 11146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 11536 11835 gene locus_tag LOCUS_05840 11536 11835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 11880 12653 gene locus_tag LOCUS_05850 11880 12653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 12650 13780 gene locus_tag LOCUS_05860 12650 13780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 13835 14797 gene locus_tag LOCUS_05870 13835 14797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 14841 15812 gene locus_tag LOCUS_05880 14841 15812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 16148 16657 gene locus_tag LOCUS_05890 16148 16657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 16623 16826 gene locus_tag LOCUS_05900 16623 16826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 16853 17980 gene locus_tag LOCUS_05910 16853 17980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 18043 19074 gene locus_tag LOCUS_05920 18043 19074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 19122 20486 gene locus_tag LOCUS_05930 19122 20486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 21244 21789 gene locus_tag LOCUS_05940 21244 21789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 21786 22928 gene locus_tag LOCUS_05950 21786 22928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 22925 23605 gene locus_tag LOCUS_05960 22925 23605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 23696 24514 gene locus_tag LOCUS_05970 23696 24514 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_05970 24553 25383 gene locus_tag LOCUS_05980 24553 25383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 25491 26399 gene locus_tag LOCUS_05990 25491 26399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 26396 27055 gene locus_tag LOCUS_06000 26396 27055 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124316.1 protein_id gnl|my_center|LOCUS_06000 27826 27975 gene locus_tag LOCUS_06010 27826 27975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 27972 28241 gene locus_tag LOCUS_06020 27972 28241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 28679 29257 gene locus_tag LOCUS_06030 28679 29257 CDS product putative colanic acid biosynthesis acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331372.1 protein_id gnl|my_center|LOCUS_06030 30033 29422 gene locus_tag LOCUS_06040 30033 29422 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144275.1 protein_id gnl|my_center|LOCUS_06040 30606 30205 gene locus_tag LOCUS_06050 30606 30205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 32260 30611 gene locus_tag LOCUS_06060 32260 30611 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257153.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence011 1133 786 gene locus_tag LOCUS_06070 gene rsfS 1133 786 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052031.1 protein_id gnl|my_center|LOCUS_06070 2289 1123 gene locus_tag LOCUS_06080 2289 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 4492 2354 gene locus_tag LOCUS_06090 4492 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 4815 4498 gene locus_tag LOCUS_06100 4815 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 4810 5121 gene locus_tag LOCUS_06110 4810 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 5118 6395 gene locus_tag LOCUS_06120 gene mtaB 5118 6395 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392125.1 protein_id gnl|my_center|LOCUS_06120 6400 7344 gene locus_tag LOCUS_06130 6400 7344 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816443.1 protein_id gnl|my_center|LOCUS_06130 7307 8650 gene locus_tag LOCUS_06140 7307 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 9572 8676 gene locus_tag LOCUS_06150 9572 8676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 9798 10001 gene locus_tag LOCUS_06160 9798 10001 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_06160 10867 10091 gene locus_tag LOCUS_06170 10867 10091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228312.1 protein_id gnl|my_center|LOCUS_06170 11895 10951 gene locus_tag LOCUS_06180 11895 10951 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867543.1 protein_id gnl|my_center|LOCUS_06180 13077 11947 gene locus_tag LOCUS_06190 13077 11947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 14813 13095 gene locus_tag LOCUS_06200 gene polX 14813 13095 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_06200 15069 16286 gene locus_tag LOCUS_06210 15069 16286 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258527.1 protein_id gnl|my_center|LOCUS_06210 16297 16650 gene locus_tag LOCUS_06220 16297 16650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 16687 17724 gene locus_tag LOCUS_06230 gene mnmA 16687 17724 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256566.1 protein_id gnl|my_center|LOCUS_06230 18014 17721 gene locus_tag LOCUS_06240 18014 17721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 19160 18219 gene locus_tag LOCUS_06250 19160 18219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 20021 19572 gene locus_tag LOCUS_06260 20021 19572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 20852 20511 gene locus_tag LOCUS_06270 20852 20511 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928563.1 protein_id gnl|my_center|LOCUS_06270 21104 20856 gene locus_tag LOCUS_06280 21104 20856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 22022 21615 gene locus_tag LOCUS_06290 22022 21615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 22288 22010 gene locus_tag LOCUS_06300 22288 22010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 22467 23708 gene locus_tag LOCUS_06310 22467 23708 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546576.1 protein_id gnl|my_center|LOCUS_06310 25755 23902 gene locus_tag LOCUS_06320 25755 23902 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868795.1 protein_id gnl|my_center|LOCUS_06320 26987 26010 gene locus_tag LOCUS_06330 26987 26010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 27195 27416 gene locus_tag LOCUS_06340 27195 27416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 27397 27855 gene locus_tag LOCUS_06350 27397 27855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 28267 28034 gene locus_tag LOCUS_06360 28267 28034 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250461.1 protein_id gnl|my_center|LOCUS_06360 28487 28260 gene locus_tag LOCUS_06370 28487 28260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 28817 29056 gene locus_tag LOCUS_06380 28817 29056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 29049 29468 gene locus_tag LOCUS_06390 29049 29468 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065019.1 protein_id gnl|my_center|LOCUS_06390 29605 29865 gene locus_tag LOCUS_06400 29605 29865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 29862 30356 gene locus_tag LOCUS_06410 29862 30356 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 protein_id gnl|my_center|LOCUS_06410 31037 30639 gene locus_tag LOCUS_06420 31037 30639 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403363.1 protein_id gnl|my_center|LOCUS_06420 31353 31009 gene locus_tag LOCUS_06430 31353 31009 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403362.1 protein_id gnl|my_center|LOCUS_06430 >Feature sequence012 1440 160 gene locus_tag LOCUS_06440 gene tyrS 1440 160 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_06440 3839 1437 gene locus_tag LOCUS_06450 gene gyrA 3839 1437 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869025.1 protein_id gnl|my_center|LOCUS_06450 3949 5010 gene locus_tag LOCUS_06460 3949 5010 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251073.1 protein_id gnl|my_center|LOCUS_06460 5003 5671 gene locus_tag LOCUS_06470 5003 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 6143 5712 gene locus_tag LOCUS_06480 6143 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 7560 6313 gene locus_tag LOCUS_06490 7560 6313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 7806 9881 gene locus_tag LOCUS_06500 gene fusA 7806 9881 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_06500 10365 9898 gene locus_tag LOCUS_06510 10365 9898 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_06510 10430 10897 gene locus_tag LOCUS_06520 10430 10897 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318917.1 protein_id gnl|my_center|LOCUS_06520 13114 10811 gene locus_tag LOCUS_06530 13114 10811 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_06530 13245 14540 gene locus_tag LOCUS_06540 gene mgtE 13245 14540 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141924.1 protein_id gnl|my_center|LOCUS_06540 14537 15019 gene locus_tag LOCUS_06550 14537 15019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 15025 15303 gene locus_tag LOCUS_06560 gene yajC 15025 15303 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545404.1 protein_id gnl|my_center|LOCUS_06560 15315 16670 gene locus_tag LOCUS_06570 gene secD 15315 16670 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869961.1 protein_id gnl|my_center|LOCUS_06570 17556 16648 gene locus_tag LOCUS_06580 17556 16648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 17812 19413 gene locus_tag LOCUS_06590 17812 19413 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080855420.1 protein_id gnl|my_center|LOCUS_06590 19426 20373 gene locus_tag LOCUS_06600 19426 20373 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_06600 20370 21209 gene locus_tag LOCUS_06610 20370 21209 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_06610 22283 21234 gene locus_tag LOCUS_06620 22283 21234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 22433 22520 gene locus_tag LOCUS_t00150 22433 22520 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22476 23519 gene locus_tag LOCUS_06630 gene plsX 22476 23519 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_06630 23526 24509 gene locus_tag LOCUS_06640 23526 24509 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583306.1 protein_id gnl|my_center|LOCUS_06640 24503 25387 gene locus_tag LOCUS_06650 gene fabD 24503 25387 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172505.1 protein_id gnl|my_center|LOCUS_06650 25398 26114 gene locus_tag LOCUS_06660 gene fabG 25398 26114 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_06660 26154 26414 gene locus_tag LOCUS_06670 gene acpP 26154 26414 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_06670 26441 27763 gene locus_tag LOCUS_06680 gene asnS 26441 27763 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228137.1 protein_id gnl|my_center|LOCUS_06680 >Feature sequence013 96 23 gene locus_tag LOCUS_t00160 96 23 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 214 138 gene locus_tag LOCUS_t00170 214 138 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 300 217 gene locus_tag LOCUS_t00180 300 217 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 385 312 gene locus_tag LOCUS_t00190 385 312 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 514 429 gene locus_tag LOCUS_t00200 514 429 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 595 519 gene locus_tag LOCUS_t00210 595 519 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 683 609 gene locus_tag LOCUS_t00220 683 609 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 762 685 gene locus_tag LOCUS_t00230 762 685 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 854 781 gene locus_tag LOCUS_t00240 854 781 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1747 950 gene locus_tag LOCUS_06690 1747 950 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889182.1 protein_id gnl|my_center|LOCUS_06690 1850 1773 gene locus_tag LOCUS_t00250 1850 1773 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3281 1875 gene locus_tag LOCUS_06700 3281 1875 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_06700 3429 4439 gene locus_tag LOCUS_06710 3429 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_06710 4992 4423 gene locus_tag LOCUS_06720 gene folE 4992 4423 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391949.1 protein_id gnl|my_center|LOCUS_06720 5075 5151 gene locus_tag LOCUS_t00260 5075 5151 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7069 5168 gene locus_tag LOCUS_06730 7069 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 7890 7108 gene locus_tag LOCUS_06740 7890 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 7804 8097 gene locus_tag LOCUS_06750 7804 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 9302 8094 gene locus_tag LOCUS_06760 9302 8094 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081252.1 protein_id gnl|my_center|LOCUS_06760 10282 9413 gene locus_tag LOCUS_06770 10282 9413 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569669.1 protein_id gnl|my_center|LOCUS_06770 10363 10950 gene locus_tag LOCUS_06780 10363 10950 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966171.1 protein_id gnl|my_center|LOCUS_06780 11207 12175 gene locus_tag LOCUS_06790 11207 12175 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529687.1 protein_id gnl|my_center|LOCUS_06790 12185 13072 gene locus_tag LOCUS_06800 12185 13072 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092881.1 protein_id gnl|my_center|LOCUS_06800 13069 13872 gene locus_tag LOCUS_06810 13069 13872 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856990.1 protein_id gnl|my_center|LOCUS_06810 13972 14745 gene locus_tag LOCUS_06820 13972 14745 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842212.1 protein_id gnl|my_center|LOCUS_06820 14742 16805 gene locus_tag LOCUS_06830 14742 16805 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421608.1 protein_id gnl|my_center|LOCUS_06830 16793 18346 gene locus_tag LOCUS_06840 16793 18346 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_06840 19122 18325 gene locus_tag LOCUS_06850 19122 18325 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869876.1 protein_id gnl|my_center|LOCUS_06850 19308 19153 gene locus_tag LOCUS_06860 19308 19153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 19376 20071 gene locus_tag LOCUS_06870 gene thyX 19376 20071 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249821.1 protein_id gnl|my_center|LOCUS_06870 20068 20628 gene locus_tag LOCUS_06880 gene dcd 20068 20628 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404183.1 protein_id gnl|my_center|LOCUS_06880 20833 20612 gene locus_tag LOCUS_06890 20833 20612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 21147 20836 gene locus_tag LOCUS_06900 21147 20836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 21517 21149 gene locus_tag LOCUS_06910 21517 21149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 22026 21514 gene locus_tag LOCUS_06920 22026 21514 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528254.1 protein_id gnl|my_center|LOCUS_06920 23164 22154 gene locus_tag LOCUS_06930 23164 22154 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249115.1 protein_id gnl|my_center|LOCUS_06930 24169 23219 gene locus_tag LOCUS_06940 24169 