>Feature sequence0001 <1 869 gene locus_tag LOCUS_00010 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005809662.1:MATE family efflux transporter 1052 1810 gene locus_tag LOCUS_00020 1052 1810 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_00020 1941 3338 gene locus_tag LOCUS_00030 1941 3338 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 protein_id gnl|my_center|LOCUS_00030 3412 3720 gene locus_tag LOCUS_00040 gene trxA 3412 3720 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_00040 3786 4697 gene locus_tag LOCUS_00050 gene trxB 3786 4697 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_00050 4759 5304 gene locus_tag LOCUS_00060 4759 5304 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_00060 5375 5818 gene locus_tag LOCUS_00070 gene ohrR 5375 5818 CDS product organic hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245653.1 protein_id gnl|my_center|LOCUS_00070 5893 6033 gene locus_tag LOCUS_00080 5893 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6034 6558 gene locus_tag LOCUS_00090 6034 6558 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454674.1 protein_id gnl|my_center|LOCUS_00090 6748 7029 gene locus_tag LOCUS_00100 6748 7029 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_00100 7022 7294 gene locus_tag LOCUS_00110 7022 7294 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665928.1 protein_id gnl|my_center|LOCUS_00110 7461 8270 gene locus_tag LOCUS_00120 7461 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 8550 9209 gene locus_tag LOCUS_00130 8550 9209 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384085.1 protein_id gnl|my_center|LOCUS_00130 9190 9861 gene locus_tag LOCUS_00140 9190 9861 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154147.1 protein_id gnl|my_center|LOCUS_00140 9894 10667 gene locus_tag LOCUS_00150 9894 10667 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005008.1 protein_id gnl|my_center|LOCUS_00150 10689 11540 gene locus_tag LOCUS_00160 10689 11540 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765262.1 protein_id gnl|my_center|LOCUS_00160 12259 11624 gene locus_tag LOCUS_00170 12259 11624 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550051.1 protein_id gnl|my_center|LOCUS_00170 12712 12263 gene locus_tag LOCUS_00180 12712 12263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 13593 12841 gene locus_tag LOCUS_00190 13593 12841 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_00190 14415 13651 gene locus_tag LOCUS_00200 14415 13651 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903786.1 protein_id gnl|my_center|LOCUS_00200 15995 14415 gene locus_tag LOCUS_00210 15995 14415 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901104.1 protein_id gnl|my_center|LOCUS_00210 16872 16078 gene locus_tag LOCUS_00220 16872 16078 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903784.1 protein_id gnl|my_center|LOCUS_00220 17710 16862 gene locus_tag LOCUS_00230 17710 16862 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015650.1 protein_id gnl|my_center|LOCUS_00230 18948 18010 gene locus_tag LOCUS_00240 18948 18010 CDS product FMN-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254509.1 protein_id gnl|my_center|LOCUS_00240 19456 21624 gene locus_tag LOCUS_00250 gene nrdD 19456 21624 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288083.1 protein_id gnl|my_center|LOCUS_00250 21873 22436 gene locus_tag LOCUS_00260 21873 22436 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899842.1 protein_id gnl|my_center|LOCUS_00260 22529 23329 gene locus_tag LOCUS_00270 22529 23329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 24633 23407 gene locus_tag LOCUS_00280 gene tyrS 24633 23407 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_00280 24897 25925 gene locus_tag LOCUS_00290 24897 25925 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_00290 25925 26473 gene locus_tag LOCUS_00300 gene nrdG 25925 26473 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_00300 26454 27134 gene locus_tag LOCUS_00310 26454 27134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 27247 28710 gene locus_tag LOCUS_00320 27247 28710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 28727 29443 gene locus_tag LOCUS_00330 28727 29443 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815859.1 protein_id gnl|my_center|LOCUS_00330 29576 30634 gene locus_tag LOCUS_00340 29576 30634 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_00340 30693 31229 gene locus_tag LOCUS_00350 30693 31229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 31226 32521 gene locus_tag LOCUS_00360 31226 32521 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898268.1 protein_id gnl|my_center|LOCUS_00360 34184 32739 gene locus_tag LOCUS_00370 gene nagE 34184 32739 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705424.1 protein_id gnl|my_center|LOCUS_00370 34721 34242 gene locus_tag LOCUS_00380 34721 34242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 35561 34725 gene locus_tag LOCUS_00390 gene licT 35561 34725 CDS product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 protein_id gnl|my_center|LOCUS_00390 36065 36391 gene locus_tag LOCUS_00400 36065 36391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 36820 37998 gene locus_tag LOCUS_00410 36820 37998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 38192 39160 gene locus_tag LOCUS_00420 38192 39160 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727629.1 protein_id gnl|my_center|LOCUS_00420 39196 40695 gene locus_tag LOCUS_00430 39196 40695 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563207.1 protein_id gnl|my_center|LOCUS_00430 40704 41621 gene locus_tag LOCUS_00440 40704 41621 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565164.1 protein_id gnl|my_center|LOCUS_00440 41700 43130 gene locus_tag LOCUS_00450 gene araA 41700 43130 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287282.1 protein_id gnl|my_center|LOCUS_00450 43142 43834 gene locus_tag LOCUS_00460 43142 43834 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287284.1 protein_id gnl|my_center|LOCUS_00460 43842 45437 gene locus_tag LOCUS_00470 43842 45437 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_00470 45460 46527 gene locus_tag LOCUS_00480 gene araR 45460 46527 CDS product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 protein_id gnl|my_center|LOCUS_00480 47757 46579 gene locus_tag LOCUS_00490 47757 46579 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965288.1 protein_id gnl|my_center|LOCUS_00490 48606 47818 gene locus_tag LOCUS_00500 48606 47818 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367330.1 protein_id gnl|my_center|LOCUS_00500 49616 48603 gene locus_tag LOCUS_00510 49616 48603 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021255.1 protein_id gnl|my_center|LOCUS_00510 49911 51737 gene locus_tag LOCUS_00520 49911 51737 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_00520 51730 52524 gene locus_tag LOCUS_00530 51730 52524 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286068.1 protein_id gnl|my_center|LOCUS_00530 52812 54233 gene locus_tag LOCUS_00540 52812 54233 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080611.1 protein_id gnl|my_center|LOCUS_00540 54226 55788 gene locus_tag LOCUS_00550 54226 55788 CDS product DUF5060 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548190.1 protein_id gnl|my_center|LOCUS_00550 55798 57342 gene locus_tag LOCUS_00560 55798 57342 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082994.1 protein_id gnl|my_center|LOCUS_00560 57339 58187 gene locus_tag LOCUS_00570 57339 58187 CDS product ketose 1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418474.1 protein_id gnl|my_center|LOCUS_00570 58200 59231 gene locus_tag LOCUS_00580 58200 59231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 59290 60633 gene locus_tag LOCUS_00590 59290 60633 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163929.1 protein_id gnl|my_center|LOCUS_00590 60644 61585 gene locus_tag LOCUS_00600 60644 61585 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733054.1 protein_id gnl|my_center|LOCUS_00600 61598 62959 gene locus_tag LOCUS_00610 61598 62959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 63636 63866 gene locus_tag LOCUS_00620 63636 63866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 63876 64724 gene locus_tag LOCUS_00630 63876 64724 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530307.1 protein_id gnl|my_center|LOCUS_00630 >Feature sequence0002 1486 962 gene locus_tag LOCUS_00640 1486 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 1701 3197 gene locus_tag LOCUS_00650 1701 3197 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678766.1 protein_id gnl|my_center|LOCUS_00650 3411 3163 gene locus_tag LOCUS_00660 3411 3163 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809979.1 protein_id gnl|my_center|LOCUS_00660 4430 3486 gene locus_tag LOCUS_00670 4430 3486 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_00670 5268 4423 gene locus_tag LOCUS_00680 5268 4423 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017014.1 protein_id gnl|my_center|LOCUS_00680 6716 5367 gene locus_tag LOCUS_00690 6716 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 8605 6728 gene locus_tag LOCUS_00700 8605 6728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 9408 8614 gene locus_tag LOCUS_00710 9408 8614 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917001.1 protein_id gnl|my_center|LOCUS_00710 11211 9544 gene locus_tag LOCUS_00720 11211 9544 CDS product DUF5722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303098.1 protein_id gnl|my_center|LOCUS_00720 12996 11314 gene locus_tag LOCUS_00730 12996 11314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 13074 13673 gene locus_tag LOCUS_00740 13074 13673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 15033 13693 gene locus_tag LOCUS_00750 15033 13693 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_00750 15667 15035 gene locus_tag LOCUS_00760 15667 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 16486 15689 gene locus_tag LOCUS_00770 16486 15689 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_00770 17390 16488 gene locus_tag LOCUS_00780 17390 16488 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 protein_id gnl|my_center|LOCUS_00780 18552 17560 gene locus_tag LOCUS_00790 18552 17560 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_00790 19496 18630 gene locus_tag LOCUS_00800 19496 18630 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789270.1 protein_id gnl|my_center|LOCUS_00800 19628 20146 gene locus_tag LOCUS_00810 19628 20146 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318917.1 protein_id gnl|my_center|LOCUS_00810 21776 20175 gene locus_tag LOCUS_00820 21776 20175 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015673.1 protein_id gnl|my_center|LOCUS_00820 22144 21779 gene locus_tag LOCUS_00830 22144 21779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 22704 22171 gene locus_tag LOCUS_00840 gene recU 22704 22171 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460152.1 protein_id gnl|my_center|LOCUS_00840 23692 22676 gene locus_tag LOCUS_00850 23692 22676 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_00850 24225 23692 gene locus_tag LOCUS_00860 24225 23692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 24866 24222 gene locus_tag LOCUS_00870 24866 24222 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_00870 28032 24874 gene locus_tag LOCUS_00880 28032 24874 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080564.1 protein_id gnl|my_center|LOCUS_00880 28729 28010 gene locus_tag LOCUS_00890 28729 28010 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860778.1 protein_id gnl|my_center|LOCUS_00890 30129 28729 gene locus_tag LOCUS_00900 30129 28729 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_00900 30861 30196 gene locus_tag LOCUS_00910 30861 30196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454870.1 protein_id gnl|my_center|LOCUS_00910 31357 30854 gene locus_tag LOCUS_00920 gene coaD 31357 30854 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074274.1 protein_id gnl|my_center|LOCUS_00920 31914 31360 gene locus_tag LOCUS_00930 gene rsmD 31914 31360 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_00930 33487 31925 gene locus_tag LOCUS_00940 33487 31925 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_00940 35549 33498 gene locus_tag LOCUS_00950 gene recG 35549 33498 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965043.1 protein_id gnl|my_center|LOCUS_00950 37271 35619 gene locus_tag LOCUS_00960 37271 35619 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454872.1 protein_id gnl|my_center|LOCUS_00960 37643 37284 gene locus_tag LOCUS_00970 37643 37284 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_00970 37987 38709 gene locus_tag LOCUS_00980 37987 38709 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454563.1 protein_id gnl|my_center|LOCUS_00980 38702 39004 gene locus_tag LOCUS_00990 38702 39004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 39720 39031 gene locus_tag LOCUS_01000 39720 39031 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_01000 40762 39731 gene locus_tag LOCUS_01010 40762 39731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 41946 40762 gene locus_tag LOCUS_01020 gene metK 41946 40762 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933820.1 protein_id gnl|my_center|LOCUS_01020 >Feature sequence0003 21 569 gene locus_tag LOCUS_01030 21 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 1787 711 gene locus_tag LOCUS_01040 1787 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 1924 2508 gene locus_tag LOCUS_01050 gene ruvA 1924 2508 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_01050 2510 3520 gene locus_tag LOCUS_01060 gene ruvB 2510 3520 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_01060 3523 5769 gene locus_tag LOCUS_01070 3523 5769 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 protein_id gnl|my_center|LOCUS_01070 5838 6284 gene locus_tag LOCUS_01080 5838 6284 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416968.1 protein_id gnl|my_center|LOCUS_01080 6271 6921 gene locus_tag LOCUS_01090 6271 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021681.1 protein_id gnl|my_center|LOCUS_01090 6896 7399 gene locus_tag LOCUS_01100 6896 7399 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166043.1 protein_id gnl|my_center|LOCUS_01100 7498 8523 gene locus_tag LOCUS_01110 gene kdgK1 7498 8523 CDS product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902071.1 protein_id gnl|my_center|LOCUS_01110 8656 9549 gene locus_tag LOCUS_01120 8656 9549 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_01120 9549 10946 gene locus_tag LOCUS_01130 gene gltA 9549 10946 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_01130 11177 12361 gene locus_tag LOCUS_01140 11177 12361 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_01140 12473 13354 gene locus_tag LOCUS_01150 12473 13354 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_01150 13362 14321 gene locus_tag LOCUS_01160 13362 14321 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 protein_id gnl|my_center|LOCUS_01160 14321 15073 gene locus_tag LOCUS_01170 14321 15073 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017145.1 protein_id gnl|my_center|LOCUS_01170 15082 15792 gene locus_tag LOCUS_01180 15082 15792 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944002.1 protein_id gnl|my_center|LOCUS_01180 16342 15815 gene locus_tag LOCUS_01190 16342 15815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 16483 20040 gene locus_tag LOCUS_01200 16483 20040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 20096 21325 gene locus_tag LOCUS_01210 20096 21325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 21316 22134 gene locus_tag LOCUS_01220 21316 22134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 22144 24786 gene locus_tag LOCUS_01230 22144 24786 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_01230 24767 25993 gene locus_tag LOCUS_01240 24767 25993 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_01240 25980 26120 gene locus_tag LOCUS_01250 25980 26120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 26123 27478 gene locus_tag LOCUS_01260 26123 27478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 27478 28020 gene locus_tag LOCUS_01270 27478 28020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 28137 28787 gene locus_tag LOCUS_01280 gene fsa 28137 28787 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722103.1 protein_id gnl|my_center|LOCUS_01280 29036 28851 gene locus_tag LOCUS_01290 gene rpmB 29036 28851 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775872.1 protein_id gnl|my_center|LOCUS_01290 29280 31271 gene locus_tag LOCUS_01300 gene tkt 29280 31271 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964657.1 protein_id gnl|my_center|LOCUS_01300 31330 32736 gene locus_tag LOCUS_01310 31330 32736 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_01310 32835 33284 gene locus_tag LOCUS_01320 32835 33284 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362455.1 protein_id gnl|my_center|LOCUS_01320 33354 35312 gene locus_tag LOCUS_01330 gene metG 33354 35312 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_01330 35350 36036 gene locus_tag LOCUS_01340 35350 36036 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_01340 36068 36853 gene locus_tag LOCUS_01350 36068 36853 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947941.1 protein_id gnl|my_center|LOCUS_01350 36898 37770 gene locus_tag LOCUS_01360 gene rsmA 36898 37770 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 protein_id gnl|my_center|LOCUS_01360 37791 39392 gene locus_tag LOCUS_01370 37791 39392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 >Feature sequence0004 96 224 gene locus_tag LOCUS_01380 96 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 332 1654 gene locus_tag LOCUS_01390 332 1654 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680871.1 protein_id gnl|my_center|LOCUS_01390 1660 3399 gene locus_tag LOCUS_01400 gene rho 1660 3399 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898714.1 protein_id gnl|my_center|LOCUS_01400 3465 5378 gene locus_tag LOCUS_01410 gene gyrB 3465 5378 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_01410 5387 7624 gene locus_tag LOCUS_01420 gene gyrA 5387 7624 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_01420 7789 8874 gene locus_tag LOCUS_01430 gene asd 7789 8874 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_01430 8829 8966 gene locus_tag LOCUS_01440 8829 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 9043 10107 gene locus_tag LOCUS_01450 9043 10107 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107212.1 protein_id gnl|my_center|LOCUS_01450 10141 12126 gene locus_tag LOCUS_01460 10141 12126 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_01460 12130 12828 gene locus_tag LOCUS_01470 12130 12828 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_01470 13694 12897 gene locus_tag LOCUS_01480 13694 12897 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_01480 13967 15682 gene locus_tag LOCUS_01490 13967 15682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 15700 17571 gene locus_tag LOCUS_01500 15700 17571 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_01500 17639 17983 gene locus_tag LOCUS_01510 17639 17983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 18294 19346 gene locus_tag LOCUS_01520 gene asrA 18294 19346 CDS product anaerobic sulfite reductase subunit AsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964821.1 protein_id gnl|my_center|LOCUS_01520 19336 20127 gene locus_tag LOCUS_01530 gene asrB 19336 20127 CDS product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964822.1 protein_id gnl|my_center|LOCUS_01530 20139 21110 gene locus_tag LOCUS_01540 gene asrC 20139 21110 CDS product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964823.1 protein_id gnl|my_center|LOCUS_01540 21266 24793 gene locus_tag LOCUS_01550 gene nifJ 21266 24793 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_01550 24917 26539 gene locus_tag LOCUS_01560 24917 26539 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207749.1 protein_id gnl|my_center|LOCUS_01560 26542 27552 gene locus_tag LOCUS_01570 26542 27552 