>Feature sequence001 1922 1320 gene locus_tag LOCUS_00010 gene purN 1922 1320 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938037.1 protein_id gnl|my_center|LOCUS_00010 2010 2873 gene locus_tag LOCUS_00020 2010 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2916 3446 gene locus_tag LOCUS_00030 2916 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3906 3487 gene locus_tag LOCUS_00040 3906 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4857 3967 gene locus_tag LOCUS_00050 gene sucD 4857 3967 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115178.1 protein_id gnl|my_center|LOCUS_00050 6039 4885 gene locus_tag LOCUS_00060 gene sucC 6039 4885 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109739.1 protein_id gnl|my_center|LOCUS_00060 6500 6075 gene locus_tag LOCUS_00070 6500 6075 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_00070 6912 6574 gene locus_tag LOCUS_00080 6912 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8473 6899 gene locus_tag LOCUS_00090 8473 6899 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_00090 10770 8476 gene locus_tag LOCUS_00100 gene pcrA 10770 8476 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_00100 10953 11492 gene locus_tag LOCUS_00110 10953 11492 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227090.1 protein_id gnl|my_center|LOCUS_00110 11500 12354 gene locus_tag LOCUS_00120 11500 12354 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115256.1 protein_id gnl|my_center|LOCUS_00120 13021 12368 gene locus_tag LOCUS_00130 gene elbB 13021 12368 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299134.1 protein_id gnl|my_center|LOCUS_00130 13584 13066 gene locus_tag LOCUS_00140 13584 13066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15206 13581 gene locus_tag LOCUS_00150 15206 13581 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660540.1 protein_id gnl|my_center|LOCUS_00150 16194 15211 gene locus_tag LOCUS_00160 16194 15211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17284 16175 gene locus_tag LOCUS_00170 gene cheB 17284 16175 CDS product chemotaxis-specific protein-glutamate methyltransferase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257541.1 protein_id gnl|my_center|LOCUS_00170 19753 17288 gene locus_tag LOCUS_00180 19753 17288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 20237 19764 gene locus_tag LOCUS_00190 20237 19764 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337487.1 protein_id gnl|my_center|LOCUS_00190 21867 20296 gene locus_tag LOCUS_00200 gene guaA 21867 20296 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_00200 23898 21991 gene locus_tag LOCUS_00210 23898 21991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 24927 24148 gene locus_tag LOCUS_00220 24927 24148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 26084 24927 gene locus_tag LOCUS_00230 26084 24927 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_00230 26406 28076 gene locus_tag LOCUS_00240 gene metG 26406 28076 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259302.1 protein_id gnl|my_center|LOCUS_00240 28743 28066 gene locus_tag LOCUS_00250 28743 28066 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189888.1 protein_id gnl|my_center|LOCUS_00250 30605 28962 gene locus_tag LOCUS_00260 gene groL 30605 28962 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_00260 30929 30642 gene locus_tag LOCUS_00270 gene groES 30929 30642 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974211.1 protein_id gnl|my_center|LOCUS_00270 31262 31471 gene locus_tag LOCUS_00280 31262 31471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 32631 31546 gene locus_tag LOCUS_00290 gene tsaD 32631 31546 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943403.1 protein_id gnl|my_center|LOCUS_00290 33176 32628 gene locus_tag LOCUS_00300 gene rimI 33176 32628 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817348.1 protein_id gnl|my_center|LOCUS_00300 33673 33173 gene locus_tag LOCUS_00310 33673 33173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34427 33867 gene locus_tag LOCUS_00320 gene tsaE 34427 33867 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393647.1 protein_id gnl|my_center|LOCUS_00320 35066 34434 gene locus_tag LOCUS_00330 35066 34434 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583745.1 protein_id gnl|my_center|LOCUS_00330 36193 35063 gene locus_tag LOCUS_00340 gene alr 36193 35063 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_00340 36663 36190 gene locus_tag LOCUS_00350 36663 36190 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057639.1 protein_id gnl|my_center|LOCUS_00350 38306 36771 gene locus_tag LOCUS_00360 38306 36771 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_00360 38753 38340 gene locus_tag LOCUS_00370 38753 38340 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_00370 40591 38750 gene locus_tag LOCUS_00380 gene glmS 40591 38750 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_00380 41127 41468 gene locus_tag LOCUS_00390 41127 41468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 42421 41513 gene locus_tag LOCUS_00400 gene ftcD 42421 41513 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836511.1 protein_id gnl|my_center|LOCUS_00400 42396 43262 gene locus_tag LOCUS_00410 42396 43262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 43259 44212 gene locus_tag LOCUS_00420 43259 44212 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259143.1 protein_id gnl|my_center|LOCUS_00420 44351 44587 gene locus_tag LOCUS_00430 44351 44587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 45385 44606 gene locus_tag LOCUS_00440 45385 44606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 47243 45456 gene locus_tag LOCUS_00450 47243 45456 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222225.1 protein_id gnl|my_center|LOCUS_00450 47424 48473 gene locus_tag LOCUS_00460 47424 48473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 49373 48492 gene locus_tag LOCUS_00470 49373 48492 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525363.1 protein_id gnl|my_center|LOCUS_00470 50168 49395 gene locus_tag LOCUS_00480 gene pstB 50168 49395 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974830.1 protein_id gnl|my_center|LOCUS_00480 51129 50218 gene locus_tag LOCUS_00490 gene pstA 51129 50218 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582861.1 protein_id gnl|my_center|LOCUS_00490 52151 51126 gene locus_tag LOCUS_00500 gene pstC 52151 51126 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140449.1 protein_id gnl|my_center|LOCUS_00500 53455 52286 gene locus_tag LOCUS_00510 gene pstS 53455 52286 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582618.1 protein_id gnl|my_center|LOCUS_00510 54307 53639 gene locus_tag LOCUS_00520 gene phoU 54307 53639 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_00520 54394 55713 gene locus_tag LOCUS_00530 54394 55713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 55780 56469 gene locus_tag LOCUS_00540 55780 56469 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_00540 57863 56466 gene locus_tag LOCUS_00550 57863 56466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 59388 58033 gene locus_tag LOCUS_00560 gene glmM 59388 58033 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 protein_id gnl|my_center|LOCUS_00560 59827 59435 gene locus_tag LOCUS_00570 59827 59435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 60291 59827 gene locus_tag LOCUS_00580 gene rplM 60291 59827 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939788.1 protein_id gnl|my_center|LOCUS_00580 60456 60962 gene locus_tag LOCUS_00590 60456 60962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 61052 62596 gene locus_tag LOCUS_00600 61052 62596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 62645 63136 gene locus_tag LOCUS_00610 gene mce 62645 63136 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_00610 63133 65406 gene locus_tag LOCUS_00620 63133 65406 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096977.1 protein_id gnl|my_center|LOCUS_00620 65757 65410 gene locus_tag LOCUS_00630 65757 65410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 65854 66546 gene locus_tag LOCUS_00640 65854 66546 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408266.1 protein_id gnl|my_center|LOCUS_00640 66543 67202 gene locus_tag LOCUS_00650 66543 67202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 67199 67735 gene locus_tag LOCUS_00660 67199 67735 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401643.1 protein_id gnl|my_center|LOCUS_00660 67732 68886 gene locus_tag LOCUS_00670 67732 68886 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900904.1 protein_id gnl|my_center|LOCUS_00670 69520 68891 gene locus_tag LOCUS_00680 gene truA 69520 68891 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854437.1 protein_id gnl|my_center|LOCUS_00680 70029 69652 gene locus_tag LOCUS_00690 70029 69652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 71099 70032 gene locus_tag LOCUS_00700 71099 70032 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055961.1 protein_id gnl|my_center|LOCUS_00700 71729 71103 gene locus_tag LOCUS_00710 gene rpsD 71729 71103 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_00710 72131 71733 gene locus_tag LOCUS_00720 gene rpsK 72131 71733 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908645.1 protein_id gnl|my_center|LOCUS_00720 72528 72148 gene locus_tag LOCUS_00730 gene rpsM 72528 72148 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285908.1 protein_id gnl|my_center|LOCUS_00730 72932 72711 gene locus_tag LOCUS_00740 gene infA 72932 72711 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558881.1 protein_id gnl|my_center|LOCUS_00740 73834 73085 gene locus_tag LOCUS_00750 gene map 73834 73085 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_00750 74532 73870 gene locus_tag LOCUS_00760 74532 73870 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029826.1 protein_id gnl|my_center|LOCUS_00760 75830 74529 gene locus_tag LOCUS_00770 gene secY 75830 74529 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222619.1 protein_id gnl|my_center|LOCUS_00770 76391 75861 gene locus_tag LOCUS_00780 gene rplO 76391 75861 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776358.1 protein_id gnl|my_center|LOCUS_00780 76573 76388 gene locus_tag LOCUS_00790 gene rpmD 76573 76388 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222615.1 protein_id gnl|my_center|LOCUS_00790 77271 76570 gene locus_tag LOCUS_00800 77271 76570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 77722 77357 gene locus_tag LOCUS_00810 gene rplR 77722 77357 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055951.1 protein_id gnl|my_center|LOCUS_00810 78335 77790 gene locus_tag LOCUS_00820 gene rplF 78335 77790 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_00820 78767 78360 gene locus_tag LOCUS_00830 gene rpsH 78767 78360 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974254.1 protein_id gnl|my_center|LOCUS_00830 78962 78777 gene locus_tag LOCUS_00840 78962 78777 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_00840 79558 78992 gene locus_tag LOCUS_00850 gene rplE 79558 78992 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_00850 79857 79555 gene locus_tag LOCUS_00860 gene rplX 79857 79555 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_00860 80261 79893 gene locus_tag LOCUS_00870 gene rplN 80261 79893 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055680.1 protein_id gnl|my_center|LOCUS_00870 80546 80265 gene locus_tag LOCUS_00880 gene rpsQ 80546 80265 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_00880 80992 80573 gene locus_tag LOCUS_00890 80992 80573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 81405 80992 gene locus_tag LOCUS_00900 gene rplP 81405 80992 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_00900 82395 81409 gene locus_tag LOCUS_00910 gene rpsC 82395 81409 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403590.1 protein_id gnl|my_center|LOCUS_00910 82781 82413 gene locus_tag LOCUS_00920 gene rplV 82781 82413 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854297.1 protein_id gnl|my_center|LOCUS_00920 83065 82787 gene locus_tag LOCUS_00930 gene rpsS 83065 82787 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102083.1 protein_id gnl|my_center|LOCUS_00930 83913 83077 gene locus_tag LOCUS_00940 gene rplB 83913 83077 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776374.1 protein_id gnl|my_center|LOCUS_00940 84218 83916 gene locus_tag LOCUS_00950 84218 83916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 84955 84215 gene locus_tag LOCUS_00960 gene rplD 84955 84215 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_00960 85616 84948 gene locus_tag LOCUS_00970 gene rplC 85616 84948 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403579.1 protein_id gnl|my_center|LOCUS_00970 85994 85665 gene locus_tag LOCUS_00980 gene rpsJ 85994 85665 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_00980 87262 86075 gene locus_tag LOCUS_00990 gene tuf 87262 86075 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 protein_id gnl|my_center|LOCUS_00990 89448 87298 gene locus_tag LOCUS_01000 gene fusA 89448 87298 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_01000 90023 89553 gene locus_tag LOCUS_01010 gene rpsG 90023 89553 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403456.1 protein_id gnl|my_center|LOCUS_01010 90400 90026 gene locus_tag LOCUS_01020 gene rpsL 90400 90026 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854221.1 protein_id gnl|my_center|LOCUS_01020 94746 90748 gene locus_tag LOCUS_01030 94746 90748 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222587.1 protein_id gnl|my_center|LOCUS_01030 98179 94802 gene locus_tag LOCUS_01040 gene rpoB 98179 94802 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_01040 98705 98319 gene locus_tag LOCUS_01050 gene rplL 98705 98319 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112006.1 protein_id gnl|my_center|LOCUS_01050 99385 98717 gene locus_tag LOCUS_01060 99385 98717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 102714 99673 gene locus_tag LOCUS_01070 102714 99673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 106336 102941 gene locus_tag LOCUS_01080 106336 102941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 106562 108544 gene locus_tag LOCUS_01090 gene acs 106562 108544 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_01090 108593 110377 gene locus_tag LOCUS_01100 108593 110377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 111089 110385 gene locus_tag LOCUS_01110 gene rplA 111089 110385 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_01110 111582 111157 gene locus_tag LOCUS_01120 gene rplK 111582 111157 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548197.1 protein_id gnl|my_center|LOCUS_01120 112604 111609 gene locus_tag LOCUS_01130 112604 111609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 112897 112601 gene locus_tag LOCUS_01140 112897 112601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 113028 112954 gene locus_tag LOCUS_t00010 113028 112954 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 113175 114086 gene locus_tag LOCUS_01150 113175 114086 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229709.1 protein_id gnl|my_center|LOCUS_01150 114121 115500 gene locus_tag LOCUS_01160 114121 115500 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_01160 116203 115517 gene locus_tag LOCUS_01170 116203 115517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 116668 116958 gene locus_tag LOCUS_01180 116668 116958 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003835265.1 protein_id gnl|my_center|LOCUS_01180 118504 117029 gene locus_tag LOCUS_01190 118504 117029 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_01190 119411 118554 gene locus_tag LOCUS_01200 119411 118554 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582599.1 protein_id gnl|my_center|LOCUS_01200 119519 120229 gene locus_tag LOCUS_01210 119519 120229 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_01210 120397 123144 gene locus_tag LOCUS_01220 120397 123144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 125396 123132 gene locus_tag LOCUS_01230 125396 123132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 126493 125360 gene locus_tag LOCUS_01240 126493 125360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 127509 126499 gene locus_tag LOCUS_01250 127509 126499 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_01250 128357 127533 gene locus_tag LOCUS_01260 128357 127533 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763632.1 protein_id gnl|my_center|LOCUS_01260 129633 128365 gene locus_tag LOCUS_01270 129633 128365 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_01270 130439 129630 gene locus_tag LOCUS_01280 130439 129630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 130906 130640 gene locus_tag LOCUS_01290 130906 130640 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223016.1 protein_id gnl|my_center|LOCUS_01290 131924 130959 gene locus_tag LOCUS_01300 131924 130959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 132065 133198 gene locus_tag LOCUS_01310 132065 133198 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087110.1 protein_id gnl|my_center|LOCUS_01310 133234 134628 gene locus_tag LOCUS_01320 133234 134628 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054423.1 protein_id gnl|my_center|LOCUS_01320 135171 134584 gene locus_tag LOCUS_01330 135171 134584 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_01330 137015 135285 gene locus_tag LOCUS_01340 137015 135285 CDS product DUF255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289401.1 protein_id gnl|my_center|LOCUS_01340 137256 139931 gene locus_tag LOCUS_01350 gene acnA 137256 139931 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 protein_id gnl|my_center|LOCUS_01350 140855 140043 gene locus_tag LOCUS_01360 140855 140043 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029786.1 protein_id gnl|my_center|LOCUS_01360 140956 141309 gene locus_tag LOCUS_01370 140956 141309 CDS product iron chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921246.1 protein_id gnl|my_center|LOCUS_01370 142015 141371 gene locus_tag LOCUS_01380 142015 141371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 142186 143145 gene locus_tag LOCUS_01390 142186 143145 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919443.1 protein_id gnl|my_center|LOCUS_01390 143239 143619 gene locus_tag LOCUS_01400 143239 143619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 143609 144043 gene locus_tag LOCUS_01410 143609 144043 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250661.1 protein_id gnl|my_center|LOCUS_01410 144810 144079 gene locus_tag LOCUS_01420 144810 144079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 145106 144885 gene locus_tag LOCUS_01430 145106 144885 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391794.1 protein_id gnl|my_center|LOCUS_01430 145303 145103 gene locus_tag LOCUS_01440 145303 145103 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391793.1 protein_id gnl|my_center|LOCUS_01440 145868 146080 gene locus_tag LOCUS_01450 145868 146080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 146859 146101 gene locus_tag LOCUS_01460 146859 146101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 147596 146868 gene locus_tag LOCUS_01470 147596 146868 CDS product TIGR02391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189846505.1 protein_id gnl|my_center|LOCUS_01470 >Feature sequence002 2023 1127 gene locus_tag LOCUS_01480 gene dapF 2023 1127 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157609.1 protein_id gnl|my_center|LOCUS_01480 3084 2020 gene locus_tag LOCUS_01490 gene miaA 3084 2020 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804679.1 protein_id gnl|my_center|LOCUS_01490 4462 3077 gene locus_tag LOCUS_01500 gene miaB 4462 3077 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_01500 6128 4452 gene locus_tag LOCUS_01510 gene rny 6128 4452 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986783.1 protein_id gnl|my_center|LOCUS_01510 6608 7672 gene locus_tag LOCUS_01520 gene recA 6608 7672 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057169.1 protein_id gnl|my_center|LOCUS_01520 8335 7718 gene locus_tag LOCUS_01530 8335 7718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 9563 8328 gene locus_tag LOCUS_01540 9563 8328 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_01540 10360 9584 gene locus_tag LOCUS_01550 10360 9584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 10537 12114 gene locus_tag LOCUS_01560 10537 12114 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_01560 12159 12599 gene locus_tag LOCUS_01570 12159 12599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 15398 12624 gene locus_tag LOCUS_01580 15398 12624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 16393 15443 gene locus_tag LOCUS_01590 16393 15443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 16456 16956 gene locus_tag LOCUS_01600 16456 16956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 17506 16991 gene locus_tag LOCUS_01610 17506 16991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 19936 17567 gene locus_tag LOCUS_01620 19936 17567 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228076.1 protein_id gnl|my_center|LOCUS_01620 21794 20127 gene locus_tag LOCUS_01630 21794 20127 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_01630 22701 21802 gene locus_tag LOCUS_01640 gene dapA 22701 21802 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_01640 23171 23560 gene locus_tag LOCUS_01650 23171 23560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 23557 24288 gene locus_tag LOCUS_01660 23557 24288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 24905 24315 gene locus_tag LOCUS_01670 24905 24315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 25693 24941 gene locus_tag LOCUS_01680 25693 24941 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_01680 26007 25795 gene locus_tag LOCUS_01690 26007 25795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 26259 27281 gene locus_tag LOCUS_01700 26259 27281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 27345 28826 gene locus_tag LOCUS_01710 gene glpK 27345 28826 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_01710 29608 28856 gene locus_tag LOCUS_01720 29608 28856 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908001.1 protein_id gnl|my_center|LOCUS_01720 29755 30522 gene locus_tag LOCUS_01730 29755 30522 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_01730 30573 31217 gene locus_tag LOCUS_01740 30573 31217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 32152 31208 gene locus_tag LOCUS_01750 gene alaC 32152 31208 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546347.1 protein_id gnl|my_center|LOCUS_01750 32204 32362 gene locus_tag LOCUS_01760 32204 32362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 32568 32861 gene locus_tag LOCUS_01770 32568 32861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 33608 32862 gene locus_tag LOCUS_01780 33608 32862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 34063 33605 gene locus_tag LOCUS_01790 34063 33605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 35032 34076 gene locus_tag LOCUS_01800 35032 34076 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_01800 35360 35061 gene locus_tag LOCUS_01810 35360 35061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 36740 35586 gene locus_tag LOCUS_01820 36740 35586 CDS product eukaryotic peptide chain release factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880076.1 protein_id gnl|my_center|LOCUS_01820 39243 36733 gene locus_tag LOCUS_01830 gene lon 39243 36733 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_01830 39755 39348 gene locus_tag LOCUS_01840 39755 39348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 40934 39774 gene locus_tag LOCUS_01850 40934 39774 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041244756.1 protein_id gnl|my_center|LOCUS_01850 41371 40931 gene locus_tag LOCUS_01860 41371 40931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 42449 41436 gene locus_tag LOCUS_01870 42449 41436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 42365 42580 gene locus_tag LOCUS_01880 42365 42580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 43807 42671 gene locus_tag LOCUS_01890 gene queG 43807 42671 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245522.1 protein_id gnl|my_center|LOCUS_01890 44419 43838 gene locus_tag LOCUS_01900 44419 43838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 44525 44944 gene locus_tag LOCUS_01910 44525 44944 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868448.1 protein_id gnl|my_center|LOCUS_01910 46089 44947 gene locus_tag LOCUS_01920 46089 44947 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_01920 46400 46134 gene locus_tag LOCUS_01930 46400 46134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 46535 47956 gene locus_tag LOCUS_01940 46535 47956 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728383.1 protein_id gnl|my_center|LOCUS_01940 49014 47965 gene locus_tag LOCUS_01950 gene trpD 49014 47965 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257622.1 protein_id gnl|my_center|LOCUS_01950 50165 49002 gene locus_tag LOCUS_01960 50165 49002 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064857.1 protein_id gnl|my_center|LOCUS_01960 50511 50278 gene locus_tag LOCUS_01970 50511 50278 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971835.1 protein_id gnl|my_center|LOCUS_01970 51579 50761 gene locus_tag LOCUS_01980 51579 50761 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_01980 53705 51744 gene locus_tag LOCUS_01990 53705 51744 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086208.1 protein_id gnl|my_center|LOCUS_01990 53878 53702 gene locus_tag LOCUS_02000 53878 53702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 54895 53990 gene locus_tag LOCUS_02010 54895 53990 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680288.1 protein_id gnl|my_center|LOCUS_02010 56462 54957 gene locus_tag LOCUS_02020 56462 54957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 58158 56692 gene locus_tag LOCUS_02030 58158 56692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 58369 60030 gene locus_tag LOCUS_02040 58369 60030 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222839.1 protein_id gnl|my_center|LOCUS_02040 60263 61585 gene locus_tag LOCUS_02050 60263 61585 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878369.1 protein_id gnl|my_center|LOCUS_02050 61609 63201 gene locus_tag LOCUS_02060 61609 63201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 63868 64803 gene locus_tag LOCUS_02070 gene fba1 63868 64803 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902472.1 protein_id gnl|my_center|LOCUS_02070 64822 65862 gene locus_tag LOCUS_02080 64822 65862 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_02080 65918 66982 gene locus_tag LOCUS_02090 65918 66982 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258073.1 protein_id gnl|my_center|LOCUS_02090 67411 67025 gene locus_tag LOCUS_02100 67411 67025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 68166 67543 gene locus_tag LOCUS_02110 68166 67543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 68687 68166 gene locus_tag LOCUS_02120 68687 68166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 69121 68684 gene locus_tag LOCUS_02130 69121 68684 CDS product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546858.1 protein_id gnl|my_center|LOCUS_02130 69887 69156 gene locus_tag LOCUS_02140 69887 69156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 72158 69996 gene locus_tag LOCUS_02150 72158 69996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 73552 72290 gene locus_tag LOCUS_02160 73552 72290 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727016.1 protein_id gnl|my_center|LOCUS_02160 73878 75419 gene locus_tag LOCUS_02170 73878 75419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 75537 76439 gene locus_tag LOCUS_02180 75537 76439 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526290.1 protein_id gnl|my_center|LOCUS_02180 76439 78634 gene locus_tag LOCUS_02190 76439 78634 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247367.1 protein_id gnl|my_center|LOCUS_02190 78647 79420 gene locus_tag LOCUS_02200 78647 79420 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_02200 79865 79440 gene locus_tag LOCUS_02210 79865 79440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 80487 79876 gene locus_tag LOCUS_02220 gene leuD 80487 79876 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222556.1 protein_id gnl|my_center|LOCUS_02220 81914 80484 gene locus_tag LOCUS_02230 gene leuC 81914 80484 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973442.1 protein_id gnl|my_center|LOCUS_02230 82189 82929 gene locus_tag LOCUS_02240 82189 82929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 83713 82838 gene locus_tag LOCUS_02250 83713 82838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 84082 85032 gene locus_tag LOCUS_02260 84082 85032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 85025 86407 gene locus_tag LOCUS_02270 gene dnaB 85025 86407 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112283.1 protein_id gnl|my_center|LOCUS_02270 86400 86816 gene locus_tag LOCUS_02280 86400 86816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 87306 87854 gene locus_tag LOCUS_02290 87306 87854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 87856 88131 gene locus_tag LOCUS_02300 87856 88131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 88238 88678 gene locus_tag LOCUS_02310 88238 88678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 88675 88941 gene locus_tag LOCUS_02320 88675 88941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 89118 89561 gene locus_tag LOCUS_02330 89118 89561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 89551 89754 gene locus_tag LOCUS_02340 89551 89754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 89751 90482 gene locus_tag LOCUS_02350 89751 90482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 90787 90563 gene locus_tag LOCUS_02360 90787 90563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 91989 90883 gene locus_tag LOCUS_02370 91989 90883 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_02370 92477 91986 gene locus_tag LOCUS_02380 92477 91986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 92703 92631 gene locus_tag LOCUS_t00020 92703 92631 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 93163 92813 gene locus_tag LOCUS_02390 93163 92813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 93389 93216 gene locus_tag LOCUS_02400 93389 93216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 93516 94091 gene locus_tag LOCUS_02410 93516 94091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 95492 94098 gene locus_tag LOCUS_02420 95492 94098 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082990.1 protein_id gnl|my_center|LOCUS_02420 95829 95521 gene locus_tag LOCUS_02430 95829 95521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 97710 95968 gene locus_tag LOCUS_02440 97710 95968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 98752 97715 gene locus_tag LOCUS_02450 98752 97715 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533083.1 protein_id gnl|my_center|LOCUS_02450 99252 101570 gene locus_tag LOCUS_02460 99252 101570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02460 102080 101616 gene locus_tag LOCUS_02470 102080 101616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 102831 102127 gene locus_tag LOCUS_02480 102831 102127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 104196 102925 gene locus_tag LOCUS_02490 104196 102925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 105636 104200 gene locus_tag LOCUS_02500 gene lnt 105636 104200 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226566.1 protein_id gnl|my_center|LOCUS_02500 106301 105861 gene locus_tag LOCUS_02510 106301 105861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 108415 106757 gene locus_tag LOCUS_02520 108415 106757 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_02520 110591 108417 gene locus_tag LOCUS_02530 110591 108417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 111906 110575 gene locus_tag LOCUS_02540 111906 110575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 112698 111925 gene locus_tag LOCUS_02550 gene tatC 112698 111925 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227900.1 protein_id gnl|my_center|LOCUS_02550 113043 112711 gene locus_tag LOCUS_02560 113043 112711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 113431 112976 gene locus_tag LOCUS_02570 113431 112976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 113653 115683 gene locus_tag LOCUS_02580 113653 115683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 117166 115712 gene locus_tag LOCUS_02590 117166 115712 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226019.1 protein_id gnl|my_center|LOCUS_02590 118128 117163 gene locus_tag LOCUS_02600 118128 117163 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080095.1 protein_id gnl|my_center|LOCUS_02600 119078 118125 gene locus_tag LOCUS_02610 119078 118125 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410775.1 protein_id gnl|my_center|LOCUS_02610 120583 119156 gene locus_tag LOCUS_02620 gene pafA 120583 119156 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_02620 120518 120754 gene locus_tag LOCUS_02630 120518 120754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 121351 120671 gene locus_tag LOCUS_02640 gene prcA 121351 120671 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_02640 122289 121348 gene locus_tag LOCUS_02650 gene prcB 122289 121348 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_02650 122490 122296 gene locus_tag LOCUS_02660 122490 122296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 124111 122636 gene locus_tag LOCUS_02670 gene dop 124111 122636 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_02670 125871 124129 gene locus_tag LOCUS_02680 gene arc 125871 124129 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_02680 126178 126411 gene locus_tag LOCUS_02690 126178 126411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 127248 126457 gene locus_tag LOCUS_02700 127248 126457 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_02700 128068 127241 gene locus_tag LOCUS_02710 128068 127241 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584019.1 protein_id gnl|my_center|LOCUS_02710 128364 128164 gene locus_tag LOCUS_02720 128364 128164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 128670 128470 gene locus_tag LOCUS_02730 128670 128470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 128923 128720 gene locus_tag LOCUS_02740 128923 128720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 129239 128916 gene locus_tag LOCUS_02750 129239 128916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 130734 129319 gene locus_tag LOCUS_02760 130734 129319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 131214 130819 gene locus_tag LOCUS_02770 131214 130819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 131428 131249 gene locus_tag LOCUS_02780 131428 131249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 131547 132767 gene locus_tag LOCUS_02790 131547 132767 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_02790 132877 133737 gene locus_tag LOCUS_02800 132877 133737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223088.1 protein_id gnl|my_center|LOCUS_02800 133734 134405 gene locus_tag LOCUS_02810 133734 134405 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080706.1 protein_id gnl|my_center|LOCUS_02810 134402 135352 gene locus_tag LOCUS_02820 134402 135352 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942288.1 protein_id gnl|my_center|LOCUS_02820 135295 136023 gene locus_tag LOCUS_02830 135295 136023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 136156 136701 gene locus_tag LOCUS_02840 136156 136701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 136698 137111 gene locus_tag LOCUS_02850 136698 137111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 140024 137136 gene locus_tag LOCUS_02860 140024 137136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 140136 141389 gene locus_tag LOCUS_02870 140136 141389 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088379.1 protein_id gnl|my_center|LOCUS_02870 141456 142259 gene locus_tag LOCUS_02880 141456 142259 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467188.1 protein_id gnl|my_center|LOCUS_02880 143412 142303 gene locus_tag LOCUS_02890 143412 142303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 143619 144380 gene locus_tag LOCUS_02900 143619 144380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 145449 144400 gene locus_tag LOCUS_02910 145449 144400 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_02910 147044 145446 gene locus_tag LOCUS_02920 147044 145446 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_02920 >Feature sequence003 177 497 gene locus_tag LOCUS_02930 177 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 2329 494 gene locus_tag LOCUS_02940 2329 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 2480 2980 gene locus_tag LOCUS_02950 2480 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 3312 6311 gene locus_tag LOCUS_02960 3312 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 6743 6336 gene locus_tag LOCUS_02970 6743 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 7187 6789 gene locus_tag LOCUS_02980 7187 6789 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809248.1 protein_id gnl|my_center|LOCUS_02980 7239 7388 gene locus_tag LOCUS_02990 7239 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 8819 7338 gene locus_tag LOCUS_03000 gene trpE 8819 7338 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_03000 9163 8816 gene locus_tag LOCUS_03010 9163 8816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 9980 9210 gene locus_tag LOCUS_03020 gene hisF 9980 9210 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404312.1 protein_id gnl|my_center|LOCUS_03020 10696 9974 gene locus_tag LOCUS_03030 gene hisA 10696 9974 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337342.1 protein_id gnl|my_center|LOCUS_03030 11283 10693 gene locus_tag LOCUS_03040 gene hisH 11283 10693 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023176026.1 protein_id gnl|my_center|LOCUS_03040 11870 11280 gene locus_tag LOCUS_03050 gene hisB 11870 11280 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537957.1 protein_id gnl|my_center|LOCUS_03050 12931 11870 gene locus_tag LOCUS_03060 12931 11870 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976762.1 protein_id gnl|my_center|LOCUS_03060 14184 12928 gene locus_tag LOCUS_03070 gene hisD 14184 12928 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058085.1 protein_id gnl|my_center|LOCUS_03070 14276 15193 gene locus_tag LOCUS_03080 14276 15193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 15190 16908 gene locus_tag LOCUS_03090 15190 16908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 17530 17009 gene locus_tag LOCUS_03100 17530 17009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 18258 17605 gene locus_tag LOCUS_03110 gene nth 18258 17605 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_03110 18525 19100 gene locus_tag LOCUS_03120 18525 19100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 19550 19104 gene locus_tag LOCUS_03130 19550 19104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 20562 19594 gene locus_tag LOCUS_03140 20562 19594 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223508.1 protein_id gnl|my_center|LOCUS_03140 21674 20562 gene locus_tag LOCUS_03150 21674 20562 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767735.1 protein_id gnl|my_center|LOCUS_03150 21832 22593 gene locus_tag LOCUS_03160 21832 22593 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113959.1 protein_id gnl|my_center|LOCUS_03160 25174 22586 gene locus_tag LOCUS_03170 25174 22586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 25261 25614 gene locus_tag LOCUS_03180 25261 25614 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_03180 26017 25616 gene locus_tag LOCUS_03190 26017 25616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 26261 26620 gene locus_tag LOCUS_03200 26261 26620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 26870 26592 gene locus_tag LOCUS_03210 26870 26592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 27791 27459 gene locus_tag LOCUS_03220 27791 27459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 28952 28545 gene locus_tag LOCUS_03230 28952 28545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 29642 29436 gene locus_tag LOCUS_03240 29642 29436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 29670 29831 gene locus_tag LOCUS_03250 29670 29831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 29901 30215 gene locus_tag LOCUS_03260 29901 30215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 30218 30619 gene locus_tag LOCUS_03270 30218 30619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 32871 30631 gene locus_tag LOCUS_03280 32871 30631 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_03280 32920 33357 gene locus_tag LOCUS_03290 32920 33357 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381519.1 protein_id gnl|my_center|LOCUS_03290 33555 34127 gene locus_tag LOCUS_03300 33555 34127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 34752 34525 gene locus_tag LOCUS_03310 34752 34525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 35118 34795 gene locus_tag LOCUS_03320 35118 34795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 