23219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876595.1 protein_id gnl|my_center|LOCUS_06940 25035 24169 gene locus_tag LOCUS_06950 gene panB 25035 24169 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_06950 25311 25108 gene locus_tag LOCUS_06960 25311 25108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 26055 25681 gene locus_tag LOCUS_06970 26055 25681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 27024 26176 gene locus_tag LOCUS_06980 27024 26176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence014 1512 217 gene locus_tag LOCUS_06990 1512 217 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081767.1 protein_id gnl|my_center|LOCUS_06990 1827 1708 gene locus_tag LOCUS_07000 1827 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 1989 1870 gene locus_tag LOCUS_07010 1989 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 2553 2230 gene locus_tag LOCUS_07020 gene hbs 2553 2230 CDS product non-specific DNA-binding protein Hbs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153447.1 protein_id gnl|my_center|LOCUS_07020 2727 3038 gene locus_tag LOCUS_07030 gene rpsF 2727 3038 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_07030 3038 3460 gene locus_tag LOCUS_07040 gene ssb 3038 3460 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815182.1 protein_id gnl|my_center|LOCUS_07040 3460 3675 gene locus_tag LOCUS_07050 3460 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 3681 4817 gene locus_tag LOCUS_07060 3681 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 4807 8076 gene locus_tag LOCUS_07070 4807 8076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 9488 8058 gene locus_tag LOCUS_07080 gene cysS 9488 8058 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869759.1 protein_id gnl|my_center|LOCUS_07080 10558 9572 gene locus_tag LOCUS_07090 10558 9572 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_07090 11715 10570 gene locus_tag LOCUS_07100 11715 10570 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_07100 12815 11730 gene locus_tag LOCUS_07110 12815 11730 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224333.1 protein_id gnl|my_center|LOCUS_07110 13087 12875 gene locus_tag LOCUS_07120 13087 12875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 14316 13075 gene locus_tag LOCUS_07130 gene glgC 14316 13075 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_07130 16478 14379 gene locus_tag LOCUS_07140 16478 14379 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118691.1 protein_id gnl|my_center|LOCUS_07140 16696 18540 gene locus_tag LOCUS_07150 gene glgB 16696 18540 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257047.1 protein_id gnl|my_center|LOCUS_07150 18537 20957 gene locus_tag LOCUS_07160 18537 20957 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393310.1 protein_id gnl|my_center|LOCUS_07160 21740 20982 gene locus_tag LOCUS_07170 21740 20982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 21862 22380 gene locus_tag LOCUS_07180 21862 22380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 22619 23347 gene locus_tag LOCUS_07190 22619 23347 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_07190 23340 24569 gene locus_tag LOCUS_07200 23340 24569 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257201.1 protein_id gnl|my_center|LOCUS_07200 24559 25233 gene locus_tag LOCUS_07210 24559 25233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 25346 26632 gene locus_tag LOCUS_07220 25346 26632 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384638.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence015 459 722 gene locus_tag LOCUS_07230 459 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 719 1996 gene locus_tag LOCUS_07240 gene dinB 719 1996 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940720.1 protein_id gnl|my_center|LOCUS_07240 4013 2142 gene locus_tag LOCUS_07250 4013 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 4822 4013 gene locus_tag LOCUS_07260 gene cysT 4822 4013 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391148.1 protein_id gnl|my_center|LOCUS_07260 5811 4819 gene locus_tag LOCUS_07270 5811 4819 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266412.1 protein_id gnl|my_center|LOCUS_07270 6193 7476 gene locus_tag LOCUS_07280 6193 7476 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886935.1 protein_id gnl|my_center|LOCUS_07280 7671 8153 gene locus_tag LOCUS_07290 7671 8153 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582732.1 protein_id gnl|my_center|LOCUS_07290 8193 10184 gene locus_tag LOCUS_07300 8193 10184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 10446 11720 gene locus_tag LOCUS_07310 10446 11720 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368318.1 protein_id gnl|my_center|LOCUS_07310 12403 11741 gene locus_tag LOCUS_07320 12403 11741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 14135 12441 gene locus_tag LOCUS_07330 14135 12441 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769933.1 protein_id gnl|my_center|LOCUS_07330 14551 14183 gene locus_tag LOCUS_07340 14551 14183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 14835 16031 gene locus_tag LOCUS_07350 gene rocD 14835 16031 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242970.1 protein_id gnl|my_center|LOCUS_07350 16140 17456 gene locus_tag LOCUS_07360 16140 17456 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877734.1 protein_id gnl|my_center|LOCUS_07360 17499 18368 gene locus_tag LOCUS_07370 17499 18368 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897070.1 protein_id gnl|my_center|LOCUS_07370 18370 19401 gene locus_tag LOCUS_07380 18370 19401 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089184.1 protein_id gnl|my_center|LOCUS_07380 20144 19398 gene locus_tag LOCUS_07390 20144 19398 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142892.1 protein_id gnl|my_center|LOCUS_07390 20932 20144 gene locus_tag LOCUS_07400 gene livG 20932 20144 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811277.1 protein_id gnl|my_center|LOCUS_07400 22599 20929 gene locus_tag LOCUS_07410 22599 20929 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763167.1 protein_id gnl|my_center|LOCUS_07410 24362 22755 gene locus_tag LOCUS_07420 24362 22755 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582481.1 protein_id gnl|my_center|LOCUS_07420 25176 24556 gene locus_tag LOCUS_07430 25176 24556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence016 426 1361 gene locus_tag LOCUS_07440 426 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 2428 1445 gene locus_tag LOCUS_07450 2428 1445 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932627.1 protein_id gnl|my_center|LOCUS_07450 3591 2620 gene locus_tag LOCUS_07460 3591 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 4695 3763 gene locus_tag LOCUS_07470 4695 3763 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_07470 5596 4778 gene locus_tag LOCUS_07480 5596 4778 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088005.1 protein_id gnl|my_center|LOCUS_07480 7017 5821 gene locus_tag LOCUS_07490 7017 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 8280 7525 gene locus_tag LOCUS_07500 gene nagB 8280 7525 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987104.1 protein_id gnl|my_center|LOCUS_07500 8962 8258 gene locus_tag LOCUS_07510 8962 8258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 8882 9130 gene locus_tag LOCUS_07520 8882 9130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 10085 9141 gene locus_tag LOCUS_07530 gene nagA 10085 9141 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230828.1 protein_id gnl|my_center|LOCUS_07530 10032 10280 gene locus_tag LOCUS_07540 10032 10280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 11434 10286 gene locus_tag LOCUS_07550 11434 10286 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405142.1 protein_id gnl|my_center|LOCUS_07550 12494 11511 gene locus_tag LOCUS_07560 12494 11511 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003597368.1 protein_id gnl|my_center|LOCUS_07560 13394 12558 gene locus_tag LOCUS_07570 13394 12558 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085650.1 protein_id gnl|my_center|LOCUS_07570 14343 13387 gene locus_tag LOCUS_07580 14343 13387 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383546.1 protein_id gnl|my_center|LOCUS_07580 15965 14430 gene locus_tag LOCUS_07590 15965 14430 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537499.1 protein_id gnl|my_center|LOCUS_07590 16836 16075 gene locus_tag LOCUS_07600 16836 16075 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930893.1 protein_id gnl|my_center|LOCUS_07600 17611 16847 gene locus_tag LOCUS_07610 17611 16847 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230307.1 protein_id gnl|my_center|LOCUS_07610 17713 18129 gene locus_tag LOCUS_07620 17713 18129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 19631 19227 gene locus_tag LOCUS_07630 19631 19227 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227658.1 protein_id gnl|my_center|LOCUS_07630 19885 19628 gene locus_tag LOCUS_07640 19885 19628 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631141.1 protein_id gnl|my_center|LOCUS_07640 >Feature sequence017 30 1256 gene locus_tag LOCUS_07650 30 1256 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867842.1 protein_id gnl|my_center|LOCUS_07650 1253 2245 gene locus_tag LOCUS_07660 1253 2245 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053771.1 protein_id gnl|my_center|LOCUS_07660 2242 2634 gene locus_tag LOCUS_07670 2242 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 3566 2598 gene locus_tag LOCUS_07680 3566 2598 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228628.1 protein_id gnl|my_center|LOCUS_07680 3670 3509 gene locus_tag LOCUS_07690 3670 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 4254 3667 gene locus_tag LOCUS_07700 4254 3667 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658321.1 protein_id gnl|my_center|LOCUS_07700 4469 4287 gene locus_tag LOCUS_07710 4469 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 4836 4495 gene locus_tag LOCUS_07720 4836 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 5070 4915 gene locus_tag LOCUS_07730 5070 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 6306 5131 gene locus_tag LOCUS_07740 6306 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 6410 7477 gene locus_tag LOCUS_07750 6410 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 7516 8619 gene locus_tag LOCUS_07760 7516 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 8673 9515 gene locus_tag LOCUS_07770 8673 9515 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869857.1 protein_id gnl|my_center|LOCUS_07770 9512 10894 gene locus_tag LOCUS_07780 gene gltA 9512 10894 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 protein_id gnl|my_center|LOCUS_07780 10905 12014 gene locus_tag LOCUS_07790 10905 12014 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393775.1 protein_id gnl|my_center|LOCUS_07790 12317 12078 gene locus_tag LOCUS_07800 gene yidD 12317 12078 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869455.1 protein_id gnl|my_center|LOCUS_07800 12384 12830 gene locus_tag LOCUS_07810 12384 12830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 14217 12883 gene locus_tag LOCUS_07820 14217 12883 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582601.1 protein_id gnl|my_center|LOCUS_07820 15038 14214 gene locus_tag LOCUS_07830 15038 14214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 15801 15028 gene locus_tag LOCUS_07840 15801 15028 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877600.1 protein_id gnl|my_center|LOCUS_07840 16532 15798 gene locus_tag LOCUS_07850 16532 15798 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877601.1 protein_id gnl|my_center|LOCUS_07850 17467 16529 gene locus_tag LOCUS_07860 17467 16529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 17457 17612 gene locus_tag LOCUS_07870 17457 17612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 17757 18530 gene locus_tag LOCUS_07880 17757 18530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 19332 18490 gene locus_tag LOCUS_07890 19332 18490 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876818.1 protein_id gnl|my_center|LOCUS_07890 19331 19954 gene locus_tag LOCUS_07900 19331 19954 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865361.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence018 1187 150 gene locus_tag LOCUS_07910 gene gap 1187 150 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_07910 2016 1210 gene locus_tag LOCUS_07920 2016 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 3346 2288 gene locus_tag LOCUS_07930 3346 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 3641 7918 gene locus_tag LOCUS_07940 3641 7918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 10001 7986 gene locus_tag LOCUS_07950 10001 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 10458 11348 gene locus_tag LOCUS_07960 10458 11348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 11345 13045 gene locus_tag LOCUS_07970 11345 13045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 14297 13359 gene locus_tag LOCUS_07980 14297 13359 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173675.1 protein_id gnl|my_center|LOCUS_07980 14663 15805 gene locus_tag LOCUS_07990 14663 15805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 16494 16075 gene locus_tag LOCUS_08000 16494 16075 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143422.1 protein_id gnl|my_center|LOCUS_08000 18204 16597 gene locus_tag LOCUS_08010 gene metG 18204 16597 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942872.1 protein_id gnl|my_center|LOCUS_08010 <20081 18371 gene locus_tag LOCUS_08020 <20081 18371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence019 2203 2 gene locus_tag LOCUS_08030 2203 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 2360 2905 gene locus_tag LOCUS_08040 2360 2905 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942963.1 protein_id gnl|my_center|LOCUS_08040 4358 2991 gene locus_tag LOCUS_08050 4358 2991 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_08050 4670 5812 gene locus_tag LOCUS_08060 4670 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 5915 6241 gene locus_tag LOCUS_08070 5915 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 6312 8387 gene locus_tag LOCUS_08080 6312 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 8489 8665 gene locus_tag LOCUS_08090 8489 8665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08090 8666 9247 gene locus_tag LOCUS_08100 8666 9247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 9244 9546 gene locus_tag LOCUS_08110 9244 9546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 9788 9489 gene locus_tag LOCUS_08120 9788 9489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 10594 9785 gene locus_tag LOCUS_08130 gene proC 10594 9785 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_08130 12122 10836 gene locus_tag LOCUS_08140 12122 10836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 12733 12179 gene locus_tag LOCUS_08150 12733 12179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 13841 12936 gene locus_tag LOCUS_08160 13841 12936 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081113.1 protein_id gnl|my_center|LOCUS_08160 14194 14685 gene locus_tag LOCUS_08170 14194 14685 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071486.1 protein_id gnl|my_center|LOCUS_08170 14771 16363 gene locus_tag LOCUS_08180 14771 16363 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538149.1 protein_id gnl|my_center|LOCUS_08180 16415 17422 gene locus_tag LOCUS_08190 16415 17422 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385674.1 protein_id gnl|my_center|LOCUS_08190 17415 18311 gene locus_tag LOCUS_08200 17415 18311 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385673.1 protein_id gnl|my_center|LOCUS_08200 18331 19407 gene locus_tag LOCUS_08210 18331 19407 CDS product DUF917 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391754.