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_01570 27564 29306 gene locus_tag LOCUS_01580 gene dnaG 27564 29306 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357766.1 protein_id gnl|my_center|LOCUS_01580 29317 30486 gene locus_tag LOCUS_01590 gene rpoD 29317 30486 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964612.1 protein_id gnl|my_center|LOCUS_01590 30495 31172 gene locus_tag LOCUS_01600 30495 31172 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964614.1 protein_id gnl|my_center|LOCUS_01600 31159 31947 gene locus_tag LOCUS_01610 31159 31947 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_01610 31951 33045 gene locus_tag LOCUS_01620 31951 33045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 33035 34480 gene locus_tag LOCUS_01630 33035 34480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 34670 35746 gene locus_tag LOCUS_01640 34670 35746 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_01640 35815 37323 gene locus_tag LOCUS_01650 35815 37323 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_01650 37316 38371 gene locus_tag LOCUS_01660 37316 38371 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_01660 >Feature sequence0005 673 1032 gene locus_tag LOCUS_01670 673 1032 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_01670 1044 2696 gene locus_tag LOCUS_01680 1044 2696 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_01680 2762 4825 gene locus_tag LOCUS_01690 gene recG 2762 4825 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_01690 4836 6422 gene locus_tag LOCUS_01700 4836 6422 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_01700 6424 6978 gene locus_tag LOCUS_01710 gene rsmD 6424 6978 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_01710 6981 7484 gene locus_tag LOCUS_01720 gene coaD 6981 7484 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074274.1 protein_id gnl|my_center|LOCUS_01720 7477 8145 gene locus_tag LOCUS_01730 7477 8145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454870.1 protein_id gnl|my_center|LOCUS_01730 8195 9610 gene locus_tag LOCUS_01740 8195 9610 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_01740 9610 10308 gene locus_tag LOCUS_01750 9610 10308 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860778.1 protein_id gnl|my_center|LOCUS_01750 10305 13418 gene locus_tag LOCUS_01760 10305 13418 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080564.1 protein_id gnl|my_center|LOCUS_01760 13422 14066 gene locus_tag LOCUS_01770 13422 14066 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_01770 14063 14617 gene locus_tag LOCUS_01780 14063 14617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 14617 15633 gene locus_tag LOCUS_01790 14617 15633 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_01790 15605 16135 gene locus_tag LOCUS_01800 gene recU 15605 16135 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460152.1 protein_id gnl|my_center|LOCUS_01800 16149 16508 gene locus_tag LOCUS_01810 gene hisI 16149 16508 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721356.1 protein_id gnl|my_center|LOCUS_01810 16511 18112 gene locus_tag LOCUS_01820 16511 18112 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015673.1 protein_id gnl|my_center|LOCUS_01820 18664 18146 gene locus_tag LOCUS_01830 18664 18146 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318917.1 protein_id gnl|my_center|LOCUS_01830 18756 19613 gene locus_tag LOCUS_01840 18756 19613 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965720.1 protein_id gnl|my_center|LOCUS_01840 19760 20767 gene locus_tag LOCUS_01850 19760 20767 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439336.1 protein_id gnl|my_center|LOCUS_01850 20830 21732 gene locus_tag LOCUS_01860 20830 21732 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 protein_id gnl|my_center|LOCUS_01860 21734 22531 gene locus_tag LOCUS_01870 21734 22531 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_01870 22546 23178 gene locus_tag LOCUS_01880 22546 23178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 23179 24525 gene locus_tag LOCUS_01890 23179 24525 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_01890 25056 24559 gene locus_tag LOCUS_01900 25056 24559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 25134 26816 gene locus_tag LOCUS_01910 25134 26816 CDS product DUF2142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963353.1 protein_id gnl|my_center|LOCUS_01910 26906 28570 gene locus_tag LOCUS_01920 26906 28570 CDS product DUF5722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303098.1 protein_id gnl|my_center|LOCUS_01920 28709 29500 gene locus_tag LOCUS_01930 28709 29500 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917001.1 protein_id gnl|my_center|LOCUS_01930 29511 31361 gene locus_tag LOCUS_01940 29511 31361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 31369 32727 gene locus_tag LOCUS_01950 31369 32727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 32815 33660 gene locus_tag LOCUS_01960 32815 33660 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811992.1 protein_id gnl|my_center|LOCUS_01960 33653 34597 gene locus_tag LOCUS_01970 33653 34597 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_01970 34670 34915 gene locus_tag LOCUS_01980 34670 34915 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809979.1 protein_id gnl|my_center|LOCUS_01980 36377 34884 gene locus_tag LOCUS_01990 36377 34884 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678766.1 protein_id gnl|my_center|LOCUS_01990 36561 37115 gene locus_tag LOCUS_02000 36561 37115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 37112 38083 gene locus_tag LOCUS_02010 37112 38083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 >Feature sequence0006 1381 884 gene locus_tag LOCUS_02020 gene trmL 1381 884 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 protein_id gnl|my_center|LOCUS_02020 2538 1381 gene locus_tag LOCUS_02030 2538 1381 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_02030 3017 2535 gene locus_tag LOCUS_02040 3017 2535 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_02040 3591 2989 gene locus_tag LOCUS_02050 3591 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 5222 3591 gene locus_tag LOCUS_02060 5222 3591 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948022.1 protein_id gnl|my_center|LOCUS_02060 5444 5229 gene locus_tag LOCUS_02070 5444 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 6135 5422 gene locus_tag LOCUS_02080 6135 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 6761 6132 gene locus_tag LOCUS_02090 gene nth 6761 6132 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895383.1 protein_id gnl|my_center|LOCUS_02090 7252 6758 gene locus_tag LOCUS_02100 7252 6758 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_02100 8360 7260 gene locus_tag LOCUS_02110 8360 7260 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892045.1 protein_id gnl|my_center|LOCUS_02110 9356 8361 gene locus_tag LOCUS_02120 9356 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 9705 9400 gene locus_tag LOCUS_02130 gene yajC 9705 9400 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080747.1 protein_id gnl|my_center|LOCUS_02130 10846 9716 gene locus_tag LOCUS_02140 gene tgt 10846 9716 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965580.1 protein_id gnl|my_center|LOCUS_02140 13322 10854 gene locus_tag LOCUS_02150 13322 10854 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944693.1 protein_id gnl|my_center|LOCUS_02150 14728 13337 gene locus_tag LOCUS_02160 gene scfB 14728 13337 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_02160 14966 14820 gene locus_tag LOCUS_02170 gene scfA 14966 14820 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_02170 17582 15081 gene locus_tag LOCUS_02180 17582 15081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 17973 17587 gene locus_tag LOCUS_02190 17973 17587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 19952 17973 gene locus_tag LOCUS_02200 19952 17973 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963726.1 protein_id gnl|my_center|LOCUS_02200 20718 19960 gene locus_tag LOCUS_02210 20718 19960 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963729.1 protein_id gnl|my_center|LOCUS_02210 22137 20722 gene locus_tag LOCUS_02220 22137 20722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 23202 22147 gene locus_tag LOCUS_02230 23202 22147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 24505 23213 gene locus_tag LOCUS_02240 24505 23213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 25144 24515 gene locus_tag LOCUS_02250 25144 24515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 26470 25157 gene locus_tag LOCUS_02260 26470 25157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 27351 26500 gene locus_tag LOCUS_02270 27351 26500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 31168 27362 gene locus_tag LOCUS_02280 31168 27362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 31859 31173 gene locus_tag LOCUS_02290 31859 31173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 32125 31883 gene locus_tag LOCUS_02300 32125 31883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 33046 32192 gene locus_tag LOCUS_02310 33046 32192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 33851 33051 gene locus_tag LOCUS_02320 33851 33051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 35089 33851 gene locus_tag LOCUS_02330 35089 33851 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920779.1 protein_id gnl|my_center|LOCUS_02330 37677 35497 gene locus_tag LOCUS_02340 37677 35497 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019639497.1 protein_id gnl|my_center|LOCUS_02340 >Feature sequence0007 138 1502 gene locus_tag LOCUS_02350 138 1502 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741259.1 protein_id gnl|my_center|LOCUS_02350 1495 2655 gene locus_tag LOCUS_02360 gene cobT 1495 2655 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_02360 2652 3170 gene locus_tag LOCUS_02370 2652 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 3173 3931 gene locus_tag LOCUS_02380 gene cobS 3173 3931 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460078.1 protein_id gnl|my_center|LOCUS_02380 3938 4957 gene locus_tag LOCUS_02390 gene cbiB 3938 4957 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861967.1 protein_id gnl|my_center|LOCUS_02390 4942 5703 gene locus_tag LOCUS_02400 gene cobM 4942 5703 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016784.1 protein_id gnl|my_center|LOCUS_02400 5690 6721 gene locus_tag LOCUS_02410 gene cobD 5690 6721 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926914.1 protein_id gnl|my_center|LOCUS_02410 6725 8230 gene locus_tag LOCUS_02420 6725 8230 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189676.1 protein_id gnl|my_center|LOCUS_02420 8243 8899 gene locus_tag LOCUS_02430 8243 8899 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721591.1 protein_id gnl|my_center|LOCUS_02430 9783 9130 gene locus_tag LOCUS_02440 9783 9130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 10033 9830 gene locus_tag LOCUS_02450 10033 9830 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405297.1 protein_id gnl|my_center|LOCUS_02450 10736 10008 gene locus_tag LOCUS_02460 10736 10008 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_02460 12179 10833 gene locus_tag LOCUS_02470 12179 10833 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_02470 13420 12242 gene locus_tag LOCUS_02480 gene alr 13420 12242 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048315.1 protein_id gnl|my_center|LOCUS_02480 14298 13432 gene locus_tag LOCUS_02490 14298 13432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 14693 14325 gene locus_tag LOCUS_02500 gene acpS 14693 14325 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861979.1 protein_id gnl|my_center|LOCUS_02500 15342 14686 gene locus_tag LOCUS_02510 15342 14686 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_02510 15528 17453 gene locus_tag LOCUS_02520 15528 17453 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_02520 17475 17675 gene locus_tag LOCUS_02530 17475 17675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 19824 17755 gene locus_tag LOCUS_02540 gene topA 19824 17755 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_02540 20953 19838 gene locus_tag LOCUS_02550 gene dprA 20953 19838 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047859.1 protein_id gnl|my_center|LOCUS_02550 22483 20963 gene locus_tag LOCUS_02560 22483 20963 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_02560 23657 22590 gene locus_tag LOCUS_02570 gene galE 23657 22590 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_02570 24935 23757 gene locus_tag LOCUS_02580 24935 23757 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860970.1 protein_id gnl|my_center|LOCUS_02580 25633 24935 gene locus_tag LOCUS_02590 25633 24935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 27001 25643 gene locus_tag LOCUS_02600 27001 25643 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459130.1 protein_id gnl|my_center|LOCUS_02600 28749 27001 gene locus_tag LOCUS_02610 28749 27001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 29429 28755 gene locus_tag LOCUS_02620 29429 28755 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878518.1 protein_id gnl|my_center|LOCUS_02620 32102 29607 gene locus_tag LOCUS_02630 gene clpC 32102 29607 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971183.1 protein_id gnl|my_center|LOCUS_02630 33152 32115 gene locus_tag LOCUS_02640 33152 32115 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 protein_id gnl|my_center|LOCUS_02640 33726 33142 gene locus_tag LOCUS_02650 33726 33142 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421255.1 protein_id gnl|my_center|LOCUS_02650 34123 33716 gene locus_tag LOCUS_02660 34123 33716 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358748.1 protein_id gnl|my_center|LOCUS_02660 35842 34544 gene locus_tag LOCUS_02670 35842 34544 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_02670 >Feature sequence0008 429 1400 gene locus_tag LOCUS_02680 429 1400 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949059.1 protein_id gnl|my_center|LOCUS_02680 1390 2049 gene locus_tag LOCUS_02690 1390 2049 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358543.1 protein_id gnl|my_center|LOCUS_02690 2105 2977 gene locus_tag LOCUS_02700 2105 2977 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949060.1 protein_id gnl|my_center|LOCUS_02700 2989 4104 gene locus_tag LOCUS_02710 2989 4104 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986252.1 protein_id gnl|my_center|LOCUS_02710 4382 4203 gene locus_tag LOCUS_02720 4382 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 4351 4911 gene locus_tag LOCUS_02730 gene efp 4351 4911 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_02730 5066 6835 gene locus_tag LOCUS_02740 gene argS 5066 6835 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_02740 6985 7887 gene locus_tag LOCUS_02750 6985 7887 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_02750 8102 8674 gene locus_tag LOCUS_02760 8102 8674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 8741 10099 gene locus_tag LOCUS_02770 8741 10099 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809662.1 protein_id gnl|my_center|LOCUS_02770 10462 11817 gene locus_tag LOCUS_02780 gene rsxC 10462 11817 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_02780 11817 12830 gene locus_tag LOCUS_02790 11817 12830 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_02790 12827 13438 gene locus_tag LOCUS_02800 12827 13438 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_02800 13451 14134 gene locus_tag LOCUS_02810 13451 14134 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_02810 14144 14719 gene locus_tag LOCUS_02820 gene rsxA 14144 14719 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_02820 14729 15553 gene locus_tag LOCUS_02830 14729 15553 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_02830 16061 15597 gene locus_tag LOCUS_02840 16061 15597 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962372.1 protein_id gnl|my_center|LOCUS_02840 16594 21375 gene locus_tag LOCUS_02850 16594 21375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 21725 22891 gene locus_tag LOCUS_02860 gene prdC 21725 22891 CDS product proline reductase-associated electron transfer protein PrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431873.1 protein_id gnl|my_center|LOCUS_02860 23045 24931 gene locus_tag LOCUS_02870 gene prdA 23045 24931 CDS product D-proline reductase (dithiol) proprotein PrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422104.1 protein_id gnl|my_center|LOCUS_02870 24961 25230 gene locus_tag LOCUS_02880 24961 25230 CDS product CBO2463/CBO2479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422102.1 protein_id gnl|my_center|LOCUS_02880 25227 25949 gene locus_tag LOCUS_02890 gene prdB 25227 25949 CDS product D-proline reductase (dithiol) protein PrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861888.1 transl_except (pos:25674..25676,aa:Sec) note codon on position 150 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_02890 26081 26824 gene locus_tag LOCUS_02900 gene prdD 26081 26824 CDS product proline reductase cluster protein PrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428092.1 protein_id gnl|my_center|LOCUS_02900 26834 27301 gene locus_tag LOCUS_02910 26834 27301 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422094.1 protein_id gnl|my_center|LOCUS_02910 27323 28327 gene locus_tag LOCUS_02920 27323 28327 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422090.1 protein_id gnl|my_center|LOCUS_02920 28377 29708 gene locus_tag LOCUS_02930 28377 29708 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986557.1 protein_id gnl|my_center|LOCUS_02930 29749 30834 gene locus_tag LOCUS_02940 29749 30834 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986558.1 protein_id gnl|my_center|LOCUS_02940 31112 31999 gene locus_tag LOCUS_02950 31112 31999 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439900.1 protein_id gnl|my_center|LOCUS_02950 32014 32898 gene locus_tag LOCUS_02960 32014 32898 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451047.1 protein_id gnl|my_center|LOCUS_02960 33481 34926 gene locus_tag LOCUS_02970 gene proS 33481 34926 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895182.1 protein_id gnl|my_center|LOCUS_02970 >Feature sequence0009 1023 328 gene locus_tag LOCUS_02980 1023 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 2356 1109 gene locus_tag LOCUS_02990 gene hflX 2356 1109 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_02990 3203 2364 gene locus_tag LOCUS_03000 3203 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 3612 3181 gene locus_tag LOCUS_03010 gene dutA 3612 3181 CDS product dUTP diphosphatase DutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245820.1 protein_id gnl|my_center|LOCUS_03010 4223 3618 gene locus_tag LOCUS_03020 gene scpB 4223 3618 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428258.1 protein_id gnl|my_center|LOCUS_03020 5010 4216 gene locus_tag LOCUS_03030 5010 4216 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965361.1 protein_id gnl|my_center|LOCUS_03030 5923 5048 gene locus_tag LOCUS_03040 5923 5048 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888897.1 protein_id gnl|my_center|LOCUS_03040 7298 5931 gene locus_tag LOCUS_03050 7298 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 8750 7563 gene locus_tag LOCUS_03060 8750 7563 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430617.1 protein_id gnl|my_center|LOCUS_03060 10470 8770 gene locus_tag LOCUS_03070 10470 8770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 11838 10495 gene locus_tag LOCUS_03080 11838 10495 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_03080 12264 11839 gene locus_tag LOCUS_03090 gene fabZ 12264 11839 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048424.1 protein_id gnl|my_center|LOCUS_03090 12725 12291 gene locus_tag LOCUS_03100 gene accB 12725 12291 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545496.1 protein_id gnl|my_center|LOCUS_03100 13965 12730 gene locus_tag LOCUS_03110 gene fabF 13965 12730 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_03110 14739 13993 gene locus_tag