36520 35276 gene locus_tag LOCUS_03330 36520 35276 CDS product IS256-like element IS1081 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901078.1 protein_id gnl|my_center|LOCUS_03330 37292 36873 gene locus_tag LOCUS_03340 37292 36873 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141677.1 protein_id gnl|my_center|LOCUS_03340 37669 37289 gene locus_tag LOCUS_03350 37669 37289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 37932 38702 gene locus_tag LOCUS_03360 37932 38702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 38994 39461 gene locus_tag LOCUS_03370 38994 39461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 39771 40133 gene locus_tag LOCUS_03380 39771 40133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 41408 40110 gene locus_tag LOCUS_03390 41408 40110 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068319765.1 protein_id gnl|my_center|LOCUS_03390 42659 41550 gene locus_tag LOCUS_03400 42659 41550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249548.1 protein_id gnl|my_center|LOCUS_03400 43585 42656 gene locus_tag LOCUS_03410 43585 42656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 43875 43585 gene locus_tag LOCUS_03420 43875 43585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 46553 43872 gene locus_tag LOCUS_03430 46553 43872 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908140.1 protein_id gnl|my_center|LOCUS_03430 47713 46550 gene locus_tag LOCUS_03440 47713 46550 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730251.1 protein_id gnl|my_center|LOCUS_03440 50166 47869 gene locus_tag LOCUS_03450 50166 47869 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083531262.1 protein_id gnl|my_center|LOCUS_03450 54163 50309 gene locus_tag LOCUS_03460 54163 50309 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_03460 57117 54166 gene locus_tag LOCUS_03470 57117 54166 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_03470 62384 57114 gene locus_tag LOCUS_03480 62384 57114 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 protein_id gnl|my_center|LOCUS_03480 62636 64066 gene locus_tag LOCUS_03490 62636 64066 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412926.1 protein_id gnl|my_center|LOCUS_03490 64079 64555 gene locus_tag LOCUS_03500 64079 64555 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899362.1 protein_id gnl|my_center|LOCUS_03500 66535 64628 gene locus_tag LOCUS_03510 66535 64628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 66881 67075 gene locus_tag LOCUS_03520 66881 67075 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_03520 67075 67281 gene locus_tag LOCUS_03530 67075 67281 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_03530 70250 67665 gene locus_tag LOCUS_03540 70250 67665 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900188.1 protein_id gnl|my_center|LOCUS_03540 71066 70305 gene locus_tag LOCUS_03550 71066 70305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 72335 71235 gene locus_tag LOCUS_03560 72335 71235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 72495 72746 gene locus_tag LOCUS_03570 72495 72746 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546699.1 protein_id gnl|my_center|LOCUS_03570 72749 72964 gene locus_tag LOCUS_03580 72749 72964 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_03580 72990 73526 gene locus_tag LOCUS_03590 72990 73526 CDS product DUF4262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229617.1 protein_id gnl|my_center|LOCUS_03590 73601 73813 gene locus_tag LOCUS_03600 73601 73813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 73810 74214 gene locus_tag LOCUS_03610 73810 74214 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119983.1 protein_id gnl|my_center|LOCUS_03610 74298 75617 gene locus_tag LOCUS_03620 74298 75617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 75669 76439 gene locus_tag LOCUS_03630 75669 76439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 77350 76949 gene locus_tag LOCUS_03640 77350 76949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 77592 79553 gene locus_tag LOCUS_03650 77592 79553 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_03650 79793 80734 gene locus_tag LOCUS_03660 gene rpoD 79793 80734 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258920.1 protein_id gnl|my_center|LOCUS_03660 80768 81484 gene locus_tag LOCUS_03670 80768 81484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 82891 81521 gene locus_tag LOCUS_03680 82891 81521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 83809 83081 gene locus_tag LOCUS_03690 83809 83081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 83949 85289 gene locus_tag LOCUS_03700 83949 85289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 86382 85270 gene locus_tag LOCUS_03710 86382 85270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 87998 86379 gene locus_tag LOCUS_03720 87998 86379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 88177 89652 gene locus_tag LOCUS_03730 88177 89652 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640376.1 protein_id gnl|my_center|LOCUS_03730 89671 90441 gene locus_tag LOCUS_03740 89671 90441 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_03740 90931 90443 gene locus_tag LOCUS_03750 90931 90443 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028328.1 protein_id gnl|my_center|LOCUS_03750 91017 92024 gene locus_tag LOCUS_03760 91017 92024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 92021 92755 gene locus_tag LOCUS_03770 92021 92755 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140371.1 protein_id gnl|my_center|LOCUS_03770 92752 93990 gene locus_tag LOCUS_03780 92752 93990 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530116.1 protein_id gnl|my_center|LOCUS_03780 94000 95367 gene locus_tag LOCUS_03790 94000 95367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 95530 96330 gene locus_tag LOCUS_03800 95530 96330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 96412 96852 gene locus_tag LOCUS_03810 96412 96852 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822741.1 protein_id gnl|my_center|LOCUS_03810 100317 96856 gene locus_tag LOCUS_03820 gene dnaE 100317 96856 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407751.1 protein_id gnl|my_center|LOCUS_03820 100624 101712 gene locus_tag LOCUS_03830 100624 101712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 103332 101716 gene locus_tag LOCUS_03840 103332 101716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 104926 103367 gene locus_tag LOCUS_03850 gene galA 104926 103367 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080136.1 protein_id gnl|my_center|LOCUS_03850 106748 104916 gene locus_tag LOCUS_03860 gene dxs 106748 104916 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081956.1 protein_id gnl|my_center|LOCUS_03860 109130 106764 gene locus_tag LOCUS_03870 109130 106764 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029584.1 protein_id gnl|my_center|LOCUS_03870 110931 109189 gene locus_tag LOCUS_03880 110931 109189 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_03880 112091 110934 gene locus_tag LOCUS_03890 gene sat 112091 110934 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141086.1 protein_id gnl|my_center|LOCUS_03890 112770 112078 gene locus_tag LOCUS_03900 112770 112078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 112942 113364 gene locus_tag LOCUS_03910 112942 113364 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419409.1 protein_id gnl|my_center|LOCUS_03910 114088 113333 gene locus_tag LOCUS_03920 114088 113333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 115002 114085 gene locus_tag LOCUS_03930 115002 114085 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388866.1 protein_id gnl|my_center|LOCUS_03930 115511 114999 gene locus_tag LOCUS_03940 115511 114999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 116227 115481 gene locus_tag LOCUS_03950 116227 115481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 116615 116289 gene locus_tag LOCUS_03960 116615 116289 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249719.1 protein_id gnl|my_center|LOCUS_03960 116748 119885 gene locus_tag LOCUS_03970 gene ileS 116748 119885 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_03970 120733 119882 gene locus_tag LOCUS_03980 120733 119882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 121127 120846 gene locus_tag LOCUS_03990 121127 120846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 121639 121130 gene locus_tag LOCUS_04000 121639 121130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 122436 121699 gene locus_tag LOCUS_04010 122436 121699 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_04010 123149 122433 gene locus_tag LOCUS_04020 gene pgeF 123149 122433 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080213.1 protein_id gnl|my_center|LOCUS_04020 124261 123161 gene locus_tag LOCUS_04030 gene ftsZ 124261 123161 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_04030 125132 124470 gene locus_tag LOCUS_04040 125132 124470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 126199 125255 gene locus_tag LOCUS_04050 gene murB 126199 125255 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_04050 127658 126192 gene locus_tag LOCUS_04060 gene murC 127658 126192 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_04060 128770 127646 gene locus_tag LOCUS_04070 gene murG 128770 127646 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930513.1 protein_id gnl|my_center|LOCUS_04070 129939 128767 gene locus_tag LOCUS_04080 gene ftsW 129939 128767 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_04080 131823 130378 gene locus_tag LOCUS_04090 gene murD 131823 130378 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228039.1 protein_id gnl|my_center|LOCUS_04090 132863 131820 gene locus_tag LOCUS_04100 gene mraY 132863 131820 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228040.1 protein_id gnl|my_center|LOCUS_04100 134398 132860 gene locus_tag LOCUS_04110 134398 132860 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_04110 136167 134395 gene locus_tag LOCUS_04120 gene ftsI 136167 134395 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_04120 136844 136362 gene locus_tag LOCUS_04130 136844 136362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 137754 136837 gene locus_tag LOCUS_04140 gene rsmH 137754 136837 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_04140 138364 137942 gene locus_tag LOCUS_04150 gene mraZ 138364 137942 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804693.1 protein_id gnl|my_center|LOCUS_04150 138552 139490 gene locus_tag LOCUS_04160 138552 139490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 140654 139536 gene locus_tag LOCUS_04170 140654 139536 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_04170 140820 141986 gene locus_tag LOCUS_04180 gene nagA 140820 141986 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074509.1 protein_id gnl|my_center|LOCUS_04180 142086 143000 gene locus_tag LOCUS_04190 142086 143000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 143389 144282 gene locus_tag LOCUS_04200 143389 144282 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776104.1 protein_id gnl|my_center|LOCUS_04200 144705 144403 gene locus_tag LOCUS_04210 144705 144403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 144738 145286 gene locus_tag LOCUS_04220 144738 145286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 <145950 145283 gene locus_tag LOCUS_04230 <145950 145283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005809362.1:HAMP domain-containing sensor histidine kinase >Feature sequence004 1695 571 gene locus_tag LOCUS_04240 1695 571 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889538.1 protein_id gnl|my_center|LOCUS_04240 2811 1705 gene locus_tag LOCUS_04250 2811 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 3468 2890 gene locus_tag LOCUS_04260 3468 2890 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_04260 3594 4502 gene locus_tag LOCUS_04270 3594 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 4483 5205 gene locus_tag LOCUS_04280 4483 5205 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250348.1 protein_id gnl|my_center|LOCUS_04280 5345 6481 gene locus_tag LOCUS_04290 5345 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 6574 6485 gene locus_tag LOCUS_t00030 6574 6485 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7241 6585 gene locus_tag LOCUS_04300 7241 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 8028 7264 gene locus_tag LOCUS_04310 8028 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 8584 8147 gene locus_tag LOCUS_04320 gene tadA 8584 8147 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_04320 8698 8788 gene locus_tag LOCUS_t00040 8698 8788 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9035 10882 gene locus_tag LOCUS_04330 gene dnaX 9035 10882 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458896.1 protein_id gnl|my_center|LOCUS_04330 10879 11472 gene locus_tag LOCUS_04340 10879 11472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 11474 12076 gene locus_tag LOCUS_04350 gene recR 11474 12076 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_04350 12069 12287 gene locus_tag LOCUS_04360 12069 12287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 12354 12995 gene locus_tag LOCUS_04370 12354 12995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 13794 13015 gene locus_tag LOCUS_04380 13794 13015 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528277.1 protein_id gnl|my_center|LOCUS_04380 14289 14873 gene locus_tag LOCUS_04390 14289 14873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 14892 15851 gene locus_tag LOCUS_04400 14892 15851 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957731.1 protein_id gnl|my_center|LOCUS_04400 15848 17140 gene locus_tag LOCUS_04410 15848 17140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 18308 17127 gene locus_tag LOCUS_04420 18308 17127 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 protein_id gnl|my_center|LOCUS_04420 18820 18389 gene locus_tag LOCUS_04430 18820 18389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 19158 18817 gene locus_tag LOCUS_04440 19158 18817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 19250 19666 gene locus_tag LOCUS_04450 gene mce 19250 19666 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_04450 19828 21459 gene locus_tag LOCUS_04460 19828 21459 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_04460 21866 22735 gene locus_tag LOCUS_04470 21866 22735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225794.1 protein_id gnl|my_center|LOCUS_04470 22925 24109 gene locus_tag LOCUS_04480 22925 24109 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 protein_id gnl|my_center|LOCUS_04480 24106 25305 gene locus_tag LOCUS_04490 gene ahbC 24106 25305 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022974.1 protein_id gnl|my_center|LOCUS_04490 25305 26120 gene locus_tag LOCUS_04500 25305 26120 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730405.1 protein_id gnl|my_center|LOCUS_04500 26711 26199 gene locus_tag LOCUS_04510 26711 26199 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891973.1 protein_id gnl|my_center|LOCUS_04510 27231 26746 gene locus_tag LOCUS_04520 27231 26746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 28559 27531 gene locus_tag LOCUS_04530 28559 27531 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_04530 29352 28666 gene locus_tag LOCUS_04540 29352 28666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 31302 29692 gene locus_tag LOCUS_04550 31302 29692 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908709.1 protein_id gnl|my_center|LOCUS_04550 31579 33732 gene locus_tag LOCUS_04560 31579 33732 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862490.1 protein_id gnl|my_center|LOCUS_04560 33733 35709 gene locus_tag LOCUS_04570 gene asnB 33733 35709 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957840.1 protein_id gnl|my_center|LOCUS_04570 35726 37051 gene locus_tag LOCUS_04580 35726 37051 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257351.1 protein_id gnl|my_center|LOCUS_04580 37056 37850 gene locus_tag LOCUS_04590 37056 37850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 37855 39519 gene locus_tag LOCUS_04600 37855 39519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 39516 41774 gene locus_tag LOCUS_04610 39516 41774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 41774 42952 gene locus_tag LOCUS_04620 41774 42952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 43000 44046 gene locus_tag LOCUS_04630 43000 44046 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889299.1 protein_id gnl|my_center|LOCUS_04630 44051 45130 gene locus_tag LOCUS_04640 44051 45130 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_04640 45263 46615 gene locus_tag LOCUS_04650 45263 46615 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978484.1 protein_id gnl|my_center|LOCUS_04650 48573 46609 gene locus_tag LOCUS_04660 48573 46609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 49412 48600 gene locus_tag LOCUS_04670 49412 48600 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_04670 49484 50734 gene locus_tag LOCUS_04680 49484 50734 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731379.1 protein_id gnl|my_center|LOCUS_04680 50781 51650 gene locus_tag LOCUS_04690 gene mca 50781 51650 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_04690 51753 52694 gene locus_tag LOCUS_04700 51753 52694 CDS product phospholipid scramblase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223563.1 protein_id gnl|my_center|LOCUS_04700 52695 53636 gene locus_tag LOCUS_04710 52695 53636 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730159.1 protein_id gnl|my_center|LOCUS_04710 53744 54400 gene locus_tag LOCUS_04720 53744 54400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 54404 55453 gene locus_tag LOCUS_04730 54404 55453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 55615 57726 gene locus_tag LOCUS_04740 gene nosZ 55615 57726 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_04740 57842 58636 gene locus_tag LOCUS_04750 57842 58636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 58633 60234 gene locus_tag LOCUS_04760 58633 60234 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_04760 60238 60909 gene locus_tag LOCUS_04770 gene lieA 60238 60909 CDS product multidrug efflux ABC transporter ATP-binding protein LieA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931919.1 protein_id gnl|my_center|LOCUS_04770 60902 61765 gene locus_tag LOCUS_04780 60902 61765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 62264 61770 gene locus_tag LOCUS_04790 62264 61770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 63423 62269 gene locus_tag LOCUS_04800 63423 62269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 64428 63574 gene locus_tag LOCUS_04810 64428 63574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 65758 64517 gene locus_tag LOCUS_04820 65758 64517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 66716 65898 gene locus_tag LOCUS_04830 gene ppiB 66716 65898 CDS product peptidylprolyl isomerase PpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950744.1 protein_id gnl|my_center|LOCUS_04830 67262 66750 gene locus_tag LOCUS_04840 67262 66750 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_04840 67452 67976 gene locus_tag LOCUS_04850 gene bldD 67452 67976 CDS product transcriptional regulator BldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_04850 67973 69277 gene locus_tag LOCUS_04860 67973 69277 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_04860 69274 70389 gene locus_tag LOCUS_04870 69274 70389 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_04870 70852 71028 gene locus_tag LOCUS_04880 70852 71028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 72432 71035 gene locus_tag LOCUS_04890 72432 71035 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_04890 72612 73886 gene locus_tag LOCUS_04900 72612 73886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 74035 74442 gene locus_tag LOCUS_04910 74035 74442 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118641.1 protein_id gnl|my_center|LOCUS_04910 74607 74532 gene locus_tag LOCUS_t00050 74607 74532 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 74982 74620 gene locus_tag LOCUS_04920 74982 74620 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893433.1 protein_id gnl|my_center|LOCUS_04920 75108 75485 gene locus_tag LOCUS_04930 75108 75485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 76677 75493 gene locus_tag LOCUS_04940 76677 75493 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_04940 77690 76674 gene locus_tag LOCUS_04950 77690 76674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 77677 79056 gene locus_tag LOCUS_04960 77677 79056 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986859.1 protein_id gnl|my_center|LOCUS_04960 79181 79450 gene locus_tag LOCUS_04970 79181 79450 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974205.1 protein_id gnl|my_center|LOCUS_04970 79648 80511 gene locus_tag LOCUS_04980 79648 80511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 80504 81316 gene locus_tag LOCUS_04990 80504 81316 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_04990 81313 82233 gene locus_tag LOCUS_05000 81313 82233 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_05000 82249 82464 gene locus_tag LOCUS_05010 82249 82464 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256480.1 protein_id gnl|my_center|LOCUS_05010 82471 83001 gene locus_tag LOCUS_05020 82471 83001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 83115 84092 gene locus_tag LOCUS_05030 83115 84092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 84189 85697 gene locus_tag LOCUS_05040 84189 85697 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259175.1 protein_id gnl|my_center|LOCUS_05040 86073 85921 gene locus_tag LOCUS_05050 86073 85921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 87693 86251 gene locus_tag LOCUS_05060 87693 86251 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223946.1 protein_id gnl|my_center|LOCUS_05060 87841 89310 gene locus_tag LOCUS_05070 87841 89310 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225878.1 protein_id gnl|my_center|LOCUS_05070 90331 89342 gene locus_tag LOCUS_05080 90331 89342 CDS product DUF6206 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879311.1 protein_id gnl|my_center|LOCUS_05080 91632 90340 gene locus_tag LOCUS_05090 91632 90340 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879310.1 protein_id gnl|my_center|LOCUS_05090 91798 92034 gene locus_tag LOCUS_05100 91798 92034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 92178 92327 gene locus_tag LOCUS_05110 92178 92327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 92865 92449 gene locus_tag LOCUS_05120 92865 92449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 93161 92874 gene locus_tag LOCUS_05130 93161 92874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 >Feature sequence005 1405 1010 gene locus_tag LOCUS_05140 1405 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 2664 1603 gene locus_tag LOCUS_05150 gene mtnA 2664 1603 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_05150 3870 2677 gene locus_tag LOCUS_05160 3870 2677 CDS product RuBisCO large subunit C-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933432.1 protein_id gnl|my_center|LOCUS_05160 5201 3945 gene locus_tag LOCUS_05170 gene ahcY 5201 3945 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_05170 6278 5220 gene locus_tag LOCUS_05180 6278 5220 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_05180 6466 6275 gene locus_tag LOCUS_05190 6466 6275 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942897.1 protein_id gnl|my_center|LOCUS_05190 7883 6528 gene locus_tag LOCUS_05200 7883 6528 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_05200 8002 10104 gene locus_tag LOCUS_05210 8002 10104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 10109 10906 gene locus_tag LOCUS_05220 10109 10906 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245141.1 protein_id gnl|my_center|LOCUS_05220 11075 11518 gene locus_tag LOCUS_05230 11075 11518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 13995 11515 gene locus_tag LOCUS_05240 13995 11515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 14772 14053 gene locus_tag LOCUS_05250 14772 14053 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_05250 15091 14900 gene locus_tag LOCUS_05260 15091 14900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 15892 15179 gene locus_tag LOCUS_05270 15892 15179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 17991 16810 gene locus_tag LOCUS_05280 17991 16810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 18173 20074 gene locus_tag LOCUS_05290 gene ftsH 18173 20074 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545429.1 protein_id gnl|my_center|LOCUS_05290 20475 20071 gene locus_tag LOCUS_05300 20475 20071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 22043 20481 gene locus_tag LOCUS_05310 22043 20481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 25282 22040 gene locus_tag LOCUS_05320 25282 22040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 26355 25279 gene locus_tag LOCUS_05330 26355 25279 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256508.1 protein_id gnl|my_center|LOCUS_05330 27691 26375 gene locus_tag LOCUS_05340 27691 26375 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048117.1 protein_id gnl|my_center|LOCUS_05340 28652 27684 gene locus_tag LOCUS_05350 28652 27684 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_05350 28578 28766 gene locus_tag LOCUS_05360 28578 28766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 28757 31234 gene locus_tag LOCUS_05370 28757 31234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 31387 32526 gene locus_tag LOCUS_05380 31387 32526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 32532 33476 gene locus_tag LOCUS_05390 32532 33476 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_05390 33455 34693 gene locus_tag LOCUS_05400 33455 34693 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_05400 34690 36495 gene locus_tag LOCUS_05410 34690 36495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 37811 36492 gene locus_tag LOCUS_05420 37811 36492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05420 39117 37873 gene locus_tag LOCUS_05430 39117 37873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 39255 40199 gene locus_tag LOCUS_05440 gene cofD 39255 40199 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_05440 40203 40901 gene locus_tag LOCUS_05450 gene cofE 40203 40901 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_05450 40898 41530 gene locus_tag LOCUS_05460 40898 41530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05460 42454 41534 gene locus_tag LOCUS_05470 gene galE1 42454 41534 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104180.1 protein_id gnl|my_center|LOCUS_05470 42824 42588 gene locus_tag LOCUS_05480 42824 42588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 43502 42861 gene locus_tag LOCUS_05490 43502 42861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 44937 43681 gene locus_tag LOCUS_05500 gene murA 44937 43681 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730199.1 protein_id gnl|my_center|LOCUS_05500 45896 44967 gene locus_tag LOCUS_05510 45896 44967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 46102 47313 gene locus_tag LOCUS_05520 46102 47313 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728380.1 protein_id gnl|my_center|LOCUS_05520 47313 48320 gene locus_tag LOCUS_05530 47313 48320 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165476103.1 protein_id gnl|my_center|LOCUS_05530 49547 48504 gene locus_tag LOCUS_05540 49547 48504 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_05540 49639 50688 gene locus_tag LOCUS_05550 49639 50688 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877839.1 protein_id gnl|my_center|LOCUS_05550 51976 50645 gene locus_tag LOCUS_05560 51976 50645 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403001.1 protein_id gnl|my_center|LOCUS_05560 52138 52923 gene locus_tag LOCUS_05570 52138 52923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 53625 52888 gene locus_tag LOCUS_05580 gene bioD 53625 52888 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_05580 54794 53622 gene locus_tag LOCUS_05590 gene bioF 54794 53622 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_05590 56193 54847 gene locus_tag LOCUS_05600 gene bioA 56193 54847 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942227.1 protein_id gnl|my_center|LOCUS_05600 57323 56190 gene locus_tag LOCUS_05610 gene bioB 57323 56190 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728886.1 protein_id gnl|my_center|LOCUS_05610 57436 57996 gene locus_tag LOCUS_05620 57436 57996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 58793 57993 gene locus_tag LOCUS_05630 58793 57993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 59639 58803 gene locus_tag LOCUS_05640 59639 58803 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902271.1 protein_id gnl|my_center|LOCUS_05640 59815 61101 gene locus_tag LOCUS_05650 59815 61101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 61412 61098 gene locus_tag LOCUS_05660 61412 61098 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409778.1 protein_id gnl|my_center|LOCUS_05660 61651 61409 gene locus_tag LOCUS_05670 61651 61409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 61760 62104 gene locus_tag LOCUS_05680 61760 62104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 62262 62930 gene locus_tag LOCUS_05690 62262 62930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 62966 64564 gene locus_tag LOCUS_05700 62966 64564 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065424.1 protein_id gnl|my_center|LOCUS_05700 64557 65996 gene locus_tag LOCUS_05710 64557 65996 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039725284.1 protein_id gnl|my_center|LOCUS_05710 66792 66025 gene locus_tag LOCUS_05720 66792 66025 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_05720 68184 66820 gene locus_tag LOCUS_05730 68184 66820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 69860 68193 gene locus_tag LOCUS_05740 69860 68193 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_05740 69965 70564 gene locus_tag LOCUS_05750 69965 70564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 71885 70638 gene locus_tag LOCUS_05760 71885 70638 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_05760 72439 72050 gene locus_tag LOCUS_05770 72439 72050 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973623.1 protein_id gnl|my_center|LOCUS_05770 73897 72452 gene locus_tag LOCUS_05780 gene atpD 73897 72452 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814333.1 protein_id gnl|my_center|LOCUS_05780 74809 73922 gene locus_tag LOCUS_05790 74809 73922 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_05790 75322 74810 gene locus_tag LOCUS_05800 75322 74810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 77017 75341 gene locus_tag LOCUS_05810 gene atpA 77017 75341 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896330.1 protein_id gnl|my_center|LOCUS_05810 77624 77076 gene locus_tag LOCUS_05820 77624 77076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 78214 77627 gene locus_tag LOCUS_05830 gene atpF 78214 77627 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558554.1 protein_id gnl|my_center|LOCUS_05830 78441 78214 gene locus_tag LOCUS_05840 78441 78214 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854855.1 protein_id gnl|my_center|LOCUS_05840 79303 78539 gene locus_tag LOCUS_05850 gene atpB 79303 78539 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399324.1 protein_id gnl|my_center|LOCUS_05850 79800 79315 gene locus_tag LOCUS_05860 79800 79315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 80069 79797 gene locus_tag LOCUS_05870 80069 79797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 80990 80172 gene locus_tag LOCUS_05880 gene ppiB 80990 80172 CDS product peptidylprolyl isomerase PpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413367.1 protein_id gnl|my_center|LOCUS_05880 82186 80987 gene locus_tag LOCUS_05890 82186 80987 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775946.1 protein_id gnl|my_center|LOCUS_05890 83458 82208 gene locus_tag LOCUS_05900 83458 82208 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_05900 83939 83493 gene locus_tag LOCUS_05910 gene rpiB 83939 83493 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_05910 84520 83936 gene locus_tag LOCUS_05920 84520 83936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 85408 84605 gene locus_tag LOCUS_05930 85408 84605 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_05930 85503 86783 gene locus_tag LOCUS_05940 85503 86783 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228118.1 protein_id gnl|my_center|LOCUS_05940 87862 86735 gene locus_tag LOCUS_05950 87862 86735 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030441.1 protein_id gnl|my_center|LOCUS_05950 88109 89617 gene locus_tag LOCUS_05960 88109 89617 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339387.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05960 89511 89843 gene locus_tag LOCUS_05970 89511 89843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 >Feature sequence006 562 819 gene locus_tag LOCUS_05980 562 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 991 2247 gene locus_tag LOCUS_05990 991 2247 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938527.1 protein_id gnl|my_center|LOCUS_05990 2258 2596 gene locus_tag LOCUS_06000 2258 2596 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 protein_id gnl|my_center|LOCUS_06000 2697 5288 gene locus_tag LOCUS_06010 gene glnD 2697 5288 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938529.1 protein_id gnl|my_center|LOCUS_06010 5341 5766 gene locus_tag LOCUS_06020 5341 5766 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407695.1 protein_id gnl|my_center|LOCUS_06020 6628 5744 gene locus_tag LOCUS_06030 6628 5744 CDS product AAC(3)-VI family aminoglycoside N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969832.1 protein_id gnl|my_center|LOCUS_06030 8004 6625 gene locus_tag LOCUS_06040 8004 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 9579 8032 gene locus_tag LOCUS_06050 9579 8032 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258761.1 protein_id gnl|my_center|LOCUS_06050 11153 9576 gene locus_tag LOCUS_06060 11153 9576 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_06060 13080 11155 gene locus_tag LOCUS_06070 gene nuoL 13080 11155 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_06070 13388 13083 gene locus_tag LOCUS_06080 gene nuoK 13388 13083 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416452.1 protein_id gnl|my_center|LOCUS_06080 13942 13385 gene locus_tag LOCUS_06090 13942 13385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 14586 13939 gene locus_tag LOCUS_06100 14586 13939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 15656 14592 gene locus_tag LOCUS_06110 gene nuoH 15656 14592 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728120.1 protein_id gnl|my_center|LOCUS_06110 18244 15653 gene locus_tag LOCUS_06120 18244 15653 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029735.1 protein_id gnl|my_center|LOCUS_06120 19597 18248 gene locus_tag LOCUS_06130 gene nuoF 19597 18248 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909320.1 protein_id gnl|my_center|LOCUS_06130 20172 19594 gene locus_tag LOCUS_06140 20172 19594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 21521 20169 gene locus_tag LOCUS_06150 gene nuoD 21521 20169 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258751.1 protein_id gnl|my_center|LOCUS_06150 22076 21534 gene locus_tag LOCUS_06160 22076 21534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 22627 22121 gene locus_tag LOCUS_06170 22627 22121 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006133126.1 protein_id gnl|my_center|LOCUS_06170 23062 22628 gene locus_tag LOCUS_06180 23062 22628 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_06180 24455 23205 gene locus_tag LOCUS_06190 24455 23205 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_06190 25347 24514 gene locus_tag LOCUS_06200 25347 24514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 27360 25363 gene locus_tag LOCUS_06210 gene ccoN 27360 25363 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_06210 28302 27445 gene locus_tag LOCUS_06220 28302 27445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 29927 28299 gene locus_tag LOCUS_06230 29927 28299 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776419.1 protein_id gnl|my_center|LOCUS_06230 30315 29920 gene locus_tag LOCUS_06240 30315 29920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 30636 30947 gene locus_tag LOCUS_06250 30636 30947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 30956 31363 gene locus_tag LOCUS_06260 30956 31363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 31407 32189 gene locus_tag LOCUS_06270 31407 32189 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625442.1 protein_id gnl|my_center|LOCUS_06270 32208 32894 gene locus_tag LOCUS_06280 32208 32894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 32905 33723 gene locus_tag LOCUS_06290 32905 33723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 33768 34730 gene locus_tag LOCUS_06300 33768 34730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 34731 35261 gene locus_tag LOCUS_06310 34731 35261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 36554 35262 gene locus_tag LOCUS_06320 gene hemL 36554 35262 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224512.1 protein_id gnl|my_center|LOCUS_06320 37461 36541 gene locus_tag LOCUS_06330 gene hemB 37461 36541 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028903.1 protein_id gnl|my_center|LOCUS_06330 38026 37538 gene locus_tag LOCUS_06340 38026 37538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 38607 38023 gene locus_tag LOCUS_06350 38607 38023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 40105 38600 gene locus_tag LOCUS_06360 gene cobA 40105 38600 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_06360 41000 40098 gene locus_tag LOCUS_06370 gene hemC 41000 40098 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776655.1 protein_id gnl|my_center|LOCUS_06370 42270 40975 gene locus_tag LOCUS_06380 42270 40975 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908887.1 protein_id gnl|my_center|LOCUS_06380 42884 42258 gene locus_tag LOCUS_06390 42884 42258 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_06390 43555 42884 gene locus_tag LOCUS_06400 43555 42884 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_06400 43756 44592 gene locus_tag LOCUS_06410 43756 44592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 44589 45320 gene locus_tag LOCUS_06420 44589 45320 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 protein_id gnl|my_center|LOCUS_06420 46788 45337 gene locus_tag LOCUS_06430 46788 45337 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392040.1 protein_id gnl|my_center|LOCUS_06430 46910 47869 gene locus_tag LOCUS_06440 46910 47869 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731568.1 protein_id gnl|my_center|LOCUS_06440 48193 47858 gene locus_tag LOCUS_06450 48193 47858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 48483 48190 gene locus_tag LOCUS_06460 48483 48190 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258081.1 protein_id gnl|my_center|LOCUS_06460 49052 48480 gene locus_tag LOCUS_06470 49052 48480 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404436.1 protein_id gnl|my_center|LOCUS_06470 50581 49049 gene locus_tag LOCUS_06480 50581 49049 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892272.1 protein_id gnl|my_center|LOCUS_06480 51013 50582 gene locus_tag LOCUS_06490 51013 50582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 51437 51015 gene locus_tag LOCUS_06500 51437 51015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 53728 51434 gene locus_tag LOCUS_06510 53728 51434 CDS product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031336.