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence020 10523 192 gene locus_tag LOCUS_08220 10523 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 18755 10722 gene locus_tag LOCUS_08230 18755 10722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 19568 19029 gene locus_tag LOCUS_08240 19568 19029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence021 4061 81 gene locus_tag LOCUS_08250 4061 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 4563 5132 gene locus_tag LOCUS_08260 4563 5132 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258349.1 protein_id gnl|my_center|LOCUS_08260 5107 6165 gene locus_tag LOCUS_08270 5107 6165 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392932.1 protein_id gnl|my_center|LOCUS_08270 6162 7160 gene locus_tag LOCUS_08280 6162 7160 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021255.1 protein_id gnl|my_center|LOCUS_08280 7157 7945 gene locus_tag LOCUS_08290 7157 7945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810400.1 protein_id gnl|my_center|LOCUS_08290 8368 7997 gene locus_tag LOCUS_08300 8368 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 8558 8485 gene locus_tag LOCUS_t00270 8558 8485 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9786 8611 gene locus_tag LOCUS_08310 gene rng 9786 8611 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461826.1 protein_id gnl|my_center|LOCUS_08310 10319 9831 gene locus_tag LOCUS_08320 gene folK 10319 9831 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531872.1 protein_id gnl|my_center|LOCUS_08320 10752 10312 gene locus_tag LOCUS_08330 10752 10312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 11151 10795 gene locus_tag LOCUS_08340 gene rplT 11151 10795 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138362.1 protein_id gnl|my_center|LOCUS_08340 11353 11162 gene locus_tag LOCUS_08350 11353 11162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 11873 11322 gene locus_tag LOCUS_08360 gene infC 11873 11322 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939807.1 protein_id gnl|my_center|LOCUS_08360 12488 11895 gene locus_tag LOCUS_08370 gene nadD 12488 11895 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_08370 13758 12496 gene locus_tag LOCUS_08380 gene obgE 13758 12496 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082646.1 protein_id gnl|my_center|LOCUS_08380 14036 13785 gene locus_tag LOCUS_08390 gene rpmA 14036 13785 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417307.1 protein_id gnl|my_center|LOCUS_08390 14375 14052 gene locus_tag LOCUS_08400 14375 14052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 14697 14380 gene locus_tag LOCUS_08410 gene rplU 14697 14380 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640343.1 protein_id gnl|my_center|LOCUS_08410 16709 14745 gene locus_tag LOCUS_08420 gene metG 16709 14745 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762101.1 protein_id gnl|my_center|LOCUS_08420 16810 17451 gene locus_tag LOCUS_08430 16810 17451 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259716.1 protein_id gnl|my_center|LOCUS_08430 17430 18296 gene locus_tag LOCUS_08440 17430 18296 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259715.1 protein_id gnl|my_center|LOCUS_08440 18457 18354 gene locus_tag LOCUS_r00010 18457 18354 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence022 293 1606 gene locus_tag LOCUS_08450 293 1606 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_08450 1650 1889 gene locus_tag LOCUS_08460 1650 1889 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057724.1 protein_id gnl|my_center|LOCUS_08460 1914 2978 gene locus_tag LOCUS_08470 1914 2978 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755814.1 protein_id gnl|my_center|LOCUS_08470 3651 3256 gene locus_tag LOCUS_08480 3651 3256 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227979.1 protein_id gnl|my_center|LOCUS_08480 3961 3638 gene locus_tag LOCUS_08490 3961 3638 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_08490 4621 4283 gene locus_tag LOCUS_08500 4621 4283 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928563.1 protein_id gnl|my_center|LOCUS_08500 4848 4606 gene locus_tag LOCUS_08510 4848 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 5977 4916 gene locus_tag LOCUS_08520 gene arsB 5977 4916 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948469.1 protein_id gnl|my_center|LOCUS_08520 6429 5995 gene locus_tag LOCUS_08530 6429 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 6819 6445 gene locus_tag LOCUS_08540 6819 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 9021 6916 gene locus_tag LOCUS_08550 9021 6916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 10736 9018 gene locus_tag LOCUS_08560 10736 9018 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583044.1 protein_id gnl|my_center|LOCUS_08560 10845 11126 gene locus_tag LOCUS_08570 10845 11126 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173644.1 protein_id gnl|my_center|LOCUS_08570 12141 11209 gene locus_tag LOCUS_08580 12141 11209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 12070 12360 gene locus_tag LOCUS_08590 12070 12360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 12354 14561 gene locus_tag LOCUS_08600 12354 14561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 16736 14631 gene locus_tag LOCUS_08610 16736 14631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 18293 16746 gene locus_tag LOCUS_08620 18293 16746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 18789 18304 gene locus_tag LOCUS_08630 18789 18304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence023 <1 708 gene locus_tag LOCUS_08640 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071542276.1:alanine racemase 1105 602 gene locus_tag LOCUS_08650 gene hypA 1105 602 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021162.1 protein_id gnl|my_center|LOCUS_08650 2418 1249 gene locus_tag LOCUS_08660 2418 1249 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108906.1 protein_id gnl|my_center|LOCUS_08660 3146 2472 gene locus_tag LOCUS_08670 3146 2472 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057383.1 protein_id gnl|my_center|LOCUS_08670 4022 3177 gene locus_tag LOCUS_08680 4022 3177 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974399.1 protein_id gnl|my_center|LOCUS_08680 4869 4024 gene locus_tag LOCUS_08690 4869 4024 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226190.1 protein_id gnl|my_center|LOCUS_08690 6408 5101 gene locus_tag LOCUS_08700 6408 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 6899 7996 gene locus_tag LOCUS_08710 6899 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 8688 8041 gene locus_tag LOCUS_08720 gene eda 8688 8041 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_08720 9815 8712 gene locus_tag LOCUS_08730 9815 8712 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878914.1 protein_id gnl|my_center|LOCUS_08730 11734 9812 gene locus_tag LOCUS_08740 gene aor 11734 9812 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250017.1 protein_id gnl|my_center|LOCUS_08740 12164 11721 gene locus_tag LOCUS_08750 12164 11721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 12665 12189 gene locus_tag LOCUS_08760 12665 12189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 13806 12694 gene locus_tag LOCUS_08770 13806 12694 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583067.1 protein_id gnl|my_center|LOCUS_08770 14794 13799 gene locus_tag LOCUS_08780 14794 13799 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 protein_id gnl|my_center|LOCUS_08780 15771 14791 gene locus_tag LOCUS_08790 15771 14791 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_08790 16696 15776 gene locus_tag LOCUS_08800 16696 15776 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083858.1 protein_id gnl|my_center|LOCUS_08800 17544 16699 gene locus_tag LOCUS_08810 17544 16699 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083857.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence024 <1 601 gene locus_tag LOCUS_08820 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000614886.1:site-specific DNA-methyltransferase 947 1165 gene locus_tag LOCUS_08830 947 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 1430 1669 gene locus_tag LOCUS_08840 1430 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1672 1941 gene locus_tag LOCUS_08850 1672 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 2197 1916 gene locus_tag LOCUS_08860 2197 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 3138 2260 gene locus_tag LOCUS_08870 3138 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 3515 3141 gene locus_tag LOCUS_08880 3515 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 4071 3502 gene locus_tag LOCUS_08890 4071 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 4939 4196 gene locus_tag LOCUS_08900 4939 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 5409 4936 gene locus_tag LOCUS_08910 5409 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 5705 5406 gene locus_tag LOCUS_08920 5705 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 6039 5767 gene locus_tag LOCUS_08930 6039 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 6382 6110 gene locus_tag LOCUS_08940 6382 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 6619 6437 gene locus_tag LOCUS_08950 6619 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 6930 6619 gene locus_tag LOCUS_08960 6930 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 7337 6927 gene locus_tag LOCUS_08970 7337 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 10324 7334 gene locus_tag LOCUS_08980 10324 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 10699 10358 gene locus_tag LOCUS_08990 10699 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 11005 10712 gene locus_tag LOCUS_09000 11005 10712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 13626 10993 gene locus_tag LOCUS_09010 13626 10993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 13779 14453 gene locus_tag LOCUS_09020 13779 14453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 14510 14722 gene locus_tag LOCUS_09030 14510 14722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 14786 15046 gene locus_tag LOCUS_09040 14786 15046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 15019 16776 gene locus_tag LOCUS_09050 15019 16776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 16773 16907 gene locus_tag LOCUS_09060 16773 16907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence025 5226 376 gene locus_tag LOCUS_09070 5226 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 8600 5226 gene locus_tag LOCUS_09080 8600 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 12247 8597 gene locus_tag LOCUS_09090 12247 8597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 13147 12299 gene locus_tag LOCUS_09100 13147 12299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 13626 13153 gene locus_tag LOCUS_09110 13626 13153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 14441 13632 gene locus_tag LOCUS_09120 14441 13632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 15110 14703 gene locus_tag LOCUS_09130 15110 14703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence026 <1 1625 gene locus_tag LOCUS_09140 <1 1625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:transglutaminase-like domain-containing protein 1798 2682 gene locus_tag LOCUS_09150 1798 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 2679 3542 gene locus_tag LOCUS_09160 2679 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 3721 4377 gene locus_tag LOCUS_09170 3721 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 4593 5504 gene locus_tag LOCUS_09180 4593 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 5915 7039 gene locus_tag LOCUS_09190 5915 7039 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_09190 7032 8285 gene locus_tag LOCUS_09200 7032 8285 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584153.1 protein_id gnl|my_center|LOCUS_09200 8351 9253 gene locus_tag LOCUS_09210 8351 9253 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584152.1 protein_id gnl|my_center|LOCUS_09210 9250 10074 gene locus_tag LOCUS_09220 9250 10074 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584151.1 protein_id gnl|my_center|LOCUS_09220 10470 11804 gene locus_tag LOCUS_09230 10470 11804 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967039.1 protein_id gnl|my_center|LOCUS_09230 12681 11866 gene locus_tag LOCUS_09240 12681 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 13398 12727 gene locus_tag LOCUS_09250 13398 12727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 13750 13373 gene locus_tag LOCUS_09260 13750 13373 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064546.1 protein_id gnl|my_center|LOCUS_09260 15179 13833 gene locus_tag LOCUS_09270 15179 13833 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027994.