LOCUS_03120 gene fabG 14739 13993 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_03120 15653 14736 gene locus_tag LOCUS_03130 gene fabD 15653 14736 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_03130 16594 15656 gene locus_tag LOCUS_03140 gene fabK 16594 15656 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_03140 16882 16646 gene locus_tag LOCUS_03150 gene acpP 16882 16646 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965054.1 protein_id gnl|my_center|LOCUS_03150 17883 16942 gene locus_tag LOCUS_03160 17883 16942 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_03160 18935 18009 gene locus_tag LOCUS_03170 18935 18009 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836550.1 protein_id gnl|my_center|LOCUS_03170 19182 20723 gene locus_tag LOCUS_03180 19182 20723 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890565.1 protein_id gnl|my_center|LOCUS_03180 20866 21783 gene locus_tag LOCUS_03190 20866 21783 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434205.1 protein_id gnl|my_center|LOCUS_03190 21780 23480 gene locus_tag LOCUS_03200 21780 23480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860733.1 protein_id gnl|my_center|LOCUS_03200 25948 23786 gene locus_tag LOCUS_03210 gene cooS 25948 23786 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768251.1 protein_id gnl|my_center|LOCUS_03210 27213 26161 gene locus_tag LOCUS_03220 27213 26161 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 protein_id gnl|my_center|LOCUS_03220 28009 27227 gene locus_tag LOCUS_03230 28009 27227 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888867.1 protein_id gnl|my_center|LOCUS_03230 29190 28036 gene locus_tag LOCUS_03240 29190 28036 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_03240 30202 29366 gene locus_tag LOCUS_03250 30202 29366 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901831.1 protein_id gnl|my_center|LOCUS_03250 31055 30279 gene locus_tag LOCUS_03260 31055 30279 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 protein_id gnl|my_center|LOCUS_03260 31477 32718 gene locus_tag LOCUS_03270 31477 32718 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921819.1 protein_id gnl|my_center|LOCUS_03270 32715 33365 gene locus_tag LOCUS_03280 32715 33365 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902988.1 protein_id gnl|my_center|LOCUS_03280 >Feature sequence0010 3 362 gene locus_tag LOCUS_03290 3 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 364 819 gene locus_tag LOCUS_03300 364 819 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_03300 857 2506 gene locus_tag LOCUS_03310 gene recN 857 2506 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986438.1 protein_id gnl|my_center|LOCUS_03310 2520 3962 gene locus_tag LOCUS_03320 gene glgA 2520 3962 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_03320 3959 4444 gene locus_tag LOCUS_03330 3959 4444 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964974.1 protein_id gnl|my_center|LOCUS_03330 4441 4899 gene locus_tag LOCUS_03340 4441 4899 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 protein_id gnl|my_center|LOCUS_03340 4902 5681 gene locus_tag LOCUS_03350 4902 5681 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_03350 5691 6668 gene locus_tag LOCUS_03360 5691 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 6655 7146 gene locus_tag LOCUS_03370 6655 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 7136 7654 gene locus_tag LOCUS_03380 7136 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 7670 8893 gene locus_tag LOCUS_03390 7670 8893 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_03390 9050 10369 gene locus_tag LOCUS_03400 9050 10369 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_03400 10410 11597 gene locus_tag LOCUS_03410 10410 11597 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_03410 11594 12259 gene locus_tag LOCUS_03420 gene cmk 11594 12259 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 protein_id gnl|my_center|LOCUS_03420 12256 13104 gene locus_tag LOCUS_03430 12256 13104 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439450.1 protein_id gnl|my_center|LOCUS_03430 13085 14191 gene locus_tag LOCUS_03440 gene rpsA 13085 14191 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986222.1 protein_id gnl|my_center|LOCUS_03440 14261 15100 gene locus_tag LOCUS_03450 14261 15100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 15097 16107 gene locus_tag LOCUS_03460 gene cbiG 15097 16107 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948632.1 protein_id gnl|my_center|LOCUS_03460 16109 16372 gene locus_tag LOCUS_03470 16109 16372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 16471 17463 gene locus_tag LOCUS_03480 gene plsX 16471 17463 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047867.1 protein_id gnl|my_center|LOCUS_03480 17477 17716 gene locus_tag LOCUS_03490 gene acpP 17477 17716 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_03490 17775 18473 gene locus_tag LOCUS_03500 gene rnc 17775 18473 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_03500 18464 22021 gene locus_tag LOCUS_03510 gene smc 18464 22021 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_03510 22031 22960 gene locus_tag LOCUS_03520 gene ftsY 22031 22960 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393780.1 protein_id gnl|my_center|LOCUS_03520 23006 24235 gene locus_tag LOCUS_03530 gene ilvA 23006 24235 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_03530 24228 25553 gene locus_tag LOCUS_03540 24228 25553 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416818.1 protein_id gnl|my_center|LOCUS_03540 25563 26444 gene locus_tag LOCUS_03550 gene dapA 25563 26444 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965674.1 protein_id gnl|my_center|LOCUS_03550 26444 27196 gene locus_tag LOCUS_03560 gene dapB 26444 27196 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_03560 27249 28505 gene locus_tag LOCUS_03570 27249 28505 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861133.1 protein_id gnl|my_center|LOCUS_03570 28948 29673 gene locus_tag LOCUS_03580 28948 29673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 >Feature sequence0011 <1 1217 gene locus_tag LOCUS_03590 <1 1217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963725.1:Ig-like domain-containing protein 1337 1483 gene locus_tag LOCUS_03600 gene scfA 1337 1483 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_03600 1578 2969 gene locus_tag LOCUS_03610 gene scfB 1578 2969 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_03610 2984 5395 gene locus_tag LOCUS_03620 gene secDF 2984 5395 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723531.1 protein_id gnl|my_center|LOCUS_03620 5403 6539 gene locus_tag LOCUS_03630 gene tgt 5403 6539 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965580.1 protein_id gnl|my_center|LOCUS_03630 6547 6855 gene locus_tag LOCUS_03640 gene yajC 6547 6855 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080747.1 protein_id gnl|my_center|LOCUS_03640 6913 7908 gene locus_tag LOCUS_03650 6913 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 7909 9009 gene locus_tag LOCUS_03660 7909 9009 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947984.1 protein_id gnl|my_center|LOCUS_03660 9006 9500 gene locus_tag LOCUS_03670 9006 9500 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_03670 9497 10126 gene locus_tag LOCUS_03680 gene nth 9497 10126 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895383.1 protein_id gnl|my_center|LOCUS_03680 10123 10830 gene locus_tag LOCUS_03690 10123 10830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 11067 12674 gene locus_tag LOCUS_03700 11067 12674 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948022.1 protein_id gnl|my_center|LOCUS_03700 12674 13276 gene locus_tag LOCUS_03710 12674 13276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 13245 13730 gene locus_tag LOCUS_03720 13245 13730 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_03720 13727 14887 gene locus_tag LOCUS_03730 13727 14887 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_03730 14884 15414 gene locus_tag LOCUS_03740 gene trmL 14884 15414 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 protein_id gnl|my_center|LOCUS_03740 16209 15430 gene locus_tag LOCUS_03750 16209 15430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 16315 16863 gene locus_tag LOCUS_03760 16315 16863 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180154.1 protein_id gnl|my_center|LOCUS_03760 16860 18776 gene locus_tag LOCUS_03770 16860 18776 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_03770 18799 19584 gene locus_tag LOCUS_03780 18799 19584 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 protein_id gnl|my_center|LOCUS_03780 19658 20605 gene locus_tag LOCUS_03790 gene argF 19658 20605 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869677.1 protein_id gnl|my_center|LOCUS_03790 20595 20882 gene locus_tag LOCUS_03800 20595 20882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 21202 22137 gene locus_tag LOCUS_03810 gene rsmH 21202 22137 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_03810 22139 22639 gene locus_tag LOCUS_03820 22139 22639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 22608 24641 gene locus_tag LOCUS_03830 22608 24641 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_03830 24657 25625 gene locus_tag LOCUS_03840 gene mraY 24657 25625 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427000.1 protein_id gnl|my_center|LOCUS_03840 25634 26980 gene locus_tag LOCUS_03850 gene murD 25634 26980 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_03850 26982 28364 gene locus_tag LOCUS_03860 gene spoVE 26982 28364 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_03860 28369 29067 gene locus_tag LOCUS_03870 28369 29067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 >Feature sequence0012 <1 1016 gene locus_tag LOCUS_03880 <1 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851634.1:N-acetyl-gamma-glutamyl-phosphate reductase 1016 1474 gene locus_tag LOCUS_03890 1016 1474 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851934.1 protein_id gnl|my_center|LOCUS_03890 1545 2771 gene locus_tag LOCUS_03900 gene argJ 1545 2771 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965687.1 protein_id gnl|my_center|LOCUS_03900 2783 3643 gene locus_tag LOCUS_03910 gene argB 2783 3643 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864194.1 protein_id gnl|my_center|LOCUS_03910 3647 4834 gene locus_tag LOCUS_03920 3647 4834 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864195.1 protein_id gnl|my_center|LOCUS_03920 4849 6153 gene locus_tag LOCUS_03930 gene glnA 4849 6153 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231737.1 protein_id gnl|my_center|LOCUS_03930 6186 6737 gene locus_tag LOCUS_03940 6186 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 6756 7559 gene locus_tag LOCUS_03950 gene dapF 6756 7559 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_03950 7887 8975 gene locus_tag LOCUS_03960 7887 8975 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966511.1 protein_id gnl|my_center|LOCUS_03960 9082 10398 gene locus_tag LOCUS_03970 9082 10398 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357628.1 protein_id gnl|my_center|LOCUS_03970 10401 13829 gene locus_tag LOCUS_03980 10401 13829 CDS product SNF2 helicase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986302.1 protein_id gnl|my_center|LOCUS_03980 13864 14793 gene locus_tag LOCUS_03990 gene hprK 13864 14793 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_03990 14815 15696 gene locus_tag LOCUS_04000 gene murB 14815 15696 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_04000 15698 16573 gene locus_tag LOCUS_04010 gene rapZ 15698 16573 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_04010 16581 17543 gene locus_tag LOCUS_04020 gene whiA 16581 17543 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_04020 17536 17796 gene locus_tag LOCUS_04030 17536 17796 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_04030 18006 18833 gene locus_tag LOCUS_04040 18006 18833 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915025.1 protein_id gnl|my_center|LOCUS_04040 18835 19527 gene locus_tag LOCUS_04050 18835 19527 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_04050 19517 20254 gene locus_tag LOCUS_04060 19517 20254 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724134.1 protein_id gnl|my_center|LOCUS_04060 20400 21791 gene locus_tag LOCUS_04070 gene clpX 20400 21791 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880858.1 protein_id gnl|my_center|LOCUS_04070 21800 22279 gene locus_tag LOCUS_04080 gene lspA 21800 22279 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974241.1 protein_id gnl|my_center|LOCUS_04080 22293 23558 gene locus_tag LOCUS_04090 22293 23558 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_04090 23558 24202 gene locus_tag LOCUS_04100 23558 24202 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435799.1 protein_id gnl|my_center|LOCUS_04100 24196 24516 gene locus_tag LOCUS_04110 24196 24516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 24504 25046 gene locus_tag LOCUS_04120 24504 25046 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526464.1 protein_id gnl|my_center|LOCUS_04120 25194 26333 gene locus_tag LOCUS_04130 25194 26333 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963712.1 protein_id gnl|my_center|LOCUS_04130 26345 27520 gene locus_tag LOCUS_04140 26345 27520 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948998.1 protein_id gnl|my_center|LOCUS_04140 >Feature sequence0013 3022 1805 gene locus_tag LOCUS_04150 3022 1805 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_04150 3552 3037 gene locus_tag LOCUS_04160 3552 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 4033 3542 gene locus_tag LOCUS_04170 4033 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 4997 4020 gene locus_tag LOCUS_04180 4997 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 5531 5073 gene locus_tag LOCUS_04190 5531 5073 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 protein_id gnl|my_center|LOCUS_04190 6013 5528 gene locus_tag LOCUS_04200 6013 5528 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964974.1 protein_id gnl|my_center|LOCUS_04200 7452 6010 gene locus_tag LOCUS_04210 gene glgA 7452 6010 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_04210 9109 7460 gene locus_tag LOCUS_04220 gene recN 9109 7460 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986438.1 protein_id gnl|my_center|LOCUS_04220 9603 9151 gene locus_tag LOCUS_04230 9603 9151 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_04230 10429 9605 gene locus_tag LOCUS_04240 10429 9605 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_04240 11229 10438 gene locus_tag LOCUS_04250 11229 10438 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_04250 13096 11219 gene locus_tag LOCUS_04260 gene dxs 13096 11219 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_04260 13994 13104 gene locus_tag LOCUS_04270 13994 13104 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_04270 14229 13987 gene locus_tag LOCUS_04280 14229 13987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 15422 14244 gene locus_tag LOCUS_04290 gene xseA 15422 14244 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_04290 15867 15427 gene locus_tag LOCUS_04300 gene nusB 15867 15427 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_04300 16004 16678 gene locus_tag LOCUS_04310 16004 16678 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127552.1 protein_id gnl|my_center|LOCUS_04310 16755 17747 gene locus_tag LOCUS_04320 16755 17747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 21241 17777 gene locus_tag LOCUS_04330 gene addA 21241 17777 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861079.1 protein_id gnl|my_center|LOCUS_04330 24590 21204 gene locus_tag LOCUS_04340 gene addB 24590 21204 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948191.1 protein_id gnl|my_center|LOCUS_04340 25843 24644 gene locus_tag LOCUS_04350 25843 24644 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_04350 26223 25852 gene locus_tag LOCUS_04360 26223 25852 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462292.1 protein_id gnl|my_center|LOCUS_04360 27554 26271 gene locus_tag LOCUS_04370 gene serS 27554 26271 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_04370 >Feature sequence0014 975 208 gene locus_tag LOCUS_04380 975 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 2408 1158 gene locus_tag LOCUS_04390 2408 1158 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 protein_id gnl|my_center|LOCUS_04390 3336 2578 gene locus_tag LOCUS_04400 gene srtB 3336 2578 CDS product sortase SrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903304.1 protein_id gnl|my_center|LOCUS_04400 4609 3467 gene locus_tag LOCUS_04410 4609 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 4955 4566 gene locus_tag LOCUS_04420 4955 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 5401 4952 gene locus_tag LOCUS_04430 5401 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 6303 5398 gene locus_tag LOCUS_04440 6303 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 8224 6317 gene locus_tag LOCUS_04450 8224 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 8397 8221 gene locus_tag LOCUS_04460 8397 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 9670 8441 gene locus_tag LOCUS_04470 9670 8441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 10219 9674 gene locus_tag LOCUS_04480 10219 9674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 11660 10401 gene locus_tag LOCUS_04490 11660 10401 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481288.1 protein_id gnl|my_center|LOCUS_04490 12133 11654 gene locus_tag LOCUS_04500 12133 11654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 13142 12135 gene locus_tag LOCUS_04510 13142 12135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 14329 13310 gene locus_tag LOCUS_04520 gene mglB 14329 13310 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215885.1 protein_id gnl|my_center|LOCUS_04520 15310 14345 gene locus_tag LOCUS_04530 15310 14345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 17084 15297 gene locus_tag LOCUS_04540 17084 15297 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_04540 18690 17086 gene locus_tag LOCUS_04550 18690 17086 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_04550 19129 18692 gene locus_tag LOCUS_04560 gene dtd 19129 18692 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547036.1 protein_id gnl|my_center|LOCUS_04560 19631 19137 gene locus_tag LOCUS_04570 gene greA 19631 19137 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818750.1 protein_id gnl|my_center|LOCUS_04570 20433 19954 gene locus_tag LOCUS_04580 20433 19954 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_04580 22316 20433 gene locus_tag LOCUS_04590 22316 20433 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459352.