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06510 55581 53725 gene locus_tag LOCUS_06520 gene asnB 55581 53725 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_06520 56246 55581 gene locus_tag LOCUS_06530 56246 55581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 58876 56243 gene locus_tag LOCUS_06540 58876 56243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 59244 58906 gene locus_tag LOCUS_06550 59244 58906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 59422 59874 gene locus_tag LOCUS_06560 gene sodN 59422 59874 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125519.1 protein_id gnl|my_center|LOCUS_06560 59938 60405 gene locus_tag LOCUS_06570 gene bcp 59938 60405 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730061.1 protein_id gnl|my_center|LOCUS_06570 60432 60971 gene locus_tag LOCUS_06580 60432 60971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230729.1 protein_id gnl|my_center|LOCUS_06580 61154 61666 gene locus_tag LOCUS_06590 61154 61666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 61727 62224 gene locus_tag LOCUS_06600 61727 62224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 62401 63435 gene locus_tag LOCUS_06610 62401 63435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 63490 64794 gene locus_tag LOCUS_06620 gene mshA 63490 64794 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326818.1 protein_id gnl|my_center|LOCUS_06620 64791 65327 gene locus_tag LOCUS_06630 64791 65327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 65317 65811 gene locus_tag LOCUS_06640 65317 65811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 66653 65997 gene locus_tag LOCUS_06650 66653 65997 CDS product DUF2275 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094014.1 protein_id gnl|my_center|LOCUS_06650 67234 66650 gene locus_tag LOCUS_06660 67234 66650 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224856.1 protein_id gnl|my_center|LOCUS_06660 67197 67811 gene locus_tag LOCUS_06670 67197 67811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 67808 68281 gene locus_tag LOCUS_06680 67808 68281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 69391 68288 gene locus_tag LOCUS_06690 69391 68288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 70229 69414 gene locus_tag LOCUS_06700 70229 69414 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_06700 71026 70226 gene locus_tag LOCUS_06710 71026 70226 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815055.1 protein_id gnl|my_center|LOCUS_06710 71927 71019 gene locus_tag LOCUS_06720 71927 71019 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_06720 73116 72019 gene locus_tag LOCUS_06730 73116 72019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 73269 73511 gene locus_tag LOCUS_06740 73269 73511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 73709 74104 gene locus_tag LOCUS_06750 73709 74104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 74501 75622 gene locus_tag LOCUS_06760 74501 75622 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305385.1 protein_id gnl|my_center|LOCUS_06760 77618 75699 gene locus_tag LOCUS_06770 77618 75699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 77893 78810 gene locus_tag LOCUS_06780 gene proC 77893 78810 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522133.1 protein_id gnl|my_center|LOCUS_06780 80055 78946 gene locus_tag LOCUS_06790 80055 78946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 80265 80990 gene locus_tag LOCUS_06800 80265 80990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 81002 81811 gene locus_tag LOCUS_06810 81002 81811 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_06810 81946 82995 gene locus_tag LOCUS_06820 81946 82995 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080280.1 protein_id gnl|my_center|LOCUS_06820 83025 84026 gene locus_tag LOCUS_06830 83025 84026 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975511.1 protein_id gnl|my_center|LOCUS_06830 84146 84886 gene locus_tag LOCUS_06840 84146 84886 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582685.1 protein_id gnl|my_center|LOCUS_06840 85068 86135 gene locus_tag LOCUS_06850 85068 86135 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_06850 >Feature sequence007 2030 270 gene locus_tag LOCUS_06860 2030 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 2146 2799 gene locus_tag LOCUS_06870 2146 2799 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_06870 3359 2886 gene locus_tag LOCUS_06880 3359 2886 CDS product plastocyanin/azurin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259089.1 protein_id gnl|my_center|LOCUS_06880 3894 3469 gene locus_tag LOCUS_06890 3894 3469 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228279.1 protein_id gnl|my_center|LOCUS_06890 4119 4580 gene locus_tag LOCUS_06900 4119 4580 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486342.1 protein_id gnl|my_center|LOCUS_06900 4637 5326 gene locus_tag LOCUS_06910 4637 5326 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_06910 5323 5700 gene locus_tag LOCUS_06920 gene crcB 5323 5700 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_06920 5697 7073 gene locus_tag LOCUS_06930 5697 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 7962 7063 gene locus_tag LOCUS_06940 7962 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 8716 7967 gene locus_tag LOCUS_06950 8716 7967 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173565.1 protein_id gnl|my_center|LOCUS_06950 8601 9281 gene locus_tag LOCUS_06960 8601 9281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 9550 9338 gene locus_tag LOCUS_06970 9550 9338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 9513 11381 gene locus_tag LOCUS_06980 9513 11381 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_06980 12258 11341 gene locus_tag LOCUS_06990 12258 11341 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229746.1 protein_id gnl|my_center|LOCUS_06990 13025 12255 gene locus_tag LOCUS_07000 13025 12255 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063198.1 protein_id gnl|my_center|LOCUS_07000 16235 13140 gene locus_tag LOCUS_07010 16235 13140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 16355 17044 gene locus_tag LOCUS_07020 16355 17044 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174871.1 protein_id gnl|my_center|LOCUS_07020 17952 17074 gene locus_tag LOCUS_07030 17952 17074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 18055 18420 gene locus_tag LOCUS_07040 18055 18420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 18510 19625 gene locus_tag LOCUS_07050 18510 19625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 19622 20848 gene locus_tag LOCUS_07060 19622 20848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 22276 20885 gene locus_tag LOCUS_07070 22276 20885 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230584.1 protein_id gnl|my_center|LOCUS_07070 24981 22315 gene locus_tag LOCUS_07080 24981 22315 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410027.1 protein_id gnl|my_center|LOCUS_07080 27902 25098 gene locus_tag LOCUS_07090 27902 25098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 29034 28102 gene locus_tag LOCUS_07100 29034 28102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 31795 29258 gene locus_tag LOCUS_07110 31795 29258 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_07110 32576 31797 gene locus_tag LOCUS_07120 32576 31797 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_07120 32791 33990 gene locus_tag LOCUS_07130 32791 33990 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222861.1 protein_id gnl|my_center|LOCUS_07130 33987 34649 gene locus_tag LOCUS_07140 33987 34649 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975186.1 protein_id gnl|my_center|LOCUS_07140 34714 35136 gene locus_tag LOCUS_07150 34714 35136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 36766 35168 gene locus_tag LOCUS_07160 36766 35168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 38086 36839 gene locus_tag LOCUS_07170 38086 36839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 38214 38864 gene locus_tag LOCUS_07180 38214 38864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 38932 39111 gene locus_tag LOCUS_07190 38932 39111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 39873 39349 gene locus_tag LOCUS_07200 39873 39349 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818232.1 protein_id gnl|my_center|LOCUS_07200 40764 39988 gene locus_tag LOCUS_07210 40764 39988 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024997765.1 protein_id gnl|my_center|LOCUS_07210 41561 40761 gene locus_tag LOCUS_07220 41561 40761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 41917 42267 gene locus_tag LOCUS_07230 41917 42267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 42278 43105 gene locus_tag LOCUS_07240 42278 43105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 43609 43211 gene locus_tag LOCUS_07250 43609 43211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 43815 43606 gene locus_tag LOCUS_07260 43815 43606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 44330 45004 gene locus_tag LOCUS_07270 44330 45004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 45542 45763 gene locus_tag LOCUS_07280 45542 45763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 45781 46974 gene locus_tag LOCUS_07290 45781 46974 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_07290 47163 47720 gene locus_tag LOCUS_07300 47163 47720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 48024 51590 gene locus_tag LOCUS_07310 48024 51590 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_07310 52397 51645 gene locus_tag LOCUS_07320 52397 51645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 53131 52394 gene locus_tag LOCUS_07330 53131 52394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 53943 53128 gene locus_tag LOCUS_07340 53943 53128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 54186 54401 gene locus_tag LOCUS_07350 54186 54401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 54406 54822 gene locus_tag LOCUS_07360 54406 54822 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 protein_id gnl|my_center|LOCUS_07360 54812 55771 gene locus_tag LOCUS_07370 54812 55771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 55764 56564 gene locus_tag LOCUS_07380 55764 56564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 56625 59429 gene locus_tag LOCUS_07390 56625 59429 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_07390 59433 62774 gene locus_tag LOCUS_07400 59433 62774 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_07400 63708 62998 gene locus_tag LOCUS_07410 63708 62998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 64337 63696 gene locus_tag LOCUS_07420 64337 63696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 64568 64350 gene locus_tag LOCUS_07430 64568 64350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 64696 64621 gene locus_tag LOCUS_t00060 64696 64621 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 64823 64731 gene locus_tag LOCUS_t00070 64823 64731 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 65512 64931 gene locus_tag LOCUS_07440 65512 64931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 65719 65805 gene locus_tag LOCUS_t00080 65719 65805 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 66659 65805 gene locus_tag LOCUS_07450 66659 65805 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_07450 66967 66656 gene locus_tag LOCUS_07460 66967 66656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 67100 67744 gene locus_tag LOCUS_07470 67100 67744 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222779.1 protein_id gnl|my_center|LOCUS_07470 71276 67737 gene locus_tag LOCUS_07480 71276 67737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 72442 71351 gene locus_tag LOCUS_07490 72442 71351 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803849.1 protein_id gnl|my_center|LOCUS_07490 72510 72911 gene locus_tag LOCUS_07500 72510 72911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 72908 74074 gene locus_tag LOCUS_07510 72908 74074 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403248.1 protein_id gnl|my_center|LOCUS_07510 77967 74125 gene locus_tag LOCUS_07520 77967 74125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 78605 78183 gene locus_tag LOCUS_07530 78605 78183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 80513 78633 gene locus_tag LOCUS_07540 80513 78633 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003908534.1 protein_id gnl|my_center|LOCUS_07540 80667 81038 gene locus_tag LOCUS_07550 80667 81038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402400.1 protein_id gnl|my_center|LOCUS_07550 81038 82000 gene locus_tag LOCUS_07560 81038 82000 CDS product TIGR03621 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229965.1 protein_id gnl|my_center|LOCUS_07560 82771 81989 gene locus_tag LOCUS_07570 gene xth 82771 81989 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546769.1 protein_id gnl|my_center|LOCUS_07570 <83317 82765 gene locus_tag LOCUS_07580 <83317 82765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_067118245.1:LLM class F420-dependent oxidoreductase >Feature sequence008 2122 806 gene locus_tag LOCUS_07590 2122 806 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169733975.1 protein_id gnl|my_center|LOCUS_07590 2305 3108 gene locus_tag LOCUS_07600 2305 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 3272 3934 gene locus_tag LOCUS_07610 3272 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 4179 4424 gene locus_tag LOCUS_07620 4179 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 4922 5437 gene locus_tag LOCUS_07630 4922 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 5461 5700 gene locus_tag LOCUS_07640 5461 5700 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312031.1 protein_id gnl|my_center|LOCUS_07640 5697 6104 gene locus_tag LOCUS_07650 5697 6104 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037032.1 protein_id gnl|my_center|LOCUS_07650 6254 6517 gene locus_tag LOCUS_07660 6254 6517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 6664 7341 gene locus_tag LOCUS_07670 6664 7341 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_07670 7348 10038 gene locus_tag LOCUS_07680 gene secA 7348 10038 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_07680 10181 11128 gene locus_tag LOCUS_07690 gene prfB 10181 11128 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096807630.1 protein_id gnl|my_center|LOCUS_07690 11287 11475 gene locus_tag LOCUS_07700 11287 11475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 11472 11909 gene locus_tag LOCUS_07710 11472 11909 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899952.1 protein_id gnl|my_center|LOCUS_07710 12113 12532 gene locus_tag LOCUS_07720 12113 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 12532 15282 gene locus_tag LOCUS_07730 12532 15282 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888895.1 protein_id gnl|my_center|LOCUS_07730 17199 15349 gene locus_tag LOCUS_07740 17199 15349 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030966.1 protein_id gnl|my_center|LOCUS_07740 17428 18120 gene locus_tag LOCUS_07750 gene ftsE 17428 18120 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082104.1 protein_id gnl|my_center|LOCUS_07750 18117 18995 gene locus_tag LOCUS_07760 gene ftsX 18117 18995 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198720.1 protein_id gnl|my_center|LOCUS_07760 19064 20281 gene locus_tag LOCUS_07770 19064 20281 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_07770 20235 20798 gene locus_tag LOCUS_07780 gene smpB 20235 20798 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391819.1 protein_id gnl|my_center|LOCUS_07780 21270 20908 gene locus_tag LOCUS_07790 21270 20908 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141056643.1 protein_id gnl|my_center|LOCUS_07790 21574 21260 gene locus_tag LOCUS_07800 21574 21260 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_07800 21885 22987 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctgtggtcagccgggaagcgccgctcagatacact 23342 23037 gene locus_tag LOCUS_07810 23342 23037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 24295 23360 gene locus_tag LOCUS_07820 gene cas1 24295 23360 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_07820 26918 24258 gene locus_tag LOCUS_07830 26918 24258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 28033 27815 gene locus_tag LOCUS_07840 28033 27815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 28106 28852 gene locus_tag LOCUS_07850 28106 28852 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944761.1 protein_id gnl|my_center|LOCUS_07850 29044 29349 gene locus_tag LOCUS_07860 29044 29349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 29476 30018 gene locus_tag LOCUS_07870 gene rpoE 29476 30018 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338711.1 protein_id gnl|my_center|LOCUS_07870 30015 30893 gene locus_tag LOCUS_07880 30015 30893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 31164 32291 gene locus_tag LOCUS_07890 31164 32291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 32796 32395 gene locus_tag LOCUS_07900 32796 32395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 33500 33000 gene locus_tag LOCUS_07910 33500 33000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 34975 33488 gene locus_tag LOCUS_07920 34975 33488 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525150.1 protein_id gnl|my_center|LOCUS_07920 34993 36483 gene locus_tag LOCUS_07930 34993 36483 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003908534.1 protein_id gnl|my_center|LOCUS_07930 36922 36572 gene locus_tag LOCUS_07940 36922 36572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 37052 37543 gene locus_tag LOCUS_07950 37052 37543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 37637 39181 gene locus_tag LOCUS_07960 gene pckA 37637 39181 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262836.1 protein_id gnl|my_center|LOCUS_07960 39366 39184 gene locus_tag LOCUS_07970 39366 39184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 39724 40749 gene locus_tag LOCUS_07980 39724 40749 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_07980 43666 40739 gene locus_tag LOCUS_07990 43666 40739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 44224 43838 gene locus_tag LOCUS_08000 44224 43838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 46014 44260 gene locus_tag LOCUS_08010 46014 44260 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742114.1 protein_id gnl|my_center|LOCUS_08010 46778 45993 gene locus_tag LOCUS_08020 46778 45993 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296515.1 protein_id gnl|my_center|LOCUS_08020 47431 48669 gene locus_tag LOCUS_08030 47431 48669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 48686 49174 gene locus_tag LOCUS_08040 48686 49174 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222885.1 protein_id gnl|my_center|LOCUS_08040 49189 50451 gene locus_tag LOCUS_08050 gene pabB 49189 50451 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314634.1 protein_id gnl|my_center|LOCUS_08050 50757 50452 gene locus_tag LOCUS_08060 50757 50452 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229161.1 protein_id gnl|my_center|LOCUS_08060 52126 50744 gene locus_tag LOCUS_08070 52126 50744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 52529 52089 gene locus_tag LOCUS_08080 52529 52089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 52583 53752 gene locus_tag LOCUS_08090 52583 53752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 55105 53729 gene locus_tag LOCUS_08100 55105 53729 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 protein_id gnl|my_center|LOCUS_08100 56612 55110 gene locus_tag LOCUS_08110 56612 55110 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729853.1 protein_id gnl|my_center|LOCUS_08110 56885 57391 gene locus_tag LOCUS_08120 56885 57391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 57393 59129 gene locus_tag LOCUS_08130 57393 59129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 59164 59508 gene locus_tag LOCUS_08140 59164 59508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 59554 59970 gene locus_tag LOCUS_08150 59554 59970 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965765.1 protein_id gnl|my_center|LOCUS_08150 59967 61115 gene locus_tag LOCUS_08160 59967 61115 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085742.1 protein_id gnl|my_center|LOCUS_08160 61122 62291 gene locus_tag LOCUS_08170 61122 62291 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583067.1 protein_id gnl|my_center|LOCUS_08170 62348 63406 gene locus_tag LOCUS_08180 62348 63406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 63412 65244 gene locus_tag LOCUS_08190 gene ctaD 63412 65244 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142160.1 protein_id gnl|my_center|LOCUS_08190 65241 65468 gene locus_tag LOCUS_08200 65241 65468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 65468 66055 gene locus_tag LOCUS_08210 65468 66055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 66667 66059 gene locus_tag LOCUS_08220 66667 66059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 69230 66645 gene locus_tag LOCUS_08230 69230 66645 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272585.1 protein_id gnl|my_center|LOCUS_08230 70246 69245 gene locus_tag LOCUS_08240 70246 69245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 71188 70283 gene locus_tag LOCUS_08250 71188 70283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 72435 71185 gene locus_tag LOCUS_08260 72435 71185 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975127.1 protein_id gnl|my_center|LOCUS_08260 73609 72422 gene locus_tag LOCUS_08270 73609 72422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 73643 74824 gene locus_tag LOCUS_08280 73643 74824 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525271.1 protein_id gnl|my_center|LOCUS_08280 74837 76390 gene locus_tag LOCUS_08290 74837 76390 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900872.1 protein_id gnl|my_center|LOCUS_08290 77075 76362 gene locus_tag LOCUS_08300 77075 76362 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877763.1 protein_id gnl|my_center|LOCUS_08300 <77884 77072 gene locus_tag LOCUS_08310 <77884 77072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730823.1:alpha/beta hydrolase >Feature sequence009 249 2639 gene locus_tag LOCUS_08320 249 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 3161 2667 gene locus_tag LOCUS_08330 3161 2667 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933512.1 protein_id gnl|my_center|LOCUS_08330 4746 3280 gene locus_tag LOCUS_08340 gene argH 4746 3280 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776175.1 protein_id gnl|my_center|LOCUS_08340 5938 4739 gene locus_tag LOCUS_08350 5938 4739 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869501.1 protein_id gnl|my_center|LOCUS_08350 6401 5931 gene locus_tag LOCUS_08360 6401 5931 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408178.1 protein_id gnl|my_center|LOCUS_08360 7342 6398 gene locus_tag LOCUS_08370 gene argF 7342 6398 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584136.1 protein_id gnl|my_center|LOCUS_08370 8544 7339 gene locus_tag LOCUS_08380 8544 7339 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939620.1 protein_id gnl|my_center|LOCUS_08380 9500 8541 gene locus_tag LOCUS_08390 gene argB 9500 8541 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058672.1 protein_id gnl|my_center|LOCUS_08390 10783 9500 gene locus_tag LOCUS_08400 gene argJ 10783 9500 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_08400 11823 10774 gene locus_tag LOCUS_08410 gene argC 11823 10774 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459299.1 protein_id gnl|my_center|LOCUS_08410 14321 11931 gene locus_tag LOCUS_08420 gene pheT 14321 11931 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_08420 15378 14341 gene locus_tag LOCUS_08430 gene pheS 15378 14341 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_08430 16889 15375 gene locus_tag LOCUS_08440 16889 15375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 17319 16954 gene locus_tag LOCUS_08450 gene rplT 17319 16954 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908315.1 protein_id gnl|my_center|LOCUS_08450 17610 17416 gene locus_tag LOCUS_08460 gene rpmI 17610 17416 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939806.1 protein_id gnl|my_center|LOCUS_08460 18116 17616 gene locus_tag LOCUS_08470 gene infC 18116 17616 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_08470 18677 18453 gene locus_tag LOCUS_08480 18677 18453 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085446.1 protein_id gnl|my_center|LOCUS_08480 19545 18670 gene locus_tag LOCUS_08490 gene hisG 19545 18670 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942177.1 protein_id gnl|my_center|LOCUS_08490 19868 21136 gene locus_tag LOCUS_08500 19868 21136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 21663 21196 gene locus_tag LOCUS_08510 gene ribE 21663 21196 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_08510 22912 21656 gene locus_tag LOCUS_08520 22912 21656 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_08520 23546 22890 gene locus_tag LOCUS_08530 23546 22890 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894458.1 protein_id gnl|my_center|LOCUS_08530 24692 23559 gene locus_tag LOCUS_08540 gene ribD 24692 23559 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_08540 25223 24840 gene locus_tag LOCUS_08550 25223 24840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 25950 25216 gene locus_tag LOCUS_08560 gene rpe 25950 25216 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_08560 26491 25916 gene locus_tag LOCUS_08570 26491 25916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 26741 27145 gene locus_tag LOCUS_08580 26741 27145 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222011.1 protein_id gnl|my_center|LOCUS_08580 28091 27138 gene locus_tag LOCUS_08590 gene fmt 28091 27138 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_08590 28628 28098 gene locus_tag LOCUS_08600 gene def 28628 28098 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082176.1 protein_id gnl|my_center|LOCUS_08600 30611 28641 gene locus_tag LOCUS_08610 30611 28641 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958461.1 protein_id gnl|my_center|LOCUS_08610 31886 30690 gene locus_tag LOCUS_08620 gene metK 31886 30690 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082170.1 protein_id gnl|my_center|LOCUS_08620 33214 32015 gene locus_tag LOCUS_08630 gene coaBC 33214 32015 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_08630 33604 33326 gene locus_tag LOCUS_08640 33604 33326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 34083 33601 gene locus_tag LOCUS_08650 gene gmk 34083 33601 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222146.1 protein_id gnl|my_center|LOCUS_08650 34514 34197 gene locus_tag LOCUS_08660 gene mihF 34514 34197 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_08660 35576 34638 gene locus_tag LOCUS_08670 35576 34638 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_08670 38901 35578 gene locus_tag LOCUS_08680 gene carB 38901 35578 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141767.1 protein_id gnl|my_center|LOCUS_08680 40064 38892 gene locus_tag LOCUS_08690 gene carA 40064 38892 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660544.1 protein_id gnl|my_center|LOCUS_08690 41407 40061 gene locus_tag LOCUS_08700 41407 40061 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805076.1 protein_id gnl|my_center|LOCUS_08700 42323 41400 gene locus_tag LOCUS_08710 42323 41400 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_08710 42874 42320 gene locus_tag LOCUS_08720 gene pyrR 42874 42320 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257759.1 protein_id gnl|my_center|LOCUS_08720 43225 43509 gene locus_tag LOCUS_08730 43225 43509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 44703 43561 gene locus_tag LOCUS_08740 44703 43561 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894937.1 protein_id gnl|my_center|LOCUS_08740 45122 44703 gene locus_tag LOCUS_08750 45122 44703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 45715 45158 gene locus_tag LOCUS_08760 gene efp 45715 45158 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_08760 46848 45712 gene locus_tag LOCUS_08770 46848 45712 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286665.1 protein_id gnl|my_center|LOCUS_08770 47318 46845 gene locus_tag LOCUS_08780 gene aroQ 47318 46845 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735140.1 protein_id gnl|my_center|LOCUS_08780 48397 47315 gene locus_tag LOCUS_08790 gene aroB 48397 47315 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082357.1 protein_id gnl|my_center|LOCUS_08790 49001 48387 gene locus_tag LOCUS_08800 49001 48387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 50137 48962 gene locus_tag LOCUS_08810 gene aroC 50137 48962 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093578.1 protein_id gnl|my_center|LOCUS_08810 51123 50356 gene locus_tag LOCUS_08820 51123 50356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 52005 51151 gene locus_tag LOCUS_08830 52005 51151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 52844 52002 gene locus_tag LOCUS_08840 52844 52002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 53909 52848 gene locus_tag LOCUS_08850 gene ftsA 53909 52848 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925150.1 protein_id gnl|my_center|LOCUS_08850 54106 53912 gene locus_tag LOCUS_08860 54106 53912 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004984898.1 protein_id gnl|my_center|LOCUS_08860 55044 54505 gene locus_tag LOCUS_08870 55044 54505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 55974 55435 gene locus_tag LOCUS_08880 55974 55435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 57259 56114 gene locus_tag LOCUS_08890 57259 56114 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_08890 58911 57271 gene locus_tag LOCUS_08900 58911 57271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 60725 59046 gene locus_tag LOCUS_08910 60725 59046 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_08910 62033 60855 gene locus_tag LOCUS_08920 62033 60855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 62626 62048 gene locus_tag LOCUS_08930 62626 62048 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256561.1 protein_id gnl|my_center|LOCUS_08930 64011 62629 gene locus_tag LOCUS_08940 64011 62629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 64487 64026 gene locus_tag LOCUS_08950 64487 64026 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256185.1 protein_id gnl|my_center|LOCUS_08950 65525 64614 gene locus_tag LOCUS_08960 65525 64614 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892481.1 protein_id gnl|my_center|LOCUS_08960 66604 65525 gene locus_tag LOCUS_08970 gene mltG 66604 65525 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722008.1 protein_id gnl|my_center|LOCUS_08970 67005 66601 gene locus_tag LOCUS_08980 gene ruvX 67005 66601 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_08980 69593 67014 gene locus_tag LOCUS_08990 gene alaS 69593 67014 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224582.1 protein_id gnl|my_center|LOCUS_08990 70155 69895 gene locus_tag LOCUS_09000 70155 69895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 70526 70170 gene locus_tag LOCUS_09010 70526 70170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 71900 70587 gene locus_tag LOCUS_09020 71900 70587 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224577.1 protein_id gnl|my_center|LOCUS_09020 71999 72364 gene locus_tag LOCUS_09030 71999 72364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 74105 72399 gene locus_tag LOCUS_09040 gene aspS 74105 72399 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_09040 <74731 74213 gene locus_tag LOCUS_09050 <74731 74213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005082383.1:histidine--tRNA ligase >Feature sequence010 829 1620 gene locus_tag LOCUS_09060 829 1620 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973077.1 protein_id gnl|my_center|LOCUS_09060 1621 3207 gene locus_tag LOCUS_09070 1621 3207 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392670.1 protein_id gnl|my_center|LOCUS_09070 3311 4861 gene locus_tag LOCUS_09080 3311 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 4869 5663 gene locus_tag LOCUS_09090 4869 5663 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_09090 5668 6054 gene locus_tag LOCUS_09100 5668 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 6130 6876 gene locus_tag LOCUS_09110 6130 6876 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401893.1 protein_id gnl|my_center|LOCUS_09110 7476 6868 gene locus_tag LOCUS_09120 7476 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 7599 8216 gene locus_tag LOCUS_09130 7599 8216 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258211.1 protein_id gnl|my_center|LOCUS_09130 9914 8244 gene locus_tag LOCUS_09140 9914 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 10466 11758 gene locus_tag LOCUS_09150 gene eno 10466 11758 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_09150 11760 12257 gene locus_tag LOCUS_09160 11760 12257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 12299 13849 gene locus_tag LOCUS_09170 12299 13849 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138270.1 protein_id gnl|my_center|LOCUS_09170 13842 14996 gene locus_tag LOCUS_09180 13842 14996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 14993 17851 gene locus_tag LOCUS_09190 14993 17851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 17852 17934 gene locus_tag LOCUS_t00090 17852 17934 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18629 17994 gene locus_tag LOCUS_09200 18629 17994 CDS product PaeR7I family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176598.1 protein_id gnl|my_center|LOCUS_09200 19689 18691 gene locus_tag LOCUS_09210 19689 18691 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227916.1 protein_id gnl|my_center|LOCUS_09210 21374 19827 gene locus_tag LOCUS_09220 21374 19827 CDS product 4-coumarate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728294.1 protein_id gnl|my_center|LOCUS_09220 22471 21389 gene locus_tag LOCUS_09230 22471 21389 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_09230 22561 23940 gene locus_tag LOCUS_09240 22561 23940 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_09240 25482 23944 gene locus_tag LOCUS_09250 25482 23944 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764944.1 protein_id gnl|my_center|LOCUS_09250 26846 25479 gene locus_tag LOCUS_09260 26846 25479 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_09260 28604 26847 gene locus_tag LOCUS_09270 28604 26847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 28680 30362 gene locus_tag LOCUS_09280 28680 30362 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529845.1 protein_id gnl|my_center|LOCUS_09280 30364 31143 gene locus_tag LOCUS_09290 30364 31143 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224750.1 protein_id gnl|my_center|LOCUS_09290 31506 32093 gene locus_tag LOCUS_09300 31506 32093 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296687.1 protein_id gnl|my_center|LOCUS_09300 32086 33111 gene locus_tag LOCUS_09310 32086 33111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 35142 33142 gene locus_tag LOCUS_09320 35142 33142 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390810.1 protein_id gnl|my_center|LOCUS_09320 35324 36664 gene locus_tag LOCUS_09330 gene ccrA 35324 36664 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223473.1 protein_id gnl|my_center|LOCUS_09330 36706 37119 gene locus_tag LOCUS_09340 36706 37119 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230404.1 protein_id gnl|my_center|LOCUS_09340 37116 37919 gene locus_tag LOCUS_09350 37116 37919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 38542 37928 gene locus_tag LOCUS_09360 38542 37928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 38672 40201 gene locus_tag LOCUS_09370 38672 40201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 40238 43657 gene locus_tag LOCUS_09380 gene metH 40238 43657 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_09380 44780 43644 gene locus_tag LOCUS_09390 44780 43644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 45775 44864 gene locus_tag LOCUS_09400 45775 44864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 45897 46412 gene locus_tag LOCUS_09410 45897 46412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 46548 47816 gene locus_tag LOCUS_09420 46548 47816 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750457.1 protein_id gnl|my_center|LOCUS_09420 47844 49058 gene locus_tag LOCUS_09430 47844 49058 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021450.1 protein_id gnl|my_center|LOCUS_09430 49792 49049 gene locus_tag LOCUS_09440 49792 49049 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 protein_id gnl|my_center|LOCUS_09440 50190 49942 gene locus_tag LOCUS_09450 50190 49942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 50468 51070 gene locus_tag LOCUS_09460 50468 51070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 51076 52089 gene locus_tag LOCUS_09470 51076 52089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 52082 53860 gene locus_tag LOCUS_09480 52082 53860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 53857 55653 gene locus_tag LOCUS_09490 53857 55653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 55650 55889 gene locus_tag LOCUS_09500 55650 55889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 55978 56538 gene locus_tag LOCUS_09510 55978 56538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 56720 58120 gene locus_tag LOCUS_09520 gene sufB 56720 58120 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_09520 58144 58914 gene locus_tag LOCUS_09530 58144 58914 CDS product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742157.1 protein_id gnl|my_center|LOCUS_09530 59750 58911 gene locus_tag LOCUS_09540 59750 58911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 59941 61269 gene locus_tag LOCUS_09550 59941 61269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 61262 61579 gene locus_tag LOCUS_09560 61262 61579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 61616 62338 gene locus_tag LOCUS_09570 gene sufC 61616 62338 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929158.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence011 211 507 gene locus_tag LOCUS_09580 211 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 522 1109 gene locus_tag LOCUS_09590 522 1109 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227937.1 protein_id gnl|my_center|LOCUS_09590 1892 1122 gene locus_tag LOCUS_09600 1892 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083223.1 protein_id gnl|my_center|LOCUS_09600 2039 2425 gene locus_tag LOCUS_09610 2039 2425 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222136.1 protein_id gnl|my_center|LOCUS_09610 3199 2459 gene locus_tag LOCUS_09620 3199 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 3457 3245 gene locus_tag LOCUS_09630 3457 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09630 4794 3373 gene locus_tag LOCUS_09640 4794 3373 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083229.