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence027 <1 960 gene locus_tag LOCUS_09280 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045012.1:GGDEF domain-containing response regulator 1136 2014 gene locus_tag LOCUS_09290 1136 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 2435 2184 gene locus_tag LOCUS_09300 2435 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 4903 2606 gene locus_tag LOCUS_09310 gene mutS2 4903 2606 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079958.1 protein_id gnl|my_center|LOCUS_09310 5841 4900 gene locus_tag LOCUS_09320 5841 4900 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931899.1 protein_id gnl|my_center|LOCUS_09320 5924 6910 gene locus_tag LOCUS_09330 5924 6910 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583008.1 protein_id gnl|my_center|LOCUS_09330 6907 7998 gene locus_tag LOCUS_09340 6907 7998 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392231.1 protein_id gnl|my_center|LOCUS_09340 8509 7985 gene locus_tag LOCUS_09350 8509 7985 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868874.1 protein_id gnl|my_center|LOCUS_09350 9543 8533 gene locus_tag LOCUS_09360 9543 8533 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_09360 9603 11102 gene locus_tag LOCUS_09370 9603 11102 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903377.1 protein_id gnl|my_center|LOCUS_09370 11108 11890 gene locus_tag LOCUS_09380 gene mutM 11108 11890 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_09380 11910 12977 gene locus_tag LOCUS_09390 11910 12977 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143858.1 protein_id gnl|my_center|LOCUS_09390 12998 13951 gene locus_tag LOCUS_09400 gene trmB 12998 13951 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080637.1 protein_id gnl|my_center|LOCUS_09400 13948 14778 gene locus_tag LOCUS_09410 13948 14778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 >Feature sequence028 120 45 gene locus_tag LOCUS_t00280 120 45 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 220 1470 gene locus_tag LOCUS_09420 220 1470 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011342568.1 protein_id gnl|my_center|LOCUS_09420 1473 1727 gene locus_tag LOCUS_09430 1473 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 1708 3174 gene locus_tag LOCUS_09440 1708 3174 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404928.1 protein_id gnl|my_center|LOCUS_09440 3171 5684 gene locus_tag LOCUS_09450 gene leuS 3171 5684 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546871.1 protein_id gnl|my_center|LOCUS_09450 5695 6849 gene locus_tag LOCUS_09460 5695 6849 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080975.1 protein_id gnl|my_center|LOCUS_09460 7411 6863 gene locus_tag LOCUS_09470 7411 6863 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023327.1 protein_id gnl|my_center|LOCUS_09470 8003 7395 gene locus_tag LOCUS_09480 8003 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 8131 9027 gene locus_tag LOCUS_09490 8131 9027 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257625.1 protein_id gnl|my_center|LOCUS_09490 9082 10062 gene locus_tag LOCUS_09500 gene gyaR 9082 10062 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 protein_id gnl|my_center|LOCUS_09500 10121 10693 gene locus_tag LOCUS_09510 10121 10693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 10698 11507 gene locus_tag LOCUS_09520 10698 11507 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_09520 12236 11550 gene locus_tag LOCUS_09530 12236 11550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 12445 13149 gene locus_tag LOCUS_09540 12445 13149 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349488.1 protein_id gnl|my_center|LOCUS_09540 14403 13168 gene locus_tag LOCUS_09550 14403 13168 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence029 4829 1392 gene locus_tag LOCUS_09560 4829 1392 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153439724.1 protein_id gnl|my_center|LOCUS_09560 5098 4919 gene locus_tag LOCUS_09570 5098 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 5153 5713 gene locus_tag LOCUS_09580 5153 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 5710 6375 gene locus_tag LOCUS_09590 5710 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 6406 8514 gene locus_tag LOCUS_09600 gene ligA 6406 8514 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403650.1 protein_id gnl|my_center|LOCUS_09600 9203 8661 gene locus_tag LOCUS_09610 9203 8661 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113538.1 protein_id gnl|my_center|LOCUS_09610 9736 9993 gene locus_tag LOCUS_09620 9736 9993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 10541 11038 gene locus_tag LOCUS_09630 10541 11038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 11829 11053 gene locus_tag LOCUS_09640 11829 11053 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_09640 13675 11882 gene locus_tag LOCUS_09650 13675 11882 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945964.1 protein_id gnl|my_center|LOCUS_09650 13843 14205 gene locus_tag LOCUS_09660 13843 14205 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256880.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence030 6400 2654 gene locus_tag LOCUS_09670 6400 2654 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545943.1 protein_id gnl|my_center|LOCUS_09670 7180 6584 gene locus_tag LOCUS_09680 7180 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 7727 7272 gene locus_tag LOCUS_09690 7727 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 9816 7828 gene locus_tag LOCUS_09700 9816 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 10572 9952 gene locus_tag LOCUS_09710 10572 9952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 11447 10569 gene locus_tag LOCUS_09720 11447 10569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 12921 11515 gene locus_tag LOCUS_09730 12921 11515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 >Feature sequence031 2274 1951 gene locus_tag LOCUS_09740 2274 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 3598 2522 gene locus_tag LOCUS_09750 3598 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 4944 3661 gene locus_tag LOCUS_09760 4944 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 6796 5033 gene locus_tag LOCUS_09770 6796 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 6978 7769 gene locus_tag LOCUS_09780 6978 7769 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098561.1 protein_id gnl|my_center|LOCUS_09780 7766 8554 gene locus_tag LOCUS_09790 7766 8554 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496786.1 protein_id gnl|my_center|LOCUS_09790 8650 9636 gene locus_tag LOCUS_09800 8650 9636 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013644.1 protein_id gnl|my_center|LOCUS_09800 9706 11427 gene locus_tag LOCUS_09810 9706 11427 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016301.1 protein_id gnl|my_center|LOCUS_09810 11438 12544 gene locus_tag LOCUS_09820 11438 12544 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence032 98 170 gene locus_tag LOCUS_t00290 98 170 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 184 262 gene locus_tag LOCUS_t00300 184 262 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 300 375 gene locus_tag LOCUS_t00310 300 375 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 426 1763 gene locus_tag LOCUS_09830 gene dnaA 426 1763 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391551.1 protein_id gnl|my_center|LOCUS_09830 2010 2558 gene locus_tag LOCUS_09840 2010 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 2551 3108 gene locus_tag LOCUS_09850 gene hslV 2551 3108 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_09850 3105 4421 gene locus_tag LOCUS_09860 gene hslU 3105 4421 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880072.1 protein_id gnl|my_center|LOCUS_09860 4493 6403 gene locus_tag LOCUS_09870 gene thrS 4493 6403 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_09870 7650 6451 gene locus_tag LOCUS_09880 gene metK 7650 6451 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392413.1 protein_id gnl|my_center|LOCUS_09880 7767 8828 gene locus_tag LOCUS_09890 7767 8828 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143227.1 protein_id gnl|my_center|LOCUS_09890 8863 9861 gene locus_tag LOCUS_09900 gene galE 8863 9861 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583707.1 protein_id gnl|my_center|LOCUS_09900 9874 10470 gene locus_tag LOCUS_09910 9874 10470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 10571 10834 gene locus_tag LOCUS_09920 10571 10834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 10976 11332 gene locus_tag LOCUS_09930 10976 11332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 11319 11696 gene locus_tag LOCUS_09940 11319 11696 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172718.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence033 46 118 gene locus_tag LOCUS_t00320 46 118 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 192 1904 gene locus_tag LOCUS_09950 192 1904 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173521.1 protein_id gnl|my_center|LOCUS_09950 2458 1880 gene locus_tag LOCUS_09960 2458 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 3380 2451 gene locus_tag LOCUS_09970 gene cysK 3380 2451 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_09970 4678 3653 gene locus_tag LOCUS_09980 4678 3653 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046594.1 protein_id gnl|my_center|LOCUS_09980 5769 4699 gene locus_tag LOCUS_09990 5769 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 6341 5874 gene locus_tag LOCUS_10000 6341 5874 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861494.1 protein_id gnl|my_center|LOCUS_10000 6487 7296 gene locus_tag LOCUS_10010 6487 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 7998 7318 gene locus_tag LOCUS_10020 7998 7318 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937696.1 protein_id gnl|my_center|LOCUS_10020 8765 7998 gene locus_tag LOCUS_10030 8765 7998 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_10030 9438 8755 gene locus_tag LOCUS_10040 9438 8755 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937694.1 protein_id gnl|my_center|LOCUS_10040 10362 9508 gene locus_tag LOCUS_10050 10362 9508 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937693.1 protein_id gnl|my_center|LOCUS_10050 11695 10529 gene locus_tag LOCUS_10060 11695 10529 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057197.1 protein_id gnl|my_center|LOCUS_10060 >Feature sequence034 924 571 gene locus_tag LOCUS_10070 924 571 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_10070 1152 2375 gene locus_tag LOCUS_10080 1152 2375 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583295.1 protein_id gnl|my_center|LOCUS_10080 2430 2702 gene locus_tag LOCUS_10090 gene rpsO 2430 2702 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583506.1 protein_id gnl|my_center|LOCUS_10090 2722 5064 gene locus_tag LOCUS_10100 gene pnp 2722 5064 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081541.1 protein_id gnl|my_center|LOCUS_10100 5061 6344 gene locus_tag LOCUS_10110 5061 6344 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_10110 6344 6832 gene locus_tag LOCUS_10120 gene coaD 6344 6832 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173005.1 protein_id gnl|my_center|LOCUS_10120 6886 7815 gene locus_tag LOCUS_10130 6886 7815 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_10130 7812 9017 gene locus_tag LOCUS_10140 7812 9017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 9014 10081 gene locus_tag LOCUS_10150 9014 10081 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582517.1 protein_id gnl|my_center|LOCUS_10150 10932 10078 gene locus_tag LOCUS_10160 10932 10078 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258586.1 protein_id gnl|my_center|LOCUS_10160 11819 10929 gene locus_tag LOCUS_10170 11819 10929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence035 1076 180 gene locus_tag LOCUS_10180 1076 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1326 3494 gene locus_tag LOCUS_10190 1326 3494 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082809.1 protein_id gnl|my_center|LOCUS_10190 3682 4104 gene locus_tag LOCUS_10200 3682 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 4126 5031 gene locus_tag LOCUS_10210 4126 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 7467 5044 gene locus_tag LOCUS_10220 7467 5044 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545339.1 protein_id gnl|my_center|LOCUS_10220 8233 7583 gene locus_tag LOCUS_10230 8233 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 10527 8347 gene locus_tag LOCUS_10240 10527 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 11199 10756 gene locus_tag LOCUS_10250 gene rplM 11199 10756 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence036 1103 750 gene locus_tag LOCUS_10260 1103 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1589 2782 gene locus_tag LOCUS_10270 1589 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 2871 3452 gene locus_tag LOCUS_10280 2871 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 3996 3670 gene locus_tag LOCUS_10290 3996 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 5953 4154 gene locus_tag LOCUS_10300 5953 4154 CDS product reverse transcriptase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272172.1 protein_id gnl|my_center|LOCUS_10300 7686 6511 gene locus_tag LOCUS_10310 7686 6511 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143249.1 protein_id gnl|my_center|LOCUS_10310 7960 7757 gene locus_tag LOCUS_10320 7960 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 8325 7957 gene locus_tag LOCUS_10330 8325 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 8537 8367 gene locus_tag LOCUS_10340 8537 8367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 9193 8711 gene locus_tag LOCUS_10350 9193 8711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 9560 9138 gene locus_tag LOCUS_10360 9560 9138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 10279 10046 gene locus_tag LOCUS_10370 10279 10046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 10656 10255 gene locus_tag LOCUS_10380 10656 10255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 >Feature sequence037 1967 1599 gene locus_tag LOCUS_10390 1967 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 3257 1971 gene locus_tag LOCUS_10400 3257 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 6017 3258 gene locus_tag LOCUS_10410 6017 3258 CDS product conjugative transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144236044.1 protein_id gnl|my_center|LOCUS_10410 6436 6014 gene locus_tag LOCUS_10420 6436 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 8024 6429 gene locus_tag LOCUS_10430 8024 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 8818 8009 gene locus_tag LOCUS_10440 8818 8009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 9441 8815 gene locus_tag LOCUS_10450 9441 8815 CDS product TIGR03746 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032826.1 protein_id gnl|my_center|LOCUS_10450 9791 9438 gene locus_tag LOCUS_10460 9791 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 10182 9796 gene locus_tag LOCUS_10470 10182 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 10411 10175 gene locus_tag LOCUS_10480 10411 10175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 >Feature sequence038 325 513 gene locus_tag LOCUS_10490 325 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1469 519 gene locus_tag LOCUS_10500 1469 519 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385500.1 protein_id gnl|my_center|LOCUS_10500 2221 1466 gene locus_tag LOCUS_10510 2221 1466 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389672.1 protein_id gnl|my_center|LOCUS_10510 3225 2281 gene locus_tag LOCUS_10520 gene gsiC 3225 2281 CDS