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04590 22563 22342 gene locus_tag LOCUS_04600 22563 22342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04600 22916 22560 gene locus_tag LOCUS_04610 22916 22560 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903515.1 protein_id gnl|my_center|LOCUS_04610 24201 23116 gene locus_tag LOCUS_04620 gene trpS 24201 23116 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_04620 25840 24194 gene locus_tag LOCUS_04630 25840 24194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 26546 25854 gene locus_tag LOCUS_04640 26546 25854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 >Feature sequence0015 <1 511 gene locus_tag LOCUS_04650 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948344.1:rod shape-determining protein RodA 528 923 gene locus_tag LOCUS_04660 gene mgsA 528 923 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230640.1 protein_id gnl|my_center|LOCUS_04660 898 1908 gene locus_tag LOCUS_04670 898 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 1995 2414 gene locus_tag LOCUS_04680 1995 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 2602 3993 gene locus_tag LOCUS_04690 2602 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 4002 4682 gene locus_tag LOCUS_04700 4002 4682 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360698.1 protein_id gnl|my_center|LOCUS_04700 4699 5232 gene locus_tag LOCUS_04710 4699 5232 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565171.1 protein_id gnl|my_center|LOCUS_04710 5235 5984 gene locus_tag LOCUS_04720 5235 5984 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358628.1 protein_id gnl|my_center|LOCUS_04720 5985 7073 gene locus_tag LOCUS_04730 gene aroB 5985 7073 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021364.1 protein_id gnl|my_center|LOCUS_04730 7058 7555 gene locus_tag LOCUS_04740 gene lspA 7058 7555 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364048.1 protein_id gnl|my_center|LOCUS_04740 7567 8478 gene locus_tag LOCUS_04750 7567 8478 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861614.1 protein_id gnl|my_center|LOCUS_04750 8649 9275 gene locus_tag LOCUS_04760 8649 9275 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_04760 9272 10402 gene locus_tag LOCUS_04770 9272 10402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 10418 12508 gene locus_tag LOCUS_04780 10418 12508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 12527 13570 gene locus_tag LOCUS_04790 12527 13570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 13713 15404 gene locus_tag LOCUS_04800 13713 15404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 15416 16123 gene locus_tag LOCUS_04810 15416 16123 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929879.1 protein_id gnl|my_center|LOCUS_04810 16188 17246 gene locus_tag LOCUS_04820 16188 17246 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369660.1 protein_id gnl|my_center|LOCUS_04820 17212 19644 gene locus_tag LOCUS_04830 17212 19644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 19645 20595 gene locus_tag LOCUS_04840 19645 20595 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_04840 20585 21460 gene locus_tag LOCUS_04850 20585 21460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 21441 22715 gene locus_tag LOCUS_04860 21441 22715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132415.1 protein_id gnl|my_center|LOCUS_04860 22797 24296 gene locus_tag LOCUS_04870 gene thrC 22797 24296 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_04870 24299 25162 gene locus_tag LOCUS_04880 gene fba 24299 25162 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_04880 >Feature sequence0016 90 1520 gene locus_tag LOCUS_04890 gene purB 90 1520 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_04890 1531 2808 gene locus_tag LOCUS_04900 1531 2808 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401829.1 protein_id gnl|my_center|LOCUS_04900 2883 3902 gene locus_tag LOCUS_04910 gene pheS 2883 3902 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_04910 3937 6357 gene locus_tag LOCUS_04920 gene pheT 3937 6357 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_04920 6403 7887 gene locus_tag LOCUS_04930 6403 7887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 7956 8186 gene locus_tag LOCUS_04940 7956 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 8201 10378 gene locus_tag LOCUS_04950 gene rnr 8201 10378 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434984.1 protein_id gnl|my_center|LOCUS_04950 10362 10823 gene locus_tag LOCUS_04960 gene smpB 10362 10823 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 protein_id gnl|my_center|LOCUS_04960 10904 11182 gene locus_tag LOCUS_04970 10904 11182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 12250 11195 gene locus_tag LOCUS_04980 12250 11195 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_04980 12413 13711 gene locus_tag LOCUS_04990 gene eno 12413 13711 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964032.1 protein_id gnl|my_center|LOCUS_04990 14422 13793 gene locus_tag LOCUS_05000 gene upp 14422 13793 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_05000 15274 14489 gene locus_tag LOCUS_05010 15274 14489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 15498 16700 gene locus_tag LOCUS_05020 15498 16700 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861646.1 protein_id gnl|my_center|LOCUS_05020 16713 17378 gene locus_tag LOCUS_05030 gene sdaAB 16713 17378 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963992.1 protein_id gnl|my_center|LOCUS_05030 17387 18250 gene locus_tag LOCUS_05040 gene sdaAA 17387 18250 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963993.1 protein_id gnl|my_center|LOCUS_05040 19276 18329 gene locus_tag LOCUS_05050 19276 18329 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153115.1 protein_id gnl|my_center|LOCUS_05050 19458 21560 gene locus_tag LOCUS_05060 19458 21560 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272522.1 protein_id gnl|my_center|LOCUS_05060 21722 22114 gene locus_tag LOCUS_05070 21722 22114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 22214 23158 gene locus_tag LOCUS_05080 22214 23158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 23280 24686 gene locus_tag LOCUS_05090 23280 24686 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262172.1 protein_id gnl|my_center|LOCUS_05090 24757 25716 gene locus_tag LOCUS_05100 24757 25716 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968826.1 protein_id gnl|my_center|LOCUS_05100 25713 27032 gene locus_tag LOCUS_05110 25713 27032 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739314.1 protein_id gnl|my_center|LOCUS_05110 >Feature sequence0017 574 65 gene locus_tag LOCUS_05120 574 65 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392747.1 protein_id gnl|my_center|LOCUS_05120 1850 681 gene locus_tag LOCUS_05130 1850 681 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_05130 4223 1965 gene locus_tag LOCUS_05140 gene lon 4223 1965 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963778.1 protein_id gnl|my_center|LOCUS_05140 5561 4389 gene locus_tag LOCUS_05150 5561 4389 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948998.1 protein_id gnl|my_center|LOCUS_05150 6745 5573 gene locus_tag LOCUS_05160 6745 5573 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963712.1 protein_id gnl|my_center|LOCUS_05160 7491 6949 gene locus_tag LOCUS_05170 7491 6949 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_05170 7799 7479 gene locus_tag LOCUS_05180 7799 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 8437 7793 gene locus_tag LOCUS_05190 8437 7793 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435799.1 protein_id gnl|my_center|LOCUS_05190 9702 8437 gene locus_tag LOCUS_05200 9702 8437 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_05200 10201 9722 gene locus_tag LOCUS_05210 10201 9722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 11607 10210 gene locus_tag LOCUS_05220 11607 10210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 12437 11700 gene locus_tag LOCUS_05230 12437 11700 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724134.1 protein_id gnl|my_center|LOCUS_05230 13119 12427 gene locus_tag LOCUS_05240 13119 12427 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_05240 13912 13121 gene locus_tag LOCUS_05250 13912 13121 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915025.1 protein_id gnl|my_center|LOCUS_05250 14385 14125 gene locus_tag LOCUS_05260 14385 14125 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_05260 15340 14378 gene locus_tag LOCUS_05270 gene whiA 15340 14378 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_05270 16224 15349 gene locus_tag LOCUS_05280 gene rapZ 16224 15349 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_05280 17113 16226 gene locus_tag LOCUS_05290 gene murB 17113 16226 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_05290 18083 17139 gene locus_tag LOCUS_05300 gene hprK 18083 17139 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_05300 21513 18100 gene locus_tag LOCUS_05310 21513 18100 CDS product SNF2 helicase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986302.1 protein_id gnl|my_center|LOCUS_05310 22832 21516 gene locus_tag LOCUS_05320 22832 21516 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357628.1 protein_id gnl|my_center|LOCUS_05320 24034 22946 gene locus_tag LOCUS_05330 24034 22946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 25166 24354 gene locus_tag LOCUS_05340 gene dapF 25166 24354 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_05340 25736 25185 gene locus_tag LOCUS_05350 25736 25185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 <27055 25811 gene locus_tag LOCUS_05360 <27055 25811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003231737.1:type I glutamate--ammonia ligase >Feature sequence0018 475 299 gene locus_tag LOCUS_05370 475 299 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405297.1 protein_id gnl|my_center|LOCUS_05370 1205 477 gene locus_tag LOCUS_05380 1205 477 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_05380 2610 1252 gene locus_tag LOCUS_05390 2610 1252 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_05390 3970 2636 gene locus_tag LOCUS_05400 3970 2636 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_05400 5196 4018 gene locus_tag LOCUS_05410 gene alr 5196 4018 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048315.1 protein_id gnl|my_center|LOCUS_05410 6061 5183 gene locus_tag LOCUS_05420 6061 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 6447 6079 gene locus_tag LOCUS_05430 gene acpS 6447 6079 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963811.1 protein_id gnl|my_center|LOCUS_05430 7096 6440 gene locus_tag LOCUS_05440 7096 6440 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_05440 7416 9344 gene locus_tag LOCUS_05450 7416 9344 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_05450 9346 9558 gene locus_tag LOCUS_05460 9346 9558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 11731 9656 gene locus_tag LOCUS_05470 gene topA 11731 9656 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_05470 12859 11744 gene locus_tag LOCUS_05480 gene dprA 12859 11744 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047859.1 protein_id gnl|my_center|LOCUS_05480 14384 12870 gene locus_tag LOCUS_05490 14384 12870 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_05490 15506 14439 gene locus_tag LOCUS_05500 gene galE 15506 14439 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_05500 16975 15617 gene locus_tag LOCUS_05510 16975 15617 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459130.1 protein_id gnl|my_center|LOCUS_05510 18715 16976 gene locus_tag LOCUS_05520 18715 16976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 19394 18720 gene locus_tag LOCUS_05530 19394 18720 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878518.1 protein_id gnl|my_center|LOCUS_05530 22032 19543 gene locus_tag LOCUS_05540 gene clpC 22032 19543 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971183.1 protein_id gnl|my_center|LOCUS_05540 23076 22045 gene locus_tag LOCUS_05550 23076 22045 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 protein_id gnl|my_center|LOCUS_05550 23632 23066 gene locus_tag LOCUS_05560 23632 23066 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421255.1 protein_id gnl|my_center|LOCUS_05560 24030 23659 gene locus_tag LOCUS_05570 24030 23659 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963919.1 protein_id gnl|my_center|LOCUS_05570 24987 24556 gene locus_tag LOCUS_05580 24987 24556 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004309783.1 protein_id gnl|my_center|LOCUS_05580 26307 25009 gene locus_tag LOCUS_05590 26307 25009 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_05590 >Feature sequence0019 861 319 gene locus_tag LOCUS_05600 861 319 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_05600 2630 1077 gene locus_tag LOCUS_05610 2630 1077 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233752.1 protein_id gnl|my_center|LOCUS_05610 2821 2627 gene locus_tag LOCUS_05620 2821 2627 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815177.1 protein_id gnl|my_center|LOCUS_05620 3657 2818 gene locus_tag LOCUS_05630 3657 2818 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_05630 4048 3770 gene locus_tag LOCUS_05640 4048 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 4466 4104 gene locus_tag LOCUS_05650 4466 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 4921 4472 gene locus_tag LOCUS_05660 gene rpiB 4921 4472 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721856.1 protein_id gnl|my_center|LOCUS_05660 5778 4936 gene locus_tag LOCUS_05670 gene rsmI 5778 4936 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947928.1 protein_id gnl|my_center|LOCUS_05670 6514 5768 gene locus_tag LOCUS_05680 6514 5768 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947927.1 protein_id gnl|my_center|LOCUS_05680 7328 6519 gene locus_tag LOCUS_05690 7328 6519 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963624.1 protein_id gnl|my_center|LOCUS_05690 8309 7338 gene locus_tag LOCUS_05700 8309 7338 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_05700 8895 8311 gene locus_tag LOCUS_05710 8895 8311 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963621.1 protein_id gnl|my_center|LOCUS_05710 10266 8902 gene locus_tag LOCUS_05720 10266 8902 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861997.1 protein_id gnl|my_center|LOCUS_05720 13249 10259 gene locus_tag LOCUS_05730 13249 10259 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_05730 13778 13260 gene locus_tag LOCUS_05740 13778 13260 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775404.1 protein_id gnl|my_center|LOCUS_05740 16213 13781 gene locus_tag LOCUS_05750 16213 13781 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775403.1 protein_id gnl|my_center|LOCUS_05750 16967 16431 gene locus_tag LOCUS_05760 gene raiA 16967 16431 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_05760 18602 17448 gene locus_tag LOCUS_05770 18602 17448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 20279 18846 gene locus_tag LOCUS_05780 20279 18846 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028321.1 protein_id gnl|my_center|LOCUS_05780 21276 20284 gene locus_tag LOCUS_05790 21276 20284 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582922.1 protein_id gnl|my_center|LOCUS_05790 22154 21309 gene locus_tag LOCUS_05800 22154 21309 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 protein_id gnl|my_center|LOCUS_05800 23068 22163 gene locus_tag LOCUS_05810 23068 22163 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032532.1 protein_id gnl|my_center|LOCUS_05810 24470 23139 gene locus_tag LOCUS_05820 24470 23139 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254171.1 protein_id gnl|my_center|LOCUS_05820 >Feature sequence0020 407 165 gene locus_tag LOCUS_05830 407 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 674 1216 gene locus_tag LOCUS_05840 674 1216 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948594.1 protein_id gnl|my_center|LOCUS_05840 1771 1268 gene locus_tag LOCUS_05850 1771 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 2708 1776 gene locus_tag LOCUS_05860 2708 1776 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048450.1 protein_id gnl|my_center|LOCUS_05860 3493 2711 gene locus_tag LOCUS_05870 3493 2711 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_05870 4490 3546 gene locus_tag LOCUS_05880 4490 3546 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257393.1 protein_id gnl|my_center|LOCUS_05880 6286 5561 gene locus_tag LOCUS_05890 gene rsmG 6286 5561 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476459.1 protein_id gnl|my_center|LOCUS_05890 8165 6279 gene locus_tag LOCUS_05900 gene mnmG 8165 6279 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966993.1 protein_id gnl|my_center|LOCUS_05900 9551 8181 gene locus_tag LOCUS_05910 gene mnmE 9551 8181 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966994.1 protein_id gnl|my_center|LOCUS_05910 10595 9627 gene locus_tag LOCUS_05920 10595 9627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 11859 10606 gene locus_tag LOCUS_05930 11859 10606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 12146 11910 gene locus_tag LOCUS_05940 gene yidD 12146 11910 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081754.1 protein_id gnl|my_center|LOCUS_05940 12480 12127 gene locus_tag LOCUS_05950 gene rnpA 12480 12127 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_05950 12802 12668 gene locus_tag LOCUS_05960 12802 12668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 13548 12919 gene locus_tag LOCUS_05970 13548 12919 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 protein_id gnl|my_center|LOCUS_05970 14137 15525 gene locus_tag LOCUS_05980 gene dnaA 14137 15525 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_05980 15711 16820 gene locus_tag LOCUS_05990 gene dnaN 15711 16820 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012615304.1 protein_id gnl|my_center|LOCUS_05990 16828 17040 gene locus_tag LOCUS_06000 gene yaaA 16828 17040 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963332.1 protein_id gnl|my_center|LOCUS_06000 17015 18106 gene locus_tag LOCUS_06010 gene recF 17015 18106 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 protein_id gnl|my_center|LOCUS_06010 18383 18646 gene locus_tag LOCUS_06020 18383 18646 CDS product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129544.1 protein_id gnl|my_center|LOCUS_06020 18791 20704 gene locus_tag LOCUS_06030 gene gyrB 18791 20704 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435982.1 protein_id gnl|my_center|LOCUS_06030 20721 23195 gene locus_tag LOCUS_06040 gene gyrA 20721 23195 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_06040 23208 24479 gene locus_tag LOCUS_06050 23208 24479 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905867.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence0021 <1 1313 gene locus_tag LOCUS_06060 <1 1313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965527.