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09640 6639 4798 gene locus_tag LOCUS_09650 6639 4798 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_09650 7838 6636 gene locus_tag LOCUS_09660 7838 6636 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392807.1 protein_id gnl|my_center|LOCUS_09660 7975 8733 gene locus_tag LOCUS_09670 7975 8733 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187151961.1 protein_id gnl|my_center|LOCUS_09670 8734 10023 gene locus_tag LOCUS_09680 8734 10023 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926967.1 protein_id gnl|my_center|LOCUS_09680 10023 11345 gene locus_tag LOCUS_09690 10023 11345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 11332 11724 gene locus_tag LOCUS_09700 11332 11724 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169809.1 protein_id gnl|my_center|LOCUS_09700 13817 11769 gene locus_tag LOCUS_09710 13817 11769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 13897 14094 gene locus_tag LOCUS_09720 13897 14094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 14735 14076 gene locus_tag LOCUS_09730 14735 14076 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_09730 14808 17450 gene locus_tag LOCUS_09740 gene polA 14808 17450 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_09740 19178 17454 gene locus_tag LOCUS_09750 19178 17454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 19153 19335 gene locus_tag LOCUS_09760 19153 19335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 20058 19306 gene locus_tag LOCUS_09770 20058 19306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 20311 22002 gene locus_tag LOCUS_09780 20311 22002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 22049 22660 gene locus_tag LOCUS_09790 gene coaE 22049 22660 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_09790 22653 23387 gene locus_tag LOCUS_09800 22653 23387 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633090.1 protein_id gnl|my_center|LOCUS_09800 24081 23395 gene locus_tag LOCUS_09810 24081 23395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907663.1 protein_id gnl|my_center|LOCUS_09810 24185 26203 gene locus_tag LOCUS_09820 gene uvrB 24185 26203 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_09820 26666 26196 gene locus_tag LOCUS_09830 26666 26196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 27042 26581 gene locus_tag LOCUS_09840 27042 26581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 27859 27071 gene locus_tag LOCUS_09850 27859 27071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 27959 29155 gene locus_tag LOCUS_09860 27959 29155 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_09860 29935 29126 gene locus_tag LOCUS_09870 29935 29126 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392510.1 protein_id gnl|my_center|LOCUS_09870 31272 29935 gene locus_tag LOCUS_09880 31272 29935 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258102.1 protein_id gnl|my_center|LOCUS_09880 31439 34336 gene locus_tag LOCUS_09890 gene uvrA 31439 34336 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_09890 34901 34311 gene locus_tag LOCUS_09900 34901 34311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 36230 35136 gene locus_tag LOCUS_09910 gene nadA 36230 35136 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 protein_id gnl|my_center|LOCUS_09910 36472 38472 gene locus_tag LOCUS_09920 gene uvrC 36472 38472 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831611.1 protein_id gnl|my_center|LOCUS_09920 38462 39388 gene locus_tag LOCUS_09930 gene rapZ 38462 39388 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_09930 39381 40286 gene locus_tag LOCUS_09940 39381 40286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 40323 41318 gene locus_tag LOCUS_09950 gene gap 40323 41318 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 protein_id gnl|my_center|LOCUS_09950 41353 42564 gene locus_tag LOCUS_09960 41353 42564 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036339.1 protein_id gnl|my_center|LOCUS_09960 42557 43330 gene locus_tag LOCUS_09970 gene tpiA 42557 43330 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_09970 43389 43625 gene locus_tag LOCUS_09980 gene secG 43389 43625 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014464.1 protein_id gnl|my_center|LOCUS_09980 43689 43775 gene locus_tag LOCUS_t00100 43689 43775 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 43925 44632 gene locus_tag LOCUS_09990 gene ric 43925 44632 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963399.1 protein_id gnl|my_center|LOCUS_09990 44677 44829 gene locus_tag LOCUS_10000 44677 44829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 44826 47060 gene locus_tag LOCUS_10010 44826 47060 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 protein_id gnl|my_center|LOCUS_10010 47702 47094 gene locus_tag LOCUS_10020 47702 47094 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729926.1 protein_id gnl|my_center|LOCUS_10020 48621 47722 gene locus_tag LOCUS_10030 48621 47722 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869263.1 protein_id gnl|my_center|LOCUS_10030 49303 48674 gene locus_tag LOCUS_10040 49303 48674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 50254 49328 gene locus_tag LOCUS_10050 50254 49328 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001327311.1 protein_id gnl|my_center|LOCUS_10050 50329 51090 gene locus_tag LOCUS_10060 50329 51090 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091874.1 protein_id gnl|my_center|LOCUS_10060 51253 52803 gene locus_tag LOCUS_10070 51253 52803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 53349 52819 gene locus_tag LOCUS_10080 53349 52819 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085863.1 protein_id gnl|my_center|LOCUS_10080 53594 53358 gene locus_tag LOCUS_10090 53594 53358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 54830 53613 gene locus_tag LOCUS_10100 gene xseA 54830 53613 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908629.1 protein_id gnl|my_center|LOCUS_10100 55404 54832 gene locus_tag LOCUS_10110 55404 54832 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_10110 56005 55472 gene locus_tag LOCUS_10120 56005 55472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 56681 56091 gene locus_tag LOCUS_10130 gene nfuA 56681 56091 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088034.1 protein_id gnl|my_center|LOCUS_10130 57948 56854 gene locus_tag LOCUS_10140 57948 56854 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_10140 59641 57980 gene locus_tag LOCUS_10150 59641 57980 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_10150 61164 59683 gene locus_tag LOCUS_10160 61164 59683 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896817.1 protein_id gnl|my_center|LOCUS_10160 61823 61161 gene locus_tag LOCUS_10170 61823 61161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence012 1124 39 gene locus_tag LOCUS_10180 1124 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 2291 1257 gene locus_tag LOCUS_10190 2291 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 3436 2288 gene locus_tag LOCUS_10200 gene vpsA 3436 2288 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) VpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756756.1 protein_id gnl|my_center|LOCUS_10200 4489 3446 gene locus_tag LOCUS_10210 4489 3446 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041077419.1 protein_id gnl|my_center|LOCUS_10210 5712 4486 gene locus_tag LOCUS_10220 5712 4486 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081170.1 protein_id gnl|my_center|LOCUS_10220 5975 7126 gene locus_tag LOCUS_10230 5975 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 7123 8877 gene locus_tag LOCUS_10240 7123 8877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 9615 8956 gene locus_tag LOCUS_10250 9615 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 10445 9612 gene locus_tag LOCUS_10260 10445 9612 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111408924.1 protein_id gnl|my_center|LOCUS_10260 11647 10442 gene locus_tag LOCUS_10270 11647 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 11722 13185 gene locus_tag LOCUS_10280 11722 13185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 13389 14744 gene locus_tag LOCUS_10290 13389 14744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 14765 16192 gene locus_tag LOCUS_10300 14765 16192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 16164 18434 gene locus_tag LOCUS_10310 16164 18434 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862490.1 protein_id gnl|my_center|LOCUS_10310 19980 18424 gene locus_tag LOCUS_10320 19980 18424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 23049 20209 gene locus_tag LOCUS_10330 23049 20209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 23408 24694 gene locus_tag LOCUS_10340 23408 24694 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_10340 24691 26040 gene locus_tag LOCUS_10350 gene purD 24691 26040 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_10350 26037 27335 gene locus_tag LOCUS_10360 gene purB 26037 27335 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817240.1 protein_id gnl|my_center|LOCUS_10360 27332 28222 gene locus_tag LOCUS_10370 27332 28222 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938096.1 protein_id gnl|my_center|LOCUS_10370 28318 30042 gene locus_tag LOCUS_10380 28318 30042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 30235 30936 gene locus_tag LOCUS_10390 30235 30936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 31632 31120 gene locus_tag LOCUS_10400 31632 31120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 33756 31807 gene locus_tag LOCUS_10410 33756 31807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 34005 34268 gene locus_tag LOCUS_10420 gene purS 34005 34268 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532128.1 protein_id gnl|my_center|LOCUS_10420 34265 35002 gene locus_tag LOCUS_10430 gene purQ 34265 35002 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393545.1 protein_id gnl|my_center|LOCUS_10430 35028 37364 gene locus_tag LOCUS_10440 gene purL 35028 37364 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_10440 37463 38977 gene locus_tag LOCUS_10450 gene purF 37463 38977 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_10450 38974 40080 gene locus_tag LOCUS_10460 gene purM 38974 40080 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_10460 40206 41933 gene locus_tag LOCUS_10470 40206 41933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 41934 42383 gene locus_tag LOCUS_10480 41934 42383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 42364 44997 gene locus_tag LOCUS_10490 42364 44997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 44984 46768 gene locus_tag LOCUS_10500 44984 46768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 46788 48704 gene locus_tag LOCUS_10510 46788 48704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 48701 49414 gene locus_tag LOCUS_10520 48701 49414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 49725 49411 gene locus_tag LOCUS_10530 49725 49411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 50495 49722 gene locus_tag LOCUS_10540 50495 49722 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098387.1 protein_id gnl|my_center|LOCUS_10540 50802 51011 gene locus_tag LOCUS_10550 gene bldC 50802 51011 CDS product developmental transcriptional regulator BldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 protein_id gnl|my_center|LOCUS_10550 51897 51070 gene locus_tag LOCUS_10560 51897 51070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 53315 51900 gene locus_tag LOCUS_10570 53315 51900 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_10570 53404 53628 gene locus_tag LOCUS_10580 53404 53628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 54270 54704 gene locus_tag LOCUS_10590 54270 54704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 55850 54882 gene locus_tag LOCUS_10600 55850 54882 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545533.1 protein_id gnl|my_center|LOCUS_10600 55866 56141 gene locus_tag LOCUS_10610 55866 56141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 56285 56509 gene locus_tag LOCUS_10620 56285 56509 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227972.1 protein_id gnl|my_center|LOCUS_10620 56511 56897 gene locus_tag LOCUS_10630 56511 56897 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_10630 58115 56973 gene locus_tag LOCUS_10640 58115 56973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 >Feature sequence013 1045 404 gene locus_tag LOCUS_10650 1045 404 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889321.1 protein_id gnl|my_center|LOCUS_10650 1413 1066 gene locus_tag LOCUS_10660 1413 1066 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972099.1 protein_id gnl|my_center|LOCUS_10660 4947 1471 gene locus_tag LOCUS_10670 4947 1471 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967237.1 protein_id gnl|my_center|LOCUS_10670 5086 6312 gene locus_tag LOCUS_10680 5086 6312 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173846.1 protein_id gnl|my_center|LOCUS_10680 7454 6309 gene locus_tag LOCUS_10690 7454 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 8294 7470 gene locus_tag LOCUS_10700 8294 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 8446 9051 gene locus_tag LOCUS_10710 8446 9051 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086626.1 protein_id gnl|my_center|LOCUS_10710 9110 10825 gene locus_tag LOCUS_10720 9110 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 10969 11292 gene locus_tag LOCUS_10730 10969 11292 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_10730 11888 11487 gene locus_tag LOCUS_10740 11888 11487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 12824 13153 gene locus_tag LOCUS_10750 12824 13153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 13233 13159 gene locus_tag LOCUS_t00110 13233 13159 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 13350 13655 gene locus_tag LOCUS_10760 gene gatC 13350 13655 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_10760 13652 15088 gene locus_tag LOCUS_10770 gene gatA 13652 15088 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223570.1 protein_id gnl|my_center|LOCUS_10770 15085 16521 gene locus_tag LOCUS_10780 gene gatB 15085 16521 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223571.1 protein_id gnl|my_center|LOCUS_10780 16530 17054 gene locus_tag LOCUS_10790 16530 17054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 17123 18262 gene locus_tag LOCUS_10800 17123 18262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 18272 19954 gene locus_tag LOCUS_10810 gene ilvD 18272 19954 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908989.1 protein_id gnl|my_center|LOCUS_10810 19966 20451 gene locus_tag LOCUS_10820 19966 20451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 21789 20815 gene locus_tag LOCUS_10830 21789 20815 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259359.1 protein_id gnl|my_center|LOCUS_10830 22393 21818 gene locus_tag LOCUS_10840 22393 21818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 23092 22751 gene locus_tag LOCUS_10850 23092 22751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 23247 23954 gene locus_tag LOCUS_10860 23247 23954 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776125.1 protein_id gnl|my_center|LOCUS_10860 23951 25333 gene locus_tag LOCUS_10870 23951 25333 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224238.1 protein_id gnl|my_center|LOCUS_10870 26440 25385 gene locus_tag LOCUS_10880 26440 25385 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_10880 27234 26437 gene locus_tag LOCUS_10890 27234 26437 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_10890 27998 27231 gene locus_tag LOCUS_10900 gene modA 27998 27231 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728090.1 protein_id gnl|my_center|LOCUS_10900 28446 28048 gene locus_tag LOCUS_10910 28446 28048 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975235.1 protein_id gnl|my_center|LOCUS_10910 29939 28614 gene locus_tag LOCUS_10920 29939 28614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 30123 30941 gene locus_tag LOCUS_10930 30123 30941 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_10930 31125 31052 gene locus_tag LOCUS_t00120 31125 31052 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 31212 31135 gene locus_tag LOCUS_t00130 31212 31135 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 31288 31215 gene locus_tag LOCUS_t00140 31288 31215 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 31821 31435 gene locus_tag LOCUS_10940 31821 31435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 32373 32014 gene locus_tag LOCUS_10950 32373 32014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 32522 34054 gene locus_tag LOCUS_10960 32522 34054 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_10960 34750 34046 gene locus_tag LOCUS_10970 34750 34046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 35238 34747 gene locus_tag LOCUS_10980 35238 34747 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 protein_id gnl|my_center|LOCUS_10980 35712 35239 gene locus_tag LOCUS_10990 35712 35239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 37464 35824 gene locus_tag LOCUS_11000 37464 35824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 37624 38433 gene locus_tag LOCUS_11010 37624 38433 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093939.1 protein_id gnl|my_center|LOCUS_11010 40542 38446 gene locus_tag LOCUS_11020 40542 38446 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893757.1 protein_id gnl|my_center|LOCUS_11020 40688 41455 gene locus_tag LOCUS_11030 40688 41455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 41882 41424 gene locus_tag LOCUS_11040 41882 41424 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_11040 42135 42060 gene locus_tag LOCUS_t00150 42135 42060 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 42511 42167 gene locus_tag LOCUS_11050 42511 42167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 43629 42508 gene locus_tag LOCUS_11060 43629 42508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 43855 43670 gene locus_tag LOCUS_11070 43855 43670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 43955 43881 gene locus_tag LOCUS_t00160 43955 43881 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 44394 44017 gene locus_tag LOCUS_11080 44394 44017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 44576 45781 gene locus_tag LOCUS_11090 44576 45781 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227721.1 protein_id gnl|my_center|LOCUS_11090 46474 45743 gene locus_tag LOCUS_11100 46474 45743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 46706 47233 gene locus_tag LOCUS_11110 46706 47233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 49644 47164 gene locus_tag LOCUS_11120 gene gyrA 49644 47164 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221961.1 protein_id gnl|my_center|LOCUS_11120 51648 49702 gene locus_tag LOCUS_11130 gene gyrB 51648 49702 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435993.1 protein_id gnl|my_center|LOCUS_11130 52197 51940 gene locus_tag LOCUS_11140 52197 51940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 53411 52305 gene locus_tag LOCUS_11150 gene recF 53411 52305 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_11150 54544 53417 gene locus_tag LOCUS_11160 gene dnaN 54544 53417 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221956.1 protein_id gnl|my_center|LOCUS_11160 56182 54764 gene locus_tag LOCUS_11170 gene dnaA 56182 54764 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400253.1 protein_id gnl|my_center|LOCUS_11170 56620 57120 gene locus_tag LOCUS_11180 56620 57120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 57036 57335 gene locus_tag LOCUS_11190 57036 57335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 >Feature sequence014 381 1502 gene locus_tag LOCUS_11200 381 1502 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_11200 1499 2440 gene locus_tag LOCUS_11210 1499 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 2437 3429 gene locus_tag LOCUS_11220 gene pseB 2437 3429 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869431.1 protein_id gnl|my_center|LOCUS_11220 3693 4577 gene locus_tag LOCUS_11230 gene pseC 3693 4577 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_11230 4574 5830 gene locus_tag LOCUS_11240 4574 5830 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222491.1 protein_id gnl|my_center|LOCUS_11240 5868 6917 gene locus_tag LOCUS_11250 5868 6917 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869395.1 protein_id gnl|my_center|LOCUS_11250 6902 7375 gene locus_tag LOCUS_11260 6902 7375 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316616.1 protein_id gnl|my_center|LOCUS_11260 7372 8373 gene locus_tag LOCUS_11270 7372 8373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 8366 9370 gene locus_tag LOCUS_11280 8366 9370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 9445 10191 gene locus_tag LOCUS_11290 9445 10191 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920693.1 protein_id gnl|my_center|LOCUS_11290 10188 11801 gene locus_tag LOCUS_11300 10188 11801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 11798 13543 gene locus_tag LOCUS_11310 11798 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 13627 14250 gene locus_tag LOCUS_11320 13627 14250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 14247 15236 gene locus_tag LOCUS_11330 14247 15236 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808328.1 protein_id gnl|my_center|LOCUS_11330 15247 15969 gene locus_tag LOCUS_11340 15247 15969 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480005.1 protein_id gnl|my_center|LOCUS_11340 15976 16824 gene locus_tag LOCUS_11350 15976 16824 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649925.1 protein_id gnl|my_center|LOCUS_11350 16815 17051 gene locus_tag LOCUS_11360 16815 17051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 18254 16989 gene locus_tag LOCUS_11370 18254 16989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 18703 19008 gene locus_tag LOCUS_11380 gene rpsF 18703 19008 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244064.1 protein_id gnl|my_center|LOCUS_11380 19062 19502 gene locus_tag LOCUS_11390 19062 19502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 19613 19873 gene locus_tag LOCUS_11400 gene rpsR 19613 19873 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 protein_id gnl|my_center|LOCUS_11400 19880 20326 gene locus_tag LOCUS_11410 gene rplI 19880 20326 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_11410 20519 21892 gene locus_tag LOCUS_11420 gene dnaB 20519 21892 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391682.1 protein_id gnl|my_center|LOCUS_11420 21899 22297 gene locus_tag LOCUS_11430 21899 22297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 22472 23395 gene locus_tag LOCUS_11440 22472 23395 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_11440 23377 23946 gene locus_tag LOCUS_11450 23377 23946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 23943 24521 gene locus_tag LOCUS_11460 23943 24521 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226119.1 protein_id gnl|my_center|LOCUS_11460 24518 25207 gene locus_tag LOCUS_11470 gene pyrF 24518 25207 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083509.1 protein_id gnl|my_center|LOCUS_11470 25339 25268 gene locus_tag LOCUS_t00170 25339 25268 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 26102 25353 gene locus_tag LOCUS_11480 26102 25353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 26998 26099 gene locus_tag LOCUS_11490 26998 26099 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582702.1 protein_id gnl|my_center|LOCUS_11490 27773 26985 gene locus_tag LOCUS_11500 27773 26985 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015343.1 protein_id gnl|my_center|LOCUS_11500 29886 27790 gene locus_tag LOCUS_11510 29886 27790 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257680.1 protein_id gnl|my_center|LOCUS_11510 30028 30696 gene locus_tag LOCUS_11520 30028 30696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 30726 31619 gene locus_tag LOCUS_11530 30726 31619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 31660 32427 gene locus_tag LOCUS_11540 gene rfbF 31660 32427 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435696.1 protein_id gnl|my_center|LOCUS_11540 32418 33944 gene locus_tag LOCUS_11550 32418 33944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 34805 33930 gene locus_tag LOCUS_11560 34805 33930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 35935 34802 gene locus_tag LOCUS_11570 35935 34802 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938758.1 protein_id gnl|my_center|LOCUS_11570 36642 35935 gene locus_tag LOCUS_11580 36642 35935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 36715 37206 gene locus_tag LOCUS_11590 36715 37206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 37958 37188 gene locus_tag LOCUS_11600 37958 37188 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974130.1 protein_id gnl|my_center|LOCUS_11600 39307 37961 gene locus_tag LOCUS_11610 39307 37961 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974129.1 protein_id gnl|my_center|LOCUS_11610 40103 39297 gene locus_tag LOCUS_11620 40103 39297 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029901.1 protein_id gnl|my_center|LOCUS_11620 40301 41074 gene locus_tag LOCUS_11630 40301 41074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 41264 43093 gene locus_tag LOCUS_11640 gene dnaK 41264 43093 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015390.1 protein_id gnl|my_center|LOCUS_11640 43109 43567 gene locus_tag LOCUS_11650 43109 43567 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_11650 43570 44193 gene locus_tag LOCUS_11660 gene grpE 43570 44193 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_11660 44190 45335 gene locus_tag LOCUS_11670 gene dnaJ 44190 45335 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401821.1 protein_id gnl|my_center|LOCUS_11670 45337 45759 gene locus_tag LOCUS_11680 45337 45759 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975271.1 protein_id gnl|my_center|LOCUS_11680 45756 46865 gene locus_tag LOCUS_11690 45756 46865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 46877 48121 gene locus_tag LOCUS_11700 46877 48121 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213498758.1 protein_id gnl|my_center|LOCUS_11700 49135 48131 gene locus_tag LOCUS_11710 49135 48131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 49266 51848 gene locus_tag LOCUS_11720 gene clpB 49266 51848 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_11720 53529 51904 gene locus_tag LOCUS_11730 53529 51904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 54370 53513 gene locus_tag LOCUS_11740 54370 53513 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111408924.1 protein_id gnl|my_center|LOCUS_11740 54442 55113 gene locus_tag LOCUS_11750 54442 55113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 55131 56189 gene locus_tag LOCUS_11760 gene wecB 55131 56189 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_11760 56817 56197 gene locus_tag LOCUS_11770 56817 56197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 >Feature sequence015 1029 3878 gene locus_tag LOCUS_11780 1029 3878 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546856.1 protein_id gnl|my_center|LOCUS_11780 3875 5182 gene locus_tag LOCUS_11790 gene hsdS 3875 5182 CDS product type I restriction-modification system specificity subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014003.1 protein_id gnl|my_center|LOCUS_11790 5242 6165 gene locus_tag LOCUS_11800 5242 6165 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899456.1 protein_id gnl|my_center|LOCUS_11800 6313 6954 gene locus_tag LOCUS_11810 6313 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 6951 8435 gene locus_tag LOCUS_11820 6951 8435 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_11820 8490 12089 gene locus_tag LOCUS_11830 8490 12089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110345.1 protein_id gnl|my_center|LOCUS_11830 12747 12343 gene locus_tag LOCUS_11840 12747 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 13212 12949 gene locus_tag LOCUS_11850 13212 12949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 14236 13193 gene locus_tag LOCUS_11860 14236 13193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405582.1 protein_id gnl|my_center|LOCUS_11860 14780 15031 gene locus_tag LOCUS_11870 14780 15031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 15028 15468 gene locus_tag LOCUS_11880 15028 15468 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403386.1 protein_id gnl|my_center|LOCUS_11880 15679 15485 gene locus_tag LOCUS_11890 15679 15485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 16843 15734 gene locus_tag LOCUS_11900 16843 15734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 17160 17918 gene locus_tag LOCUS_11910 17160 17918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 18014 19492 gene locus_tag LOCUS_11920 18014 19492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 20151 19750 gene locus_tag LOCUS_11930 20151 19750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 20449 20784 gene locus_tag LOCUS_11940 20449 20784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 21246 20794 gene locus_tag LOCUS_11950 21246 20794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 21371 22030 gene locus_tag LOCUS_11960 21371 22030 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179719124.1 protein_id gnl|my_center|LOCUS_11960 22509 22042 gene locus_tag LOCUS_11970 22509 22042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 23135 22506 gene locus_tag LOCUS_11980 23135 22506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 24313 23252 gene locus_tag LOCUS_11990 24313 23252 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061040.1 protein_id gnl|my_center|LOCUS_11990 24605 24348 gene locus_tag LOCUS_12000 24605 24348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 24812 26329 gene locus_tag LOCUS_12010 24812 26329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 28176 26986 gene locus_tag LOCUS_12020 28176 26986 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064343.1 protein_id gnl|my_center|LOCUS_12020 28339 28671 gene locus_tag LOCUS_12030 28339 28671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 29994 29074 gene locus_tag LOCUS_12040 29994 29074 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265741.1 protein_id gnl|my_center|LOCUS_12040 30722 30015 gene locus_tag LOCUS_12050 30722 30015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 31887 30736 gene locus_tag LOCUS_12060 31887 30736 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_12060 33517 32060 gene locus_tag LOCUS_12070 33517 32060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 33549 34271 gene locus_tag LOCUS_12080 33549 34271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 34359 35558 gene locus_tag LOCUS_12090 34359 35558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 35659 35904 gene locus_tag LOCUS_12100 35659 35904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 35907 37133 gene locus_tag LOCUS_12110 35907 37133 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639983.1 protein_id gnl|my_center|LOCUS_12110 37200 39041 gene locus_tag LOCUS_12120 gene ilvD 37200 39041 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099286.1 protein_id gnl|my_center|LOCUS_12120 40431 39073 gene locus_tag LOCUS_12130 40431 39073 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530465.1 protein_id gnl|my_center|LOCUS_12130 40519 41052 gene locus_tag LOCUS_12140 40519 41052 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228475.1 protein_id gnl|my_center|LOCUS_12140 42244 41072 gene locus_tag LOCUS_12150 42244 41072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 42393 43196 gene locus_tag LOCUS_12160 42393 43196 CDS product DUF6008 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226232.1 protein_id gnl|my_center|LOCUS_12160 44978 43230 gene locus_tag LOCUS_12170 44978 43230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 45117 45512 gene locus_tag LOCUS_12180 45117 45512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 45539 46498 gene locus_tag LOCUS_12190 45539 46498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_12190 47577 46507 gene locus_tag LOCUS_12200 47577 46507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 48513 47626 gene locus_tag LOCUS_12210 48513 47626 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230819.1 protein_id gnl|my_center|LOCUS_12210 48888 48535 gene locus_tag LOCUS_12220 48888 48535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 49983 49042 gene locus_tag LOCUS_12230 49983 49042 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113965.1 protein_id gnl|my_center|LOCUS_12230 50683 50183 gene locus_tag LOCUS_12240 50683 50183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 52190 50697 gene locus_tag LOCUS_12250 52190 50697 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083032.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence016 801 157 gene locus_tag LOCUS_12260 801 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 2300 798 gene locus_tag LOCUS_12270 2300 798 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877924.1 protein_id gnl|my_center|LOCUS_12270 3302 2301 gene locus_tag LOCUS_12280 gene holB 3302 2301 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_12280 3931 3299 gene locus_tag LOCUS_12290 gene tmk 3931 3299 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886759.1 protein_id gnl|my_center|LOCUS_12290 5538 3931 gene locus_tag LOCUS_12300 5538 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 7780 5543 gene locus_tag LOCUS_12310 gene topA 7780 5543 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943185.1 protein_id gnl|my_center|LOCUS_12310 8097 7780 gene locus_tag LOCUS_12320 8097 7780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 8152 8835 gene locus_tag LOCUS_12330 8152 8835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 8835 9722 gene locus_tag LOCUS_12340 8835 9722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 10172 9723 gene locus_tag LOCUS_12350 gene greA 10172 9723 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229826.1 protein_id gnl|my_center|LOCUS_12350 10232 10708 gene locus_tag LOCUS_12360 10232 10708 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_12360 11104 10730 gene locus_tag LOCUS_12370 11104 10730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 11307 11101 gene locus_tag LOCUS_12380 11307 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 12028 11327 gene locus_tag LOCUS_12390 12028 11327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 12783 12022 gene locus_tag LOCUS_12400 12783 12022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 13997 12771 gene locus_tag LOCUS_12410 13997 12771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 15091 13994 gene locus_tag LOCUS_12420 15091 13994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 15330 16157 gene locus_tag LOCUS_12430 15330 16157 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230527.1 protein_id gnl|my_center|LOCUS_12430 20098 16241 gene locus_tag LOCUS_12440 20098 16241 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229685.1 protein_id gnl|my_center|LOCUS_12440 21726 20098 gene locus_tag LOCUS_12450 21726 20098 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957853.1 protein_id gnl|my_center|LOCUS_12450 21841 24726 gene locus_tag LOCUS_12460 21841 24726 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_12460 25358 24714 gene locus_tag LOCUS_12470 25358 24714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 25942 25397 gene locus_tag LOCUS_12480 25942 25397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 26954 25935 gene locus_tag LOCUS_12490 26954 25935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 28056 26962 gene locus_tag LOCUS_12500 28056 26962 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223158.1 protein_id gnl|my_center|LOCUS_12500 29504 28056 gene locus_tag LOCUS_12510 29504 28056 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026894.1 protein_id gnl|my_center|LOCUS_12510 30127 29549 gene locus_tag LOCUS_12520 30127 29549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 30295 31275 gene locus_tag LOCUS_12530 30295 31275 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057395.1 protein_id gnl|my_center|LOCUS_12530 31262 32488 gene locus_tag LOCUS_12540 31262 32488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 32461 34998 gene locus_tag LOCUS_12550 32461 34998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 35091 36935 gene locus_tag LOCUS_12560 35091 36935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 37008 38015 gene locus_tag LOCUS_12570 37008 38015 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256099.1 protein_id gnl|my_center|LOCUS_12570 39575 38043 gene locus_tag LOCUS_12580 gene mazG 39575 38043 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226718.1 protein_id gnl|my_center|LOCUS_12580 40635 39556 gene locus_tag LOCUS_12590 40635 39556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 44082 40696 gene locus_tag LOCUS_12600 gene mfd 44082 40696 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_12600 45654 44089 gene locus_tag LOCUS_12610 45654 44089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 46297 45707 gene locus_tag LOCUS_12620 gene pth 46297 45707 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405251.1 protein_id gnl|my_center|LOCUS_12620 47014 46328 gene locus_tag LOCUS_12630 47014 46328 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_12630 47156 47743 gene locus_tag LOCUS_12640 47156 47743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 47770 47973 gene locus_tag LOCUS_12650 47770 47973 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407785.1 protein_id gnl|my_center|LOCUS_12650 47970 48359 gene locus_tag LOCUS_12660 gene vapc11 47970 48359 CDS product type II toxin-antitoxin system toxin ribonuclease VapC11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407786.1 protein_id gnl|my_center|LOCUS_12660 49368 48544 gene locus_tag LOCUS_12670 49368 48544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 49543 49920 gene locus_tag LOCUS_12680 49543 49920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 50430 50005 gene locus_tag LOCUS_12690 50430 50005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 <51257 50442 gene locus_tag LOCUS_12700 <51257 50442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_225949840.1:PA14 domain-containing protein >Feature sequence017 57 701 gene locus_tag LOCUS_12710 57 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 2191 1298 gene locus_tag LOCUS_12720 2191 1298 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_12720 2230 2688 gene locus_tag LOCUS_12730 2230 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 4591 2726 gene locus_tag LOCUS_12740 4591 2726 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 protein_id gnl|my_center|LOCUS_12740 5810 4575 gene locus_tag LOCUS_12750 5810 4575 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405030.1 protein_id gnl|my_center|LOCUS_12750 7023 5797 gene locus_tag LOCUS_12760 7023 5797 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_12760 7141 7920 gene locus_tag LOCUS_12770 gene mshB 7141 7920 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089212260.1 protein_id gnl|my_center|LOCUS_12770 8716 7928 gene locus_tag LOCUS_12780 8716 7928 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095780.1 protein_id gnl|my_center|LOCUS_12780 9105 8920 gene locus_tag LOCUS_12790 9105 8920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 9161 9562 gene locus_tag LOCUS_12800 9161 9562 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974348.1 protein_id gnl|my_center|LOCUS_12800 9553 10056 gene locus_tag LOCUS_12810 9553 10056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 10031 10780 gene locus_tag LOCUS_12820 10031 10780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 10777 11946 gene locus_tag LOCUS_12830 10777 11946 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_12830 11943 12959 gene locus_tag LOCUS_12840 11943 12959 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029756.1 protein_id gnl|my_center|LOCUS_12840 12965 13432 gene locus_tag LOCUS_12850 12965 13432 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974344.1 protein_id gnl|my_center|LOCUS_12850 13429 13944 gene locus_tag LOCUS_12860 13429 13944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 13949 14257 gene locus_tag LOCUS_12870 gene nuoK 13949 14257 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056517.1 protein_id gnl|my_center|LOCUS_12870 14251 16320 gene locus_tag LOCUS_12880 gene nuoL 14251 16320 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_12880 16361 17878 gene locus_tag LOCUS_12890 16361 17878 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029759.1 protein_id gnl|my_center|LOCUS_12890 17882 19363 gene locus_tag LOCUS_12900 17882 19363 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_12900 19368 20456 gene locus_tag LOCUS_12910 19368 20456 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142380.1 protein_id gnl|my_center|LOCUS_12910 20458 20748 gene locus_tag LOCUS_12920 gene clpS 20458 20748 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180153.1 protein_id gnl|my_center|LOCUS_12920 20787 21305 gene locus_tag LOCUS_12930 20787 21305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 21391 21717 gene locus_tag LOCUS_12940 21391 21717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 21796 22518 gene locus_tag LOCUS_12950 21796 22518 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_12950 22545 25526 gene locus_tag LOCUS_12960 22545 25526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 26680 25553 gene locus_tag LOCUS_12970 26680 25553 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286318.1 protein_id gnl|my_center|LOCUS_12970 26952 27677 gene locus_tag LOCUS_12980 26952 27677 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727432.1 protein_id gnl|my_center|LOCUS_12980 27770 28090 gene locus_tag LOCUS_12990 27770 28090 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_12990 29015 28095 gene locus_tag LOCUS_13000 29015 28095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 29688 29503 gene locus_tag LOCUS_13010 29688 29503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 30167 30550 gene locus_tag LOCUS_13020 30167 30550 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869964.1 protein_id gnl|my_center|LOCUS_13020 30772 31065 gene locus_tag LOCUS_13030 30772 31065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 31062 31289 gene locus_tag LOCUS_13040 31062 31289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 31713 31892 gene locus_tag LOCUS_13050 31713 31892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 31914 32333 gene locus_tag LOCUS_13060 31914 32333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 33035 32355 gene locus_tag LOCUS_13070 gene glnR 33035 32355 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_13070 34422 33097 gene locus_tag LOCUS_13080 gene glnA 34422 33097 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545065.1 protein_id gnl|my_center|LOCUS_13080 34544 35083 gene locus_tag LOCUS_13090 gene pyrE 34544 35083 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903560.1 protein_id gnl|my_center|LOCUS_13090 35751 35542 gene locus_tag LOCUS_13100 35751 35542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 35785 36606 gene locus_tag LOCUS_13110 35785 36606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 36960 38198 gene locus_tag LOCUS_13120 36960 38198 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_13120 38259 39794 gene locus_tag LOCUS_13130 38259 39794 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389949.1 protein_id gnl|my_center|LOCUS_13130 41170 39791 gene locus_tag LOCUS_13140 41170 39791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 41366 41172 gene locus_tag LOCUS_13150 41366 41172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 41473 42666 gene locus_tag LOCUS_13160 41473 42666 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755904.1 protein_id gnl|my_center|LOCUS_13160 <44093 42668 gene locus_tag LOCUS_13170 <44093 42668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583490.1:PBP1A family penicillin-binding protein >Feature sequence018 726 1682 gene locus_tag LOCUS_13180 726 1682 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142163.1 protein_id gnl|my_center|LOCUS_13180 3374 2055 gene locus_tag LOCUS_13190 3374 2055 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223056.1 protein_id gnl|my_center|LOCUS_13190 4633 3371 gene locus_tag LOCUS_13200 4633 3371 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223055.1 protein_id gnl|my_center|LOCUS_13200 4897 4721 gene locus_tag LOCUS_13210 4897 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 5643 4987 gene locus_tag LOCUS_13220 5643 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 5870 6628 gene locus_tag LOCUS_13230 5870 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 6706 7149 gene locus_tag LOCUS_13240 6706 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 8492 7224 gene locus_tag LOCUS_13250 8492 7224 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_13250 9309 8719 gene locus_tag LOCUS_13260 9309 