product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936066.1 protein_id gnl|my_center|LOCUS_10520 4079 3222 gene locus_tag LOCUS_10530 4079 3222 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388346.1 protein_id gnl|my_center|LOCUS_10530 4917 4090 gene locus_tag LOCUS_10540 4917 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 6422 4923 gene locus_tag LOCUS_10550 6422 4923 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990685.1 protein_id gnl|my_center|LOCUS_10550 6904 7212 gene locus_tag LOCUS_10560 6904 7212 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089812.1 protein_id gnl|my_center|LOCUS_10560 7324 8172 gene locus_tag LOCUS_10570 7324 8172 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140583.1 protein_id gnl|my_center|LOCUS_10570 8162 9250 gene locus_tag LOCUS_10580 8162 9250 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140582.1 protein_id gnl|my_center|LOCUS_10580 9247 10047 gene locus_tag LOCUS_10590 9247 10047 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050725350.1 protein_id gnl|my_center|LOCUS_10590 >Feature sequence039 900 253 gene locus_tag LOCUS_10600 900 253 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977570.1 protein_id gnl|my_center|LOCUS_10600 2168 1152 gene locus_tag LOCUS_10610 2168 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 2394 2185 gene locus_tag LOCUS_10620 2394 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 3034 2327 gene locus_tag LOCUS_10630 3034 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 3718 3098 gene locus_tag LOCUS_10640 3718 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 5020 4385 gene locus_tag LOCUS_10650 5020 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 5619 5038 gene locus_tag LOCUS_10660 5619 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 6433 5804 gene locus_tag LOCUS_10670 6433 5804 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_10670 7925 6474 gene locus_tag LOCUS_10680 7925 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 9251 8130 gene locus_tag LOCUS_10690 9251 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 9548 9372 gene locus_tag LOCUS_10700 9548 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence040 604 74 gene locus_tag LOCUS_10710 604 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1035 601 gene locus_tag LOCUS_10720 1035 601 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867844.1 protein_id gnl|my_center|LOCUS_10720 1370 1044 gene locus_tag LOCUS_10730 1370 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 2913 1372 gene locus_tag LOCUS_10740 2913 1372 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867846.1 protein_id gnl|my_center|LOCUS_10740 3269 2910 gene locus_tag LOCUS_10750 3269 2910 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330371.1 protein_id gnl|my_center|LOCUS_10750 3708 3259 gene locus_tag LOCUS_10760 3708 3259 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251035.1 protein_id gnl|my_center|LOCUS_10760 3968 3705 gene locus_tag LOCUS_10770 3968 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 4216 3965 gene locus_tag LOCUS_10780 4216 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 4551 4213 gene locus_tag LOCUS_10790 gene mnhG 4551 4213 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251032.1 protein_id gnl|my_center|LOCUS_10790 4814 4548 gene locus_tag LOCUS_10800 4814 4548 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251031.1 protein_id gnl|my_center|LOCUS_10800 5323 4811 gene locus_tag LOCUS_10810 5323 4811 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867852.1 protein_id gnl|my_center|LOCUS_10810 5504 6157 gene locus_tag LOCUS_10820 gene hypB 5504 6157 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876419.1 protein_id gnl|my_center|LOCUS_10820 8700 6475 gene locus_tag LOCUS_10830 gene hypF 8700 6475 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250947.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence041 14 1183 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccattagttcaacttccggagaagttttgag 1581 2051 gene locus_tag LOCUS_10840 1581 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10840 2341 2619 gene locus_tag LOCUS_10850 2341 2619 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_10850 2600 2833 gene locus_tag LOCUS_10860 2600 2833 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681198.1 protein_id gnl|my_center|LOCUS_10860 4101 2839 gene locus_tag LOCUS_10870 4101 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 7420 4094 gene locus_tag LOCUS_10880 7420 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 7852 7634 gene locus_tag LOCUS_10890 7852 7634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 8379 7951 gene locus_tag LOCUS_10900 8379 7951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence042 980 1366 gene locus_tag LOCUS_10910 980 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1359 1772 gene locus_tag LOCUS_10920 1359 1772 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419170.1 protein_id gnl|my_center|LOCUS_10920 3720 1906 gene locus_tag LOCUS_10930 3720 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 4206 7622 gene locus_tag LOCUS_10940 4206 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 7957 8187 gene locus_tag LOCUS_10950 7957 8187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 8184 8660 gene locus_tag LOCUS_10960 8184 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence043 1572 88 gene locus_tag LOCUS_10970 1572 88 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938325.1 protein_id gnl|my_center|LOCUS_10970 1755 2093 gene locus_tag LOCUS_10980 1755 2093 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064179.1 protein_id gnl|my_center|LOCUS_10980 2125 2571 gene locus_tag LOCUS_10990 2125 2571 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176702.1 protein_id gnl|my_center|LOCUS_10990 4097 2559 gene locus_tag LOCUS_11000 4097 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 5916 4252 gene locus_tag LOCUS_11010 5916 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 7367 5913 gene locus_tag LOCUS_11020 7367 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 7672 7364 gene locus_tag LOCUS_11030 7672 7364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence044 2285 939 gene locus_tag LOCUS_11040 2285 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 2766 2374 gene locus_tag LOCUS_11050 2766 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 2801 3718 gene locus_tag LOCUS_11060 gene nadC 2801 3718 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840153.1 protein_id gnl|my_center|LOCUS_11060 3715 4755 gene locus_tag LOCUS_11070 gene nadA 3715 4755 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080872.1 protein_id gnl|my_center|LOCUS_11070 4903 5130 gene locus_tag LOCUS_11080 4903 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 5120 5617 gene locus_tag LOCUS_11090 5120 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 6497 5646 gene locus_tag LOCUS_11100 6497 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 7318 6494 gene locus_tag LOCUS_11110 7318 6494 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582436.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence045 1621 143 gene locus_tag LOCUS_11120 gene lysS 1621 143 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257111.1 protein_id gnl|my_center|LOCUS_11120 2102 1623 gene locus_tag LOCUS_11130 gene greA 2102 1623 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082222.1 protein_id gnl|my_center|LOCUS_11130 2572 3900 gene locus_tag LOCUS_11140 gene pyk 2572 3900 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393367.1 protein_id gnl|my_center|LOCUS_11140 4001 5632 gene locus_tag LOCUS_11150 4001 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 5956 5681 gene locus_tag LOCUS_11160 5956 5681 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_11160 6038 6214 gene locus_tag LOCUS_11170 6038 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 7252 6209 gene locus_tag LOCUS_11180 7252 6209 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064463.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence046 646 422 gene locus_tag LOCUS_11190 646 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1588 656 gene locus_tag LOCUS_11200 1588 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 3091 1841 gene locus_tag LOCUS_11210 3091 1841 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_11210 3882 3163 gene locus_tag LOCUS_11220 3882 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 4018 4206 gene locus_tag LOCUS_11230 4018 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 4939 4238 gene locus_tag LOCUS_11240 4939 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 5006 5470 gene locus_tag LOCUS_11250 5006 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 5491 6126 gene locus_tag LOCUS_11260 5491 6126 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938652.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence047 395 6 gene locus_tag LOCUS_11270 395 6 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227926.1 protein_id gnl|my_center|LOCUS_11270 454 885 gene locus_tag LOCUS_11280 454 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 882 1673 gene locus_tag LOCUS_11290 882 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1737 3680 gene locus_tag LOCUS_11300 1737 3680 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066875.1 protein_id gnl|my_center|LOCUS_11300 4685 3699 gene locus_tag LOCUS_11310 4685 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 5248 4742 gene locus_tag LOCUS_11320 5248 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 5398 6825 gene locus_tag LOCUS_11330 5398 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence048 1636 728 gene locus_tag LOCUS_11340 1636 728 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437082.1 protein_id gnl|my_center|LOCUS_11340 2730 1651 gene locus_tag LOCUS_11350 2730 1651 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888750.1 protein_id gnl|my_center|LOCUS_11350 4272 2809 gene locus_tag LOCUS_11360 4272 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 4607 4269 gene locus_tag LOCUS_11370 4607 4269 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867829.1 protein_id gnl|my_center|LOCUS_11370 5250 4618 gene locus_tag LOCUS_11380 5250 4618 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057649.1 protein_id gnl|my_center|LOCUS_11380 6080 5256 gene locus_tag LOCUS_11390 6080 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 6355 6077 gene locus_tag LOCUS_11400 6355 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 6612 6355 gene locus_tag LOCUS_11410 6612 6355 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258081.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence049 306 2027 gene locus_tag LOCUS_11420 306 2027 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869281.1 protein_id gnl|my_center|LOCUS_11420 2213 3442 gene locus_tag LOCUS_11430 2213 3442 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_11430 5821 3506 gene locus_tag LOCUS_11440 5821 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence050 1259 222 gene locus_tag LOCUS_11450 1259 222 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349826.1 protein_id gnl|my_center|LOCUS_11450 2350 1649 gene locus_tag LOCUS_11460 2350 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 3525 2485 gene locus_tag LOCUS_11470 3525 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 4274 4047 gene locus_tag LOCUS_11480 4274 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 4483 4271 gene locus_tag LOCUS_11490 4483 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 5041 4706 gene locus_tag LOCUS_11500 5041 4706 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402966.1 protein_id gnl|my_center|LOCUS_11500 6526 5423 gene locus_tag LOCUS_11510 6526 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 >Feature sequence051 2388 331 gene locus_tag LOCUS_11520 2388 331 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878688.1 protein_id gnl|my_center|LOCUS_11520 3635 2403 gene locus_tag LOCUS_11530 3635 2403 CDS product 3-hydroxy-3-methylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814048.1 protein_id gnl|my_center|LOCUS_11530 4887 3709 gene locus_tag LOCUS_11540 4887 3709 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870473.1 protein_id gnl|my_center|LOCUS_11540 6221 4890 gene locus_tag LOCUS_11550 gene hemL 6221 4890 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496557.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence052 71 901 gene locus_tag LOCUS_11560 71 901 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 protein_id gnl|my_center|LOCUS_11560 1082 1627 gene locus_tag LOCUS_11570 1082 1627 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_11570 2589 1618 gene locus_tag LOCUS_11580 gene tgt 2589 1618 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100607.1 protein_id gnl|my_center|LOCUS_11580 2842 4176 gene locus_tag LOCUS_11590 gene miaB 2842 4176 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947064.1 protein_id gnl|my_center|LOCUS_11590 4173 5198 gene locus_tag LOCUS_11600 4173 5198 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268976.1 protein_id gnl|my_center|LOCUS_11600 5195 5662 gene locus_tag LOCUS_11610 gene ybeY 5195 5662 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191149949.