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 1670 2908 gene locus_tag LOCUS_06070 1670 2908 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399406.1 protein_id gnl|my_center|LOCUS_06070 2921 4300 gene locus_tag LOCUS_06080 2921 4300 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113788.1 protein_id gnl|my_center|LOCUS_06080 4303 5175 gene locus_tag LOCUS_06090 4303 5175 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360454.1 protein_id gnl|my_center|LOCUS_06090 5178 7112 gene locus_tag LOCUS_06100 gene pulA 5178 7112 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203210.1 protein_id gnl|my_center|LOCUS_06100 7125 8879 gene locus_tag LOCUS_06110 7125 8879 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262518.1 protein_id gnl|my_center|LOCUS_06110 8894 11158 gene locus_tag LOCUS_06120 gene glgP 8894 11158 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950133.1 protein_id gnl|my_center|LOCUS_06120 11344 13002 gene locus_tag LOCUS_06130 11344 13002 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207749.1 protein_id gnl|my_center|LOCUS_06130 13004 14014 gene locus_tag LOCUS_06140 13004 14014 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_06140 14026 15765 gene locus_tag LOCUS_06150 gene dnaG 14026 15765 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_06150 15776 16939 gene locus_tag LOCUS_06160 gene rpoD 15776 16939 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764065.1 protein_id gnl|my_center|LOCUS_06160 16945 17625 gene locus_tag LOCUS_06170 16945 17625 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964614.1 protein_id gnl|my_center|LOCUS_06170 17612 18400 gene locus_tag LOCUS_06180 17612 18400 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_06180 18404 19501 gene locus_tag LOCUS_06190 18404 19501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 19491 20930 gene locus_tag LOCUS_06200 19491 20930 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288002.1 protein_id gnl|my_center|LOCUS_06200 21111 22181 gene locus_tag LOCUS_06210 21111 22181 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_06210 22257 23762 gene locus_tag LOCUS_06220 22257 23762 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_06220 >Feature sequence0022 <1 2381 gene locus_tag LOCUS_06230 <1 2381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011475723.1:glycoside hydrolase family 2 TIM barrel-domain containing protein 3449 2475 gene locus_tag LOCUS_06240 3449 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 5180 3624 gene locus_tag LOCUS_06250 gene rny 5180 3624 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_06250 8023 5354 gene locus_tag LOCUS_06260 8023 5354 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108345.1 protein_id gnl|my_center|LOCUS_06260 8729 8124 gene locus_tag LOCUS_06270 8729 8124 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246350.1 protein_id gnl|my_center|LOCUS_06270 9333 8752 gene locus_tag LOCUS_06280 9333 8752 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420269.1 protein_id gnl|my_center|LOCUS_06280 10487 9345 gene locus_tag LOCUS_06290 10487 9345 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964720.1 protein_id gnl|my_center|LOCUS_06290 12796 10544 gene locus_tag LOCUS_06300 12796 10544 CDS product YceG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964719.1 protein_id gnl|my_center|LOCUS_06300 14281 12818 gene locus_tag LOCUS_06310 14281 12818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 14465 15424 gene locus_tag LOCUS_06320 14465 15424 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861279.1 protein_id gnl|my_center|LOCUS_06320 16566 15505 gene locus_tag LOCUS_06330 16566 15505 CDS product cysteine protease StiP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861280.1 protein_id gnl|my_center|LOCUS_06330 17617 16550 gene locus_tag LOCUS_06340 17617 16550 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454526.1 protein_id gnl|my_center|LOCUS_06340 18501 17719 gene locus_tag LOCUS_06350 18501 17719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 19428 18652 gene locus_tag LOCUS_06360 19428 18652 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861674.1 protein_id gnl|my_center|LOCUS_06360 20343 19783 gene locus_tag LOCUS_06370 20343 19783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 20739 20365 gene locus_tag LOCUS_06380 20739 20365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 21964 20729 gene locus_tag LOCUS_06390 21964 20729 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462038.1 protein_id gnl|my_center|LOCUS_06390 22163 22531 gene locus_tag LOCUS_06400 22163 22531 CDS product EXLDI protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262962.1 protein_id gnl|my_center|LOCUS_06400 23151 22624 gene locus_tag LOCUS_06410 23151 22624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 24328 23165 gene locus_tag LOCUS_06420 24328 23165 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_06420 >Feature sequence0023 2455 1574 gene locus_tag LOCUS_06430 2455 1574 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_06430 3207 2560 gene locus_tag LOCUS_06440 3207 2560 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112597.1 protein_id gnl|my_center|LOCUS_06440 4255 3209 gene locus_tag LOCUS_06450 gene metN 4255 3209 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242531.1 protein_id gnl|my_center|LOCUS_06450 5667 4264 gene locus_tag LOCUS_06460 gene pepV 5667 4264 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371462.1 protein_id gnl|my_center|LOCUS_06460 7264 5678 gene locus_tag LOCUS_06470 7264 5678 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_06470 8464 7265 gene locus_tag LOCUS_06480 gene coaBC 8464 7265 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911730.1 protein_id gnl|my_center|LOCUS_06480 8608 9372 gene locus_tag LOCUS_06490 8608 9372 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_06490 10864 9461 gene locus_tag LOCUS_06500 10864 9461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 11637 10939 gene locus_tag LOCUS_06510 11637 10939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 12955 11642 gene locus_tag LOCUS_06520 gene spoVE 12955 11642 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_06520 14303 12957 gene locus_tag LOCUS_06530 gene murD 14303 12957 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_06530 15280 14312 gene locus_tag LOCUS_06540 gene mraY 15280 14312 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427000.1 protein_id gnl|my_center|LOCUS_06540 17201 15297 gene locus_tag LOCUS_06550 17201 15297 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266230.1 protein_id gnl|my_center|LOCUS_06550 17784 17287 gene locus_tag LOCUS_06560 17784 17287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 18720 17785 gene locus_tag LOCUS_06570 gene rsmH 18720 17785 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_06570 19153 18866 gene locus_tag LOCUS_06580 19153 18866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 20090 19143 gene locus_tag LOCUS_06590 gene argF 20090 19143 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869677.1 protein_id gnl|my_center|LOCUS_06590 20941 20159 gene locus_tag LOCUS_06600 20941 20159 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436797.1 protein_id gnl|my_center|LOCUS_06600 22851 20941 gene locus_tag LOCUS_06610 22851 20941 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_06610 23396 22848 gene locus_tag LOCUS_06620 23396 22848 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180154.1 protein_id gnl|my_center|LOCUS_06620 23507 24286 gene locus_tag LOCUS_06630 23507 24286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 >Feature sequence0024 38 724 gene locus_tag LOCUS_06640 gene rnc 38 724 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989817.1 protein_id gnl|my_center|LOCUS_06640 725 4282 gene locus_tag LOCUS_06650 gene smc 725 4282 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861158.1 protein_id gnl|my_center|LOCUS_06650 4304 5233 gene locus_tag LOCUS_06660 4304 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 5271 6500 gene locus_tag LOCUS_06670 gene ilvA 5271 6500 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_06670 6493 7818 gene locus_tag LOCUS_06680 6493 7818 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416818.1 protein_id gnl|my_center|LOCUS_06680 7828 8709 gene locus_tag LOCUS_06690 gene dapA 7828 8709 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965674.1 protein_id gnl|my_center|LOCUS_06690 8709 9464 gene locus_tag LOCUS_06700 gene dapB 8709 9464 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_06700 9530 10810 gene locus_tag LOCUS_06710 9530 10810 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861133.1 protein_id gnl|my_center|LOCUS_06710 11369 12085 gene locus_tag LOCUS_06720 11369 12085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 12116 14314 gene locus_tag LOCUS_06730 12116 14314 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990923.1 protein_id gnl|my_center|LOCUS_06730 14308 15261 gene locus_tag LOCUS_06740 14308 15261 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940714.1 protein_id gnl|my_center|LOCUS_06740 15300 15887 gene locus_tag LOCUS_06750 15300 15887 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439354.1 protein_id gnl|my_center|LOCUS_06750 16570 15908 gene locus_tag LOCUS_06760 16570 15908 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901930.1 protein_id gnl|my_center|LOCUS_06760 16933 17652 gene locus_tag LOCUS_06770 16933 17652 CDS product tyrosine-protein phosphatase CpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565383.1 protein_id gnl|my_center|LOCUS_06770 17657 18346 gene locus_tag LOCUS_06780 17657 18346 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476103.1 protein_id gnl|my_center|LOCUS_06780 18364 19041 gene locus_tag LOCUS_06790 18364 19041 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704149.1 protein_id gnl|my_center|LOCUS_06790 19038 20036 gene locus_tag LOCUS_06800 19038 20036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 20057 20668 gene locus_tag LOCUS_06810 20057 20668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 20698 22752 gene locus_tag LOCUS_06820 20698 22752 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_06820 22848 24131 gene locus_tag LOCUS_06830 22848 24131 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476101.1 protein_id gnl|my_center|LOCUS_06830 >Feature sequence0025 37 852 gene locus_tag LOCUS_06840 37 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 864 3506 gene locus_tag LOCUS_06850 864 3506 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_06850 3487 4725 gene locus_tag LOCUS_06860 3487 4725 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254253.1 protein_id gnl|my_center|LOCUS_06860 4712 4852 gene locus_tag LOCUS_06870 4712 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 4854 6188 gene locus_tag LOCUS_06880 4854 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 6188 6733 gene locus_tag LOCUS_06890 6188 6733 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836381.1 protein_id gnl|my_center|LOCUS_06890 6822 7874 gene locus_tag LOCUS_06900 6822 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 7956 8606 gene locus_tag LOCUS_06910 gene fsa 7956 8606 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722103.1 protein_id gnl|my_center|LOCUS_06910 8861 8676 gene locus_tag LOCUS_06920 gene rpmB 8861 8676 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775872.1 protein_id gnl|my_center|LOCUS_06920 9104 11095 gene locus_tag LOCUS_06930 gene tkt 9104 11095 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964657.1 protein_id gnl|my_center|LOCUS_06930 11314 11754 gene locus_tag LOCUS_06940 11314 11754 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048431.1 protein_id gnl|my_center|LOCUS_06940 11855 13819 gene locus_tag LOCUS_06950 gene metG 11855 13819 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_06950 13888 14559 gene locus_tag LOCUS_06960 13888 14559 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986406.1 protein_id gnl|my_center|LOCUS_06960 14592 15377 gene locus_tag LOCUS_06970 14592 15377 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947941.1 protein_id gnl|my_center|LOCUS_06970 15414 16292 gene locus_tag LOCUS_06980 gene rsmA 15414 16292 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_06980 16314 17933 gene locus_tag LOCUS_06990 16314 17933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 18140 18925 gene locus_tag LOCUS_07000 gene udp 18140 18925 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_07000 19014 20114 gene locus_tag LOCUS_07010 19014 20114 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964021.1 protein_id gnl|my_center|LOCUS_07010 20217 21761 gene locus_tag LOCUS_07020 20217 21761 CDS product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099547.1 protein_id gnl|my_center|LOCUS_07020 21761 22603 gene locus_tag LOCUS_07030 21761 22603 CDS product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099548.1 protein_id gnl|my_center|LOCUS_07030 >Feature sequence0026 1044 286 gene locus_tag LOCUS_07040 gene sufC 1044 286 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_07040 2560 1226 gene locus_tag LOCUS_07050 gene gdhA 2560 1226 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_07050 3391 2747 gene locus_tag LOCUS_07060 3391 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 4289 3393 gene locus_tag LOCUS_07070 gene era 4289 3393 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_07070 7276 4301 gene locus_tag LOCUS_07080 7276 4301 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_07080 8151 7345 gene locus_tag LOCUS_07090 8151 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 9400 8162 gene locus_tag LOCUS_07100 9400 8162 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_07100 10050 9403 gene locus_tag LOCUS_07110 10050 9403 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438166.1 protein_id gnl|my_center|LOCUS_07110 10432 10034 gene locus_tag LOCUS_07120 10432 10034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 12550 10436 gene locus_tag LOCUS_07130 12550 10436 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_07130 12863 12591 gene locus_tag LOCUS_07140 12863 12591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 13284 12853 gene locus_tag LOCUS_07150 gene ruvX 13284 12853 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_07150 13696 13439 gene locus_tag LOCUS_07160 13696 13439 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025772973.1 protein_id gnl|my_center|LOCUS_07160 15175 13802 gene locus_tag LOCUS_07170 gene mtaB 15175 13802 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964598.1 protein_id gnl|my_center|LOCUS_07170 15310 15543 gene locus_tag LOCUS_07180 15310 15543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 16768 15584 gene locus_tag LOCUS_07190 gene thiI 16768 15584 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_07190 17922 16768 gene locus_tag LOCUS_07200 17922 16768 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966255.1 protein_id gnl|my_center|LOCUS_07200 18660 17923 gene locus_tag LOCUS_07210 18660 17923 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_07210 19626 18661 gene locus_tag LOCUS_07220 gene prmA 19626 18661 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964596.1 protein_id gnl|my_center|LOCUS_07220 20142 19963 gene locus_tag LOCUS_07230 gene rpmF 20142 19963 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 protein_id gnl|my_center|LOCUS_07230 21414 20212 gene locus_tag LOCUS_07240 gene ackA 21414 20212 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_07240 22441 21440 gene locus_tag LOCUS_07250 gene pta 22441 21440 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_07250 23326 22676 gene locus_tag LOCUS_07260 23326 22676 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994403.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence0027 3417 2446 gene locus_tag LOCUS_07270 gene asrC 3417 2446 CDS product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964823.1 protein_id gnl|my_center|LOCUS_07270 4220 3429 gene locus_tag LOCUS_07280 gene asrB 4220 3429 CDS product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964822.1 protein_id gnl|my_center|LOCUS_07280 5262 4210 gene locus_tag LOCUS_07290 gene asrA 5262 4210 CDS product anaerobic sulfite reductase subunit AsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964821.1 protein_id gnl|my_center|LOCUS_07290 5917 5573 gene locus_tag LOCUS_07300 5917 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 7856 5985 gene locus_tag LOCUS_07310 7856 5985 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_07310 9589 7874 gene locus_tag LOCUS_07320 9589 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 9862 10659 gene locus_tag LOCUS_07330 9862 10659 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_07330 11426 10728 gene locus_tag LOCUS_07340 11426 10728 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_07340 13415 11430 gene locus_tag LOCUS_07350 13415 11430 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_07350 14513 13449 gene locus_tag LOCUS_07360 14513 13449 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107212.1 protein_id gnl|my_center|LOCUS_07360 14727 14590 gene locus_tag LOCUS_07370 14727 14590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 15767 14682 gene locus_tag LOCUS_07380 gene asd 15767 14682 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_07380 18169 15932 gene locus_tag LOCUS_07390 gene gyrA 18169 15932 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_07390 20091 18178 gene locus_tag LOCUS_07400 gene gyrB 20091 18178 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_07400 21896 20157 gene locus_tag LOCUS_07410 gene rho 21896 20157 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898714.1 protein_id gnl|my_center|LOCUS_07410 23224 21902 gene locus_tag LOCUS_07420 23224 21902 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680871.1 protein_id gnl|my_center|LOCUS_07420 23460 23332 gene locus_tag LOCUS_07430 23460 23332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence0028 1981 1337 gene locus_tag LOCUS_07440 1981 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 2877 1978 gene locus_tag LOCUS_07450 gene era 2877 1978 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_07450 5861 2889 gene locus_tag LOCUS_07460 5861 2889 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_07460 6679 5873 gene locus_tag LOCUS_07470 6679 5873 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897033.1 protein_id gnl|my_center|LOCUS_07470 7928 6690 gene locus_tag LOCUS_07480 7928 6690 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_07480 8577 7930 gene locus_tag LOCUS_07490 8577 7930 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438166.1 protein_id gnl|my_center|LOCUS_07490 8983 8561 gene locus_tag LOCUS_07500 8983 8561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 11093 8994 gene locus_tag LOCUS_07510 11093 8994 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_07510 11407 11135 gene locus_tag LOCUS_07520 11407 11135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 11834 11397 gene locus_tag LOCUS_07530 gene ruvX 11834 11397 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_07530 12234 11977 gene locus_tag LOCUS_07540 12234 11977 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025772973.1 protein_id gnl|my_center|LOCUS_07540 13733 12354 gene locus_tag LOCUS_07550 gene mtaB 13733 12354 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964598.1 protein_id gnl|my_center|LOCUS_07550 13869 14102 gene locus_tag LOCUS_07560 13869 14102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 15325 14141 gene locus_tag LOCUS_07570 gene thiI 15325 14141 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_07570 16479 15325 gene locus_tag LOCUS_07580 16479 15325 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966255.1 protein_id gnl|my_center|LOCUS_07580 17217 16480 gene locus_tag LOCUS_07590 17217 16480 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_07590 18236 17217 gene locus_tag LOCUS_07600 gene prmA 18236 17217 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964596.1 protein_id gnl|my_center|LOCUS_07600 18450 18271 gene locus_tag LOCUS_07610 gene rpmF 18450 18271 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 protein_id gnl|my_center|LOCUS_07610 19722 18520 gene locus_tag LOCUS_07620 gene ackA 19722 18520 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_07620 20750 19749 gene locus_tag LOCUS_07630 gene pta 20750 19749 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_07630 21577 20927 gene locus_tag LOCUS_07640 21577 20927 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994403.1 protein_id gnl|my_center|LOCUS_07640 21765 22439 gene locus_tag LOCUS_07650 21765 22439 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967029.