8719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 9738 9388 gene locus_tag LOCUS_13270 9738 9388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 11191 10031 gene locus_tag LOCUS_13280 11191 10031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 11461 11389 gene locus_tag LOCUS_t00180 11461 11389 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11466 11732 gene locus_tag LOCUS_13290 11466 11732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 11698 13176 gene locus_tag LOCUS_13300 11698 13176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 13251 13460 gene locus_tag LOCUS_13310 13251 13460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 13388 13645 gene locus_tag LOCUS_13320 13388 13645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13320 14909 13656 gene locus_tag LOCUS_13330 14909 13656 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_13330 15151 16863 gene locus_tag LOCUS_13340 gene argS 15151 16863 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_13340 16860 18191 gene locus_tag LOCUS_13350 gene lysA 16860 18191 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_13350 18220 19536 gene locus_tag LOCUS_13360 18220 19536 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_13360 19537 20601 gene locus_tag LOCUS_13370 gene thrC 19537 20601 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546273.1 protein_id gnl|my_center|LOCUS_13370 20716 21861 gene locus_tag LOCUS_13380 20716 21861 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_13380 21875 23260 gene locus_tag LOCUS_13390 21875 23260 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060774.1 protein_id gnl|my_center|LOCUS_13390 23323 24204 gene locus_tag LOCUS_13400 23323 24204 CDS product 2-phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877485.1 protein_id gnl|my_center|LOCUS_13400 24243 24443 gene locus_tag LOCUS_13410 24243 24443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 24513 26105 gene locus_tag LOCUS_13420 24513 26105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 26287 26520 gene locus_tag LOCUS_13430 gene rpmE 26287 26520 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229538.1 protein_id gnl|my_center|LOCUS_13430 26542 27477 gene locus_tag LOCUS_13440 26542 27477 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 protein_id gnl|my_center|LOCUS_13440 27577 28668 gene locus_tag LOCUS_13450 gene prfA 27577 28668 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_13450 28665 29612 gene locus_tag LOCUS_13460 gene prmC 28665 29612 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 protein_id gnl|my_center|LOCUS_13460 29609 30229 gene locus_tag LOCUS_13470 29609 30229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 30230 31066 gene locus_tag LOCUS_13480 30230 31066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 31109 31693 gene locus_tag LOCUS_13490 31109 31693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 31690 32448 gene locus_tag LOCUS_13500 31690 32448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 33235 32435 gene locus_tag LOCUS_13510 33235 32435 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_13510 33301 33885 gene locus_tag LOCUS_13520 gene sigR 33301 33885 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_13520 33885 34118 gene locus_tag LOCUS_13530 33885 34118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 34274 34591 gene locus_tag LOCUS_13540 34274 34591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 34588 35778 gene locus_tag LOCUS_13550 34588 35778 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256151.1 protein_id gnl|my_center|LOCUS_13550 35793 37175 gene locus_tag LOCUS_13560 gene tilS 35793 37175 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_13560 37247 37783 gene locus_tag LOCUS_13570 gene hpt 37247 37783 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230473.1 protein_id gnl|my_center|LOCUS_13570 37812 39725 gene locus_tag LOCUS_13580 gene ftsH 37812 39725 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391653.1 protein_id gnl|my_center|LOCUS_13580 39726 40289 gene locus_tag LOCUS_13590 gene folE 39726 40289 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391949.1 protein_id gnl|my_center|LOCUS_13590 40286 41578 gene locus_tag LOCUS_13600 40286 41578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 41669 42145 gene locus_tag LOCUS_13610 41669 42145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 >Feature sequence019 <1 592 gene locus_tag LOCUS_13620 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010950468.1:IS256-like element IS1554 family transposase 671 1252 gene locus_tag LOCUS_13630 671 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1689 2069 gene locus_tag LOCUS_13640 1689 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 2090 2335 gene locus_tag LOCUS_13650 2090 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 2519 2869 gene locus_tag LOCUS_13660 2519 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 2901 3071 gene locus_tag LOCUS_13670 2901 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 3426 3250 gene locus_tag LOCUS_13680 3426 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 3734 3423 gene locus_tag LOCUS_13690 3734 3423 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_13690 3887 4153 gene locus_tag LOCUS_13700 3887 4153 CDS product antitoxin VapB48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419787.1 protein_id gnl|my_center|LOCUS_13700 4150 4590 gene locus_tag LOCUS_13710 4150 4590 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899644.1 protein_id gnl|my_center|LOCUS_13710 4795 5049 gene locus_tag LOCUS_13720 4795 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 5282 5055 gene locus_tag LOCUS_13730 5282 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 5172 5480 gene locus_tag LOCUS_13740 5172 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 5962 5546 gene locus_tag LOCUS_13750 5962 5546 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_13750 6707 5955 gene locus_tag LOCUS_13760 6707 5955 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398893.1 protein_id gnl|my_center|LOCUS_13760 6794 7288 gene locus_tag LOCUS_13770 6794 7288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 7278 7691 gene locus_tag LOCUS_13780 7278 7691 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227979.1 protein_id gnl|my_center|LOCUS_13780 7859 9109 gene locus_tag LOCUS_13790 7859 9109 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257950.1 protein_id gnl|my_center|LOCUS_13790 9117 10151 gene locus_tag LOCUS_13800 9117 10151 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112789.1 protein_id gnl|my_center|LOCUS_13800 11692 10280 gene locus_tag LOCUS_13810 11692 10280 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893539.1 protein_id gnl|my_center|LOCUS_13810 12933 11692 gene locus_tag LOCUS_13820 12933 11692 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229595.1 protein_id gnl|my_center|LOCUS_13820 13441 14094 gene locus_tag LOCUS_13830 13441 14094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 14239 15129 gene locus_tag LOCUS_13840 14239 15129 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258911.1 protein_id gnl|my_center|LOCUS_13840 15148 15936 gene locus_tag LOCUS_13850 15148 15936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 17068 15947 gene locus_tag LOCUS_13860 17068 15947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 18806 17223 gene locus_tag LOCUS_13870 18806 17223 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115243.1 protein_id gnl|my_center|LOCUS_13870 19589 18900 gene locus_tag LOCUS_13880 19589 18900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 19715 21427 gene locus_tag LOCUS_13890 19715 21427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 21545 21910 gene locus_tag LOCUS_13900 21545 21910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 22251 23255 gene locus_tag LOCUS_13910 22251 23255 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030814.1 protein_id gnl|my_center|LOCUS_13910 23295 24461 gene locus_tag LOCUS_13920 23295 24461 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081124.1 protein_id gnl|my_center|LOCUS_13920 24462 24689 gene locus_tag LOCUS_13930 24462 24689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 24696 25547 gene locus_tag LOCUS_13940 gene couO 24696 25547 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225127.1 protein_id gnl|my_center|LOCUS_13940 26088 25552 gene locus_tag LOCUS_13950 26088 25552 CDS product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075651.1 protein_id gnl|my_center|LOCUS_13950 26191 27063 gene locus_tag LOCUS_13960 26191 27063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 27967 27104 gene locus_tag LOCUS_13970 27967 27104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 29111 28125 gene locus_tag LOCUS_13980 29111 28125 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921125.1 protein_id gnl|my_center|LOCUS_13980 30095 29217 gene locus_tag LOCUS_13990 30095 29217 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812031.1 protein_id gnl|my_center|LOCUS_13990 30928 30092 gene locus_tag LOCUS_14000 30928 30092 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062696006.1 protein_id gnl|my_center|LOCUS_14000 31926 30943 gene locus_tag LOCUS_14010 31926 30943 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703242.1 protein_id gnl|my_center|LOCUS_14010 32426 31995 gene locus_tag LOCUS_14020 32426 31995 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_14020 33787 32447 gene locus_tag LOCUS_14030 33787 32447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 34918 33800 gene locus_tag LOCUS_14040 gene thiH 34918 33800 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704008.1 protein_id gnl|my_center|LOCUS_14040 35712 34918 gene locus_tag LOCUS_14050 35712 34918 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479758.1 protein_id gnl|my_center|LOCUS_14050 35916 37325 gene locus_tag LOCUS_14060 gene lpdA 35916 37325 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258694.1 protein_id gnl|my_center|LOCUS_14060 37408 38712 gene locus_tag LOCUS_14070 37408 38712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 38715 40388 gene locus_tag LOCUS_14080 38715 40388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence020 1316 792 gene locus_tag LOCUS_14090 1316 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1420 1779 gene locus_tag LOCUS_14100 gene folB 1420 1779 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419537.1 protein_id gnl|my_center|LOCUS_14100 1791 2300 gene locus_tag LOCUS_14110 gene folK 1791 2300 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613722.1 protein_id gnl|my_center|LOCUS_14110 2532 3329 gene locus_tag LOCUS_14120 2532 3329 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230459.1 protein_id gnl|my_center|LOCUS_14120 3326 4261 gene locus_tag LOCUS_14130 gene panC 3326 4261 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_14130 4284 4703 gene locus_tag LOCUS_14140 4284 4703 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027487.1 protein_id gnl|my_center|LOCUS_14140 4715 5686 gene locus_tag LOCUS_14150 gene nadC 4715 5686 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224104.1 protein_id gnl|my_center|LOCUS_14150 5690 6472 gene locus_tag LOCUS_14160 5690 6472 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_14160 6469 7899 gene locus_tag LOCUS_14170 gene lysS 6469 7899 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_14170 8367 7921 gene locus_tag LOCUS_14180 8367 7921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 8573 10639 gene locus_tag LOCUS_14190 8573 10639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 11666 10677 gene locus_tag LOCUS_14200 11666 10677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 12983 11919 gene locus_tag LOCUS_14210 12983 11919 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222468.1 protein_id gnl|my_center|LOCUS_14210 13358 15853 gene locus_tag LOCUS_14220 13358 15853 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_14220 15972 16337 gene locus_tag LOCUS_14230 15972 16337 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188723.1 protein_id gnl|my_center|LOCUS_14230 16391 17185 gene locus_tag LOCUS_14240 16391 17185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 17182 18600 gene locus_tag LOCUS_14250 gene radA 17182 18600 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928233.1 protein_id gnl|my_center|LOCUS_14250 19295 18597 gene locus_tag LOCUS_14260 19295 18597 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175285932.1 protein_id gnl|my_center|LOCUS_14260 19809 20303 gene locus_tag LOCUS_14270 19809 20303 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003953493.1 protein_id gnl|my_center|LOCUS_14270 20411 21565 gene locus_tag LOCUS_14280 20411 21565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 21562 22737 gene locus_tag LOCUS_14290 gene ispD 21562 22737 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938747.1 protein_id gnl|my_center|LOCUS_14290 22799 24202 gene locus_tag LOCUS_14300 gene cysS 22799 24202 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868520.1 protein_id gnl|my_center|LOCUS_14300 24169 24963 gene locus_tag LOCUS_14310 gene rlmB 24169 24963 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_14310 24988 25061 gene locus_tag LOCUS_t00190 24988 25061 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 25099 25623 gene locus_tag LOCUS_14320 25099 25623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 25746 26450 gene locus_tag LOCUS_14330 25746 26450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 26466 28040 gene locus_tag LOCUS_14340 26466 28040 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_14340 28410 28066 gene locus_tag LOCUS_14350 28410 28066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 29002 28385 gene locus_tag LOCUS_14360 29002 28385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 29517 28999 gene locus_tag LOCUS_14370 29517 28999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 32128 30719 gene locus_tag LOCUS_14380 32128 30719 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029560.1 protein_id gnl|my_center|LOCUS_14380 33489 32155 gene locus_tag LOCUS_14390 33489 32155 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083215.1 protein_id gnl|my_center|LOCUS_14390 33437 34726 gene locus_tag LOCUS_14400 33437 34726 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082051.1 protein_id gnl|my_center|LOCUS_14400 34730 35623 gene locus_tag LOCUS_14410 34730 35623 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975079.1 protein_id gnl|my_center|LOCUS_14410 35761 36297 gene locus_tag LOCUS_14420 35761 36297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 37387 36317 gene locus_tag LOCUS_14430 37387 36317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence021 6929 7510 gene locus_tag LOCUS_14440 6929 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 7667 8065 gene locus_tag LOCUS_14450 7667 8065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 8192 8509 gene locus_tag LOCUS_14460 8192 8509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 8752 10485 gene locus_tag LOCUS_14470 8752 10485 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495579.1 protein_id gnl|my_center|LOCUS_14470 11208 10510 gene locus_tag LOCUS_14480 11208 10510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 12437 11223 gene locus_tag LOCUS_14490 12437 11223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 12794 13345 gene locus_tag LOCUS_14500 12794 13345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 13423 13602 gene locus_tag LOCUS_14510 13423 13602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 13599 15428 gene locus_tag LOCUS_14520 13599 15428 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209489743.1 protein_id gnl|my_center|LOCUS_14520 15603 15251 gene locus_tag LOCUS_tm00010 15603 15251 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 16596 15667 gene locus_tag LOCUS_14530 gene era 16596 15667 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775752.1 protein_id gnl|my_center|LOCUS_14530 17915 16602 gene locus_tag LOCUS_14540 17915 16602 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_14540 18406 17912 gene locus_tag LOCUS_14550 gene ybeY 18406 17912 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899292.1 protein_id gnl|my_center|LOCUS_14550 19362 18406 gene locus_tag LOCUS_14560 19362 18406 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_14560 19837 19454 gene locus_tag LOCUS_14570 19837 19454 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_14570 20643 19819 gene locus_tag LOCUS_14580 20643 19819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 21479 20688 gene locus_tag LOCUS_14590 21479 20688 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345437.1 protein_id gnl|my_center|LOCUS_14590 22261 21443 gene locus_tag LOCUS_14600 22261 21443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 22339 22264 gene locus_tag LOCUS_t00200 22339 22264 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 23642 22446 gene locus_tag LOCUS_14610 23642 22446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 25514 23718 gene locus_tag LOCUS_14620 25514 23718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 26527 25532 gene locus_tag LOCUS_14630 26527 25532 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_14630 28282 26567 gene locus_tag LOCUS_14640 28282 26567 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_14640 30036 28297 gene locus_tag LOCUS_14650 30036 28297 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_14650 30600 30091 gene locus_tag LOCUS_14660 30600 30091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 30678 31631 gene locus_tag LOCUS_14670 30678 31631 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918834.1 protein_id gnl|my_center|LOCUS_14670 31647 32297 gene locus_tag LOCUS_14680 gene fsa 31647 32297 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393880.1 protein_id gnl|my_center|LOCUS_14680 32294 33541 gene locus_tag LOCUS_14690 32294 33541 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066535.1 protein_id gnl|my_center|LOCUS_14690 34756 33551 gene locus_tag LOCUS_14700 34756 33551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 35223 34762 gene locus_tag LOCUS_14710 35223 34762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 35996 35586 gene locus_tag LOCUS_14720 35996 35586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 36859 35993 gene locus_tag LOCUS_14730 36859 35993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 36998 37318 gene locus_tag LOCUS_14740 36998 37318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 37273 37524 gene locus_tag LOCUS_14750 37273 37524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence022 395 1048 gene locus_tag LOCUS_14760 395 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 1918 1061 gene locus_tag LOCUS_14770 1918 1061 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230706.1 protein_id gnl|my_center|LOCUS_14770 2159 1896 gene locus_tag LOCUS_14780 2159 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 2225 2920 gene locus_tag LOCUS_14790 2225 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 2917 4269 gene locus_tag LOCUS_14800 2917 4269 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869104.1 protein_id gnl|my_center|LOCUS_14800 4262 4822 gene locus_tag LOCUS_14810 4262 4822 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_14810 4873 6366 gene locus_tag LOCUS_14820 4873 6366 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_14820 6405 7058 gene locus_tag LOCUS_14830 6405 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 8224 7055 gene locus_tag LOCUS_14840 gene moeB 8224 7055 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057412.1 protein_id gnl|my_center|LOCUS_14840 9114 8338 gene locus_tag LOCUS_14850 9114 8338 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030941.1 protein_id gnl|my_center|LOCUS_14850 9808 9158 gene locus_tag LOCUS_14860 9808 9158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 10127 10411 gene locus_tag LOCUS_14870 10127 10411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 10709 10452 gene locus_tag LOCUS_14880 10709 10452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 10821 11510 gene locus_tag LOCUS_14890 10821 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 11507 12316 gene locus_tag LOCUS_14900 11507 12316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 12313 13458 gene locus_tag LOCUS_14910 12313 13458 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776058.1 protein_id gnl|my_center|LOCUS_14910 13455 14300 gene locus_tag LOCUS_14920 13455 14300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 14300 15130 gene locus_tag LOCUS_14930 14300 15130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 15151 15396 gene locus_tag LOCUS_14940 15151 15396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 15453 15803 gene locus_tag LOCUS_14950 15453 15803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 15800 16225 gene locus_tag LOCUS_14960 15800 16225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 16227 16652 gene locus_tag LOCUS_14970 16227 16652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 16762 18369 gene locus_tag LOCUS_14980 16762 18369 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_14980 18366 19841 gene locus_tag LOCUS_14990 18366 19841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 19943 20107 gene locus_tag LOCUS_15000 19943 20107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 21903 20116 gene locus_tag LOCUS_15010 gene accC 21903 20116 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257262.1 protein_id gnl|my_center|LOCUS_15010 22002 22784 gene locus_tag LOCUS_15020 22002 22784 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877512.1 protein_id gnl|my_center|LOCUS_15020 23650 22781 gene locus_tag LOCUS_15030 gene ilvE 23650 22781 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583718.1 protein_id gnl|my_center|LOCUS_15030 27306 23683 gene locus_tag LOCUS_15040 27306 23683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 28106 27363 gene locus_tag LOCUS_15050 28106 27363 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061374.1 protein_id gnl|my_center|LOCUS_15050 28229 30106 gene locus_tag LOCUS_15060 28229 30106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 30951 30076 gene locus_tag LOCUS_15070 30951 30076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 31064 32635 gene locus_tag LOCUS_15080 31064 32635 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094018.1 protein_id gnl|my_center|LOCUS_15080 32710 33396 gene locus_tag LOCUS_15090 32710 33396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 33393 34757 gene locus_tag LOCUS_15100 33393 34757 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115243.1 protein_id gnl|my_center|LOCUS_15100 36268 34754 gene locus_tag LOCUS_15110 36268 34754 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_15110 36920 36333 gene locus_tag LOCUS_15120 36920 36333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 37312 36917 gene locus_tag LOCUS_15130 37312 36917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 >Feature sequence023 2787 532 gene locus_tag LOCUS_15140 2787 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 3182 2841 gene locus_tag LOCUS_15150 3182 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 3292 3375 gene locus_tag LOCUS_t00210 3292 3375 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3402 3779 gene locus_tag LOCUS_15160 3402 3779 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228875.1 protein_id gnl|my_center|LOCUS_15160 4875 3769 gene locus_tag LOCUS_15170 4875 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 6049 4868 gene locus_tag LOCUS_15180 gene trpB 6049 4868 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124343.1 protein_id gnl|my_center|LOCUS_15180 6744 6046 gene locus_tag LOCUS_15190 6744 6046 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932400.1 protein_id gnl|my_center|LOCUS_15190 8064 6754 gene locus_tag LOCUS_15200 8064 6754 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_15200 8877 8095 gene locus_tag LOCUS_15210 gene trpC 8877 8095 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_15210 8935 9903 gene locus_tag LOCUS_15220 gene corA 8935 9903 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259376.1 protein_id gnl|my_center|LOCUS_15220 11722 9881 gene locus_tag LOCUS_15230 11722 9881 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114739.1 protein_id gnl|my_center|LOCUS_15230 12153 11725 gene locus_tag LOCUS_15240 12153 11725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 13624 12167 gene locus_tag LOCUS_15250 13624 12167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 14387 13707 gene locus_tag LOCUS_15260 14387 13707 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228141.1 protein_id gnl|my_center|LOCUS_15260 14616 15464 gene locus_tag LOCUS_15270 14616 15464 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950459.1 protein_id gnl|my_center|LOCUS_15270 15663 16907 gene locus_tag LOCUS_15280 15663 16907 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730235.1 protein_id gnl|my_center|LOCUS_15280 16904 19282 gene locus_tag LOCUS_15290 16904 19282 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029390.1 protein_id gnl|my_center|LOCUS_15290 19298 19996 gene locus_tag LOCUS_15300 19298 19996 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730856.1 protein_id gnl|my_center|LOCUS_15300 19998 21416 gene locus_tag LOCUS_15310 19998 21416 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878477.1 protein_id gnl|my_center|LOCUS_15310 21533 23191 gene locus_tag LOCUS_15320 21533 23191 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551607.1 protein_id gnl|my_center|LOCUS_15320 25533 23227 gene locus_tag LOCUS_15330 25533 23227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 25641 26051 gene locus_tag LOCUS_15340 gene msrB 25641 26051 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090911.1 protein_id gnl|my_center|LOCUS_15340 26953 26117 gene locus_tag LOCUS_15350 26953 26117 CDS product histidine decarboxylase, pyruvoyl type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786245.1 protein_id gnl|my_center|LOCUS_15350 28436 26925 gene locus_tag LOCUS_15360 28436 26925 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947418.1 protein_id gnl|my_center|LOCUS_15360 28710 30662 gene locus_tag LOCUS_15370 28710 30662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 30859 31080 gene locus_tag LOCUS_15380 30859 31080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 32010 31228 gene locus_tag LOCUS_15390 32010 31228 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973205.1 protein_id gnl|my_center|LOCUS_15390 32229 33311 gene locus_tag LOCUS_15400 32229 33311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15400 33368 33922 gene locus_tag LOCUS_15410 33368 33922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 34128 33913 gene locus_tag LOCUS_15420 34128 33913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 34339 34136 gene locus_tag LOCUS_15430 34339 34136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 34244 36886 gene locus_tag LOCUS_15440 34244 36886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 >Feature sequence024 1660 686 gene locus_tag LOCUS_15450 gene fabD 1660 686 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962577.1 protein_id gnl|my_center|LOCUS_15450 2722 1745 gene locus_tag LOCUS_15460 2722 1745 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879275.1 protein_id gnl|my_center|LOCUS_15460 3795 2764 gene locus_tag LOCUS_15470 3795 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 3680 3901 gene locus_tag LOCUS_15480 3680 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 4081 4974 gene locus_tag LOCUS_15490 4081 4974 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_15490 4974 6158 gene locus_tag LOCUS_15500 4974 6158 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030944.1 protein_id gnl|my_center|LOCUS_15500 6158 6655 gene locus_tag LOCUS_15510 6158 6655 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_15510 7920 6622 gene locus_tag LOCUS_15520 gene mtaB 7920 6622 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_15520 8510 7956 gene locus_tag LOCUS_15530 8510 7956 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096372.1 protein_id gnl|my_center|LOCUS_15530 9710 8619 gene locus_tag LOCUS_15540 gene dnaJ 9710 8619 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_15540 10803 9730 gene locus_tag LOCUS_15550 gene hrcA 10803 9730 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123574708.1 protein_id gnl|my_center|LOCUS_15550 11992 10841 gene locus_tag LOCUS_15560 gene hemW 11992 10841 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087641.1 protein_id gnl|my_center|LOCUS_15560 13794 11992 gene locus_tag LOCUS_15570 gene lepA 13794 11992 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392118.1 protein_id gnl|my_center|LOCUS_15570 13890 14156 gene locus_tag LOCUS_15580 gene rpsT 13890 14156 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775769.1 protein_id gnl|my_center|LOCUS_15580 15123 14149 gene locus_tag LOCUS_15590 15123 14149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 15998 15123 gene locus_tag LOCUS_15600 15998 15123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 16987 15995 gene locus_tag LOCUS_15610 16987 15995 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_15610 18275 16995 gene locus_tag LOCUS_15620 18275 16995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 19377 18862 gene locus_tag LOCUS_15630 19377 18862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15630 21886 19574 gene locus_tag LOCUS_15640 21886 19574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 22408 21998 gene locus_tag LOCUS_15650 22408 21998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 24867 22405 gene locus_tag LOCUS_15660 gene leuS 24867 22405 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_15660 25035 26765 gene locus_tag LOCUS_15670 25035 26765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 26801 26875 gene locus_tag LOCUS_t00220 26801 26875 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 29319 26962 gene locus_tag LOCUS_15680 29319 26962 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776802.1 protein_id gnl|my_center|LOCUS_15680 29837 31951 gene locus_tag LOCUS_15690 29837 31951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 31948 32364 gene locus_tag LOCUS_15700 31948 32364 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878970.1 protein_id gnl|my_center|LOCUS_15700 32361 33530 gene locus_tag LOCUS_15710 32361 33530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 33497 33991 gene locus_tag LOCUS_15720 gene bfr 33497 33991 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908683.1 protein_id gnl|my_center|LOCUS_15720 34105 36342 gene locus_tag LOCUS_15730 34105 36342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence025 651 103 gene locus_tag LOCUS_15740 651 103 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584056.1 protein_id gnl|my_center|LOCUS_15740 720 1451 gene locus_tag LOCUS_15750 720 1451 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887469.1 protein_id gnl|my_center|LOCUS_15750 2168 1497 gene locus_tag LOCUS_15760 2168 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 3529 2165 gene locus_tag LOCUS_15770 3529 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 4371 3532 gene locus_tag LOCUS_15780 4371 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 5313 4471 gene locus_tag LOCUS_15790 5313 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 5538 6959 gene locus_tag LOCUS_15800 5538 6959 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029333.1 protein_id gnl|my_center|LOCUS_15800 8588 7050 gene locus_tag LOCUS_15810 8588 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 8738 10417 gene locus_tag LOCUS_15820 8738 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 10756 11799 gene locus_tag LOCUS_15830 10756 11799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 12178 11837 gene locus_tag LOCUS_15840 12178 11837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 12105 12491 gene locus_tag LOCUS_15850 12105 12491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 13347 12562 gene locus_tag LOCUS_15860 13347 12562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 14753 13476 gene locus_tag LOCUS_15870 14753 13476 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_15870 14919 15968 gene locus_tag LOCUS_15880 14919 15968 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_15880 15965 16768 gene locus_tag LOCUS_15890 15965 16768 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227726.1 protein_id gnl|my_center|LOCUS_15890 16875 17555 gene locus_tag LOCUS_15900 16875 17555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 17558 18601 gene locus_tag LOCUS_15910 17558 18601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 19705 18566 gene locus_tag LOCUS_15920 19705 18566 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533637.1 protein_id gnl|my_center|LOCUS_15920 20562 19774 gene locus_tag LOCUS_15930 20562 19774 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414497.1 protein_id gnl|my_center|LOCUS_15930 22821 20617 gene locus_tag LOCUS_15940 22821 20617 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144184.1 protein_id gnl|my_center|LOCUS_15940 26101 23111 gene locus_tag LOCUS_15950 26101 23111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 27098 26343 gene locus_tag LOCUS_15960 27098 26343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 27464 27150 gene locus_tag LOCUS_15970 27464 27150 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409778.1 protein_id gnl|my_center|LOCUS_15970 27616 27461 gene locus_tag LOCUS_15980 27616 27461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 28915 27773 gene locus_tag LOCUS_15990 28915 27773 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_15990 30740 29037 gene locus_tag LOCUS_16000 30740 29037 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_16000 31870 30737 gene locus_tag LOCUS_16010 31870 30737 CDS product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090843.1 protein_id gnl|my_center|LOCUS_16010 33129 32149 gene locus_tag LOCUS_16020 33129 32149 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266314.1 protein_id gnl|my_center|LOCUS_16020 33379 33618 gene locus_tag LOCUS_16030 33379 33618 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414620.1 protein_id gnl|my_center|LOCUS_16030 33639 34043 gene locus_tag LOCUS_16040 33639 34043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 34619 34275 gene locus_tag LOCUS_16050 34619 34275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 35256 34684 gene locus_tag LOCUS_16060 35256 34684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16060 >Feature sequence026 <1 650 gene locus_tag LOCUS_16070 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976192.1:rod shape-determining protein RodA 826 2604 gene locus_tag LOCUS_16080 826 2604 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_16080 2601 3347 gene locus_tag LOCUS_16090 2601 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16090 3616 3810 gene locus_tag LOCUS_16100 3616 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 3849 5081 gene locus_tag LOCUS_16110 3849 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16110 5213 5803 gene locus_tag LOCUS_16120 5213 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 5807 6061 gene locus_tag LOCUS_16130 gene rpmA 5807 6061 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060213.1 protein_id gnl|my_center|LOCUS_16130 6104 7363 gene locus_tag LOCUS_16140 gene obgE 6104 7363 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_16140 7360 8502 gene locus_tag LOCUS_16150 gene proB 7360 8502 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 protein_id gnl|my_center|LOCUS_16150 8538 9797 gene locus_tag LOCUS_16160 8538 9797 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_16160 9794 10669 gene locus_tag LOCUS_16170 9794 10669 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224865.1 protein_id gnl|my_center|LOCUS_16170 10669 11301 gene locus_tag LOCUS_16180 10669 11301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 11282 12757 gene locus_tag LOCUS_16190 11282 12757 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224866.1 protein_id gnl|my_center|LOCUS_16190 12758 13354 gene locus_tag LOCUS_16200 gene nadD 12758 13354 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_16200 13581 15242 gene locus_tag LOCUS_16210 13581 15242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 15343 15648 gene locus_tag LOCUS_16220 gene rsfS 15343 15648 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_16220 15681 16046 gene locus_tag LOCUS_16230 15681 16046 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172908.1 protein_id gnl|my_center|LOCUS_16230 16103 16435 gene locus_tag LOCUS_16240 16103 16435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 16453 17646 gene locus_tag LOCUS_16250 16453 17646 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225678.1 protein_id gnl|my_center|LOCUS_16250 19264 17690 gene locus_tag LOCUS_16260 19264 17690 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_16260 19172 19357 gene locus_tag LOCUS_16270 19172 19357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 19454 20836 gene locus_tag LOCUS_16280 19454 20836 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_16280 20860 21531 gene locus_tag LOCUS_16290 20860 21531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 21570 22133 gene locus_tag LOCUS_16300 21570 22133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 22178 24181 gene locus_tag LOCUS_16310 22178 24181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 24957 24163 gene locus_tag LOCUS_16320 24957 24163 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731455.1 protein_id gnl|my_center|LOCUS_16320 25036 26085 gene locus_tag LOCUS_16330 25036 26085 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330812.1 protein_id gnl|my_center|LOCUS_16330 26619 26095 gene locus_tag LOCUS_16340 gene cysC 26619 26095 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140515.1 protein_id gnl|my_center|LOCUS_16340 27619 26648 gene locus_tag LOCUS_16350 27619 26648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 28773 27637 gene locus_tag LOCUS_16360 28773 27637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 29897 28770 gene locus_tag LOCUS_16370 29897 28770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 32278 29948 gene locus_tag LOCUS_16380 32278 29948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 32632 33459 gene locus_tag LOCUS_16390 32632 33459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 <36183 33474 gene locus_tag LOCUS_16400 <36183 33474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000705149.1:O antigen biosynthesis rhamnosyltransferase RfbN >Feature sequence027 466 1848 gene locus_tag LOCUS_16410 466 1848 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014824.1 protein_id gnl|my_center|LOCUS_16410 1924 3048 gene locus_tag LOCUS_16420 gene ispG 1924 3048 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 protein_id gnl|my_center|LOCUS_16420 3205 3663 gene locus_tag LOCUS_16430 gene rimP 3205 3663 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231915.1 protein_id gnl|my_center|LOCUS_16430 3676 4860 gene locus_tag LOCUS_16440 gene nusA 3676 4860 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_16440 4914 5141 gene locus_tag LOCUS_16450 4914 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 5119 7908 gene locus_tag LOCUS_16460 5119 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 7959 8255 gene locus_tag LOCUS_16470 7959 8255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 8262 8642 gene locus_tag LOCUS_16480 gene rbfA 8262 8642 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545236.1 protein_id gnl|my_center|LOCUS_16480 8642 9631 gene locus_tag LOCUS_16490 gene nrnA 8642 9631 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414507.1 protein_id gnl|my_center|LOCUS_16490 9628 10542 gene locus_tag LOCUS_16500 gene truB 9628 10542 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942236.1 protein_id gnl|my_center|LOCUS_16500 10583 11515 gene locus_tag LOCUS_16510 10583 11515 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121910865.1 protein_id gnl|my_center|LOCUS_16510 11512 12126 gene locus_tag LOCUS_16520 11512 12126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 12599 13783 gene locus_tag LOCUS_16530 12599 13783 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230547.1 protein_id gnl|my_center|LOCUS_16530 13824 14153 gene locus_tag LOCUS_16540 gene rpsO 13824 14153 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392569.1 protein_id gnl|my_center|LOCUS_16540 14325 17102 gene locus_tag LOCUS_16550 14325 17102 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414124.1 protein_id gnl|my_center|LOCUS_16550 16923 17086 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggaaaccgtggaggcggcgg 17148 18404 gene locus_tag LOCUS_16560 17148 18404 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_16560 18465 19232 gene locus_tag LOCUS_16570 gene dapB 18465 19232 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081787.1 protein_id gnl|my_center|LOCUS_16570 19296 21575 gene locus_tag LOCUS_16580 19296 21575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 21945 22592 gene locus_tag LOCUS_16590 21945 22592 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112853.1 protein_id gnl|my_center|LOCUS_16590 22606 23721 gene locus_tag LOCUS_16600 22606 23721 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_16600 23843 24403 gene locus_tag LOCUS_16610 23843 