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence053 319 456 gene locus_tag LOCUS_11620 319 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 5884 1376 gene locus_tag LOCUS_11630 5884 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence054 347 1426 gene locus_tag LOCUS_11640 347 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1468 2598 gene locus_tag LOCUS_11650 1468 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2782 3192 gene locus_tag LOCUS_11660 2782 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 3496 3347 gene locus_tag LOCUS_11670 3496 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 3452 4801 gene locus_tag LOCUS_11680 3452 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 4957 6417 gene locus_tag LOCUS_11690 4957 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence055 1347 136 gene locus_tag LOCUS_11700 1347 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 2072 2305 gene locus_tag LOCUS_11710 2072 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 3733 3014 gene locus_tag LOCUS_11720 3733 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 4618 3764 gene locus_tag LOCUS_11730 4618 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 6332 6033 gene locus_tag LOCUS_11740 6332 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence056 <6330 296 gene locus_tag LOCUS_11750 <6330 296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:transglutaminase-like domain-containing protein >Feature sequence057 655 1464 gene locus_tag LOCUS_11760 655 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 2429 1458 gene locus_tag LOCUS_11770 2429 1458 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888004.1 protein_id gnl|my_center|LOCUS_11770 2721 3023 gene locus_tag LOCUS_11780 2721 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 3205 3639 gene locus_tag LOCUS_11790 3205 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 3654 5240 gene locus_tag LOCUS_11800 3654 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 6022 5237 gene locus_tag LOCUS_11810 6022 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence058 61 516 gene locus_tag LOCUS_11820 61 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 2096 582 gene locus_tag LOCUS_11830 2096 582 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861384.1 protein_id gnl|my_center|LOCUS_11830 2271 2131 gene locus_tag LOCUS_11840 2271 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 2770 2264 gene locus_tag LOCUS_11850 2770 2264 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399411.1 protein_id gnl|my_center|LOCUS_11850 3775 2816 gene locus_tag LOCUS_11860 3775 2816 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980238.1 protein_id gnl|my_center|LOCUS_11860 4220 3777 gene locus_tag LOCUS_11870 4220 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 5711 4461 gene locus_tag LOCUS_11880 gene gudB 5711 4461 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225170.1 protein_id gnl|my_center|LOCUS_11880 5999 5712 gene locus_tag LOCUS_11890 5999 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence059 49 1458 gene locus_tag LOCUS_11900 gene gndA 49 1458 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582611.1 protein_id gnl|my_center|LOCUS_11900 1458 2714 gene locus_tag LOCUS_11910 1458 2714 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777076.1 protein_id gnl|my_center|LOCUS_11910 3116 2733 gene locus_tag LOCUS_11920 3116 2733 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081696.1 protein_id gnl|my_center|LOCUS_11920 4348 3113 gene locus_tag LOCUS_11930 4348 3113 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008195104.1 protein_id gnl|my_center|LOCUS_11930 <5762 4345 gene locus_tag LOCUS_11940 <5762 4345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010865341.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence060 387 1181 gene locus_tag LOCUS_11950 387 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1578 1859 gene locus_tag LOCUS_11960 1578 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1905 2915 gene locus_tag LOCUS_11970 1905 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 2985 4484 gene locus_tag LOCUS_11980 2985 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 4563 5492 gene locus_tag LOCUS_11990 4563 5492 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence061 <1 635 gene locus_tag LOCUS_12000 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385788.1:ABC transporter permease 625 2970 gene locus_tag LOCUS_12010 625 2970 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_12010 4572 3007 gene locus_tag LOCUS_12020 4572 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 5449 4565 gene locus_tag LOCUS_12030 5449 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 >Feature sequence062 962 357 gene locus_tag LOCUS_12040 962 357 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966513.1 protein_id gnl|my_center|LOCUS_12040 1199 2266 gene locus_tag LOCUS_12050 1199 2266 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257568.1 protein_id gnl|my_center|LOCUS_12050 3552 2635 gene locus_tag LOCUS_12060 gene coxFIC1 3552 2635 CDS product Dot/Icm type IV secretion system effector CoxFIC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769896.1 protein_id gnl|my_center|LOCUS_12060 4341 3682 gene locus_tag LOCUS_12070 4341 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 4883 5386 gene locus_tag LOCUS_12080 4883 5386 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870109.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence063 545 988 gene locus_tag LOCUS_12090 545 988 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972203.1 protein_id gnl|my_center|LOCUS_12090 1143 1694 gene locus_tag LOCUS_12100 1143 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 1963 3987 gene locus_tag LOCUS_12110 1963 3987 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464000.1 protein_id gnl|my_center|LOCUS_12110 4427 5146 gene locus_tag LOCUS_12120 4427 5146 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265853.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence064 336 2615 gene locus_tag LOCUS_12130 gene pflB 336 2615 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056834.1 protein_id gnl|my_center|LOCUS_12130 2615 3340 gene locus_tag LOCUS_12140 gene pflA 2615 3340 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799649.1 protein_id gnl|my_center|LOCUS_12140 3374 4717 gene locus_tag LOCUS_12150 3374 4717 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688844.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence065 2 898 gene locus_tag LOCUS_12160 2 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1298 2539 gene locus_tag LOCUS_12170 1298 2539 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_12170 2621 4780 gene locus_tag LOCUS_12180 2621 4780 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869551.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence066 337 501 gene locus_tag LOCUS_12190 337 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 2434 1034 gene locus_tag LOCUS_12200 2434 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 4791 2452 gene locus_tag LOCUS_12210 4791 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence067 <1 1506 gene locus_tag LOCUS_12220 <1 1506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203504.1:ComEC/Rec2 family competence protein 1675 4848 gene locus_tag LOCUS_12230 1675 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence068 952 224 gene locus_tag LOCUS_12240 952 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 4107 958 gene locus_tag LOCUS_12250 4107 958 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962208.1 protein_id gnl|my_center|LOCUS_12250 4288 4818 gene locus_tag LOCUS_12260 4288 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence069 <1 611 gene locus_tag LOCUS_12270 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391755.1:DUF1177 domain-containing protein 608 1273 gene locus_tag LOCUS_12280 608 1273 CDS product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391756.1 protein_id gnl|my_center|LOCUS_12280 2800 1412 gene locus_tag LOCUS_12290 2800 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 4724 2949 gene locus_tag LOCUS_12300 4724 2949 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545652.1 protein_id gnl|my_center|LOCUS_12300 4887 4726 gene locus_tag LOCUS_12310 4887 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence070 242 123 gene locus_tag LOCUS_12320 242 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 976 407 gene locus_tag LOCUS_12330 976 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1220 2326 gene locus_tag LOCUS_12340 1220 2326 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184748160.1 protein_id gnl|my_center|LOCUS_12340 2663 2881 gene locus_tag LOCUS_12350 2663 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 2878 3792 gene locus_tag LOCUS_12360 2878 3792 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039958.1 protein_id gnl|my_center|LOCUS_12360 3801 4343 gene locus_tag LOCUS_12370 3801 4343 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence071 447 1709 gene locus_tag LOCUS_12380 447 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1702 3426 gene locus_tag LOCUS_12390 1702 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 3923 4243 gene locus_tag LOCUS_12400 3923 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence072 761 324 gene locus_tag LOCUS_12410 761 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 2140 839 gene locus_tag LOCUS_12420 2140 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 3393 2413 gene locus_tag LOCUS_12430 3393 2413 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044973.1 protein_id gnl|my_center|LOCUS_12430 3721 3566 gene locus_tag LOCUS_12440 3721 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 <4780 3718 gene locus_tag LOCUS_12450 <4780 3718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010990081.1:class 1 internalin InlJ >Feature sequence073 42 1058 gene locus_tag LOCUS_12460 42 1058 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545166.1 protein_id gnl|my_center|LOCUS_12460 1055 2473 gene locus_tag LOCUS_12470 1055 2473 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962735.1 protein_id gnl|my_center|LOCUS_12470 2522 3481 gene locus_tag LOCUS_12480 2522 3481 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986890.1 protein_id gnl|my_center|LOCUS_12480 3605 4336 gene locus_tag LOCUS_12490 3605 4336 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524570.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence074 1022 3958 gene locus_tag LOCUS_12500 1022 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 4086 4280 gene locus_tag LOCUS_12510 4086 4280 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546452.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence075 1263 160 gene locus_tag LOCUS_12520 gene ugpC 1263 160 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228038.1 protein_id gnl|my_center|LOCUS_12520 2053 1241 gene locus_tag LOCUS_12530 2053 1241 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_12530 2435 2121 gene locus_tag LOCUS_12540 2435 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 3763 2456 gene locus_tag LOCUS_12550 3763 2456 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256327.1 protein_id gnl|my_center|LOCUS_12550 3870 3945 gene locus_tag LOCUS_t00330 3870 3945 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4015 4090 gene locus_tag LOCUS_t00340 4015 4090 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4138 4213 gene locus_tag LOCUS_t00350 4138 4213 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4247 4318 gene locus_tag LOCUS_t00360 4247 4318 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4333 4411 gene locus_tag LOCUS_t00370 4333 4411 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence076 60 728 gene locus_tag LOCUS_12560 60 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 712 1035 gene locus_tag LOCUS_12570 712 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1013 1204 gene locus_tag LOCUS_12580 1013 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1206 1736 gene locus_tag LOCUS_12590 1206 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1738 2529 gene locus_tag LOCUS_12600 1738 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 2526 3272 gene locus_tag LOCUS_12610 2526 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 3303 3752 gene locus_tag LOCUS_12620 3303 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence077 2462 510 gene locus_tag LOCUS_12630 2462 510 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066875.1 protein_id gnl|my_center|LOCUS_12630 3272 2589 gene locus_tag LOCUS_12640 3272 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 4182 3505 gene locus_tag LOCUS_12650 4182 3505 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021737.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence078 118 381 gene locus_tag LOCUS_12660 118 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 388 2445 gene locus_tag LOCUS_12670 gene traD 388 2445 CDS product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173272813.1 protein_id gnl|my_center|LOCUS_12670 2442 3167 gene locus_tag LOCUS_12680 2442 3167 CDS product TIGR03747 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989289.1 protein_id gnl|my_center|LOCUS_12680 3232 3864 gene locus_tag LOCUS_12690 3232 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence079 918 340 gene locus_tag LOCUS_12700 918 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1599 1297 gene locus_tag LOCUS_12710 1599 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 2971 2087 gene locus_tag LOCUS_12720 2971 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3368 3213 gene locus_tag LOCUS_12730 3368 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 >Feature sequence080 2643 7 gene locus_tag LOCUS_12740 2643 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 3739 2648 gene locus_tag LOCUS_12750 3739 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 >Feature sequence081 <1 578 gene locus_tag LOCUS_12760 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391659.1:phosphatase PAP2 family protein 580 1806 gene locus_tag LOCUS_12770 580 1806 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_12770 3291 1822 gene locus_tag LOCUS_12780 3291 1822 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250240.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence082 <1 852 gene locus_tag LOCUS_12790 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083260.1:scyllo-inosose 3-dehydrogenase 971 2068 gene locus_tag LOCUS_12800 gene iolN 971 2068 CDS product 3-dehydro-scyllo-inosose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083262.1 protein_id gnl|my_center|LOCUS_12800 2084 2923 gene locus_tag LOCUS_12810 2084 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence083 241 873 gene locus_tag LOCUS_12820 241 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1382 1143 gene locus_tag LOCUS_12830 1382 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1413 2057 gene locus_tag LOCUS_12840 1413 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 3284 2415 gene locus_tag LOCUS_12850 3284 2415 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391836.1 protein_id gnl|my_center|LOCUS_12850 3670 3359 gene locus_tag LOCUS_12860 3670 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence084 1715 534 gene locus_tag LOCUS_12870 1715 534 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142358.1 protein_id gnl|my_center|LOCUS_12870 2805 2005 gene locus_tag LOCUS_12880 2805 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 <4015 3214 gene locus_tag LOCUS_12890 <4015 3214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007246357.1:ribokinase >Feature sequence085 >Feature sequence086 2477 699 gene locus_tag LOCUS_12900 2477 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 3802 3110 gene locus_tag LOCUS_12910 3802 3110 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920873.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence087 >Feature sequence088 <1 1183 gene locus_tag LOCUS_12920 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065292.1:DUF2341 domain-containing protein 1344 2828 gene locus_tag LOCUS_12930 1344 2828 CDS product IS701-like element ISRba4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921909.1 protein_id gnl|my_center|LOCUS_12930 2921 3667 gene locus_tag LOCUS_12940 2921 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence089 141 329 gene locus_tag LOCUS_12950 141 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 545 1789 gene locus_tag LOCUS_12960 gene ltrA 545 1789 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024495.1 protein_id gnl|my_center|LOCUS_12960 3303 2068 gene locus_tag LOCUS_12970 3303 2068 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989913.