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence0029 289 26 gene locus_tag LOCUS_07660 289 26 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_07660 557 294 gene locus_tag LOCUS_07670 557 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 726 4184 gene locus_tag LOCUS_07680 726 4184 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_07680 4316 5086 gene locus_tag LOCUS_07690 4316 5086 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_07690 5132 5845 gene locus_tag LOCUS_07700 5132 5845 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_07700 7244 5883 gene locus_tag LOCUS_07710 7244 5883 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_07710 8662 7298 gene locus_tag LOCUS_07720 gene fumC 8662 7298 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228523.1 protein_id gnl|my_center|LOCUS_07720 8815 9345 gene locus_tag LOCUS_07730 gene lepB 8815 9345 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_07730 9366 10211 gene locus_tag LOCUS_07740 gene ylqF 9366 10211 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236706.1 protein_id gnl|my_center|LOCUS_07740 10213 10857 gene locus_tag LOCUS_07750 10213 10857 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_07750 10886 11191 gene locus_tag LOCUS_07760 10886 11191 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017105.1 protein_id gnl|my_center|LOCUS_07760 11188 12039 gene locus_tag LOCUS_07770 gene pgeF 11188 12039 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_07770 12155 12460 gene locus_tag LOCUS_07780 12155 12460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 12480 13760 gene locus_tag LOCUS_07790 12480 13760 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_07790 13763 15400 gene locus_tag LOCUS_07800 13763 15400 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_07800 15402 16160 gene locus_tag LOCUS_07810 15402 16160 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989811.1 protein_id gnl|my_center|LOCUS_07810 16188 17960 gene locus_tag LOCUS_07820 16188 17960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 18032 18104 gene locus_tag LOCUS_t00010 18032 18104 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 18171 18824 gene locus_tag LOCUS_07830 18171 18824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 18833 19543 gene locus_tag LOCUS_07840 18833 19543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 19553 20374 gene locus_tag LOCUS_07850 19553 20374 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986367.1 protein_id gnl|my_center|LOCUS_07850 20424 21410 gene locus_tag LOCUS_07860 20424 21410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 21668 21432 gene locus_tag LOCUS_07870 21668 21432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 21826 23184 gene locus_tag LOCUS_07880 gene trkA 21826 23184 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence0030 1970 252 gene locus_tag LOCUS_07890 gene recJ 1970 252 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943623.1 protein_id gnl|my_center|LOCUS_07890 2269 1997 gene locus_tag LOCUS_07900 2269 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 2960 2280 gene locus_tag LOCUS_07910 2960 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 3144 3941 gene locus_tag LOCUS_07920 3144 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 5281 3968 gene locus_tag LOCUS_07930 gene brnQ 5281 3968 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239244.1 protein_id gnl|my_center|LOCUS_07930 5748 5296 gene locus_tag LOCUS_07940 5748 5296 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890423.1 protein_id gnl|my_center|LOCUS_07940 7056 5761 gene locus_tag LOCUS_07950 7056 5761 CDS product DUF4026 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453703.1 protein_id gnl|my_center|LOCUS_07950 8567 7056 gene locus_tag LOCUS_07960 8567 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 10280 8889 gene locus_tag LOCUS_07970 10280 8889 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681107.1 protein_id gnl|my_center|LOCUS_07970 10934 10494 gene locus_tag LOCUS_07980 10934 10494 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993892.1 protein_id gnl|my_center|LOCUS_07980 11231 12097 gene locus_tag LOCUS_07990 11231 12097 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438030.1 protein_id gnl|my_center|LOCUS_07990 12622 12179 gene locus_tag LOCUS_08000 12622 12179 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229083.1 protein_id gnl|my_center|LOCUS_08000 15694 12875 gene locus_tag LOCUS_08010 gene uvrA 15694 12875 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462189.1 protein_id gnl|my_center|LOCUS_08010 16234 15758 gene locus_tag LOCUS_08020 16234 15758 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_08020 17419 16331 gene locus_tag LOCUS_08030 17419 16331 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_08030 19575 17422 gene locus_tag LOCUS_08040 gene gnpA 19575 17422 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389475.1 protein_id gnl|my_center|LOCUS_08040 21935 19737 gene locus_tag LOCUS_08050 21935 19737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 <22847 22196 gene locus_tag LOCUS_08060 <22847 22196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681676.1:HEAT repeat domain-containing protein >Feature sequence0031 2687 1035 gene locus_tag LOCUS_08070 2687 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 3694 3002 gene locus_tag LOCUS_08080 3694 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 5509 3719 gene locus_tag LOCUS_08090 5509 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 6312 5536 gene locus_tag LOCUS_08100 6312 5536 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989811.1 protein_id gnl|my_center|LOCUS_08100 7942 6305 gene locus_tag LOCUS_08110 7942 6305 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_08110 9228 7945 gene locus_tag LOCUS_08120 9228 7945 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_08120 9547 9239 gene locus_tag LOCUS_08130 9547 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 10475 9618 gene locus_tag LOCUS_08140 gene pgeF 10475 9618 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_08140 10813 10472 gene locus_tag LOCUS_08150 10813 10472 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017105.1 protein_id gnl|my_center|LOCUS_08150 11450 10806 gene locus_tag LOCUS_08160 11450 10806 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_08160 12338 11496 gene locus_tag LOCUS_08170 gene ylqF 12338 11496 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861161.1 protein_id gnl|my_center|LOCUS_08170 12890 12360 gene locus_tag LOCUS_08180 gene lepB 12890 12360 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583882.1 protein_id gnl|my_center|LOCUS_08180 12961 14325 gene locus_tag LOCUS_08190 gene fumC 12961 14325 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857888.1 protein_id gnl|my_center|LOCUS_08190 14341 15708 gene locus_tag LOCUS_08200 14341 15708 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_08200 16524 15811 gene locus_tag LOCUS_08210 16524 15811 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_08210 17347 16577 gene locus_tag LOCUS_08220 17347 16577 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_08220 20962 17504 gene locus_tag LOCUS_08230 20962 17504 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_08230 21143 21406 gene locus_tag LOCUS_08240 21143 21406 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113434.1 protein_id gnl|my_center|LOCUS_08240 21411 21674 gene locus_tag LOCUS_08250 21411 21674 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_08250 22289 21750 gene locus_tag LOCUS_08260 22289 21750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 >Feature sequence0032 23 239 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq caggatcacccccgcatacgcggggaacactg 1160 261 gene locus_tag LOCUS_08270 gene cas2e 1160 261 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674076.1 protein_id gnl|my_center|LOCUS_08270 2082 1162 gene locus_tag LOCUS_08280 gene cas1e 2082 1162 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440418.1 protein_id gnl|my_center|LOCUS_08280 2718 2098 gene locus_tag LOCUS_08290 gene cas6e 2718 2098 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112674.1 protein_id gnl|my_center|LOCUS_08290 3445 2720 gene locus_tag LOCUS_08300 gene cas5e 3445 2720 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994022.1 protein_id gnl|my_center|LOCUS_08300 4562 3456 gene locus_tag LOCUS_08310 gene cas7e 4562 3456 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 protein_id gnl|my_center|LOCUS_08310 5130 4552 gene locus_tag LOCUS_08320 gene casB 5130 4552 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003586648.1 protein_id gnl|my_center|LOCUS_08320 6801 5140 gene locus_tag LOCUS_08330 6801 5140 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994024.1 protein_id gnl|my_center|LOCUS_08330 9557 6801 gene locus_tag LOCUS_08340 gene cas3 9557 6801 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440412.1 protein_id gnl|my_center|LOCUS_08340 9990 9727 gene locus_tag LOCUS_08350 9990 9727 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367773.1 protein_id gnl|my_center|LOCUS_08350 10208 9987 gene locus_tag LOCUS_08360 10208 9987 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775256.1 protein_id gnl|my_center|LOCUS_08360 11173 10280 gene locus_tag LOCUS_08370 11173 10280 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385464.1 protein_id gnl|my_center|LOCUS_08370 11814 11173 gene locus_tag LOCUS_08380 11814 11173 CDS product dihydroxyacetone kinase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680280.1 protein_id gnl|my_center|LOCUS_08380 12813 11824 gene locus_tag LOCUS_08390 12813 11824 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674237.1 protein_id gnl|my_center|LOCUS_08390 13998 12907 gene locus_tag LOCUS_08400 gene mtnA 13998 12907 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392493.1 protein_id gnl|my_center|LOCUS_08400 15235 14015 gene locus_tag LOCUS_08410 gene mtnK 15235 14015 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033250.1 protein_id gnl|my_center|LOCUS_08410 16215 15244 gene locus_tag LOCUS_08420 16215 15244 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168379.1 protein_id gnl|my_center|LOCUS_08420 17750 16215 gene locus_tag LOCUS_08430 17750 16215 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816711.1 protein_id gnl|my_center|LOCUS_08430 19078 17891 gene locus_tag LOCUS_08440 19078 17891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 19356 20366 gene locus_tag LOCUS_08450 19356 20366 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989641.1 protein_id gnl|my_center|LOCUS_08450 20883 20383 gene locus_tag LOCUS_08460 20883 20383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 <21507 20950 gene locus_tag LOCUS_08470 <21507 20950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000753855.1:choline-binding protein PcpA >Feature sequence0033 1751 87 gene locus_tag LOCUS_08480 1751 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 3695 1959 gene locus_tag LOCUS_08490 3695 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 5115 3709 gene locus_tag LOCUS_08500 5115 3709 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_08500 6232 5240 gene locus_tag LOCUS_08510 6232 5240 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875811.1 protein_id gnl|my_center|LOCUS_08510 8459 6246 gene locus_tag LOCUS_08520 8459 6246 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378512.1 protein_id gnl|my_center|LOCUS_08520 9412 8474 gene locus_tag LOCUS_08530 9412 8474 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_08530 10475 9414 gene locus_tag LOCUS_08540 10475 9414 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065256.1 protein_id gnl|my_center|LOCUS_08540 11557 10676 gene locus_tag LOCUS_08550 11557 10676 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_08550 13093 11921 gene locus_tag LOCUS_08560 gene hemA 13093 11921 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546522.1 protein_id gnl|my_center|LOCUS_08560 14385 13090 gene locus_tag LOCUS_08570 gene hemL 14385 13090 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941005.1 protein_id gnl|my_center|LOCUS_08570 15859 14366 gene locus_tag LOCUS_08580 gene cobA 15859 14366 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898657.1 protein_id gnl|my_center|LOCUS_08580 16778 15849 gene locus_tag LOCUS_08590 gene hemC 16778 15849 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836539.1 protein_id gnl|my_center|LOCUS_08590 17538 16768 gene locus_tag LOCUS_08600 17538 16768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 18509 17535 gene locus_tag LOCUS_08610 gene hemB 18509 17535 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948609.1 protein_id gnl|my_center|LOCUS_08610 19040 18534 gene locus_tag LOCUS_08620 19040 18534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 19965 19438 gene locus_tag LOCUS_08630 19965 19438 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678346.1 protein_id gnl|my_center|LOCUS_08630 20324 19962 gene locus_tag LOCUS_08640 20324 19962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence0034 340 128 gene locus_tag LOCUS_08650 340 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 708 526 gene locus_tag LOCUS_08660 708 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 2585 1305 gene locus_tag LOCUS_08670 2585 1305 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_08670 4206 2569 gene locus_tag LOCUS_08680 4206 2569 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861887.1 protein_id gnl|my_center|LOCUS_08680 5247 4234 gene locus_tag LOCUS_08690 5247 4234 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680278.1 protein_id gnl|my_center|LOCUS_08690 6282 5260 gene locus_tag LOCUS_08700 6282 5260 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680278.1 protein_id gnl|my_center|LOCUS_08700 6926 6282 gene locus_tag LOCUS_08710 gene dhaL 6926 6282 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015866.1 protein_id gnl|my_center|LOCUS_08710 7931 6942 gene locus_tag LOCUS_08720 gene dhaK 7931 6942 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166915.1 protein_id gnl|my_center|LOCUS_08720 8650 7943 gene locus_tag LOCUS_08730 8650 7943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_08730 9419 8643 gene locus_tag LOCUS_08740 9419 8643 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937291.1 protein_id gnl|my_center|LOCUS_08740 10450 9416 gene locus_tag LOCUS_08750 10450 9416 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 protein_id gnl|my_center|LOCUS_08750 11328 10453 gene locus_tag LOCUS_08760 11328 10453 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_08760 12497 11352 gene locus_tag LOCUS_08770 12497 11352 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399632.1 protein_id gnl|my_center|LOCUS_08770 14790 13141 gene locus_tag LOCUS_08780 14790 13141 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964866.1 protein_id gnl|my_center|LOCUS_08780 16959 15010 gene locus_tag LOCUS_08790 16959 15010 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963745.1 protein_id gnl|my_center|LOCUS_08790 18108 17206 gene locus_tag LOCUS_08800 18108 17206 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976195.1 protein_id gnl|my_center|LOCUS_08800 18815 18105 gene locus_tag LOCUS_08810 18815 18105 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016216.1 protein_id gnl|my_center|LOCUS_08810 20561 18840 gene locus_tag LOCUS_08820 20561 18840 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_08820 <21312 20740 gene locus_tag LOCUS_08830 <21312 20740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528455.1:substrate-binding domain-containing protein >Feature sequence0035 3155 1692 gene locus_tag LOCUS_08840 3155 1692 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416108.1 protein_id gnl|my_center|LOCUS_08840 3297 4013 gene locus_tag LOCUS_08850 3297 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 4206 5381 gene locus_tag LOCUS_08860 4206 5381 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_08860 7065 5431 gene locus_tag LOCUS_08870 7065 5431 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_08870 8142 7117 gene locus_tag LOCUS_08880 8142 7117 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_08880 9225 8158 gene locus_tag LOCUS_08890 gene prfA 9225 8158 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_08890 10077 9250 gene locus_tag LOCUS_08900 gene prmC 10077 9250 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_08900 11005 10079 gene locus_tag LOCUS_08910 11005 10079 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947980.1 protein_id gnl|my_center|LOCUS_08910 11290 11084 gene locus_tag LOCUS_08920 gene rpmE 11290 11084 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_08920 11880 11452 gene locus_tag LOCUS_08930 11880 11452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 12798 11938 gene locus_tag LOCUS_08940 12798 11938 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357090.1 protein_id gnl|my_center|LOCUS_08940 13767 12817 gene locus_tag LOCUS_08950 13767 12817 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_08950 14735 13764 gene locus_tag LOCUS_08960 14735 13764 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_08960 15651 14737 gene locus_tag LOCUS_08970 15651 14737 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867268.1 protein_id gnl|my_center|LOCUS_08970 16584 15661 gene locus_tag LOCUS_08980 16584 15661 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_08980 18303 16666 gene locus_tag LOCUS_08990 18303 16666 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_08990 20778 18523 gene locus_tag LOCUS_09000 20778 18523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence0036 <1 1129 gene locus_tag LOCUS_09010 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681807.1:MATE family efflux transporter 2057 1269 gene locus_tag LOCUS_09020 2057 1269 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_09020 2963 2235 gene locus_tag LOCUS_09030 2963 2235 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966910.1 protein_id gnl|my_center|LOCUS_09030 3058 3966 gene locus_tag LOCUS_09040 gene pyrF 3058 3966 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_09040 3977 4741 gene locus_tag LOCUS_09050 3977 4741 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_09050 4738 5643 gene locus_tag LOCUS_09060 4738 5643 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_09060 5664 6335 gene locus_tag LOCUS_09070 gene pyrE 5664 6335 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_09070 6357 6506 gene locus_tag LOCUS_09080 6357 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 6508 6960 gene locus_tag LOCUS_09090 6508 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 6957 7382 gene locus_tag LOCUS_09100 6957 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 7385 9403 gene locus_tag LOCUS_09110 7385 9403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 9603 11057 gene locus_tag LOCUS_09120 gene guaB 9603 11057 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048242.1 protein_id gnl|my_center|LOCUS_09120 11088 12005 gene locus_tag LOCUS_09130 11088 12005 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_09130 12015 13676 gene locus_tag LOCUS_09140 12015 13676 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_09140 13684 14343 gene locus_tag LOCUS_09150 13684 14343 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_09150 14333 14902 gene locus_tag LOCUS_09160 14333 14902 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840898.1 protein_id gnl|my_center|LOCUS_09160 14918 16294 gene locus_tag LOCUS_09170 gene murC 14918 16294 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_09170 16353 17579 gene locus_tag LOCUS_09180 16353 17579 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132280311.1 protein_id gnl|my_center|LOCUS_09180 17599 18624 gene locus_tag LOCUS_09190 17599 18624 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_09190 18635 19810 gene locus_tag LOCUS_09200 18635 19810 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_09200 19828 20541 gene locus_tag LOCUS_09210 19828 20541 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence0037 1531 278 gene locus_tag LOCUS_09220 gene hemW 1531 278 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016482.1 protein_id gnl|my_center|LOCUS_09220 2095 1562 gene locus_tag LOCUS_09230 2095 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 2603 2136 gene locus_tag LOCUS_09240 2603 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 3780 2722 gene locus_tag LOCUS_09250 3780 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 6795 4213 gene locus_tag LOCUS_09260 6795 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 8656 7484 gene locus_tag LOCUS_09270 8656 7484 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_09270 9742 8765 gene locus_tag LOCUS_09280 9742 8765 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 protein_id gnl|my_center|LOCUS_09280 11278 9755 gene locus_tag LOCUS_09290 gene gguA 11278 9755 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_09290 12826 11606 gene locus_tag LOCUS_09300 12826 11606 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964765.1 protein_id gnl|my_center|LOCUS_09300 13494 12823 gene locus_tag LOCUS_09310 13494 12823 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964764.1 protein_id gnl|my_center|LOCUS_09310 14807 13494 gene locus_tag LOCUS_09320 14807 13494 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964763.1 protein_id gnl|my_center|LOCUS_09320 15749 14814 gene locus_tag LOCUS_09330 15749 14814 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964762.1 protein_id gnl|my_center|LOCUS_09330 17474 16032 gene locus_tag LOCUS_09340 17474 16032 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434751.1 protein_id gnl|my_center|LOCUS_09340 18185 17493 gene locus_tag LOCUS_09350 18185 17493 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434748.1 protein_id gnl|my_center|LOCUS_09350 19030 18236 gene locus_tag LOCUS_09360 19030 18236 CDS product lantibiotic immunity ABC transporter MutG family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860831.1 protein_id gnl|my_center|LOCUS_09360 19782 19027 gene locus_tag LOCUS_09370 19782 19027 CDS product lantibiotic immunity ABC transporter MutE/EpiE family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888312.1 protein_id gnl|my_center|LOCUS_09370 20480 19773 gene locus_tag LOCUS_09380 20480 19773 CDS product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434737.