24403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 25088 24471 gene locus_tag LOCUS_16620 25088 24471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 26324 26037 gene locus_tag LOCUS_16630 26324 26037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 26244 26552 gene locus_tag LOCUS_16640 26244 26552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 26658 26731 gene locus_tag LOCUS_t00230 26658 26731 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 26766 26838 gene locus_tag LOCUS_t00240 26766 26838 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 28175 26838 gene locus_tag LOCUS_16650 28175 26838 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582827.1 protein_id gnl|my_center|LOCUS_16650 28439 28176 gene locus_tag LOCUS_16660 28439 28176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 28529 28601 gene locus_tag LOCUS_t00250 28529 28601 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 28704 29039 gene locus_tag LOCUS_16670 28704 29039 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_16670 29023 29424 gene locus_tag LOCUS_16680 29023 29424 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249914.1 protein_id gnl|my_center|LOCUS_16680 29425 29766 gene locus_tag LOCUS_16690 29425 29766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 29763 30059 gene locus_tag LOCUS_16700 29763 30059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 30116 30361 gene locus_tag LOCUS_16710 30116 30361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 30603 31358 gene locus_tag LOCUS_16720 30603 31358 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081911.1 protein_id gnl|my_center|LOCUS_16720 31440 32543 gene locus_tag LOCUS_16730 31440 32543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227554.1 protein_id gnl|my_center|LOCUS_16730 32610 33056 gene locus_tag LOCUS_16740 32610 33056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 33096 33491 gene locus_tag LOCUS_16750 33096 33491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 33966 33523 gene locus_tag LOCUS_16760 33966 33523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 34561 34217 gene locus_tag LOCUS_16770 34561 34217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 34692 34501 gene locus_tag LOCUS_16780 34692 34501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 35220 34873 gene locus_tag LOCUS_16790 35220 34873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence028 3039 229 gene locus_tag LOCUS_16800 3039 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 3115 3360 gene locus_tag LOCUS_16810 3115 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 3722 4135 gene locus_tag LOCUS_16820 3722 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 4163 5035 gene locus_tag LOCUS_16830 4163 5035 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919111.1 protein_id gnl|my_center|LOCUS_16830 9425 5085 gene locus_tag LOCUS_16840 9425 5085 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200903603.1 protein_id gnl|my_center|LOCUS_16840 9588 10220 gene locus_tag LOCUS_16850 9588 10220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 10879 10292 gene locus_tag LOCUS_16860 10879 10292 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 protein_id gnl|my_center|LOCUS_16860 11186 12940 gene locus_tag LOCUS_16870 11186 12940 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284399.1 protein_id gnl|my_center|LOCUS_16870 12937 13488 gene locus_tag LOCUS_16880 gene ilvN 12937 13488 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_16880 13632 14474 gene locus_tag LOCUS_16890 13632 14474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 14480 15535 gene locus_tag LOCUS_16900 14480 15535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 16159 15548 gene locus_tag LOCUS_16910 16159 15548 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867997.1 protein_id gnl|my_center|LOCUS_16910 16349 17194 gene locus_tag LOCUS_16920 16349 17194 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111464.1 protein_id gnl|my_center|LOCUS_16920 17194 18051 gene locus_tag LOCUS_16930 17194 18051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 18592 18302 gene locus_tag LOCUS_16940 18592 18302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 18512 18844 gene locus_tag LOCUS_16950 18512 18844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 18810 19364 gene locus_tag LOCUS_16960 18810 19364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 19780 19262 gene locus_tag LOCUS_16970 19780 19262 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583140.1 protein_id gnl|my_center|LOCUS_16970 20772 19852 gene locus_tag LOCUS_16980 gene panB 20772 19852 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_16980 21451 20738 gene locus_tag LOCUS_16990 21451 20738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 22107 21457 gene locus_tag LOCUS_17000 22107 21457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 24449 22191 gene locus_tag LOCUS_17010 24449 22191 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777144.1 protein_id gnl|my_center|LOCUS_17010 25091 24729 gene locus_tag LOCUS_17020 25091 24729 CDS product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323592.1 protein_id gnl|my_center|LOCUS_17020 26324 25218 gene locus_tag LOCUS_17030 26324 25218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 27693 26308 gene locus_tag LOCUS_17040 27693 26308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 28183 27695 gene locus_tag LOCUS_17050 28183 27695 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222510.1 protein_id gnl|my_center|LOCUS_17050 28359 28441 gene locus_tag LOCUS_t00260 28359 28441 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 28654 29388 gene locus_tag LOCUS_17060 28654 29388 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_17060 29532 29605 gene locus_tag LOCUS_t00270 29532 29605 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 29608 29682 gene locus_tag LOCUS_t00280 29608 29682 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 29791 30174 gene locus_tag LOCUS_17070 29791 30174 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096263.1 protein_id gnl|my_center|LOCUS_17070 30215 30376 gene locus_tag LOCUS_17080 gene rpmG 30215 30376 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005152047.1 protein_id gnl|my_center|LOCUS_17080 30401 30817 gene locus_tag LOCUS_17090 30401 30817 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285884.1 protein_id gnl|my_center|LOCUS_17090 30804 31238 gene locus_tag LOCUS_17100 30804 31238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 31301 31876 gene locus_tag LOCUS_17110 31301 31876 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_17110 31877 32284 gene locus_tag LOCUS_17120 31877 32284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 32348 33982 gene locus_tag LOCUS_17130 32348 33982 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112402.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence029 384 457 gene locus_tag LOCUS_t00290 384 457 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 517 594 gene locus_tag LOCUS_t00300 517 594 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2245 587 gene locus_tag LOCUS_17140 2245 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 2344 3366 gene locus_tag LOCUS_17150 2344 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 3383 4387 gene locus_tag LOCUS_17160 3383 4387 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085728.1 protein_id gnl|my_center|LOCUS_17160 4381 4752 gene locus_tag LOCUS_17170 4381 4752 CDS product DUF6285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728129.1 protein_id gnl|my_center|LOCUS_17170 5494 4754 gene locus_tag LOCUS_17180 5494 4754 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256806.1 protein_id gnl|my_center|LOCUS_17180 5677 5751 gene locus_tag LOCUS_t00310 5677 5751 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5856 9335 gene locus_tag LOCUS_17190 5856 9335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 9349 9975 gene locus_tag LOCUS_17200 9349 9975 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225626.1 protein_id gnl|my_center|LOCUS_17200 10032 10114 gene locus_tag LOCUS_t00320 10032 10114 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10762 10115 gene locus_tag LOCUS_17210 gene rdgB 10762 10115 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932022.1 protein_id gnl|my_center|LOCUS_17210 11586 10762 gene locus_tag LOCUS_17220 gene rph 11586 10762 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942439.1 protein_id gnl|my_center|LOCUS_17220 12326 11583 gene locus_tag LOCUS_17230 12326 11583 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_17230 13177 12323 gene locus_tag LOCUS_17240 gene murI 13177 12323 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730179.1 protein_id gnl|my_center|LOCUS_17240 14131 13199 gene locus_tag LOCUS_17250 14131 13199 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229459.1 protein_id gnl|my_center|LOCUS_17250 14427 14155 gene locus_tag LOCUS_17260 14427 14155 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975899.1 protein_id gnl|my_center|LOCUS_17260 14882 14547 gene locus_tag LOCUS_17270 14882 14547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 15698 14979 gene locus_tag LOCUS_17280 15698 14979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 17004 15685 gene locus_tag LOCUS_17290 17004 15685 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_17290 17114 19009 gene locus_tag LOCUS_17300 17114 19009 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_17300 21978 19006 gene locus_tag LOCUS_17310 21978 19006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 24442 22091 gene locus_tag LOCUS_17320 24442 22091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 24435 25235 gene locus_tag LOCUS_17330 gene ppk2 24435 25235 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705561.1 protein_id gnl|my_center|LOCUS_17330 25299 26942 gene locus_tag LOCUS_17340 25299 26942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 27005 27655 gene locus_tag LOCUS_17350 27005 27655 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092058.1 protein_id gnl|my_center|LOCUS_17350 28789 27626 gene locus_tag LOCUS_17360 28789 27626 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225711.1 protein_id gnl|my_center|LOCUS_17360 31575 28795 gene locus_tag LOCUS_17370 31575 28795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 32636 31605 gene locus_tag LOCUS_17380 gene narH 32636 31605 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092958.1 protein_id gnl|my_center|LOCUS_17380 33247 32633 gene locus_tag LOCUS_17390 33247 32633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence030 951 247 gene locus_tag LOCUS_17400 951 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 1394 948 gene locus_tag LOCUS_17410 1394 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 1886 1401 gene locus_tag LOCUS_17420 1886 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 2334 2047 gene locus_tag LOCUS_17430 2334 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 2221 3609 gene locus_tag LOCUS_17440 gene purH 2221 3609 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393540.1 protein_id gnl|my_center|LOCUS_17440 3627 4484 gene locus_tag LOCUS_17450 3627 4484 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_17450 4495 5391 gene locus_tag LOCUS_17460 4495 5391 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_17460 5555 6337 gene locus_tag LOCUS_17470 5555 6337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 6432 10823 gene locus_tag LOCUS_17480 6432 10823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 10866 12302 gene locus_tag LOCUS_17490 gene proS 10866 12302 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583195.1 protein_id gnl|my_center|LOCUS_17490 12335 13267 gene locus_tag LOCUS_17500 gene mdh 12335 13267 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404318.1 protein_id gnl|my_center|LOCUS_17500 13294 14007 gene locus_tag LOCUS_17510 13294 14007 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250671.1 protein_id gnl|my_center|LOCUS_17510 15694 13973 gene locus_tag LOCUS_17520 15694 13973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 15788 16558 gene locus_tag LOCUS_17530 15788 16558 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730375.1 protein_id gnl|my_center|LOCUS_17530 16580 17512 gene locus_tag LOCUS_17540 16580 17512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 17524 18726 gene locus_tag LOCUS_17550 17524 18726 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393149.1 protein_id gnl|my_center|LOCUS_17550 21733 18800 gene locus_tag LOCUS_17560 21733 18800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 23156 22164 gene locus_tag LOCUS_17570 23156 22164 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392272.1 protein_id gnl|my_center|LOCUS_17570 23924 23163 gene locus_tag LOCUS_17580 23924 23163 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250671.1 protein_id gnl|my_center|LOCUS_17580 24410 23973 gene locus_tag LOCUS_17590 24410 23973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 24473 24760 gene locus_tag LOCUS_17600 24473 24760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 29173 24971 gene locus_tag LOCUS_17610 29173 24971 CDS product alpha-(1->3)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229292.1 protein_id gnl|my_center|LOCUS_17610 29257 29424 gene locus_tag LOCUS_17620 29257 29424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 30201 29398 gene locus_tag LOCUS_17630 30201 29398 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229286.1 protein_id gnl|my_center|LOCUS_17630 31517 30198 gene locus_tag LOCUS_17640 31517 30198 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250670.1 protein_id gnl|my_center|LOCUS_17640 <32716 31514 gene locus_tag LOCUS_17650 <32716 31514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726835.1:glycosyltransferase family 4 protein >Feature sequence031 1460 279 gene locus_tag LOCUS_17660 1460 279 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223470.1 protein_id gnl|my_center|LOCUS_17660 3475 1511 gene locus_tag LOCUS_17670 3475 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 3600 4544 gene locus_tag LOCUS_17680 3600 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 4641 6170 gene locus_tag LOCUS_17690 4641 6170 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145161935.1 protein_id gnl|my_center|LOCUS_17690 6180 6416 gene locus_tag LOCUS_17700 6180 6416 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667146.1 protein_id gnl|my_center|LOCUS_17700 6409 7563 gene locus_tag LOCUS_17710 gene xylA 6409 7563 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_17710 7575 7934 gene locus_tag LOCUS_17720 7575 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 8021 8497 gene locus_tag LOCUS_17730 8021 8497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 8632 10464 gene locus_tag LOCUS_17740 8632 10464 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404064.1 protein_id gnl|my_center|LOCUS_17740 15183 10477 gene locus_tag LOCUS_17750 15183 10477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 15367 16269 gene locus_tag LOCUS_17760 15367 16269 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731198.1 protein_id gnl|my_center|LOCUS_17760 16373 16792 gene locus_tag LOCUS_17770 16373 16792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 16960 17583 gene locus_tag LOCUS_17780 16960 17583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 17731 18258 gene locus_tag LOCUS_17790 17731 18258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 18283 19110 gene locus_tag LOCUS_17800 18283 19110 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729929.1 protein_id gnl|my_center|LOCUS_17800 19110 19787 gene locus_tag LOCUS_17810 19110 19787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 19784 20833 gene locus_tag LOCUS_17820 19784 20833 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728353.1 protein_id gnl|my_center|LOCUS_17820 20830 22101 gene locus_tag LOCUS_17830 20830 22101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 22098 23621 gene locus_tag LOCUS_17840 22098 23621 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_17840 23666 24946 gene locus_tag LOCUS_17850 23666 24946 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123295.1 protein_id gnl|my_center|LOCUS_17850 25559 24954 gene locus_tag LOCUS_17860 25559 24954 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_17860 25778 25653 gene locus_tag LOCUS_17870 25778 25653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 26539 25775 gene locus_tag LOCUS_17880 26539 25775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 26709 26846 gene locus_tag LOCUS_17890 26709 26846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 27262 26996 gene locus_tag LOCUS_17900 27262 26996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 28462 27287 gene locus_tag LOCUS_17910 28462 27287 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226452.1 protein_id gnl|my_center|LOCUS_17910 28693 29664 gene locus_tag LOCUS_17920 28693 29664 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_17920 29661 30095 gene locus_tag LOCUS_17930 29661 30095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence032 1103 126 gene locus_tag LOCUS_17940 1103 126 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_17940 1507 1103 gene locus_tag LOCUS_17950 1507 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 2349 1510 gene locus_tag LOCUS_17960 2349 1510 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_17960 2498 3604 gene locus_tag LOCUS_17970 2498 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 3970 3617 gene locus_tag LOCUS_17980 3970 3617 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_17980 4285 3995 gene locus_tag LOCUS_17990 4285 3995 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_17990 5113 4376 gene locus_tag LOCUS_18000 gene lepB 5113 4376 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929024.1 protein_id gnl|my_center|LOCUS_18000 5455 5114 gene locus_tag LOCUS_18010 gene rplS 5455 5114 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223853.1 protein_id gnl|my_center|LOCUS_18010 6388 5624 gene locus_tag LOCUS_18020 gene trmD 6388 5624 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_18020 7002 6385 gene locus_tag LOCUS_18030 gene rimM 7002 6385 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414726.1 protein_id gnl|my_center|LOCUS_18030 7371 7009 gene locus_tag LOCUS_18040 7371 7009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 7905 7372 gene locus_tag LOCUS_18050 7905 7372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 9411 8059 gene locus_tag LOCUS_18060 gene ffh 9411 8059 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_18060 10615 9443 gene locus_tag LOCUS_18070 gene ftsY 10615 9443 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_18070 14145 10630 gene locus_tag LOCUS_18080 gene smc 14145 10630 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908442.1 protein_id gnl|my_center|LOCUS_18080 15337 14237 gene locus_tag LOCUS_18090 15337 14237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 16258 15422 gene locus_tag LOCUS_18100 gene mutM 16258 15422 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_18100 17018 16251 gene locus_tag LOCUS_18110 gene rnc 17018 16251 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_18110 18145 17015 gene locus_tag LOCUS_18120 gene plsX 18145 17015 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173767.1 protein_id gnl|my_center|LOCUS_18120 19271 18549 gene locus_tag LOCUS_18130 19271 18549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 19755 19264 gene locus_tag LOCUS_18140 gene coaD 19755 19264 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728327.1 protein_id gnl|my_center|LOCUS_18140 20304 19765 gene locus_tag LOCUS_18150 gene rsmD 20304 19765 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 protein_id gnl|my_center|LOCUS_18150 21774 20464 gene locus_tag LOCUS_18160 21774 20464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 22555 21836 gene locus_tag LOCUS_18170 22555 21836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 23793 22549 gene locus_tag LOCUS_18180 23793 22549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 23973 25439 gene locus_tag LOCUS_18190 23973 25439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 27571 25436 gene locus_tag LOCUS_18200 gene recG 27571 25436 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141278.1 protein_id gnl|my_center|LOCUS_18200 29119 27581 gene locus_tag LOCUS_18210 29119 27581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 29892 29143 gene locus_tag LOCUS_18220 29892 29143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 31197 29893 gene locus_tag LOCUS_18230 31197 29893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 32157 31504 gene locus_tag LOCUS_18240 32157 31504 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence033 1101 238 gene locus_tag LOCUS_18250 1101 238 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730384.1 protein_id gnl|my_center|LOCUS_18250 1258 1905 gene locus_tag LOCUS_18260 1258 1905 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 protein_id gnl|my_center|LOCUS_18260 1989 4481 gene locus_tag LOCUS_18270 1989 4481 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027759.1 protein_id gnl|my_center|LOCUS_18270 4524 4907 gene locus_tag LOCUS_18280 gene gcvH 4524 4907 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393442.1 protein_id gnl|my_center|LOCUS_18280 5004 5468 gene locus_tag LOCUS_18290 5004 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 5478 6197 gene locus_tag LOCUS_18300 5478 6197 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027756.1 protein_id gnl|my_center|LOCUS_18300 6235 6828 gene locus_tag LOCUS_18310 gene hpt 6235 6828 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 protein_id gnl|my_center|LOCUS_18310 6825 7385 gene locus_tag LOCUS_18320 6825 7385 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_18320 7536 8039 gene locus_tag LOCUS_18330 7536 8039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 8172 8489 gene locus_tag LOCUS_18340 8172 8489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 8628 9620 gene locus_tag LOCUS_18350 gene gcvT 8628 9620 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085318.1 protein_id gnl|my_center|LOCUS_18350 9887 11221 gene locus_tag LOCUS_18360 gene gcvPA 9887 11221 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933289.1 protein_id gnl|my_center|LOCUS_18360 11218 11478 gene locus_tag LOCUS_18370 11218 11478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 11791 11660 gene locus_tag LOCUS_18380 11791 11660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 11840 13075 gene locus_tag LOCUS_18390 gene gcvPB 11840 13075 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230209.1 protein_id gnl|my_center|LOCUS_18390 13236 13649 gene locus_tag LOCUS_18400 13236 13649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 13646 14599 gene locus_tag LOCUS_18410 gene lgt 13646 14599 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389930.1 protein_id gnl|my_center|LOCUS_18410 15667 14600 gene locus_tag LOCUS_18420 15667 14600 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922313.1 protein_id gnl|my_center|LOCUS_18420 15701 17200 gene locus_tag LOCUS_18430 15701 17200 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077101.1 protein_id gnl|my_center|LOCUS_18430 18993 17329 gene locus_tag LOCUS_18440 18993 17329 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896832.1 protein_id gnl|my_center|LOCUS_18440 19336 19884 gene locus_tag LOCUS_18450 19336 19884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 22566 19906 gene locus_tag LOCUS_18460 22566 19906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 22708 24288 gene locus_tag LOCUS_18470 22708 24288 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098014.1 protein_id gnl|my_center|LOCUS_18470 24439 25089 gene locus_tag LOCUS_18480 24439 25089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 25451 25209 gene locus_tag LOCUS_18490 25451 25209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 25335 26699 gene locus_tag LOCUS_18500 25335 26699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 26712 29876 gene locus_tag LOCUS_18510 26712 29876 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284781.1 protein_id gnl|my_center|LOCUS_18510 29899 29973 gene locus_tag LOCUS_t00330 29899 29973 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 30382 30020 gene locus_tag LOCUS_18520 30382 30020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 <31016 30372 gene locus_tag LOCUS_18530 <31016 30372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890425.1:sulfite exporter TauE/SafE family protein >Feature sequence034 741 124 gene locus_tag LOCUS_18540 741 124 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409568.1 protein_id gnl|my_center|LOCUS_18540 1596 811 gene locus_tag LOCUS_18550 1596 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 1817 3058 gene locus_tag LOCUS_18560 1817 3058 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061151682.1 protein_id gnl|my_center|LOCUS_18560 3187 4740 gene locus_tag LOCUS_18570 3187 4740 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892286.1 protein_id gnl|my_center|LOCUS_18570 4737 5174 gene locus_tag LOCUS_18580 4737 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 7784 5328 gene locus_tag LOCUS_18590 7784 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18590 8082 7819 gene locus_tag LOCUS_18600 8082 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 11003 8166 gene locus_tag LOCUS_18610 11003 8166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 12366 11164 gene locus_tag LOCUS_18620 12366 11164 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879903.1 protein_id gnl|my_center|LOCUS_18620 13181 12396 gene locus_tag LOCUS_18630 13181 12396 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461805.1 protein_id gnl|my_center|LOCUS_18630 14824 13259 gene locus_tag LOCUS_18640 14824 13259 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892286.1 protein_id gnl|my_center|LOCUS_18640 16089 14824 gene locus_tag LOCUS_18650 16089 14824 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815636.1 protein_id gnl|my_center|LOCUS_18650 17329 16121 gene locus_tag LOCUS_18660 17329 16121 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878348.1 protein_id gnl|my_center|LOCUS_18660 18022 17339 gene locus_tag LOCUS_18670 18022 17339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 19222 18104 gene locus_tag LOCUS_18680 gene narH 19222 18104 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487116.1 protein_id gnl|my_center|LOCUS_18680 19910 19284 gene locus_tag LOCUS_18690 19910 19284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 22752 19927 gene locus_tag LOCUS_18700 22752 19927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 23566 22907 gene locus_tag LOCUS_18710 23566 22907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 24051 23566 gene locus_tag LOCUS_18720 gene mobB 24051 23566 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 protein_id gnl|my_center|LOCUS_18720 24480 24052 gene locus_tag LOCUS_18730 24480 24052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 26148 24547 gene locus_tag LOCUS_18740 26148 24547 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_18740 26345 27958 gene locus_tag LOCUS_18750 26345 27958 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140397.1 protein_id gnl|my_center|LOCUS_18750 28032 28472 gene locus_tag LOCUS_18760 28032 28472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 30027 28525 gene locus_tag LOCUS_18770 30027 28525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence035 1143 1502 gene locus_tag LOCUS_18780 1143 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1839 1558 gene locus_tag LOCUS_18790 1839 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 1962 2801 gene locus_tag LOCUS_18800 gene uppP 1962 2801 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_18800 2834 4297 gene locus_tag LOCUS_18810 2834 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 4285 6978 gene locus_tag LOCUS_18820 gene fdhF 4285 6978 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338701.1 protein_id gnl|my_center|LOCUS_18820 7085 7360 gene locus_tag LOCUS_18830 7085 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 7363 7755 gene locus_tag LOCUS_18840 7363 7755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 8297 7800 gene locus_tag LOCUS_18850 8297 7800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 8952 8305 gene locus_tag LOCUS_18860 8952 8305 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087647.1 protein_id gnl|my_center|LOCUS_18860 9478 9014 gene locus_tag LOCUS_18870 9478 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 10609 9800 gene locus_tag LOCUS_18880 10609 9800 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_18880 10945 10613 gene locus_tag LOCUS_18890 10945 10613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 10999 11658 gene locus_tag LOCUS_18900 gene plsY 10999 11658 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_18900 11680 12591 gene locus_tag LOCUS_18910 gene galU 11680 12591 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937189.1 protein_id gnl|my_center|LOCUS_18910 12610 13101 gene locus_tag LOCUS_18920 gene moaC 12610 13101 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093030.1 protein_id gnl|my_center|LOCUS_18920 13522 14244 gene locus_tag LOCUS_18930 13522 14244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 14268 14906 gene locus_tag LOCUS_18940 14268 14906 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868496.1 protein_id gnl|my_center|LOCUS_18940 14953 15027 gene locus_tag LOCUS_t00340 14953 15027 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 15266 16954 gene locus_tag LOCUS_18950 15266 16954 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_18950 17041 18225 gene locus_tag LOCUS_18960 17041 18225 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 protein_id gnl|my_center|LOCUS_18960 18741 19751 gene locus_tag LOCUS_18970 18741 19751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 19755 20612 gene locus_tag LOCUS_18980 19755 20612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 20652 20909 gene locus_tag LOCUS_18990 20652 20909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 20909 23188 gene locus_tag LOCUS_19000 20909 23188 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932366.1 protein_id gnl|my_center|LOCUS_19000 23185 23316 gene locus_tag LOCUS_19010 23185 23316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 23331 24707 gene locus_tag LOCUS_19020 23331 24707 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767538.1 protein_id gnl|my_center|LOCUS_19020 24652 25278 gene locus_tag LOCUS_19030 24652 25278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 25323 26570 gene locus_tag LOCUS_19040 25323 26570 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence036 147 1118 gene locus_tag LOCUS_19050 147 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 1115 2068 gene locus_tag LOCUS_19060 1115 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 2065 2241 gene locus_tag LOCUS_19070 2065 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 2274 3116 gene locus_tag LOCUS_19080 2274 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 3116 4057 gene locus_tag LOCUS_19090 3116 4057 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419775.1 protein_id gnl|my_center|LOCUS_19090 4054 5508 gene locus_tag LOCUS_19100 4054 5508 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918454.1 protein_id gnl|my_center|LOCUS_19100 6493 5480 gene locus_tag LOCUS_19110 6493 5480 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768670.1 protein_id gnl|my_center|LOCUS_19110 6538 7341 gene locus_tag LOCUS_19120 6538 7341 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068264628.1 protein_id gnl|my_center|LOCUS_19120 7365 8006 gene locus_tag LOCUS_19130 7365 8006 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227889.1 protein_id gnl|my_center|LOCUS_19130 8988 8014 gene locus_tag LOCUS_19140 8988 8014 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899889.1 protein_id gnl|my_center|LOCUS_19140 9785 9000 gene locus_tag LOCUS_19150 9785 9000 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_19150 10078 10857 gene locus_tag LOCUS_19160 gene galT 10078 10857 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_19160 11779 10844 gene locus_tag LOCUS_19170 gene meaB 11779 10844 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_19170 12021 11785 gene locus_tag LOCUS_19180 12021 11785 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015102.1 protein_id gnl|my_center|LOCUS_19180 13718 12069 gene locus_tag LOCUS_19190 13718 12069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 13793 14671 gene locus_tag LOCUS_19200 13793 14671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 14685 15590 gene locus_tag LOCUS_19210 14685 15590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 15629 16081 gene locus_tag LOCUS_19220 15629 16081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 17394 16078 gene locus_tag LOCUS_19230 gene thiC 17394 16078 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326663.1 protein_id gnl|my_center|LOCUS_19230 17497 18090 gene locus_tag LOCUS_19240 17497 18090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 18090 18830 gene locus_tag LOCUS_19250 18090 18830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 19861 18827 gene locus_tag LOCUS_19260 19861 18827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 20045 20995 gene locus_tag LOCUS_19270 20045 20995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 22109 21000 gene locus_tag LOCUS_19280 22109 21000 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258545.1 protein_id gnl|my_center|LOCUS_19280 22221 23717 gene locus_tag LOCUS_19290 22221 23717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 24436 23714 gene locus_tag LOCUS_19300 24436 23714 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_19300 25407 24451 gene locus_tag LOCUS_19310 25407 24451 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403373.1 protein_id gnl|my_center|LOCUS_19310 26696 25407 gene locus_tag LOCUS_19320 26696 25407 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_19320 26771 28711 gene locus_tag LOCUS_19330 26771 28711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 28708 29838 gene locus_tag LOCUS_19340 28708 29838 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222922.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence037 151 1161 gene locus_tag LOCUS_19350 151 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 1363 1181 gene locus_tag LOCUS_19360 1363 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 1274 1615 gene locus_tag LOCUS_19370 1274 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 2971 1691 gene locus_tag LOCUS_19380 2971 1691 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726776.1 protein_id gnl|my_center|LOCUS_19380 3240 4358 gene locus_tag LOCUS_19390 3240 4358 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230990.1 protein_id gnl|my_center|LOCUS_19390 4359 5297 gene locus_tag LOCUS_19400 4359 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 9160 5324 gene locus_tag LOCUS_19410 9160 5324 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967237.1 protein_id gnl|my_center|LOCUS_19410 9360 11387 gene locus_tag LOCUS_19420 9360 11387 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141209.1 protein_id gnl|my_center|LOCUS_19420 11501 12424 gene locus_tag LOCUS_19430 11501 12424 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_19430 13832 12438 gene locus_tag LOCUS_19440 13832 12438 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_19440 14717 13968 gene locus_tag LOCUS_19450 14717 13968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 15942 14854 gene locus_tag LOCUS_19460 15942 14854 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228908.1 protein_id gnl|my_center|LOCUS_19460 16263 17018 gene locus_tag LOCUS_19470 16263 17018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 17015 19108 gene locus_tag LOCUS_19480 17015 19108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 19098 19589 gene locus_tag LOCUS_19490 19098 19589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 19652 21274 gene locus_tag LOCUS_19500 19652 21274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 21271 21891 gene locus_tag LOCUS_19510 gene sigM 21271 21891 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029295.1 protein_id gnl|my_center|LOCUS_19510 21888 22718 gene locus_tag LOCUS_19520 21888 22718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 22852 23289 gene locus_tag LOCUS_19530 22852 23289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 23383 24348 gene locus_tag LOCUS_19540 gene trxB 23383 24348 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231058.1 protein_id gnl|my_center|LOCUS_19540 24462 24788 gene locus_tag LOCUS_19550 gene trxA 24462 24788 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082899.1 protein_id gnl|my_center|LOCUS_19550 24921 26042 gene locus_tag LOCUS_19560 24921 26042 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231059.1 protein_id gnl|my_center|LOCUS_19560 27067 26039 gene locus_tag LOCUS_19570 27067 26039 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231063.1 protein_id gnl|my_center|LOCUS_19570 27764 27060 gene locus_tag LOCUS_19580 27764 27060 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_19580 27699 27869 gene locus_tag LOCUS_19590 27699 27869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 28659 27967 gene locus_tag LOCUS_19600 28659 27967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 29435 28746 gene locus_tag LOCUS_19610 29435 28746 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393997.