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence090 401 1375 gene locus_tag LOCUS_12980 401 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2016 1396 gene locus_tag LOCUS_12990 2016 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 2938 3090 gene locus_tag LOCUS_13000 2938 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence091 36 2606 gene locus_tag LOCUS_13010 36 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 2751 3371 gene locus_tag LOCUS_13020 2751 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence092 1046 594 gene locus_tag LOCUS_13030 1046 594 CDS product DUF1931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228706.1 protein_id gnl|my_center|LOCUS_13030 1907 1164 gene locus_tag LOCUS_13040 1907 1164 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770491.1 protein_id gnl|my_center|LOCUS_13040 3408 2158 gene locus_tag LOCUS_13050 3408 2158 CDS product App1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence093 50 1078 gene locus_tag LOCUS_13060 50 1078 CDS product IS630-like element ISDra3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197480514.1 protein_id gnl|my_center|LOCUS_13060 2433 1438 gene locus_tag LOCUS_13070 2433 1438 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582913.1 protein_id gnl|my_center|LOCUS_13070 3118 2426 gene locus_tag LOCUS_13080 3118 2426 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855686.1 protein_id gnl|my_center|LOCUS_13080 3673 3212 gene locus_tag LOCUS_13090 3673 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 >Feature sequence094 241 11 gene locus_tag LOCUS_13100 241 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1834 320 gene locus_tag LOCUS_13110 1834 320 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016217.1 protein_id gnl|my_center|LOCUS_13110 3219 1831 gene locus_tag LOCUS_13120 3219 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence095 1172 1351 gene locus_tag LOCUS_13130 1172 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1351 2256 gene locus_tag LOCUS_13140 1351 2256 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941295.1 protein_id gnl|my_center|LOCUS_13140 2256 2576 gene locus_tag LOCUS_13150 2256 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence096 1254 286 gene locus_tag LOCUS_13160 1254 286 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248640.1 protein_id gnl|my_center|LOCUS_13160 2017 1814 gene locus_tag LOCUS_13170 2017 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 2265 2014 gene locus_tag LOCUS_13180 2265 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 2882 2328 gene locus_tag LOCUS_13190 2882 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 3034 3390 gene locus_tag LOCUS_13200 3034 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence097 849 550 gene locus_tag LOCUS_13210 849 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1223 1002 gene locus_tag LOCUS_13220 1223 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1454 1627 gene locus_tag LOCUS_13230 1454 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1896 2198 gene locus_tag LOCUS_13240 1896 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 2188 3294 gene locus_tag LOCUS_13250 2188 3294 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence098 282 1061 gene locus_tag LOCUS_13260 282 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 3365 1077 gene locus_tag LOCUS_13270 3365 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence099 867 301 gene locus_tag LOCUS_13280 867 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1030 785 gene locus_tag LOCUS_13290 1030 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1191 2261 gene locus_tag LOCUS_13300 1191 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13300 2268 2894 gene locus_tag LOCUS_13310 2268 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13310 3587 3027 gene locus_tag LOCUS_13320 3587 3027 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058037.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence100 2904 1108 gene locus_tag LOCUS_13330 2904 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 3601 3005 gene locus_tag LOCUS_13340 3601 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence101 226 525 gene locus_tag LOCUS_13350 226 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1454 1269 gene locus_tag LOCUS_13360 1454 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1683 1483 gene locus_tag LOCUS_13370 1683 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 3081 1762 gene locus_tag LOCUS_13380 3081 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence102 2237 1236 gene locus_tag LOCUS_13390 2237 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 <3594 2609 gene locus_tag LOCUS_13400 <3594 2609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767027.1:glycoside hydrolase family 127 protein >Feature sequence103 >Feature sequence104 387 1850 gene locus_tag LOCUS_13410 gene istA 387 1850 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974233.1 protein_id gnl|my_center|LOCUS_13410 1850 2641 gene locus_tag LOCUS_13420 gene istB 1850 2641 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_13420 3188 2727 gene locus_tag LOCUS_13430 3188 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 >Feature sequence105 >Feature sequence106 1153 845 gene locus_tag LOCUS_13440 1153 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 2103 1591 gene locus_tag LOCUS_13450 2103 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 3006 2521 gene locus_tag LOCUS_13460 gene apcA 3006 2521 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056801.1 protein_id gnl|my_center|LOCUS_13460 3414 3145 gene locus_tag LOCUS_13470 3414 3145 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005397239.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence107 243 1079 gene locus_tag LOCUS_13480 243 1079 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867167.1 protein_id gnl|my_center|LOCUS_13480 1076 1522 gene locus_tag LOCUS_13490 1076 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 2392 1793 gene locus_tag LOCUS_13500 2392 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 2570 3376 gene locus_tag LOCUS_13510 2570 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence108 896 48 gene locus_tag LOCUS_13520 896 48 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064714.1 protein_id gnl|my_center|LOCUS_13520 2293 890 gene locus_tag LOCUS_13530 2293 890 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939561.1 protein_id gnl|my_center|LOCUS_13530 3408 2518 gene locus_tag LOCUS_13540 3408 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 >Feature sequence109 2674 98 gene locus_tag LOCUS_13550 2674 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 3229 2969 gene locus_tag LOCUS_13560 3229 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence110 649 1032 gene locus_tag LOCUS_13570 649 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1281 3194 gene locus_tag LOCUS_13580 1281 3194 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228675.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence111 1490 129 gene locus_tag LOCUS_13590 1490 129 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602551.1 protein_id gnl|my_center|LOCUS_13590 <3437 1490 gene locus_tag LOCUS_13600 <3437 1490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268660.1:RecQ family ATP-dependent DNA helicase >Feature sequence112 1182 232 gene locus_tag LOCUS_13610 gene arcC 1182 232 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251108.1 protein_id gnl|my_center|LOCUS_13610 1898 1206 gene locus_tag LOCUS_13620 gene glcC 1898 1206 CDS product transcriptional regulator GlcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115387.1 protein_id gnl|my_center|LOCUS_13620 2065 3102 gene locus_tag LOCUS_13630 gene thiL 2065 3102 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence113 1888 1142 gene locus_tag LOCUS_13640 gene fabG 1888 1142 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_13640 2825 2040 gene locus_tag LOCUS_13650 2825 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence114 766 1968 gene locus_tag LOCUS_13660 766 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1978 2811 gene locus_tag LOCUS_13670 1978 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 3288 2890 gene locus_tag LOCUS_13680 3288 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13680 >Feature sequence115 >Feature sequence116 <1 1211 gene locus_tag LOCUS_13690 <1 1211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209167.1:McrC family protein 1256 2512 gene locus_tag LOCUS_13700 1256 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 >Feature sequence117 <1 1065 gene locus_tag LOCUS_13710 <1 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927132.1:AI-2E family transporter 2740 1634 gene locus_tag LOCUS_13720 2740 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 3137 2940 gene locus_tag LOCUS_13730 3137 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence118 2569 2105 gene locus_tag LOCUS_13740 2569 2105 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967412.1 protein_id gnl|my_center|LOCUS_13740 3018 2764 gene locus_tag LOCUS_13750 3018 2764 CDS product DUF5372 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086024521.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence119 369 79 gene locus_tag LOCUS_13760 369 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 571 416 gene locus_tag LOCUS_13770 571 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 1071 934 gene locus_tag LOCUS_13780 1071 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1424 1071 gene locus_tag LOCUS_13790 1424 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 2301 1531 gene locus_tag LOCUS_13800 2301 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 2946 3158 gene locus_tag LOCUS_13810 2946 3158 CDS product DUF2281 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877811.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence120 622 113 gene locus_tag LOCUS_13820 622 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1905 652 gene locus_tag LOCUS_13830 1905 652 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457408.1 protein_id gnl|my_center|LOCUS_13830 2723 1986 gene locus_tag LOCUS_13840 2723 1986 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229188.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence121 >Feature sequence122 <1 1170 gene locus_tag LOCUS_13850 <1 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891154.1:AAA family ATPase 1163 2038 gene locus_tag LOCUS_13860 1163 2038 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948290.1 protein_id gnl|my_center|LOCUS_13860 2096 3088 gene locus_tag LOCUS_13870 2096 3088 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010044806.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence123 693 2981 gene locus_tag LOCUS_13880 693 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence124 237 449 gene locus_tag LOCUS_13890 237 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 669 1070 gene locus_tag LOCUS_13900 669 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1077 3077 gene locus_tag LOCUS_13910 1077 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence125 373 699 gene locus_tag LOCUS_13920 373 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 692 811 gene locus_tag LOCUS_13930 692 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 839 1207 gene locus_tag LOCUS_13940 839 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence126 1814 672 gene locus_tag LOCUS_13950 1814 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 >Feature sequence127 488 18 gene locus_tag LOCUS_13960 488 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence128 363 1061 gene locus_tag LOCUS_13970 363 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1107 2240 gene locus_tag LOCUS_13980 1107 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence129 <1 1486 gene locus_tag LOCUS_13990 <1 1486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003233433.1:serine/threonine protein kinase PrkA 1499 2023 gene locus_tag LOCUS_14000 1499 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 2159 2770 gene locus_tag LOCUS_14010 2159 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 2783 3025 gene locus_tag LOCUS_14020 2783 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence130 <1 815 gene locus_tag LOCUS_14030 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391569.1:phosphoglycerate dehydrogenase 925 2391 gene locus_tag LOCUS_14040 925 2391 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461267.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence131 <3022 2373 gene locus_tag LOCUS_14050 <3022 2373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531971.1:TetR/AcrR family transcriptional regulator >Feature sequence132 1339 614 gene locus_tag LOCUS_14060 1339 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1755 1324 gene locus_tag LOCUS_14070 1755 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 2566 1763 gene locus_tag LOCUS_14080 2566 1763 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937413.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence133 1559 2176 gene locus_tag LOCUS_14090 1559 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 2303 2136 gene locus_tag LOCUS_14100 2303 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 2427 2780 gene locus_tag LOCUS_14110 2427 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14110 >Feature sequence134 551 718 gene locus_tag LOCUS_14120 551 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1315 791 gene locus_tag LOCUS_14130 1315 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 2624 1320 gene locus_tag LOCUS_14140 2624 1320 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence135 712 2616 gene locus_tag LOCUS_14150 712 2616 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256833.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence136 937 368 gene locus_tag LOCUS_14160 937 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14160 2706 1147 gene locus_tag LOCUS_14170 gene istA 2706 1147 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189327688.