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence0038 284 439 gene locus_tag LOCUS_09390 284 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 993 436 gene locus_tag LOCUS_09400 993 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837041.1 protein_id gnl|my_center|LOCUS_09400 1744 998 gene locus_tag LOCUS_09410 1744 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 3049 1808 gene locus_tag LOCUS_09420 3049 1808 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943626.1 protein_id gnl|my_center|LOCUS_09420 3822 3058 gene locus_tag LOCUS_09430 gene cobK 3822 3058 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915112.1 protein_id gnl|my_center|LOCUS_09430 4546 3815 gene locus_tag LOCUS_09440 gene cobJ 4546 3815 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016778.1 protein_id gnl|my_center|LOCUS_09440 5228 4548 gene locus_tag LOCUS_09450 gene cobI 5228 4548 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626293.1 protein_id gnl|my_center|LOCUS_09450 6415 5225 gene locus_tag LOCUS_09460 gene cbiD 6415 5225 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669153.1 protein_id gnl|my_center|LOCUS_09460 7948 6419 gene locus_tag LOCUS_09470 7948 6419 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_09470 9832 7991 gene locus_tag LOCUS_09480 9832 7991 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_09480 11258 9807 gene locus_tag LOCUS_09490 gene gltX 11258 9807 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_09490 11983 11306 gene locus_tag LOCUS_09500 11983 11306 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044683.1 protein_id gnl|my_center|LOCUS_09500 13801 12017 gene locus_tag LOCUS_09510 gene aspS 13801 12017 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965567.1 protein_id gnl|my_center|LOCUS_09510 15074 13815 gene locus_tag LOCUS_09520 gene hisS 15074 13815 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_09520 16485 15061 gene locus_tag LOCUS_09530 16485 15061 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_09530 17144 16482 gene locus_tag LOCUS_09540 17144 16482 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871221.1 protein_id gnl|my_center|LOCUS_09540 19432 17144 gene locus_tag LOCUS_09550 19432 17144 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_09550 20311 19568 gene locus_tag LOCUS_09560 20311 19568 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948000.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence0039 335 123 gene locus_tag LOCUS_09570 gene yaaA 335 123 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963332.1 protein_id gnl|my_center|LOCUS_09570 1473 364 gene locus_tag LOCUS_09580 gene dnaN 1473 364 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012615304.1 protein_id gnl|my_center|LOCUS_09580 3053 1665 gene locus_tag LOCUS_09590 gene dnaA 3053 1665 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_09590 3685 4314 gene locus_tag LOCUS_09600 3685 4314 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 protein_id gnl|my_center|LOCUS_09600 4432 4566 gene locus_tag LOCUS_09610 4432 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 4716 5093 gene locus_tag LOCUS_09620 gene rnpA 4716 5093 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_09620 5053 5286 gene locus_tag LOCUS_09630 gene yidD 5053 5286 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081754.1 protein_id gnl|my_center|LOCUS_09630 5346 6602 gene locus_tag LOCUS_09640 5346 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 6613 7566 gene locus_tag LOCUS_09650 6613 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 7712 9082 gene locus_tag LOCUS_09660 gene mnmE 7712 9082 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359423.1 protein_id gnl|my_center|LOCUS_09660 9123 11009 gene locus_tag LOCUS_09670 gene mnmG 9123 11009 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966993.1 protein_id gnl|my_center|LOCUS_09670 11002 11727 gene locus_tag LOCUS_09680 gene rsmG 11002 11727 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476459.1 protein_id gnl|my_center|LOCUS_09680 15810 16754 gene locus_tag LOCUS_09690 15810 16754 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257393.1 protein_id gnl|my_center|LOCUS_09690 16777 17559 gene locus_tag LOCUS_09700 16777 17559 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_09700 17562 18491 gene locus_tag LOCUS_09710 17562 18491 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048450.1 protein_id gnl|my_center|LOCUS_09710 18488 18991 gene locus_tag LOCUS_09720 18488 18991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 19565 19023 gene locus_tag LOCUS_09730 19565 19023 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948594.1 protein_id gnl|my_center|LOCUS_09730 19700 19870 gene locus_tag LOCUS_09740 19700 19870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 20105 20524 gene locus_tag LOCUS_09750 gene rpsL 20105 20524 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence0040 <1 1598 gene locus_tag LOCUS_09760 <1 1598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965728.1:trypsin-like peptidase domain-containing protein 1850 2503 gene locus_tag LOCUS_09770 gene trmB 1850 2503 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_09770 2835 2569 gene locus_tag LOCUS_09780 gene rpsT 2835 2569 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273615.1 protein_id gnl|my_center|LOCUS_09780 3155 3577 gene locus_tag LOCUS_09790 3155 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 3891 4898 gene locus_tag LOCUS_09800 gene asnA 3891 4898 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641196.1 protein_id gnl|my_center|LOCUS_09800 4975 5283 gene locus_tag LOCUS_09810 4975 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 5285 6778 gene locus_tag LOCUS_09820 gene tilS 5285 6778 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048376.1 protein_id gnl|my_center|LOCUS_09820 6775 7302 gene locus_tag LOCUS_09830 gene hpt 6775 7302 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 protein_id gnl|my_center|LOCUS_09830 7314 9140 gene locus_tag LOCUS_09840 gene ftsH 7314 9140 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_09840 9141 11162 gene locus_tag LOCUS_09850 gene malZ 9141 11162 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482420.1 protein_id gnl|my_center|LOCUS_09850 11187 12560 gene locus_tag LOCUS_09860 11187 12560 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233074.1 protein_id gnl|my_center|LOCUS_09860 12557 13537 gene locus_tag LOCUS_09870 12557 13537 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_09870 13534 13701 gene locus_tag LOCUS_09880 13534 13701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 13701 14567 gene locus_tag LOCUS_09890 13701 14567 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926048.1 protein_id gnl|my_center|LOCUS_09890 14571 16031 gene locus_tag LOCUS_09900 14571 16031 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822525.1 protein_id gnl|my_center|LOCUS_09900 16028 16951 gene locus_tag LOCUS_09910 16028 16951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 16953 19211 gene locus_tag LOCUS_09920 16953 19211 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967776.1 protein_id gnl|my_center|LOCUS_09920 19333 20631 gene locus_tag LOCUS_09930 19333 20631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence0041 134 59 gene locus_tag LOCUS_t00020 134 59 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 234 160 gene locus_tag LOCUS_t00030 234 160 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1247 492 gene locus_tag LOCUS_09940 1247 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 2665 1412 gene locus_tag LOCUS_09950 2665 1412 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 protein_id gnl|my_center|LOCUS_09950 3589 2828 gene locus_tag LOCUS_09960 3589 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 5163 4027 gene locus_tag LOCUS_09970 5163 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 5509 5120 gene locus_tag LOCUS_09980 5509 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 5955 5506 gene locus_tag LOCUS_09990 5955 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 6827 5952 gene locus_tag LOCUS_10000 6827 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 8739 6841 gene locus_tag LOCUS_10010 8739 6841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 8912 8736 gene locus_tag LOCUS_10020 8912 8736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 10202 8973 gene locus_tag LOCUS_10030 10202 8973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 11039 10206 gene locus_tag LOCUS_10040 11039 10206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 12198 10933 gene locus_tag LOCUS_10050 12198 10933 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481288.1 protein_id gnl|my_center|LOCUS_10050 12671 12192 gene locus_tag LOCUS_10060 12671 12192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 13675 12668 gene locus_tag LOCUS_10070 13675 12668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 14896 13877 gene locus_tag LOCUS_10080 gene mglB 14896 13877 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215885.1 protein_id gnl|my_center|LOCUS_10080 15856 14915 gene locus_tag LOCUS_10090 15856 14915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 17636 15843 gene locus_tag LOCUS_10100 17636 15843 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_10100 19244 17640 gene locus_tag LOCUS_10110 19244 17640 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582720.1 protein_id gnl|my_center|LOCUS_10110 19683 19246 gene locus_tag LOCUS_10120 gene dtd 19683 19246 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547036.1 protein_id gnl|my_center|LOCUS_10120 20186 19692 gene locus_tag LOCUS_10130 gene greA 20186 19692 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818750.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence0042 125 1087 gene locus_tag LOCUS_10140 125 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1115 2104 gene locus_tag LOCUS_10150 1115 2104 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965779.1 protein_id gnl|my_center|LOCUS_10150 2113 2721 gene locus_tag LOCUS_10160 2113 2721 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889235.1 protein_id gnl|my_center|LOCUS_10160 3053 2745 gene locus_tag LOCUS_10170 3053 2745 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720075.1 protein_id gnl|my_center|LOCUS_10170 3210 4178 gene locus_tag LOCUS_10180 gene potA 3210 4178 CDS product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720321.1 protein_id gnl|my_center|LOCUS_10180 4168 5022 gene locus_tag LOCUS_10190 gene potB 4168 5022 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715500.1 protein_id gnl|my_center|LOCUS_10190 5019 5786 gene locus_tag LOCUS_10200 5019 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10200 5820 6929 gene locus_tag LOCUS_10210 5820 6929 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984738.1 protein_id gnl|my_center|LOCUS_10210 8430 6973 gene locus_tag LOCUS_10220 8430 6973 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 protein_id gnl|my_center|LOCUS_10220 10190 8637 gene locus_tag LOCUS_10230 10190 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 10406 11440 gene locus_tag LOCUS_10240 gene selD 10406 11440 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462047.1 protein_id gnl|my_center|LOCUS_10240 11454 12074 gene locus_tag LOCUS_10250 gene yedF 11454 12074 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681889.1 protein_id gnl|my_center|LOCUS_10250 12074 13240 gene locus_tag LOCUS_10260 12074 13240 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811901.1 protein_id gnl|my_center|LOCUS_10260 13295 13531 gene locus_tag LOCUS_10270 13295 13531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 13871 15259 gene locus_tag LOCUS_10280 13871 15259 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389802.1 protein_id gnl|my_center|LOCUS_10280 15260 15973 gene locus_tag LOCUS_10290 gene yqeC 15260 15973 CDS product selenium cofactor biosynthesis protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459386.1 protein_id gnl|my_center|LOCUS_10290 15970 16773 gene locus_tag LOCUS_10300 gene yqeB 15970 16773 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459388.1 protein_id gnl|my_center|LOCUS_10300 16773 17378 gene locus_tag LOCUS_10310 gene mocA 16773 17378 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047953.1 protein_id gnl|my_center|LOCUS_10310 17692 18954 gene locus_tag LOCUS_10320 17692 18954 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896806.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence0043 910 290 gene locus_tag LOCUS_10330 910 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1982 957 gene locus_tag LOCUS_10340 gene queA 1982 957 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_10340 2790 1984 gene locus_tag LOCUS_10350 2790 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 2954 3028 gene locus_tag LOCUS_t00040 2954 3028 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3054 4037 gene locus_tag LOCUS_10360 3054 4037 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948775.1 protein_id gnl|my_center|LOCUS_10360 4143 4071 gene locus_tag LOCUS_t00050 4143 4071 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4332 4607 gene locus_tag LOCUS_10370 4332 4607 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595964.1 protein_id gnl|my_center|LOCUS_10370 4713 5132 gene locus_tag LOCUS_10380 4713 5132 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461668.1 protein_id gnl|my_center|LOCUS_10380 5380 6462 gene locus_tag LOCUS_10390 5380 6462 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902589.1 protein_id gnl|my_center|LOCUS_10390 6584 7675 gene locus_tag LOCUS_10400 6584 7675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902588.1 protein_id gnl|my_center|LOCUS_10400 7677 9341 gene locus_tag LOCUS_10410 7677 9341 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896074.1 protein_id gnl|my_center|LOCUS_10410 9361 11058 gene locus_tag LOCUS_10420 9361 11058 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_10420 11051 11875 gene locus_tag LOCUS_10430 11051 11875 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286068.1 protein_id gnl|my_center|LOCUS_10430 12856 12107 gene locus_tag LOCUS_10440 12856 12107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_10440 13644 12868 gene locus_tag LOCUS_10450 13644 12868 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_10450 14411 13623 gene locus_tag LOCUS_10460 gene tauC 14411 13623 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114620.1 protein_id gnl|my_center|LOCUS_10460 15198 14413 gene locus_tag LOCUS_10470 gene tauC 15198 14413 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704532.1 protein_id gnl|my_center|LOCUS_10470 16299 15214 gene locus_tag LOCUS_10480 16299 15214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 17947 16445 gene locus_tag LOCUS_10490 17947 16445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 19733 17925 gene locus_tag LOCUS_10500 19733 17925 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289136.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence0044 <1 1736 gene locus_tag LOCUS_10510 <1 1736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986883.1:translational GTPase TypA 1908 4916 gene locus_tag LOCUS_10520 1908 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 5751 4960 gene locus_tag LOCUS_10530 5751 4960 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808997.1 protein_id gnl|my_center|LOCUS_10530 6637 5738 gene locus_tag LOCUS_10540 6637 5738 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461074.1 protein_id gnl|my_center|LOCUS_10540 7713 6649 gene locus_tag LOCUS_10550 7713 6649 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945303.1 protein_id gnl|my_center|LOCUS_10550 9478 8186 gene locus_tag LOCUS_10560 9478 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 11196 9478 gene locus_tag LOCUS_10570 gene ptsP 11196 9478 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_10570 11479 11210 gene locus_tag LOCUS_10580 11479 11210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 12766 11492 gene locus_tag LOCUS_10590 12766 11492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 13622 12750 gene locus_tag LOCUS_10600 gene cdaA 13622 12750 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_10600 14581 13619 gene locus_tag LOCUS_10610 14581 13619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 14990 14583 gene locus_tag LOCUS_10620 14990 14583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 16483 15146 gene locus_tag LOCUS_10630 gene rfbH 16483 15146 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_10630 17393 16788 gene locus_tag LOCUS_10640 gene gmhA 17393 16788 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194315.1 protein_id gnl|my_center|LOCUS_10640 18465 17446 gene locus_tag LOCUS_10650 18465 17446 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence0045 1617 622 gene locus_tag LOCUS_10660 1617 622 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315915.1 protein_id gnl|my_center|LOCUS_10660 3146 1620 gene locus_tag LOCUS_10670 3146 1620 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582804.1 protein_id gnl|my_center|LOCUS_10670 4722 3364 gene locus_tag LOCUS_10680 4722 3364 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_10680 4993 7566 gene locus_tag LOCUS_10690 gene secA 4993 7566 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947996.1 protein_id gnl|my_center|LOCUS_10690 7583 8626 gene locus_tag LOCUS_10700 7583 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 8784 11141 gene locus_tag LOCUS_10710 8784 11141 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_10710 11159 11866 gene locus_tag LOCUS_10720 11159 11866 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966496.1 protein_id gnl|my_center|LOCUS_10720 11863 13263 gene locus_tag LOCUS_10730 11863 13263 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_10730 14236 13325 gene locus_tag LOCUS_10740 14236 13325 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_10740 14662 14261 gene locus_tag LOCUS_10750 14662 14261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 15181 14807 gene locus_tag LOCUS_10760 15181 14807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 17694 15319 gene locus_tag LOCUS_10770 17694 15319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 18601 17804 gene locus_tag LOCUS_10780 18601 17804 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494981.