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence038 652 299 gene locus_tag LOCUS_19620 652 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 966 1583 gene locus_tag LOCUS_19630 966 1583 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_19630 1736 2164 gene locus_tag LOCUS_19640 1736 2164 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339592.1 protein_id gnl|my_center|LOCUS_19640 2145 3371 gene locus_tag LOCUS_19650 2145 3371 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_19650 4128 3361 gene locus_tag LOCUS_19660 4128 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 4379 4134 gene locus_tag LOCUS_19670 4379 4134 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205394.1 protein_id gnl|my_center|LOCUS_19670 4917 5861 gene locus_tag LOCUS_19680 4917 5861 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 protein_id gnl|my_center|LOCUS_19680 5854 6252 gene locus_tag LOCUS_19690 5854 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 6441 7538 gene locus_tag LOCUS_19700 6441 7538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 7587 8468 gene locus_tag LOCUS_19710 7587 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 8684 8821 gene locus_tag LOCUS_19720 8684 8821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 8845 9966 gene locus_tag LOCUS_19730 8845 9966 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528974.1 protein_id gnl|my_center|LOCUS_19730 9966 11069 gene locus_tag LOCUS_19740 9966 11069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 11301 11630 gene locus_tag LOCUS_19750 11301 11630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 11656 12117 gene locus_tag LOCUS_19760 11656 12117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 12129 12674 gene locus_tag LOCUS_19770 12129 12674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 13685 13449 gene locus_tag LOCUS_19780 13685 13449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 14270 14572 gene locus_tag LOCUS_19790 14270 14572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024889622.1 protein_id gnl|my_center|LOCUS_19790 14865 15029 gene locus_tag LOCUS_19800 14865 15029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 18450 15142 gene locus_tag LOCUS_19810 18450 15142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 18654 19070 gene locus_tag LOCUS_19820 18654 19070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 19080 19424 gene locus_tag LOCUS_19830 19080 19424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 19428 19667 gene locus_tag LOCUS_19840 19428 19667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 19664 20095 gene locus_tag LOCUS_19850 19664 20095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 20092 20535 gene locus_tag LOCUS_19860 20092 20535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 20532 22175 gene locus_tag LOCUS_19870 20532 22175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 22189 23058 gene locus_tag LOCUS_19880 22189 23058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 23055 23639 gene locus_tag LOCUS_19890 23055 23639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 23868 24680 gene locus_tag LOCUS_19900 23868 24680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 24784 25413 gene locus_tag LOCUS_19910 24784 25413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 25890 25432 gene locus_tag LOCUS_19920 25890 25432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 26633 25908 gene locus_tag LOCUS_19930 26633 25908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 28053 26830 gene locus_tag LOCUS_19940 28053 26830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence039 455 144 gene locus_tag LOCUS_19950 455 144 CDS product glutamine synthetase/cystathionine beta-lyase binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228759.1 protein_id gnl|my_center|LOCUS_19950 912 490 gene locus_tag LOCUS_19960 912 490 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258944.1 protein_id gnl|my_center|LOCUS_19960 984 3824 gene locus_tag LOCUS_19970 984 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 3838 4569 gene locus_tag LOCUS_19980 3838 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 6134 4566 gene locus_tag LOCUS_19990 6134 4566 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225732.1 protein_id gnl|my_center|LOCUS_19990 7203 6136 gene locus_tag LOCUS_20000 7203 6136 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392833.1 protein_id gnl|my_center|LOCUS_20000 7874 7176 gene locus_tag LOCUS_20010 7874 7176 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222170.1 protein_id gnl|my_center|LOCUS_20010 7954 8793 gene locus_tag LOCUS_20020 7954 8793 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877328.1 protein_id gnl|my_center|LOCUS_20020 8801 9421 gene locus_tag LOCUS_20030 8801 9421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 9872 9387 gene locus_tag LOCUS_20040 9872 9387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 9762 10016 gene locus_tag LOCUS_20050 9762 10016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 10084 11211 gene locus_tag LOCUS_20060 10084 11211 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879898.1 protein_id gnl|my_center|LOCUS_20060 11211 11951 gene locus_tag LOCUS_20070 11211 11951 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_20070 12766 11948 gene locus_tag LOCUS_20080 12766 11948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 13714 13202 gene locus_tag LOCUS_20090 13714 13202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 13925 13707 gene locus_tag LOCUS_20100 13925 13707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 13917 14363 gene locus_tag LOCUS_20110 13917 14363 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810412.1 protein_id gnl|my_center|LOCUS_20110 18024 14368 gene locus_tag LOCUS_20120 18024 14368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 18129 18056 gene locus_tag LOCUS_t00350 18129 18056 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 18229 18157 gene locus_tag LOCUS_t00360 18229 18157 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 19782 18295 gene locus_tag LOCUS_20130 gene gltX 19782 18295 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_20130 20107 19772 gene locus_tag LOCUS_20140 20107 19772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 21632 20271 gene locus_tag LOCUS_20150 21632 20271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 23245 21629 gene locus_tag LOCUS_20160 gene cimA 23245 21629 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056694.1 protein_id gnl|my_center|LOCUS_20160 24197 23289 gene locus_tag LOCUS_20170 24197 23289 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_20170 25359 24277 gene locus_tag LOCUS_20180 25359 24277 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_20180 25628 26728 gene locus_tag LOCUS_20190 25628 26728 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407690.1 protein_id gnl|my_center|LOCUS_20190 >Feature sequence040 <1 1765 gene locus_tag LOCUS_20200 <1 1765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066275.1:PKD domain-containing protein 1983 2891 gene locus_tag LOCUS_20210 1983 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 3589 2900 gene locus_tag LOCUS_20220 3589 2900 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093220.1 protein_id gnl|my_center|LOCUS_20220 5140 3590 gene locus_tag LOCUS_20230 5140 3590 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_20230 5403 5951 gene locus_tag LOCUS_20240 5403 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 7565 5958 gene locus_tag LOCUS_20250 gene serA 7565 5958 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_20250 8755 7574 gene locus_tag LOCUS_20260 8755 7574 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_20260 9757 8756 gene locus_tag LOCUS_20270 gene ilvC 9757 8756 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392863.1 protein_id gnl|my_center|LOCUS_20270 9957 10778 gene locus_tag LOCUS_20280 9957 10778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 11140 10775 gene locus_tag LOCUS_20290 11140 10775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 11242 12006 gene locus_tag LOCUS_20300 11242 12006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 13518 11992 gene locus_tag LOCUS_20310 13518 11992 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392725.1 protein_id gnl|my_center|LOCUS_20310 15043 13511 gene locus_tag LOCUS_20320 15043 13511 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085735.1 protein_id gnl|my_center|LOCUS_20320 15866 15312 gene locus_tag LOCUS_20330 15866 15312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 16967 16065 gene locus_tag LOCUS_20340 16967 16065 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083569.1 protein_id gnl|my_center|LOCUS_20340 18250 17021 gene locus_tag LOCUS_20350 18250 17021 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095742.1 protein_id gnl|my_center|LOCUS_20350 19390 18266 gene locus_tag LOCUS_20360 19390 18266 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877291.1 protein_id gnl|my_center|LOCUS_20360 21372 19498 gene locus_tag LOCUS_20370 gene pknB 21372 19498 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 protein_id gnl|my_center|LOCUS_20370 21869 21456 gene locus_tag LOCUS_20380 21869 21456 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086611.1 protein_id gnl|my_center|LOCUS_20380 22342 21872 gene locus_tag LOCUS_20390 22342 21872 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086612.1 protein_id gnl|my_center|LOCUS_20390 24391 22355 gene locus_tag LOCUS_20400 gene ligA 24391 22355 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_20400 24493 24807 gene locus_tag LOCUS_20410 gene trxA 24493 24807 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598398.1 protein_id gnl|my_center|LOCUS_20410 24862 25800 gene locus_tag LOCUS_20420 24862 25800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 >Feature sequence041 1356 2411 gene locus_tag LOCUS_20430 1356 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 2408 3199 gene locus_tag LOCUS_20440 2408 3199 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972825.1 protein_id gnl|my_center|LOCUS_20440 3180 4058 gene locus_tag LOCUS_20450 3180 4058 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223442.1 protein_id gnl|my_center|LOCUS_20450 4089 5519 gene locus_tag LOCUS_20460 4089 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 5957 5448 gene locus_tag LOCUS_20470 5957 5448 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060116.1 protein_id gnl|my_center|LOCUS_20470 6257 5973 gene locus_tag LOCUS_20480 6257 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 7107 6631 gene locus_tag LOCUS_20490 7107 6631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 7527 7144 gene locus_tag LOCUS_20500 7527 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 8841 7651 gene locus_tag LOCUS_20510 gene dinB 8841 7651 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804691.1 protein_id gnl|my_center|LOCUS_20510 9207 10481 gene locus_tag LOCUS_20520 9207 10481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 10492 12126 gene locus_tag LOCUS_20530 10492 12126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 12641 12123 gene locus_tag LOCUS_20540 12641 12123 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_20540 13294 12638 gene locus_tag LOCUS_20550 13294 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 13876 13337 gene locus_tag LOCUS_20560 13876 13337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 13961 14770 gene locus_tag LOCUS_20570 13961 14770 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970485.1 protein_id gnl|my_center|LOCUS_20570 14754 15527 gene locus_tag LOCUS_20580 14754 15527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 15518 16279 gene locus_tag LOCUS_20590 15518 16279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 16811 16248 gene locus_tag LOCUS_20600 16811 16248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 16933 19227 gene locus_tag LOCUS_20610 16933 19227 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029076.1 protein_id gnl|my_center|LOCUS_20610 19340 19813 gene locus_tag LOCUS_20620 19340 19813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 20811 19819 gene locus_tag LOCUS_20630 20811 19819 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404488.1 protein_id gnl|my_center|LOCUS_20630 20901 21197 gene locus_tag LOCUS_20640 20901 21197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 22118 21198 gene locus_tag LOCUS_20650 22118 21198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 23362 22094 gene locus_tag LOCUS_20660 gene fabF 23362 22094 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125918.1 protein_id gnl|my_center|LOCUS_20660 23644 23402 gene locus_tag LOCUS_20670 gene acpP 23644 23402 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631656.1 protein_id gnl|my_center|LOCUS_20670 24491 23745 gene locus_tag LOCUS_20680 gene fabG 24491 23745 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_20680 >Feature sequence042 771 1583 gene locus_tag LOCUS_20690 771 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 1605 2630 gene locus_tag LOCUS_20700 1605 2630 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227145.1 protein_id gnl|my_center|LOCUS_20700 2627 3745 gene locus_tag LOCUS_20710 2627 3745 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227144.1 protein_id gnl|my_center|LOCUS_20710 3735 4736 gene locus_tag LOCUS_20720 3735 4736 CDS product inorganic polyphosphate/ATP-NAD kinase (Poly(P)/ATP NAD kinase) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546481.1 protein_id gnl|my_center|LOCUS_20720 4849 5403 gene locus_tag LOCUS_20730 4849 5403 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_20730 5437 6309 gene locus_tag LOCUS_20740 gene htpX 5437 6309 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836621.1 protein_id gnl|my_center|LOCUS_20740 6316 7086 gene locus_tag LOCUS_20750 6316 7086 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666589.1 protein_id gnl|my_center|LOCUS_20750 7150 8082 gene locus_tag LOCUS_20760 gene pdxS 7150 8082 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_20760 8098 8688 gene locus_tag LOCUS_20770 gene pdxT 8098 8688 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_20770 8694 9443 gene locus_tag LOCUS_20780 8694 9443 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_20780 9456 10010 gene locus_tag LOCUS_20790 gene ruvC 9456 10010 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_20790 10007 10600 gene locus_tag LOCUS_20800 gene ruvA 10007 10600 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_20800 10615 11682 gene locus_tag LOCUS_20810 gene ruvB 10615 11682 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_20810 11718 12815 gene locus_tag LOCUS_20820 gene queA 11718 12815 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280526.1 protein_id gnl|my_center|LOCUS_20820 12957 15389 gene locus_tag LOCUS_20830 12957 15389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 15605 16588 gene locus_tag LOCUS_20840 gene tgt 15605 16588 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393196.1 protein_id gnl|my_center|LOCUS_20840 16702 17055 gene locus_tag LOCUS_20850 16702 17055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 17052 18485 gene locus_tag LOCUS_20860 17052 18485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20860 18485 19780 gene locus_tag LOCUS_20870 gene secF 18485 19780 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_20870 19777 20325 gene locus_tag LOCUS_20880 19777 20325 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256182.1 protein_id gnl|my_center|LOCUS_20880 20414 22666 gene locus_tag LOCUS_20890 gene relA 20414 22666 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_20890 22733 23608 gene locus_tag LOCUS_20900 22733 23608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 23601 24398 gene locus_tag LOCUS_20910 23601 24398 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence043 600 2234 gene locus_tag LOCUS_20920 600 2234 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640335.1 protein_id gnl|my_center|LOCUS_20920 2237 3106 gene locus_tag LOCUS_20930 2237 3106 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063805.1 protein_id gnl|my_center|LOCUS_20930 3118 4038 gene locus_tag LOCUS_20940 gene ligD 3118 4038 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973663.1 protein_id gnl|my_center|LOCUS_20940 4121 4513 gene locus_tag LOCUS_20950 4121 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 4727 5881 gene locus_tag LOCUS_20960 4727 5881 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929894.1 protein_id gnl|my_center|LOCUS_20960 5878 7185 gene locus_tag LOCUS_20970 5878 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224795.1 protein_id gnl|my_center|LOCUS_20970 7250 8074 gene locus_tag LOCUS_20980 7250 8074 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478523.1 protein_id gnl|my_center|LOCUS_20980 8102 8566 gene locus_tag LOCUS_20990 8102 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 9553 8534 gene locus_tag LOCUS_21000 9553 8534 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_21000 13137 9550 gene locus_tag LOCUS_21010 gene nifJ 13137 9550 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_21010 15984 13228 gene locus_tag LOCUS_21020 15984 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 16212 16030 gene locus_tag LOCUS_21030 16212 16030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 16609 16196 gene locus_tag LOCUS_21040 16609 16196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 16704 18938 gene locus_tag LOCUS_21050 16704 18938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 19857 18943 gene locus_tag LOCUS_21060 19857 18943 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808254.1 protein_id gnl|my_center|LOCUS_21060 20241 19870 gene locus_tag LOCUS_21070 20241 19870 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261952.1 protein_id gnl|my_center|LOCUS_21070 20331 20960 gene locus_tag LOCUS_21080 20331 20960 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289241.1 protein_id gnl|my_center|LOCUS_21080 21435 21031 gene locus_tag LOCUS_21090 21435 21031 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413432.1 protein_id gnl|my_center|LOCUS_21090 21677 21432 gene locus_tag LOCUS_21100 21677 21432 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413429.1 protein_id gnl|my_center|LOCUS_21100 21946 21722 gene locus_tag LOCUS_21110 21946 21722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 22229 22017 gene locus_tag LOCUS_21120 22229 22017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 22390 22226 gene locus_tag LOCUS_21130 22390 22226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 22497 22348 gene locus_tag LOCUS_21140 22497 22348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 22792 22637 gene locus_tag LOCUS_21150 22792 22637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 22998 22789 gene locus_tag LOCUS_21160 22998 22789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 23418 23068 gene locus_tag LOCUS_21170 23418 23068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence044 2695 347 gene locus_tag LOCUS_21180 2695 347 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510635.1 protein_id gnl|my_center|LOCUS_21180 3155 2802 gene locus_tag LOCUS_21190 3155 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 3691 3930 gene locus_tag LOCUS_21200 3691 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 5527 4049 gene locus_tag LOCUS_21210 5527 4049 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731185.1 protein_id gnl|my_center|LOCUS_21210 6753 5524 gene locus_tag LOCUS_21220 6753 5524 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101593.1 protein_id gnl|my_center|LOCUS_21220 6846 7532 gene locus_tag LOCUS_21230 6846 7532 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002040907.1 protein_id gnl|my_center|LOCUS_21230 7529 8581 gene locus_tag LOCUS_21240 7529 8581 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064397.1 protein_id gnl|my_center|LOCUS_21240 8610 9737 gene locus_tag LOCUS_21250 8610 9737 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448968.1 protein_id gnl|my_center|LOCUS_21250 9836 10882 gene locus_tag LOCUS_21260 9836 10882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 12315 11230 gene locus_tag LOCUS_21270 12315 11230 CDS product D-cysteine desulfhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222349.1 protein_id gnl|my_center|LOCUS_21270 13814 12312 gene locus_tag LOCUS_21280 13814 12312 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_21280 16051 13817 gene locus_tag LOCUS_21290 16051 13817 CDS product large subunit of N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727394.1 protein_id gnl|my_center|LOCUS_21290 17115 16048 gene locus_tag LOCUS_21300 17115 16048 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528136.1 protein_id gnl|my_center|LOCUS_21300 17864 17112 gene locus_tag LOCUS_21310 17864 17112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 18543 18184 gene locus_tag LOCUS_21320 18543 18184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 19379 18546 gene locus_tag LOCUS_21330 19379 18546 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537723.1 protein_id gnl|my_center|LOCUS_21330 20326 19376 gene locus_tag LOCUS_21340 20326 19376 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384740.1 protein_id gnl|my_center|LOCUS_21340 21870 20368 gene locus_tag LOCUS_21350 21870 20368 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729759.1 protein_id gnl|my_center|LOCUS_21350 22747 22911 gene locus_tag LOCUS_21360 22747 22911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 >Feature sequence045 1313 21 gene locus_tag LOCUS_21370 1313 21 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_21370 1845 1426 gene locus_tag LOCUS_21380 1845 1426 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_21380 2342 1908 gene locus_tag LOCUS_21390 2342 1908 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143722.1 protein_id gnl|my_center|LOCUS_21390 3893 2448 gene locus_tag LOCUS_21400 gene gltA 3893 2448 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 protein_id gnl|my_center|LOCUS_21400 4398 3886 gene locus_tag LOCUS_21410 4398 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21410 5843 4902 gene locus_tag LOCUS_21420 5843 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 6642 5851 gene locus_tag LOCUS_21430 gene fabI 6642 5851 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_21430 7936 6758 gene locus_tag LOCUS_21440 7936 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 8304 7933 gene locus_tag LOCUS_21450 8304 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 9039 8305 gene locus_tag LOCUS_21460 9039 8305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 9227 9460 gene locus_tag LOCUS_21470 9227 9460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 9746 10690 gene locus_tag LOCUS_21480 9746 10690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 10687 11286 gene locus_tag LOCUS_21490 10687 11286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 11261 11599 gene locus_tag LOCUS_21500 11261 11599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 11629 12153 gene locus_tag LOCUS_21510 11629 12153 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_21510 12399 12854 gene locus_tag LOCUS_21520 12399 12854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 12951 17558 gene locus_tag LOCUS_21530 12951 17558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 18249 17551 gene locus_tag LOCUS_21540 18249 17551 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 protein_id gnl|my_center|LOCUS_21540 18962 18303 gene locus_tag LOCUS_21550 18962 18303 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022379.1 protein_id gnl|my_center|LOCUS_21550 19021 19323 gene locus_tag LOCUS_21560 19021 19323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 19611 19324 gene locus_tag LOCUS_21570 19611 19324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 21276 19660 gene locus_tag LOCUS_21580 gene groL 21276 19660 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_21580 21474 22385 gene locus_tag LOCUS_21590 21474 22385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 22706 22434 gene locus_tag LOCUS_21600 22706 22434 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence046 2036 3151 gene locus_tag LOCUS_21610 2036 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 3148 4731 gene locus_tag LOCUS_21620 3148 4731 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257530.1 protein_id gnl|my_center|LOCUS_21620 4728 5534 gene locus_tag LOCUS_21630 4728 5534 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256891.1 protein_id gnl|my_center|LOCUS_21630 6309 5497 gene locus_tag LOCUS_21640 6309 5497 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 protein_id gnl|my_center|LOCUS_21640 7340 6312 gene locus_tag LOCUS_21650 7340 6312 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876331.1 protein_id gnl|my_center|LOCUS_21650 7827 7369 gene locus_tag LOCUS_21660 7827 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 8758 7907 gene locus_tag LOCUS_21670 8758 7907 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728081.1 protein_id gnl|my_center|LOCUS_21670 9673 8759 gene locus_tag LOCUS_21680 9673 8759 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973051.1 protein_id gnl|my_center|LOCUS_21680 9921 9739 gene locus_tag LOCUS_21690 9921 9739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 9868 10557 gene locus_tag LOCUS_21700 9868 10557 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389611.1 protein_id gnl|my_center|LOCUS_21700 12489 11185 gene locus_tag LOCUS_21710 12489 11185 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056872.1 protein_id gnl|my_center|LOCUS_21710 13573 12491 gene locus_tag LOCUS_21720 13573 12491 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391635.1 protein_id gnl|my_center|LOCUS_21720 14337 13570 gene locus_tag LOCUS_21730 14337 13570 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082972.1 protein_id gnl|my_center|LOCUS_21730 14431 15750 gene locus_tag LOCUS_21740 14431 15750 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022265.1 protein_id gnl|my_center|LOCUS_21740 15809 17353 gene locus_tag LOCUS_21750 15809 17353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 17677 18222 gene locus_tag LOCUS_21760 17677 18222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 18838 18188 gene locus_tag LOCUS_21770 18838 18188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 19782 18835 gene locus_tag LOCUS_21780 19782 18835 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_21780 21001 19832 gene locus_tag LOCUS_21790 21001 19832 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730434.1 protein_id gnl|my_center|LOCUS_21790 21931 21095 gene locus_tag LOCUS_21800 21931 21095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 <22628 21937 gene locus_tag LOCUS_21810 <22628 21937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228789.1:D-alanine--D-alanine ligase >Feature sequence047 950 138 gene locus_tag LOCUS_21820 gene thiD 950 138 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975923.1 protein_id gnl|my_center|LOCUS_21820 1956 943 gene locus_tag LOCUS_21830 gene thiL 1956 943 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_21830 1988 2197 gene locus_tag LOCUS_21840 1988 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 2301 2534 gene locus_tag LOCUS_21850 2301 2534 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091994.1 protein_id gnl|my_center|LOCUS_21850 2976 2605 gene locus_tag LOCUS_21860 2976 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 3472 2990 gene locus_tag LOCUS_21870 3472 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 5207 3456 gene locus_tag LOCUS_21880 5207 3456 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_21880 6040 5258 gene locus_tag LOCUS_21890 gene fetB 6040 5258 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496671.1 protein_id gnl|my_center|LOCUS_21890 6773 6030 gene locus_tag LOCUS_21900 6773 6030 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392686.1 protein_id gnl|my_center|LOCUS_21900 6857 9205 gene locus_tag LOCUS_21910 6857 9205 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258185.1 protein_id gnl|my_center|LOCUS_21910 10347 9187 gene locus_tag LOCUS_21920 10347 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 10465 11898 gene locus_tag LOCUS_21930 10465 11898 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207163.1 protein_id gnl|my_center|LOCUS_21930 13282 11873 gene locus_tag LOCUS_21940 13282 11873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 15944 13296 gene locus_tag LOCUS_21950 gene ppdK 15944 13296 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_21950 17360 16020 gene locus_tag LOCUS_21960 17360 16020 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228379.1 protein_id gnl|my_center|LOCUS_21960 18173 17439 gene locus_tag LOCUS_21970 18173 17439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 18955 18170 gene locus_tag LOCUS_21980 18955 18170 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775743.1 protein_id gnl|my_center|LOCUS_21980 19307 18966 gene locus_tag LOCUS_21990 19307 18966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 20090 19338 gene locus_tag LOCUS_22000 gene recO 20090 19338 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060357.1 protein_id gnl|my_center|LOCUS_22000 20189 21088 gene locus_tag LOCUS_22010 20189 21088 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729742.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence048 80 862 gene locus_tag LOCUS_22020 80 862 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223860.1 protein_id gnl|my_center|LOCUS_22020 864 1658 gene locus_tag LOCUS_22030 864 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 1639 1869 gene locus_tag LOCUS_22040 1639 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 1962 2291 gene locus_tag LOCUS_22050 1962 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2284 2517 gene locus_tag LOCUS_22060 2284 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 4811 2844 gene locus_tag LOCUS_22070 4811 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 5567 4893 gene locus_tag LOCUS_22080 5567 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 7504 5567 gene locus_tag LOCUS_22090 gene mrdA 7504 5567 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_22090 8002 7517 gene locus_tag LOCUS_22100 8002 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 8835 7999 gene locus_tag LOCUS_22110 gene mreC 8835 7999 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388230.1 protein_id gnl|my_center|LOCUS_22110 10101 8971 gene locus_tag LOCUS_22120 10101 8971 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_22120 10987 10364 gene locus_tag LOCUS_22130 10987 10364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 11468 11070 gene locus_tag LOCUS_22140 gene ndk 11468 11070 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_22140 12815 11523 gene locus_tag LOCUS_22150 12815 11523 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_22150 15513 12832 gene locus_tag LOCUS_22160 15513 12832 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_22160 16280 15573 gene locus_tag LOCUS_22170 16280 15573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 17718 16429 gene locus_tag LOCUS_22180 gene clpX 17718 16429 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_22180 18369 17749 gene locus_tag LOCUS_22190 gene clpP 18369 17749 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880859.1 protein_id gnl|my_center|LOCUS_22190 19790 18372 gene locus_tag LOCUS_22200 gene tig 19790 18372 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 protein_id gnl|my_center|LOCUS_22200 19884 20126 gene locus_tag LOCUS_22210 19884 20126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 20166 20242 gene locus_tag LOCUS_t00370 20166 20242 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 20457 20783 gene locus_tag LOCUS_22220 20457 20783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 20871 20942 gene locus_tag LOCUS_t00380 20871 20942 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence049 <1 502 gene locus_tag LOCUS_22230 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246107.1:DNA-binding response regulator ResD 502 1050 gene locus_tag LOCUS_22240 502 1050 CDS product DUF6141 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093726791.1 protein_id gnl|my_center|LOCUS_22240 1360 4758 gene locus_tag LOCUS_22250 1360 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 5089 7956 gene locus_tag LOCUS_22260 5089 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 8137 10857 gene locus_tag LOCUS_22270 8137 10857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 12464 10854 gene locus_tag LOCUS_22280 12464 10854 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_22280 13315 12635 gene locus_tag LOCUS_22290 13315 12635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 14156 13308 gene locus_tag LOCUS_22300 14156 13308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 15452 14259 gene locus_tag LOCUS_22310 15452 14259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 16715 15513 gene locus_tag LOCUS_22320 16715 15513 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_22320 16961 16764 gene locus_tag LOCUS_22330 16961 16764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence050 926 1960 gene locus_tag LOCUS_22340 926 1960 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_22340 3510 1996 gene locus_tag LOCUS_22350 3510 1996 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226507.1 protein_id gnl|my_center|LOCUS_22350 3637 4608 gene locus_tag LOCUS_22360 3637 4608 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921208.1 protein_id gnl|my_center|LOCUS_22360 5173 4595 gene locus_tag LOCUS_22370 5173 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 5325 7094 gene locus_tag LOCUS_22380 5325 7094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 8705 7110 gene locus_tag LOCUS_22390 8705 7110 CDS product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 protein_id gnl|my_center|LOCUS_22390 9625 8702 gene locus_tag LOCUS_22400 9625 8702 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222248.1 protein_id gnl|my_center|LOCUS_22400 10940 9657 gene locus_tag LOCUS_22410 10940 9657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 11365 10937 gene locus_tag LOCUS_22420 11365 10937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 12857 11430 gene locus_tag LOCUS_22430 12857 11430 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_22430 13810 13013 gene locus_tag LOCUS_22440 13810 13013 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112739.1 protein_id gnl|my_center|LOCUS_22440 14400 13828 gene locus_tag LOCUS_22450 14400 13828 CDS product DM13 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978724.1 protein_id gnl|my_center|LOCUS_22450 15258 14464 gene locus_tag LOCUS_22460 gene amrB 15258 14464 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_22460 15412 16488 gene locus_tag LOCUS_22470 gene amrS 15412 16488 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_22470 16485 17087 gene locus_tag LOCUS_22480 16485 17087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 17139 17555 gene locus_tag LOCUS_22490 17139 17555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 17592 18314 gene locus_tag LOCUS_22500 17592 18314 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327314.1 protein_id gnl|my_center|LOCUS_22500 18336 18545 gene locus_tag LOCUS_22510 18336 18545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 18546 19028 gene locus_tag LOCUS_22520 18546 19028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 >Feature sequence051 <1 1435 gene locus_tag LOCUS_22530 <1 1435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942578.1:elongation factor G 3822 1432 gene locus_tag LOCUS_22540 3822 1432 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_22540 3922 4440 gene locus_tag LOCUS_22550 3922 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 5044 4583 gene locus_tag LOCUS_22560 5044 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 5543 5037 gene locus_tag LOCUS_22570 5543 5037 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_22570 7545 5545 gene locus_tag LOCUS_22580 gene thrS 7545 5545 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 protein_id gnl|my_center|LOCUS_22580 8324 7617 gene locus_tag LOCUS_22590 8324 7617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 8623 8321 gene locus_tag LOCUS_22600 8623 8321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 10456 8666 gene locus_tag LOCUS_22610 10456 8666 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_22610 10793 11782 gene locus_tag LOCUS_22620 10793 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 11779 13695 gene locus_tag LOCUS_22630 11779 13695 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229339.1 protein_id gnl|my_center|LOCUS_22630 13769 13697 gene locus_tag LOCUS_t00390 13769 13697 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 14131 14787 gene locus_tag LOCUS_22640 14131 14787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 15465 14803 gene locus_tag LOCUS_22650 15465 14803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 16351 15563 gene locus_tag LOCUS_22660 16351 15563 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387888.1 protein_id gnl|my_center|LOCUS_22660 17115 16348 gene locus_tag LOCUS_22670 17115 16348 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387887.1 protein_id gnl|my_center|LOCUS_22670 17406 17125 gene locus_tag LOCUS_22680 17406 17125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 18381 17437 gene locus_tag LOCUS_22690 18381 17437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 >Feature sequence052 154 1338 gene locus_tag LOCUS_22700 154 1338 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869241.1 protein_id gnl|my_center|LOCUS_22700 1369 3018 gene locus_tag LOCUS_22710 1369 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 3049 4140 gene locus_tag LOCUS_22720 3049 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 4195 4683 gene locus_tag LOCUS_22730 4195 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 4781 5407 gene locus_tag LOCUS_22740 4781 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 5739 5419 gene locus_tag LOCUS_22750 5739 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 5671 6411 gene locus_tag LOCUS_22760 5671 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 7427 6408 gene locus_tag LOCUS_22770 7427 6408 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919898.1 protein_id gnl|my_center|LOCUS_22770 7846 7433 gene locus_tag LOCUS_22780 7846 7433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 7904 8251 gene locus_tag LOCUS_22790 gene queD 7904 8251 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368414.1 protein_id gnl|my_center|LOCUS_22790 8248 8916 gene locus_tag LOCUS_22800 gene queC 8248 8916 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272362.1 protein_id gnl|my_center|LOCUS_22800 8913 9677 gene locus_tag LOCUS_22810 8913 9677 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797963.1 protein_id gnl|my_center|LOCUS_22810 10184 9711 gene locus_tag LOCUS_22820 10184 9711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 10348 10707 gene locus_tag LOCUS_22830 10348 10707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 11002 10814 gene locus_tag LOCUS_22840 11002 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 11068 12612 gene locus_tag LOCUS_22850 11068 12612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 12786 13781 gene locus_tag LOCUS_22860 12786 13781 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903488.1 protein_id gnl|my_center|LOCUS_22860 14903 13800 gene locus_tag LOCUS_22870 14903 13800 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 protein_id gnl|my_center|LOCUS_22870 15549 15037 gene locus_tag LOCUS_22880 15549 15037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 16493 15567 gene locus_tag LOCUS_22890 16493 15567 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284372.1 protein_id gnl|my_center|LOCUS_22890 16629 16495 gene locus_tag LOCUS_22900 16629 16495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 17646 16729 gene locus_tag LOCUS_22910 17646 16729 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103863.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence053 3 1436 gene locus_tag LOCUS_22920 3 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 2101 1781 gene locus_tag LOCUS_22930 2101 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 2162 2917 gene locus_tag LOCUS_22940 2162 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 4030 2981 gene locus_tag LOCUS_22950 4030 2981 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064504886.1 protein_id gnl|my_center|LOCUS_22950 5189 4023 gene locus_tag LOCUS_22960 5189 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 6754 5186 gene locus_tag LOCUS_22970 6754 5186 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294639.1 protein_id gnl|my_center|LOCUS_22970 7856 6774 gene locus_tag LOCUS_22980 7856 6774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 9331 7955 gene locus_tag LOCUS_22990 9331 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 10587 9454 gene locus_tag LOCUS_23000 10587 9454 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124212.1 protein_id gnl|my_center|LOCUS_23000 11738 10584 gene locus_tag LOCUS_23010 11738 10584 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141525.1 protein_id gnl|my_center|LOCUS_23010 13103 11775 gene locus_tag LOCUS_23020 13103 11775 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730947.1 protein_id gnl|my_center|LOCUS_23020 14687 13143 gene locus_tag LOCUS_23030 14687 13143 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049744721.1 protein_id gnl|my_center|LOCUS_23030 15348 15154 gene locus_tag LOCUS_23040 15348 15154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 15476 16420 gene locus_tag LOCUS_23050 15476 16420 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082898.1 protein_id gnl|my_center|LOCUS_23050 17772 16453 gene locus_tag LOCUS_23060 17772 16453 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876837.