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence137 252 1538 gene locus_tag LOCUS_14180 252 1538 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_14180 1667 1861 gene locus_tag LOCUS_14190 1667 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 2799 1876 gene locus_tag LOCUS_14200 gene moeB 2799 1876 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence138 886 605 gene locus_tag LOCUS_14210 886 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence139 768 1133 gene locus_tag LOCUS_14220 768 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 1670 1233 gene locus_tag LOCUS_14230 1670 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 2741 1881 gene locus_tag LOCUS_14240 2741 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence140 1385 381 gene locus_tag LOCUS_14250 1385 381 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216554.1 protein_id gnl|my_center|LOCUS_14250 <2921 1528 gene locus_tag LOCUS_14260 <2921 1528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056091.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence141 523 77 gene locus_tag LOCUS_14270 523 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1707 679 gene locus_tag LOCUS_14280 1707 679 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096185.1 protein_id gnl|my_center|LOCUS_14280 2202 1714 gene locus_tag LOCUS_14290 2202 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence142 >Feature sequence143 <1 760 gene locus_tag LOCUS_14300 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066467.1:anaerobic carbon-monoxide dehydrogenase catalytic subunit 792 2036 gene locus_tag LOCUS_14310 792 2036 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_14310 2316 2107 gene locus_tag LOCUS_14320 2316 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 2754 2434 gene locus_tag LOCUS_14330 2754 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence144 1538 858 gene locus_tag LOCUS_14340 gene cas5c 1538 858 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176707.1 protein_id gnl|my_center|LOCUS_14340 2824 1724 gene locus_tag LOCUS_14350 2824 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence145 1224 238 gene locus_tag LOCUS_14360 1224 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 2432 1278 gene locus_tag LOCUS_14370 gene neuC 2432 1278 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545909.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence146 >Feature sequence147 986 540 gene locus_tag LOCUS_14380 986 540 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582602.1 protein_id gnl|my_center|LOCUS_14380 <2778 1930 gene locus_tag LOCUS_14390 <2778 1930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974722.1:FAD binding domain-containing protein >Feature sequence148 560 213 gene locus_tag LOCUS_14400 560 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1036 698 gene locus_tag LOCUS_14410 1036 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1270 1058 gene locus_tag LOCUS_14420 1270 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1594 1400 gene locus_tag LOCUS_14430 1594 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 2275 1814 gene locus_tag LOCUS_14440 2275 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 2612 2289 gene locus_tag LOCUS_14450 2612 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 2742 2572 gene locus_tag LOCUS_14460 2742 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence149 1943 576 gene locus_tag LOCUS_14470 1943 576 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228344.1 protein_id gnl|my_center|LOCUS_14470 2452 1955 gene locus_tag LOCUS_14480 2452 1955 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402987.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence150 1738 920 gene locus_tag LOCUS_14490 1738 920 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_14490 2029 1829 gene locus_tag LOCUS_14500 2029 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 2204 2022 gene locus_tag LOCUS_14510 2204 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence151 494 895 gene locus_tag LOCUS_14520 494 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1158 2084 gene locus_tag LOCUS_14530 1158 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence152 1119 2246 gene locus_tag LOCUS_14540 1119 2246 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454080.1 protein_id gnl|my_center|LOCUS_14540 2388 2543 gene locus_tag LOCUS_14550 2388 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence153 95 388 gene locus_tag LOCUS_14560 95 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14560 1059 2150 gene locus_tag LOCUS_14570 1059 2150 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140387.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence154 1784 243 gene locus_tag LOCUS_14580 1784 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1933 1781 gene locus_tag LOCUS_14590 1933 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 2601 1930 gene locus_tag LOCUS_14600 2601 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence155 <1 877 gene locus_tag LOCUS_14610 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838467.1:sodium-dependent transporter >Feature sequence156 742 861 gene locus_tag LOCUS_14620 742 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 864 1712 gene locus_tag LOCUS_14630 864 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence157 132 341 gene locus_tag LOCUS_14640 132 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 429 1019 gene locus_tag LOCUS_14650 429 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1022 1705 gene locus_tag LOCUS_14660 1022 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1702 1947 gene locus_tag LOCUS_14670 1702 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1944 2150 gene locus_tag LOCUS_14680 1944 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 2147 2392 gene locus_tag LOCUS_14690 2147 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 2389 2634 gene locus_tag LOCUS_14700 2389 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence158 1750 533 gene locus_tag LOCUS_14710 1750 533 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_14710 2318 1737 gene locus_tag LOCUS_14720 2318 1737 CDS product IS607-like element IS1535 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404760.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence159 881 120 gene locus_tag LOCUS_14730 881 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1240 878 gene locus_tag LOCUS_14740 1240 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 <2661 1573 gene locus_tag LOCUS_14750 <2661 1573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022632.1:DEAD/DEAH box helicase >Feature sequence160 <1 1275 gene locus_tag LOCUS_14760 <1 1275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933392.1:DEAD/DEAH box helicase family protein 1407 1616 gene locus_tag LOCUS_14770 1407 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 1894 2235 gene locus_tag LOCUS_14780 1894 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence161 726 1427 gene locus_tag LOCUS_14790 726 1427 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814050.1 protein_id gnl|my_center|LOCUS_14790 1450 1941 gene locus_tag LOCUS_14800 1450 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1957 2124 gene locus_tag LOCUS_14810 1957 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2271 2501 gene locus_tag LOCUS_14820 2271 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence162 301 152 gene locus_tag LOCUS_14830 301 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1764 784 gene locus_tag LOCUS_14840 1764 784 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_14840 2530 1769 gene locus_tag LOCUS_14850 2530 1769 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930893.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence163 2576 87 gene locus_tag LOCUS_14860 2576 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence164 2491 941 gene locus_tag LOCUS_14870 2491 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 >Feature sequence165 >Feature sequence166 269 517 gene locus_tag LOCUS_14880 269 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 531 1490 gene locus_tag LOCUS_14890 531 1490 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919030.1 protein_id gnl|my_center|LOCUS_14890 1602 2408 gene locus_tag LOCUS_14900 1602 2408 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111408924.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence167 1094 261 gene locus_tag LOCUS_14910 1094 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 2147 1569 gene locus_tag LOCUS_14920 2147 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14920 >Feature sequence168 1654 296 gene locus_tag LOCUS_14930 1654 296 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089418476.1 protein_id gnl|my_center|LOCUS_14930 2413 2075 gene locus_tag LOCUS_14940 2413 2075 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005643896.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence169 213 410 gene locus_tag LOCUS_14950 213 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 415 1386 gene locus_tag LOCUS_14960 415 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 >Feature sequence170 720 391 gene locus_tag LOCUS_14970 720 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 879 730 gene locus_tag LOCUS_14980 879 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1181 876 gene locus_tag LOCUS_14990 1181 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1499 1711 gene locus_tag LOCUS_15000 1499 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1830 2057 gene locus_tag LOCUS_15010 1830 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 2203 2487 gene locus_tag LOCUS_15020 2203 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 >Feature sequence171 308 84 gene locus_tag LOCUS_15030 308 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 2241 670 gene locus_tag LOCUS_15040 2241 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence172 201 740 gene locus_tag LOCUS_15050 201 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 770 1921 gene locus_tag LOCUS_15060 770 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence173 419 946 gene locus_tag LOCUS_15070 419 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 950 1939 gene locus_tag LOCUS_15080 950 1939 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192760.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence174 405 283 gene locus_tag LOCUS_15090 405 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 539 378 gene locus_tag LOCUS_15100 539 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 726 532 gene locus_tag LOCUS_15110 726 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1135 719 gene locus_tag LOCUS_15120 1135 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1281 1135 gene locus_tag LOCUS_15130 1281 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 1775 1545 gene locus_tag LOCUS_15140 1775 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 2212 1790 gene locus_tag LOCUS_15150 2212 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence175 >Feature sequence176 144 458 gene locus_tag LOCUS_15160 144 458 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626089.1 protein_id gnl|my_center|LOCUS_15160 828 532 gene locus_tag LOCUS_15170 828 532 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190833654.1 protein_id gnl|my_center|LOCUS_15170 1063 821 gene locus_tag LOCUS_15180 1063 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1308 1529 gene locus_tag LOCUS_15190 1308 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1522 1848 gene locus_tag LOCUS_15200 1522 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence177 1162 806 gene locus_tag LOCUS_15210 1162 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1626 1159 gene locus_tag LOCUS_15220 gene ybeY 1626 1159 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392132.1 protein_id gnl|my_center|LOCUS_15220 <2577 1607 gene locus_tag LOCUS_15230 <2577 1607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392131.1:HDIG domain-containing protein >Feature sequence178 1934 2095 gene locus_tag LOCUS_15240 1934 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 2180 2443 gene locus_tag LOCUS_15250 2180 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence179 <1 1113 gene locus_tag LOCUS_15260 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211787.1:phage terminase large subunit 1228 2277 gene locus_tag LOCUS_15270 1228 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence180 1459 335 gene locus_tag LOCUS_15280 1459 335 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060762.1 protein_id gnl|my_center|LOCUS_15280 1973 1491 gene locus_tag LOCUS_15290 1973 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 2303 2019 gene locus_tag LOCUS_15300 2303 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 2470 2297 gene locus_tag LOCUS_15310 2470 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence181 1326 418 gene locus_tag LOCUS_15320 gene nifH 1326 418 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943447.1 protein_id gnl|my_center|LOCUS_15320 2353 1931 gene locus_tag LOCUS_15330 2353 1931 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence182 43 786 gene locus_tag LOCUS_15340 43 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1345 827 gene locus_tag LOCUS_15350 1345 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence183 1056 130 gene locus_tag LOCUS_15360 1056 130 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937860.1 protein_id gnl|my_center|LOCUS_15360 <2535 1057 gene locus_tag LOCUS_15370 <2535 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003411269.1:glycogen synthase GlgA >Feature sequence184 1023 40 gene locus_tag LOCUS_15380 1023 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1932 1120 gene locus_tag LOCUS_15390 1932 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 2289 2161 gene locus_tag LOCUS_15400 2289 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence185 <1 642 gene locus_tag LOCUS_15410 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258680.1:formylglycine-generating enzyme family protein 730 999 gene locus_tag LOCUS_15420 730 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1506 1132 gene locus_tag LOCUS_15430 1506 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence186 894 109 gene locus_tag LOCUS_15440 894 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1394 939 gene locus_tag LOCUS_15450 1394 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 2257 1502 gene locus_tag LOCUS_15460 2257 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence187 >Feature sequence188 >Feature sequence189 129 56 gene locus_tag LOCUS_t00380 129 56 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 588 214 gene locus_tag LOCUS_15470 588 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 813 1370 gene locus_tag LOCUS_15480 813 1370 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038393.1 protein_id gnl|my_center|LOCUS_15480 2135 1380 gene locus_tag LOCUS_15490 gene prmC 2135 1380 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266734.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence190 196 990 gene locus_tag LOCUS_15500 196 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1097 2107 gene locus_tag LOCUS_15510 1097 2107 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946516.1 protein_id gnl|my_center|LOCUS_15510