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence054 19 813 gene locus_tag LOCUS_23070 19 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 810 1769 gene locus_tag LOCUS_23080 810 1769 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_23080 1771 2826 gene locus_tag LOCUS_23090 1771 2826 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705177.1 protein_id gnl|my_center|LOCUS_23090 5989 2861 gene locus_tag LOCUS_23100 5989 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 6272 6745 gene locus_tag LOCUS_23110 6272 6745 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_23110 6795 7661 gene locus_tag LOCUS_23120 6795 7661 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403426.1 protein_id gnl|my_center|LOCUS_23120 7739 7963 gene locus_tag LOCUS_23130 7739 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 8516 7971 gene locus_tag LOCUS_23140 8516 7971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 8614 9195 gene locus_tag LOCUS_23150 8614 9195 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951033.1 protein_id gnl|my_center|LOCUS_23150 9245 9850 gene locus_tag LOCUS_23160 9245 9850 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401571.1 protein_id gnl|my_center|LOCUS_23160 9847 11157 gene locus_tag LOCUS_23170 9847 11157 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969720.1 protein_id gnl|my_center|LOCUS_23170 11167 12492 gene locus_tag LOCUS_23180 11167 12492 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878013.1 protein_id gnl|my_center|LOCUS_23180 12489 14075 gene locus_tag LOCUS_23190 12489 14075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 14079 14921 gene locus_tag LOCUS_23200 14079 14921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 14918 15658 gene locus_tag LOCUS_23210 14918 15658 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027565.1 protein_id gnl|my_center|LOCUS_23210 16128 15655 gene locus_tag LOCUS_23220 16128 15655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 17804 16125 gene locus_tag LOCUS_23230 17804 16125 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_23230 >Feature sequence055 111 911 gene locus_tag LOCUS_23240 111 911 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067240.1 protein_id gnl|my_center|LOCUS_23240 979 2256 gene locus_tag LOCUS_23250 gene moeA 979 2256 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704836.1 protein_id gnl|my_center|LOCUS_23250 2270 3067 gene locus_tag LOCUS_23260 2270 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 3135 3208 gene locus_tag LOCUS_t00400 3135 3208 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4488 3370 gene locus_tag LOCUS_23270 4488 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 4702 7170 gene locus_tag LOCUS_23280 4702 7170 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256961.1 protein_id gnl|my_center|LOCUS_23280 10657 7193 gene locus_tag LOCUS_23290 10657 7193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 14266 10907 gene locus_tag LOCUS_23300 14266 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 15246 14542 gene locus_tag LOCUS_23310 15246 14542 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854958.1 protein_id gnl|my_center|LOCUS_23310 15647 15243 gene locus_tag LOCUS_23320 15647 15243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 15725 16435 gene locus_tag LOCUS_23330 15725 16435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 >Feature sequence056 1965 415 gene locus_tag LOCUS_23340 1965 415 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405061.1 protein_id gnl|my_center|LOCUS_23340 2705 1962 gene locus_tag LOCUS_23350 2705 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 2865 4547 gene locus_tag LOCUS_23360 2865 4547 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086844353.1 protein_id gnl|my_center|LOCUS_23360 4551 4832 gene locus_tag LOCUS_23370 4551 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23370 4834 5988 gene locus_tag LOCUS_23380 4834 5988 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898047.1 protein_id gnl|my_center|LOCUS_23380 6028 6255 gene locus_tag LOCUS_23390 6028 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 6252 6671 gene locus_tag LOCUS_23400 gene vapC26 6252 6671 CDS product type II toxin-antitoxin system toxin ribonuclease C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403047.1 protein_id gnl|my_center|LOCUS_23400 7972 6683 gene locus_tag LOCUS_23410 7972 6683 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230206.1 protein_id gnl|my_center|LOCUS_23410 8412 7969 gene locus_tag LOCUS_23420 8412 7969 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230207.1 protein_id gnl|my_center|LOCUS_23420 8596 10119 gene locus_tag LOCUS_23430 8596 10119 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272219.1 protein_id gnl|my_center|LOCUS_23430 10986 10174 gene locus_tag LOCUS_23440 10986 10174 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085668.1 protein_id gnl|my_center|LOCUS_23440 11779 10997 gene locus_tag LOCUS_23450 11779 10997 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877865.1 protein_id gnl|my_center|LOCUS_23450 11903 13801 gene locus_tag LOCUS_23460 11903 13801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 13819 15024 gene locus_tag LOCUS_23470 gene acdA 13819 15024 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242719.1 protein_id gnl|my_center|LOCUS_23470 15026 16582 gene locus_tag LOCUS_23480 gene dacB 15026 16582 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279147.1 protein_id gnl|my_center|LOCUS_23480 <17299 16711 gene locus_tag LOCUS_23490 <17299 16711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_030868049.1:TetR/AcrR family transcriptional regulator >Feature sequence057 1193 285 gene locus_tag LOCUS_23500 1193 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 1229 2101 gene locus_tag LOCUS_23510 1229 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 3823 2222 gene locus_tag LOCUS_23520 3823 2222 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_23520 3841 4932 gene locus_tag LOCUS_23530 gene ychF 3841 4932 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_23530 4925 5308 gene locus_tag LOCUS_23540 4925 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 5289 6176 gene locus_tag LOCUS_23550 gene rsmI 5289 6176 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_23550 6173 6931 gene locus_tag LOCUS_23560 6173 6931 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_23560 6928 7860 gene locus_tag LOCUS_23570 gene rsmA 6928 7860 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804943.1 protein_id gnl|my_center|LOCUS_23570 7884 8729 gene locus_tag LOCUS_23580 7884 8729 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336977.1 protein_id gnl|my_center|LOCUS_23580 8873 8946 gene locus_tag LOCUS_t00410 8873 8946 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8991 10400 gene locus_tag LOCUS_23590 gene glmU 8991 10400 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 protein_id gnl|my_center|LOCUS_23590 10417 11655 gene locus_tag LOCUS_23600 10417 11655 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877816.1 protein_id gnl|my_center|LOCUS_23600 12127 11684 gene locus_tag LOCUS_23610 12127 11684 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_23610 14105 12117 gene locus_tag LOCUS_23620 14105 12117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 14422 15396 gene locus_tag LOCUS_23630 14422 15396 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_23630 16087 15401 gene locus_tag LOCUS_23640 16087 15401 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022907.1 protein_id gnl|my_center|LOCUS_23640 16218 16835 gene locus_tag LOCUS_23650 16218 16835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence058 554 96 gene locus_tag LOCUS_23660 554 96 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141369.1 protein_id gnl|my_center|LOCUS_23660 889 4413 gene locus_tag LOCUS_23670 889 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 4406 5545 gene locus_tag LOCUS_23680 4406 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 5555 6700 gene locus_tag LOCUS_23690 5555 6700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 6702 7550 gene locus_tag LOCUS_23700 6702 7550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 8728 7547 gene locus_tag LOCUS_23710 8728 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 9284 8775 gene locus_tag LOCUS_23720 9284 8775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 9886 9347 gene locus_tag LOCUS_23730 9886 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 11341 9911 gene locus_tag LOCUS_23740 11341 9911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 14211 11398 gene locus_tag LOCUS_23750 14211 11398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 14392 15414 gene locus_tag LOCUS_23760 gene moaA 14392 15414 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence059 824 48 gene locus_tag LOCUS_23770 824 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 1188 844 gene locus_tag LOCUS_23780 1188 844 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524184.1 protein_id gnl|my_center|LOCUS_23780 2144 1185 gene locus_tag LOCUS_23790 gene xerD 2144 1185 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408401.1 protein_id gnl|my_center|LOCUS_23790 3336 2161 gene locus_tag LOCUS_23800 gene ald 3336 2161 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_23800 5087 3393 gene locus_tag LOCUS_23810 5087 3393 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_23810 6916 5228 gene locus_tag LOCUS_23820 gene recN 6916 5228 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_23820 7885 7019 gene locus_tag LOCUS_23830 7885 7019 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227821.1 protein_id gnl|my_center|LOCUS_23830 8688 7882 gene locus_tag LOCUS_23840 8688 7882 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081998.1 protein_id gnl|my_center|LOCUS_23840 8946 8740 gene locus_tag LOCUS_23850 8946 8740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 9020 9865 gene locus_tag LOCUS_23860 9020 9865 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270259.1 protein_id gnl|my_center|LOCUS_23860 10785 9859 gene locus_tag LOCUS_23870 10785 9859 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804972.1 protein_id gnl|my_center|LOCUS_23870 10932 12143 gene locus_tag LOCUS_23880 10932 12143 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_23880 12140 13144 gene locus_tag LOCUS_23890 12140 13144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 13736 13146 gene locus_tag LOCUS_23900 13736 13146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 14152 13886 gene locus_tag LOCUS_23910 14152 13886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 14596 14486 gene locus_tag LOCUS_r00010 14596 14486 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence060 409 101 gene locus_tag LOCUS_23920 409 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 622 1467 gene locus_tag LOCUS_23930 622 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 1464 2516 gene locus_tag LOCUS_23940 1464 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 3655 2642 gene locus_tag LOCUS_23950 3655 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 4842 3910 gene locus_tag LOCUS_23960 gene pheA 4842 3910 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060994.1 protein_id gnl|my_center|LOCUS_23960 4988 4839 gene locus_tag LOCUS_23970 4988 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 6070 5006 gene locus_tag LOCUS_23980 6070 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 6128 6043 gene locus_tag LOCUS_t00420 6128 6043 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6248 6901 gene locus_tag LOCUS_23990 6248 6901 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257858.1 protein_id gnl|my_center|LOCUS_23990 6959 7414 gene locus_tag LOCUS_24000 6959 7414 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776669.1 protein_id gnl|my_center|LOCUS_24000 7419 8261 gene locus_tag LOCUS_24010 7419 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 8282 9592 gene locus_tag LOCUS_24020 8282 9592 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726618.1 protein_id gnl|my_center|LOCUS_24020 9589 11064 gene locus_tag LOCUS_24030 gene pbpA 9589 11064 CDS product D,D-transpeptidase PbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891359.1 protein_id gnl|my_center|LOCUS_24030 11064 12920 gene locus_tag LOCUS_24040 gene pknB 11064 12920 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222003.1 protein_id gnl|my_center|LOCUS_24040 12925 14592 gene locus_tag LOCUS_24050 12925 14592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 >Feature sequence061 1588 554 gene locus_tag LOCUS_24060 1588 554 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014665.1 protein_id gnl|my_center|LOCUS_24060 1809 1597 gene locus_tag LOCUS_24070 1809 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2206 2132 gene locus_tag LOCUS_t00430 2206 2132 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2322 2801 gene locus_tag LOCUS_24080 2322 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 3007 3402 gene locus_tag LOCUS_24090 3007 3402 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230429.1 protein_id gnl|my_center|LOCUS_24090 6436 3428 gene locus_tag LOCUS_24100 6436 3428 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_24100 8185 6482 gene locus_tag LOCUS_24110 8185 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 9586 8336 gene locus_tag LOCUS_24120 gene ddcP 9586 8336 CDS product protease DdcP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245451.1 protein_id gnl|my_center|LOCUS_24120 9562 10020 gene locus_tag LOCUS_24130 9562 10020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 10921 10040 gene locus_tag LOCUS_24140 10921 10040 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_24140 11288 11049 gene locus_tag LOCUS_24150 11288 11049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 11716 11285 gene locus_tag LOCUS_24160 11716 11285 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 protein_id gnl|my_center|LOCUS_24160 11857 12903 gene locus_tag LOCUS_24170 11857 12903 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_24170 12951 14114 gene locus_tag LOCUS_24180 12951 14114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 >Feature sequence062 365 733 gene locus_tag LOCUS_24190 365 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 1599 1084 gene locus_tag LOCUS_24200 1599 1084 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831954.1 protein_id gnl|my_center|LOCUS_24200 2812 1589 gene locus_tag LOCUS_24210 2812 1589 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_24210 3558 2809 gene locus_tag LOCUS_24220 gene sufC 3558 2809 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228949.1 protein_id gnl|my_center|LOCUS_24220 4524 3652 gene locus_tag LOCUS_24230 4524 3652 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227801.1 protein_id gnl|my_center|LOCUS_24230 5142 4531 gene locus_tag LOCUS_24240 5142 4531 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_24240 5289 6485 gene locus_tag LOCUS_24250 5289 6485 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900438.1 protein_id gnl|my_center|LOCUS_24250 6585 7724 gene locus_tag LOCUS_24260 6585 7724 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225683.1 protein_id gnl|my_center|LOCUS_24260 7742 8167 gene locus_tag LOCUS_24270 7742 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 8164 8841 gene locus_tag LOCUS_24280 8164 8841 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014001204.1 protein_id gnl|my_center|LOCUS_24280 8863 9675 gene locus_tag LOCUS_24290 8863 9675 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085614.1 protein_id gnl|my_center|LOCUS_24290 10673 9672 gene locus_tag LOCUS_24300 10673 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 10692 13172 gene locus_tag LOCUS_24310 10692 13172 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227286.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence063 4261 1487 gene locus_tag LOCUS_24320 4261 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 5280 4258 gene locus_tag LOCUS_24330 5280 4258 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002067912.1 protein_id gnl|my_center|LOCUS_24330 5440 6186 gene locus_tag LOCUS_24340 5440 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 6195 7394 gene locus_tag LOCUS_24350 6195 7394 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173212.1 protein_id gnl|my_center|LOCUS_24350 7391 8806 gene locus_tag LOCUS_24360 7391 8806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 8850 10535 gene locus_tag LOCUS_24370 8850 10535 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061070.1 protein_id gnl|my_center|LOCUS_24370 10532 10747 gene locus_tag LOCUS_24380 10532 10747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 <13223 10775 gene locus_tag LOCUS_24390 <13223 10775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027999870.1:tandem-95 repeat protein >Feature sequence064 1528 569 gene locus_tag LOCUS_24400 1528 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 1760 2008 gene locus_tag LOCUS_24410 1760 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 3330 2146 gene locus_tag LOCUS_24420 3330 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 3652 4551 gene locus_tag LOCUS_24430 3652 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 4530 5957 gene locus_tag LOCUS_24440 4530 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 6133 6206 gene locus_tag LOCUS_t00440 6133 6206 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6496 6236 gene locus_tag LOCUS_24450 6496 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 6845 6447 gene locus_tag LOCUS_24460 6845 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24460 7082 7750 gene locus_tag LOCUS_24470 7082 7750 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136889.1 protein_id gnl|my_center|LOCUS_24470 7767 7955 gene locus_tag LOCUS_24480 7767 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 8139 8891 gene locus_tag LOCUS_24490 8139 8891 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967757.1 protein_id gnl|my_center|LOCUS_24490 9289 8936 gene locus_tag LOCUS_24500 9289 8936 CDS product ClpX C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226927.1 protein_id gnl|my_center|LOCUS_24500 10211 9432 gene locus_tag LOCUS_24510 10211 9432 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403012.1 protein_id gnl|my_center|LOCUS_24510 10406 12454 gene locus_tag LOCUS_24520 10406 12454 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962866.1 protein_id gnl|my_center|LOCUS_24520 12755 12438 gene locus_tag LOCUS_24530 12755 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 >Feature sequence065 604 3618 gene locus_tag LOCUS_24540 604 3618 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263395.1 protein_id gnl|my_center|LOCUS_24540 3668 4858 gene locus_tag LOCUS_24550 3668 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 5182 4880 gene locus_tag LOCUS_24560 5182 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 6246 5296 gene locus_tag LOCUS_24570 6246 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 10194 6862 gene locus_tag LOCUS_24580 10194 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 10127 10522 gene locus_tag LOCUS_24590 10127 10522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 10717 11730 gene locus_tag LOCUS_24600 10717 11730 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417210.1 protein_id gnl|my_center|LOCUS_24600 11831 12106 gene locus_tag LOCUS_24610 11831 12106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 12119 12643 gene locus_tag LOCUS_24620 12119 12643 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301452.1 protein_id gnl|my_center|LOCUS_24620 12767 12558 gene locus_tag LOCUS_24630 12767 12558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 >Feature sequence066 <1 2530 gene locus_tag LOCUS_24640 <1 2530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467599.1:RHS repeat-associated core domain-containing protein 2552 3097 gene locus_tag LOCUS_24650 2552 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 3123 4205 gene locus_tag LOCUS_24660 3123 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 4229 4699 gene locus_tag LOCUS_24670 4229 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 4858 5820 gene locus_tag LOCUS_24680 4858 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 5817 6143 gene locus_tag LOCUS_24690 5817 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 6438 7382 gene locus_tag LOCUS_24700 6438 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 8696 9697 gene locus_tag LOCUS_24710 8696 9697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 9690 10238 gene locus_tag LOCUS_24720 9690 10238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 10580 10891 gene locus_tag LOCUS_24730 10580 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 10828 11532 gene locus_tag LOCUS_24740 10828 11532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 11615 12037 gene locus_tag LOCUS_24750 11615 12037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 12552 12034 gene locus_tag LOCUS_24760 12552 12034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 >Feature sequence067 158 1747 gene locus_tag LOCUS_24770 158 1747 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174141.1 protein_id gnl|my_center|LOCUS_24770 2043 1867 gene locus_tag LOCUS_24780 2043 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 2062 2862 gene locus_tag LOCUS_24790 2062 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 3007 3858 gene locus_tag LOCUS_24800 3007 3858 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223859.1 protein_id gnl|my_center|LOCUS_24800 3886 4704 gene locus_tag LOCUS_24810 gene whiG 3886 4704 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_24810 4936 6747 gene locus_tag LOCUS_24820 4936 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 6931 7800 gene locus_tag LOCUS_24830 gene rpsB 6931 7800 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223862.1 protein_id gnl|my_center|LOCUS_24830 7790 8398 gene locus_tag LOCUS_24840 gene tsf 7790 8398 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_24840 8490 9245 gene locus_tag LOCUS_24850 gene pyrH 8490 9245 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_24850 9258 9824 gene locus_tag LOCUS_24860 gene frr 9258 9824 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466739.1 protein_id gnl|my_center|LOCUS_24860 9827 12166 gene locus_tag LOCUS_24870 9827 12166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 >Feature sequence068 1702 461 gene locus_tag LOCUS_24880 1702 461 CDS product IS110-like element IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027512.1 protein_id gnl|my_center|LOCUS_24880 2179 5478 gene locus_tag LOCUS_24890 2179 5478 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839231.1 protein_id gnl|my_center|LOCUS_24890 5471 7963 gene locus_tag LOCUS_24900 5471 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 7921 8880 gene locus_tag LOCUS_24910 7921 8880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 9721 8855 gene locus_tag LOCUS_24920 9721 8855 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941492.1 protein_id gnl|my_center|LOCUS_24920 10793 9771 gene locus_tag LOCUS_24930 10793 9771 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986244.1 protein_id gnl|my_center|LOCUS_24930 >Feature sequence069 960 1376 gene locus_tag LOCUS_24940 960 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 1505 1687 gene locus_tag LOCUS_24950 1505 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 1741 2391 gene locus_tag LOCUS_24960 1741 2391 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918133.1 protein_id gnl|my_center|LOCUS_24960 3119 2421 gene locus_tag LOCUS_24970 3119 2421 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228693.1 protein_id gnl|my_center|LOCUS_24970 4846 3119 gene locus_tag LOCUS_24980 gene sdhA 4846 3119 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056124.1 protein_id gnl|my_center|LOCUS_24980 5293 4853 gene locus_tag LOCUS_24990 5293 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 5808 5293 gene locus_tag LOCUS_25000 5808 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 6209 6670 gene locus_tag LOCUS_25010 6209 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 6773 8197 gene locus_tag LOCUS_25020 6773 8197 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878358.1 protein_id gnl|my_center|LOCUS_25020 8203 10254 gene locus_tag LOCUS_25030 8203 10254 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_25030 10256 10699 gene locus_tag LOCUS_25040 10256 10699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 10795 11757 gene locus_tag LOCUS_25050 10795 11757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 >Feature sequence070 891 1550 gene locus_tag LOCUS_25060 891 1550 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_25060 1547 2236 gene locus_tag LOCUS_25070 1547 2236 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067924.1 protein_id gnl|my_center|LOCUS_25070 2611 2237 gene locus_tag LOCUS_25080 2611 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 2678 4129 gene locus_tag LOCUS_25090 2678 4129 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228743.1 protein_id gnl|my_center|LOCUS_25090 4129 4638 gene locus_tag LOCUS_25100 gene purE 4129 4638 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340324.1 protein_id gnl|my_center|LOCUS_25100 6039 4669 gene locus_tag LOCUS_25110 gene xylB 6039 4669 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027626.1 protein_id gnl|my_center|LOCUS_25110 6560 6039 gene locus_tag LOCUS_25120 6560 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 7291 6557 gene locus_tag LOCUS_25130 7291 6557 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228806.1 protein_id gnl|my_center|LOCUS_25130 8985 7429 gene locus_tag LOCUS_25140 8985 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 9994 8990 gene locus_tag LOCUS_25150 9994 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 11229 10048 gene locus_tag LOCUS_25160 11229 10048 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207044.1 protein_id gnl|my_center|LOCUS_25160 11589 11410 gene locus_tag LOCUS_25170 11589 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence071 1104 175 gene locus_tag LOCUS_25180 1104 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 1214 1945 gene locus_tag LOCUS_25190 1214 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 2409 1948 gene locus_tag LOCUS_25200 2409 1948 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111199.1 protein_id gnl|my_center|LOCUS_25200 3725 2475 gene locus_tag LOCUS_25210 3725 2475 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141940.1 protein_id gnl|my_center|LOCUS_25210 4929 3730 gene locus_tag LOCUS_25220 4929 3730 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111467.1 protein_id gnl|my_center|LOCUS_25220 5624 5025 gene locus_tag LOCUS_25230 5624 5025 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941233.1 protein_id gnl|my_center|LOCUS_25230 7001 5727 gene locus_tag LOCUS_25240 7001 5727 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_25240 7203 7439 gene locus_tag LOCUS_25250 7203 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 7511 7873 gene locus_tag LOCUS_25260 7511 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 8375 7956 gene locus_tag LOCUS_25270 8375 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 8971 8372 gene locus_tag LOCUS_25280 8971 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 9363 9157 gene locus_tag LOCUS_25290 9363 9157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 <10669 9976 gene locus_tag LOCUS_25300 <10669 9976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_225949840.1:PA14 domain-containing protein >Feature sequence072 <1 3376 gene locus_tag LOCUS_25310 <1 3376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257735.1:peptidoglycan recognition family protein 3408 4907 gene locus_tag LOCUS_25320 3408 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 4997 5230 gene locus_tag LOCUS_25330 4997 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 5254 5664 gene locus_tag LOCUS_25340 5254 5664 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391721.1 protein_id gnl|my_center|LOCUS_25340 5954 6202 gene locus_tag LOCUS_25350 5954 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 6160 6561 gene locus_tag LOCUS_25360 6160 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 9280 6521 gene locus_tag LOCUS_25370 9280 6521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 >Feature sequence073 2238 1381 gene locus_tag LOCUS_25380 2238 1381 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727874.1 protein_id gnl|my_center|LOCUS_25380 2823 2344 gene locus_tag LOCUS_25390 2823 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 5457 3070 gene locus_tag LOCUS_25400 5457 3070 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022610.1 protein_id gnl|my_center|LOCUS_25400 7261 6068 gene locus_tag LOCUS_25410 7261 6068 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_25410 7465 7641 gene locus_tag LOCUS_25420 7465 7641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 8805 7624 gene locus_tag LOCUS_25430 8805 7624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 9142 8789 gene locus_tag LOCUS_25440 9142 8789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 >Feature sequence074 1548 139 gene locus_tag LOCUS_25450 gene der 1548 139 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_25450 2740 1508 gene locus_tag LOCUS_25460 2740 1508 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_25460 3026 4045 gene locus_tag LOCUS_25470 gene ispH 3026 4045 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922221.1 protein_id gnl|my_center|LOCUS_25470 4751 4062 gene locus_tag LOCUS_25480 4751 4062 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_25480 5337 4744 gene locus_tag LOCUS_25490 gene cmk 5337 4744 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729300.1 protein_id gnl|my_center|LOCUS_25490 6880 5465 gene locus_tag LOCUS_25500 gene aroA 6880 5465 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392845.1 protein_id gnl|my_center|LOCUS_25500 8055 6883 gene locus_tag LOCUS_25510 8055 6883 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_25510 <8908 8056 gene locus_tag LOCUS_25520 <8908 8056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393889.1:3-deoxy-7-phosphoheptulonate synthase >Feature sequence075 <1 1459 gene locus_tag LOCUS_25530 <1 1459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256059.1:APC family permease 3210 1420 gene locus_tag LOCUS_25540 3210 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 3209 4261 gene locus_tag LOCUS_25550 3209 4261 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957530.1 protein_id gnl|my_center|LOCUS_25550 4317 4949 gene locus_tag LOCUS_25560 4317 4949 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977621.1 protein_id gnl|my_center|LOCUS_25560 4962 6194 gene locus_tag LOCUS_25570 4962 6194 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090523.1 protein_id gnl|my_center|LOCUS_25570 <8166 6197 gene locus_tag LOCUS_25580 <8166 6197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029699.1:serine/threonine-protein kinase >Feature sequence076 1931 1029 gene locus_tag LOCUS_25590 1931 1029 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908070.1 protein_id gnl|my_center|LOCUS_25590 2802 1993 gene locus_tag LOCUS_25600 2802 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 3381 2803 gene locus_tag LOCUS_25610 3381 2803 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141762.1 protein_id gnl|my_center|LOCUS_25610 4613 3399 gene locus_tag LOCUS_25620 gene galK 4613 3399 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053437.1 protein_id gnl|my_center|LOCUS_25620 5650 4610 gene locus_tag LOCUS_25630 gene galT 5650 4610 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583557.1 protein_id gnl|my_center|LOCUS_25630 7209 5647 gene locus_tag LOCUS_25640 7209 5647 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143220.1 protein_id gnl|my_center|LOCUS_25640 7850 7422 gene locus_tag LOCUS_25650 7850 7422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 >Feature sequence077 1493 813 gene locus_tag LOCUS_25660 1493 813 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068898.1 protein_id gnl|my_center|LOCUS_25660 1633 2520 gene locus_tag LOCUS_25670 1633 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 3204 2461 gene locus_tag LOCUS_25680 3204 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 3989 3201 gene locus_tag LOCUS_25690 3989 3201 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257033.1 protein_id gnl|my_center|LOCUS_25690 5122 3989 gene locus_tag LOCUS_25700 5122 3989 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_25700 6155 5127 gene locus_tag LOCUS_25710 6155 5127 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 protein_id gnl|my_center|LOCUS_25710 7408 6233 gene locus_tag LOCUS_25720 7408 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 >Feature sequence078 925 683 gene locus_tag LOCUS_25730 925 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 1034 1165 gene locus_tag LOCUS_25740 1034 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 1601 1768 gene locus_tag LOCUS_25750 1601 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 2293 1844 gene locus_tag LOCUS_25760 2293 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 4092 2290 gene locus_tag LOCUS_25770 4092 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 4293 5468 gene locus_tag LOCUS_25780 4293 5468 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124568.1 protein_id gnl|my_center|LOCUS_25780 6612 5476 gene locus_tag LOCUS_25790 6612 5476 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227995.1 protein_id gnl|my_center|LOCUS_25790 >Feature sequence079 1171 482 gene locus_tag LOCUS_25800 1171 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 1641 1222 gene locus_tag LOCUS_25810 1641 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 2149 1628 gene locus_tag LOCUS_25820 2149 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 3092 2139 gene locus_tag LOCUS_25830 3092 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 6096 3550 gene locus_tag LOCUS_25840 6096 3550 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170304.1 protein_id gnl|my_center|LOCUS_25840 >Feature sequence080 118 2292 gene locus_tag LOCUS_25850 118 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095415.1 protein_id gnl|my_center|LOCUS_25850 2285 2986 gene locus_tag LOCUS_25860 2285 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 3394 3095 gene locus_tag LOCUS_25870 3394 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 3590 3399 gene locus_tag LOCUS_25880 3590 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25880 4126 3587 gene locus_tag LOCUS_25890 4126 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25890 4805 4272 gene locus_tag LOCUS_25900 4805 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 <5695 4852 gene locus_tag LOCUS_25910 <5695 4852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006037763.1:RHS repeat-associated core domain-containing protein >Feature sequence081 1368 247 gene locus_tag LOCUS_25920 1368 247 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086601.1 protein_id gnl|my_center|LOCUS_25920 2714 1416 gene locus_tag LOCUS_25930 2714 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 4075 2678 gene locus_tag LOCUS_25940 4075 2678 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_25940 <5428 4131 gene locus_tag LOCUS_25950 <5428 4131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003908534.1:GMC family oxidoreductase >Feature sequence082 1553 183 gene locus_tag LOCUS_25960 1553 183 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226839.1 protein_id gnl|my_center|LOCUS_25960 2056 1607 gene locus_tag LOCUS_25970 2056 1607 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082410.1 protein_id gnl|my_center|LOCUS_25970 2330 1953 gene locus_tag LOCUS_25980 2330 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 2440 3651 gene locus_tag LOCUS_25990 2440 3651 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064343.1 protein_id gnl|my_center|LOCUS_25990 3954 4586 gene locus_tag LOCUS_26000 3954 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 <5312 4583 gene locus_tag LOCUS_26010 <5312 4583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229261.1:acyl-CoA dehydrogenase family protein >Feature sequence083 925 497 gene locus_tag LOCUS_26020 925 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 4565 972 gene locus_tag LOCUS_26030 4565 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 >Feature sequence084 355 1341 gene locus_tag LOCUS_26040 355 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 2188 3159 gene locus_tag LOCUS_26050 2188 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 3170 3562 gene locus_tag LOCUS_26060 3170 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 >Feature sequence085 892 47 gene locus_tag LOCUS_26070 gene rfbD 892 47 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_26070 1901 897 gene locus_tag LOCUS_26080 gene rfbB 1901 897 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978112.1 protein_id gnl|my_center|LOCUS_26080 2998 1937 gene locus_tag LOCUS_26090 2998 1937 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_26090 4257 3028 gene locus_tag LOCUS_26100 4257 3028 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326400.1 protein_id gnl|my_center|LOCUS_26100 >Feature sequence086 <1 741 gene locus_tag LOCUS_26110 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228964.1:LLM class flavin-dependent oxidoreductase 1776 637 gene locus_tag LOCUS_26120 gene mnmA 1776 637 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256566.1 protein_id gnl|my_center|LOCUS_26120 2921 1794 gene locus_tag LOCUS_26130 2921 1794 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257333.1 protein_id gnl|my_center|LOCUS_26130 4304 3087 gene locus_tag LOCUS_26140 4304 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 >Feature sequence087 640 263 gene locus_tag LOCUS_26150 gene aroH 640 263 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967606.1 protein_id gnl|my_center|LOCUS_26150 1382 681 gene locus_tag LOCUS_26160 1382 681 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_26160 2061 1411 gene locus_tag LOCUS_26170 gene scpB 2061 1411 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_26170 3330 2131 gene locus_tag LOCUS_26180 3330 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 4361 3279 gene locus_tag LOCUS_26190 gene trpS 4361 3279 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937453.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence088 <1 1024 gene locus_tag LOCUS_26200 <1 1024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_225949840.1:PA14 domain-containing protein 1078 1335 gene locus_tag LOCUS_26210 1078 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 1470 1763 gene locus_tag LOCUS_26220 1470 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 2368 1847 gene locus_tag LOCUS_26230 2368 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 2618 3877 gene locus_tag LOCUS_26240 2618 3877 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727856.1 protein_id gnl|my_center|LOCUS_26240 >Feature sequence089 198 1505 gene locus_tag LOCUS_26250 198 1505 CDS product IS256-like element ISSod18 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071025.1 protein_id gnl|my_center|LOCUS_26250 1821 1489 gene locus_tag LOCUS_26260 1821 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 2983 2204 gene locus_tag LOCUS_26270 2983 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 3848 3414 gene locus_tag LOCUS_26280 3848 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 >Feature sequence090 470 1630 gene locus_tag LOCUS_26290 470 1630 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021204.1 protein_id gnl|my_center|LOCUS_26290 1630 2712 gene locus_tag LOCUS_26300 1630 2712 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_26300 <4075 2724 gene locus_tag LOCUS_26310 <4075 2724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257610.1:ABC transporter ATP-binding protein >Feature sequence091 975 577 gene locus_tag LOCUS_26320 975 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 1907 1044 gene locus_tag LOCUS_26330 1907 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 <3845 2430 gene locus_tag LOCUS_26340 <3845 2430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243665.1:tRNA nuclease WapA >Feature sequence092 884 1756 gene locus_tag LOCUS_26350 884 1756 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728140.1 protein_id gnl|my_center|LOCUS_26350 2179 1766 gene locus_tag LOCUS_26360 2179 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 3208 2312 gene locus_tag LOCUS_26370 3208 2312 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256486.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence093 <1 678 gene locus_tag LOCUS_26380 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243665.1:tRNA nuclease WapA 784 1050 gene locus_tag LOCUS_26390 784 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 1212 2150 gene locus_tag LOCUS_26400 1212 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 2172 3143 gene locus_tag LOCUS_26410 2172 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 3381 3202 gene locus_tag LOCUS_26420 3381 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 3609 3424 gene locus_tag LOCUS_26430 3609 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence094 1020 541 gene locus_tag LOCUS_26440 1020 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 1928 1017 gene locus_tag LOCUS_26450 1928 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 2649 2080 gene locus_tag LOCUS_26460 2649 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 <3385 2636 gene locus_tag LOCUS_26470 <3385 2636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243665.1:tRNA nuclease WapA >Feature sequence095 452 751 gene locus_tag LOCUS_26480 452 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 770 1225 gene locus_tag LOCUS_26490 770 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 1219 1575 gene locus_tag LOCUS_26500 1219 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 1689 2459 gene locus_tag LOCUS_26510 1689 2459 CDS product IS1595-like element ISSod11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071113.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence096 >Feature sequence097 <1 667 gene locus_tag LOCUS_26520 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267592.1:RHS repeat-associated core domain-containing protein 677 1063 gene locus_tag LOCUS_26530 677 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 1265 1438 gene locus_tag LOCUS_26540 1265 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 1435 1803 gene locus_tag LOCUS_26550 1435 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 1800 2240 gene locus_tag LOCUS_26560 1800 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 2306 2734 gene locus_tag LOCUS_26570 2306 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 >Feature sequence098 227 376 gene locus_tag LOCUS_26580 227 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 2358 421 gene locus_tag LOCUS_26590 gene asnB 2358 421 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_26590 >Feature sequence099 1347 367 gene locus_tag LOCUS_26600 1347 367 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164689163.1 protein_id gnl|my_center|LOCUS_26600 1766 1347 gene locus_tag LOCUS_26610 1766 1347 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144317.1 protein_id gnl|my_center|LOCUS_26610 2054 1794 gene locus_tag LOCUS_26620 2054 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 2221 2051 gene locus_tag LOCUS_26630 2221 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence100 796 296 gene locus_tag LOCUS_26640 796 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 1755 793 gene locus_tag LOCUS_26650 1755 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 >Feature sequence101 <1 979 gene locus_tag LOCUS_26660 <1 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255994.1:glycosyltransferase family 1 protein <2069 962 gene locus_tag LOCUS_26670 <2069 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729039.1:HNH endonuclease signature motif containing protein >Feature sequence102 1100 879 gene locus_tag LOCUS_26680 1100 879 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165815993.1 protein_id gnl|my_center|LOCUS_26680 >Feature sequence103 883 29 gene locus_tag LOCUS_26690 883 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26690 1191 886 gene locus_tag LOCUS_26700 1191 886 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545884.1 protein_id gnl|my_center|LOCUS_26700 1257 1529 gene locus_tag LOCUS_26710 1257 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 >Feature sequence104 477 166 gene locus_tag LOCUS_26720 477 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 1027 644 gene locus_tag LOCUS_26730 1027 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730