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence0046 543 16 gene locus_tag LOCUS_10790 543 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 2776 674 gene locus_tag LOCUS_10800 gene fusA 2776 674 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_10800 3081 4172 gene locus_tag LOCUS_10810 gene tyrA 3081 4172 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228138.1 protein_id gnl|my_center|LOCUS_10810 4183 5433 gene locus_tag LOCUS_10820 gene aroA 4183 5433 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246068.1 protein_id gnl|my_center|LOCUS_10820 6297 5491 gene locus_tag LOCUS_10830 6297 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 6526 7002 gene locus_tag LOCUS_10840 6526 7002 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436247.1 protein_id gnl|my_center|LOCUS_10840 9005 7050 gene locus_tag LOCUS_10850 gene thrS 9005 7050 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_10850 10511 9276 gene locus_tag LOCUS_10860 10511 9276 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964082.1 protein_id gnl|my_center|LOCUS_10860 10971 10606 gene locus_tag LOCUS_10870 10971 10606 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_10870 13194 11110 gene locus_tag LOCUS_10880 13194 11110 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_10880 13540 13283 gene locus_tag LOCUS_10890 13540 13283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 13834 14046 gene locus_tag LOCUS_10900 13834 14046 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_10900 14149 14373 gene locus_tag LOCUS_10910 14149 14373 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_10910 14383 16542 gene locus_tag LOCUS_10920 gene feoB 14383 16542 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_10920 16570 16710 gene locus_tag LOCUS_10930 16570 16710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 <19253 16735 gene locus_tag LOCUS_10940 <19253 16735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814361.1:TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein >Feature sequence0047 554 1768 gene locus_tag LOCUS_10950 554 1768 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966853.1 protein_id gnl|my_center|LOCUS_10950 1786 3399 gene locus_tag LOCUS_10960 1786 3399 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048336.1 protein_id gnl|my_center|LOCUS_10960 3402 4235 gene locus_tag LOCUS_10970 gene proB 3402 4235 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_10970 4246 4464 gene locus_tag LOCUS_10980 4246 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 4457 5026 gene locus_tag LOCUS_10990 4457 5026 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905169.1 protein_id gnl|my_center|LOCUS_10990 5082 6509 gene locus_tag LOCUS_11000 gene miaB 5082 6509 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_11000 6510 9158 gene locus_tag LOCUS_11010 gene mutS 6510 9158 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_11010 9191 11176 gene locus_tag LOCUS_11020 gene mutL 9191 11176 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861409.1 protein_id gnl|my_center|LOCUS_11020 11173 12123 gene locus_tag LOCUS_11030 gene miaA 11173 12123 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_11030 12116 13396 gene locus_tag LOCUS_11040 12116 13396 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_11040 13527 14216 gene locus_tag LOCUS_11050 gene radC 13527 14216 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360029.1 protein_id gnl|my_center|LOCUS_11050 14216 15046 gene locus_tag LOCUS_11060 gene mreC 14216 15046 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945174.1 protein_id gnl|my_center|LOCUS_11060 15047 15559 gene locus_tag LOCUS_11070 15047 15559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 15556 18429 gene locus_tag LOCUS_11080 15556 18429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence0048 <1 746 gene locus_tag LOCUS_11090 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357375.1:NCS2 family permease 1094 1786 gene locus_tag LOCUS_11100 1094 1786 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706813.1 protein_id gnl|my_center|LOCUS_11100 1826 3115 gene locus_tag LOCUS_11110 1826 3115 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989565.1 protein_id gnl|my_center|LOCUS_11110 3191 4108 gene locus_tag LOCUS_11120 3191 4108 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582766.1 protein_id gnl|my_center|LOCUS_11120 4129 4962 gene locus_tag LOCUS_11130 4129 4962 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223061.1 protein_id gnl|my_center|LOCUS_11130 4966 6528 gene locus_tag LOCUS_11140 4966 6528 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 protein_id gnl|my_center|LOCUS_11140 6546 8795 gene locus_tag LOCUS_11150 6546 8795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 8917 10266 gene locus_tag LOCUS_11160 8917 10266 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672105.1 protein_id gnl|my_center|LOCUS_11160 10370 11278 gene locus_tag LOCUS_11170 10370 11278 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260027.1 protein_id gnl|my_center|LOCUS_11170 11280 12164 gene locus_tag LOCUS_11180 11280 12164 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730582.1 protein_id gnl|my_center|LOCUS_11180 12188 13039 gene locus_tag LOCUS_11190 12188 13039 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028344.1 protein_id gnl|my_center|LOCUS_11190 13317 14537 gene locus_tag LOCUS_11200 gene rpoD 13317 14537 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861220.1 protein_id gnl|my_center|LOCUS_11200 14534 15187 gene locus_tag LOCUS_11210 14534 15187 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_11210 15265 15531 gene locus_tag LOCUS_11220 15265 15531 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_11220 15640 15882 gene locus_tag LOCUS_11230 15640 15882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 16075 16617 gene locus_tag LOCUS_11240 gene ispF 16075 16617 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947931.1 protein_id gnl|my_center|LOCUS_11240 16628 18037 gene locus_tag LOCUS_11250 gene cysS 16628 18037 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_11250 18022 18477 gene locus_tag LOCUS_11260 18022 18477 CDS product ribonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860630.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence0049 182 889 gene locus_tag LOCUS_11270 182 889 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949128.1 protein_id gnl|my_center|LOCUS_11270 2192 954 gene locus_tag LOCUS_11280 2192 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 3307 2201 gene locus_tag LOCUS_11290 3307 2201 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_11290 4183 3329 gene locus_tag LOCUS_11300 4183 3329 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847567.1 protein_id gnl|my_center|LOCUS_11300 5075 4197 gene locus_tag LOCUS_11310 5075 4197 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339520.1 protein_id gnl|my_center|LOCUS_11310 6420 5161 gene locus_tag LOCUS_11320 6420 5161 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049832539.1 protein_id gnl|my_center|LOCUS_11320 6588 8375 gene locus_tag LOCUS_11330 6588 8375 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356857.1 protein_id gnl|my_center|LOCUS_11330 8372 9976 gene locus_tag LOCUS_11340 8372 9976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 10053 11174 gene locus_tag LOCUS_11350 10053 11174 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379407.1 protein_id gnl|my_center|LOCUS_11350 12003 11254 gene locus_tag LOCUS_11360 gene tpiA 12003 11254 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_11360 13235 12021 gene locus_tag LOCUS_11370 13235 12021 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429565.1 protein_id gnl|my_center|LOCUS_11370 14378 13347 gene locus_tag LOCUS_11380 gene gap 14378 13347 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_11380 16157 14499 gene locus_tag LOCUS_11390 16157 14499 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_11390 <18629 16444 gene locus_tag LOCUS_11400 <18629 16444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000753855.1:choline-binding protein PcpA >Feature sequence0050 242 547 gene locus_tag LOCUS_11410 242 547 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811036.1 protein_id gnl|my_center|LOCUS_11410 544 777 gene locus_tag LOCUS_11420 544 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 2725 1073 gene locus_tag LOCUS_11430 2725 1073 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812007.1 protein_id gnl|my_center|LOCUS_11430 4415 2757 gene locus_tag LOCUS_11440 4415 2757 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812007.1 protein_id gnl|my_center|LOCUS_11440 5513 4461 gene locus_tag LOCUS_11450 5513 4461 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812005.1 protein_id gnl|my_center|LOCUS_11450 6525 5506 gene locus_tag LOCUS_11460 6525 5506 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812003.1 protein_id gnl|my_center|LOCUS_11460 7532 6537 gene locus_tag LOCUS_11470 7532 6537 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812002.1 protein_id gnl|my_center|LOCUS_11470 8556 7639 gene locus_tag LOCUS_11480 8556 7639 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_11480 8997 9308 gene locus_tag LOCUS_11490 8997 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 9311 10378 gene locus_tag LOCUS_11500 9311 10378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 10375 12300 gene locus_tag LOCUS_11510 10375 12300 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_11510 12365 12790 gene locus_tag LOCUS_11520 12365 12790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 12801 13109 gene locus_tag LOCUS_11530 12801 13109 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_11530 13221 13802 gene locus_tag LOCUS_11540 13221 13802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 13802 15568 gene locus_tag LOCUS_11550 13802 15568 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_11550 15580 17007 gene locus_tag LOCUS_11560 15580 17007 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869268.1 protein_id gnl|my_center|LOCUS_11560 17010 17627 gene locus_tag LOCUS_11570 17010 17627 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_11570 17627 18310 gene locus_tag LOCUS_11580 17627 18310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence0051 690 283 gene locus_tag LOCUS_11590 690 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1219 788 gene locus_tag LOCUS_11600 1219 788 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_11600 2435 1209 gene locus_tag LOCUS_11610 2435 1209 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_11610 3482 2436 gene locus_tag LOCUS_11620 gene sufD 3482 2436 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 protein_id gnl|my_center|LOCUS_11620 4898 3492 gene locus_tag LOCUS_11630 gene sufB 4898 3492 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_11630 5662 4898 gene locus_tag LOCUS_11640 gene sufC 5662 4898 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_11640 6523 5777 gene locus_tag LOCUS_11650 gene trmD 6523 5777 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686892.1 protein_id gnl|my_center|LOCUS_11650 7069 6533 gene locus_tag LOCUS_11660 gene rimM 7069 6533 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_11660 7376 7149 gene locus_tag LOCUS_11670 7376 7149 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362589.1 protein_id gnl|my_center|LOCUS_11670 7633 7391 gene locus_tag LOCUS_11680 gene rpsP 7633 7391 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_11680 9081 7720 gene locus_tag LOCUS_11690 gene ffh 9081 7720 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_11690 9434 9093 gene locus_tag LOCUS_11700 9434 9093 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393779.1 protein_id gnl|my_center|LOCUS_11700 9941 9483 gene locus_tag LOCUS_11710 gene smpB 9941 9483 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_11710 12162 10021 gene locus_tag LOCUS_11720 gene rnr 12162 10021 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_11720 12804 12340 gene locus_tag LOCUS_11730 12804 12340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 13167 12931 gene locus_tag LOCUS_11740 13167 12931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 13417 13815 gene locus_tag LOCUS_11750 13417 13815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 14902 14360 gene locus_tag LOCUS_11760 14902 14360 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902203.1 protein_id gnl|my_center|LOCUS_11760 15529 14915 gene locus_tag LOCUS_11770 15529 14915 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016144.1 protein_id gnl|my_center|LOCUS_11770 16492 15593 gene locus_tag LOCUS_11780 16492 15593 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018365292.1 protein_id gnl|my_center|LOCUS_11780 17581 16739 gene locus_tag LOCUS_11790 17581 16739 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861356.1 protein_id gnl|my_center|LOCUS_11790 18038 17724 gene locus_tag LOCUS_11800 18038 17724 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142672.1 protein_id gnl|my_center|LOCUS_11800 >Feature sequence0052 153 1100 gene locus_tag LOCUS_11810 153 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 2350 1148 gene locus_tag LOCUS_11820 2350 1148 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_11820 3792 2353 gene locus_tag LOCUS_11830 gene proS 3792 2353 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 protein_id gnl|my_center|LOCUS_11830 3953 3798 gene locus_tag LOCUS_11840 3953 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 5157 3931 gene locus_tag LOCUS_11850 5157 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 5875 5162 gene locus_tag LOCUS_11860 5875 5162 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_11860 7066 5894 gene locus_tag LOCUS_11870 7066 5894 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_11870 8102 7077 gene locus_tag LOCUS_11880 8102 7077 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048435.1 protein_id gnl|my_center|LOCUS_11880 9328 8123 gene locus_tag LOCUS_11890 9328 8123 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132280311.1 protein_id gnl|my_center|LOCUS_11890 10762 9386 gene locus_tag LOCUS_11900 gene murC 10762 9386 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_11900 11345 10779 gene locus_tag LOCUS_11910 11345 10779 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840898.1 protein_id gnl|my_center|LOCUS_11910 11997 11335 gene locus_tag LOCUS_11920 11997 11335 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_11920 13666 12005 gene locus_tag LOCUS_11930 13666 12005 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_11930 14606 13680 gene locus_tag LOCUS_11940 14606 13680 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_11940 16065 14611 gene locus_tag LOCUS_11950 gene guaB 16065 14611 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048242.1 protein_id gnl|my_center|LOCUS_11950 17458 16184 gene locus_tag LOCUS_11960 gene purD 17458 16184 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436062.1 protein_id gnl|my_center|LOCUS_11960 18051 17455 gene locus_tag LOCUS_11970 gene purN 18051 17455 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_11970 18290 18060 gene locus_tag LOCUS_11980 18290 18060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 >Feature sequence0053 <1 629 gene locus_tag LOCUS_11990 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392083.1:chaperonin GroEL 889 2259 gene locus_tag LOCUS_12000 889 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 2278 4074 gene locus_tag LOCUS_12010 2278 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 4215 4922 gene locus_tag LOCUS_12020 4215 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 5079 5750 gene locus_tag LOCUS_12030 5079 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 5752 6927 gene locus_tag LOCUS_12040 5752 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 7060 7794 gene locus_tag LOCUS_12050 7060 7794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 7953 8612 gene locus_tag LOCUS_12060 7953 8612 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989471.1 protein_id gnl|my_center|LOCUS_12060 8631 9629 gene locus_tag LOCUS_12070 8631 9629 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363756.1 protein_id gnl|my_center|LOCUS_12070 9622 10182 gene locus_tag LOCUS_12080 9622 10182 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_12080 10179 10736 gene locus_tag LOCUS_12090 10179 10736 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_12090 11642 10785 gene locus_tag LOCUS_12100 11642 10785 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288251.1 protein_id gnl|my_center|LOCUS_12100 11812 14835 gene locus_tag LOCUS_12110 11812 14835 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288607.1 protein_id gnl|my_center|LOCUS_12110 14859 16220 gene locus_tag LOCUS_12120 14859 16220 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_12120 16351 17838 gene locus_tag LOCUS_12130 gene galT 16351 17838 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence0054 <1 917 gene locus_tag LOCUS_12140 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948784.1:DUF1015 family protein 907 1281 gene locus_tag LOCUS_12150 907 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1296 1790 gene locus_tag LOCUS_12160 1296 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 2248 3024 gene locus_tag LOCUS_12170 2248 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 3194 3970 gene locus_tag LOCUS_12180 3194 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 4040 5143 gene locus_tag LOCUS_12190 4040 5143 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454526.1 protein_id gnl|my_center|LOCUS_12190 5136 6182 gene locus_tag LOCUS_12200 5136 6182 CDS product cysteine protease StiP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861280.1 protein_id gnl|my_center|LOCUS_12200 7174 6215 gene locus_tag LOCUS_12210 7174 6215 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861279.1 protein_id gnl|my_center|LOCUS_12210 7285 8739 gene locus_tag LOCUS_12220 7285 8739 CDS product YceG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861277.1 protein_id gnl|my_center|LOCUS_12220 8770 11022 gene locus_tag LOCUS_12230 8770 11022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 11083 12219 gene locus_tag LOCUS_12240 11083 12219 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964720.1 protein_id gnl|my_center|LOCUS_12240 12234 12815 gene locus_tag LOCUS_12250 12234 12815 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241242.1 protein_id gnl|my_center|LOCUS_12250 12846 13460 gene locus_tag LOCUS_12260 12846 13460 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246350.1 protein_id gnl|my_center|LOCUS_12260 13569 16238 gene locus_tag LOCUS_12270 13569 16238 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108345.1 protein_id gnl|my_center|LOCUS_12270 16475 16912 gene locus_tag LOCUS_12280 16475 16912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 17172 18071 gene locus_tag LOCUS_12290 17172 18071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence0055 2021 915 gene locus_tag LOCUS_12300 gene mglB 2021 915 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869062.1 protein_id gnl|my_center|LOCUS_12300 2382 3743 gene locus_tag LOCUS_12310 2382 3743 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_12310 4627 3836 gene locus_tag LOCUS_12320 4627 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 5855 4788 gene locus_tag LOCUS_12330 5855 4788 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733041.1 protein_id gnl|my_center|LOCUS_12330 7465 5867 gene locus_tag LOCUS_12340 7465 5867 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_12340 8656 7640 gene locus_tag LOCUS_12350 8656 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 9356 8631 gene locus_tag LOCUS_12360 9356 8631 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_12360 11205 9340 gene locus_tag LOCUS_12370 11205 9340 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099491.1 protein_id gnl|my_center|LOCUS_12370 12950 11220 gene locus_tag LOCUS_12380 12950 11220 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_12380 14676 12940 gene locus_tag LOCUS_12390 14676 12940 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_12390 15656 14817 gene locus_tag LOCUS_12400 15656 14817 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289121.1 protein_id gnl|my_center|LOCUS_12400 16357 15680 gene locus_tag LOCUS_12410 16357 15680 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416528.1 protein_id gnl|my_center|LOCUS_12410 16872 17717 gene locus_tag LOCUS_12420 16872 17717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence0056 253 29 gene locus_tag LOCUS_12430 253 29 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_12430 580 368 gene locus_tag LOCUS_12440 580 368 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_12440 908 1174 gene locus_tag LOCUS_12450 908 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1264 3348 gene locus_tag LOCUS_12460 1264 3348 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_12460 3503 3868 gene locus_tag LOCUS_12470 3503 3868 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_12470 3995 5215 gene locus_tag LOCUS_12480 3995 5215 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964082.1 protein_id gnl|my_center|LOCUS_12480 5524 7479 gene locus_tag LOCUS_12490 gene thrS 5524 7479 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_12490 8000 7521 gene locus_tag LOCUS_12500 8000 7521 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436247.1 protein_id gnl|my_center|LOCUS_12500 9423 8173 gene locus_tag LOCUS_12510 gene aroA 9423 8173 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246068.1 protein_id gnl|my_center|LOCUS_12510 10528 9437 gene locus_tag LOCUS_12520 gene tyrA 10528 9437 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228138.1 protein_id gnl|my_center|LOCUS_12520 10861 12963 gene locus_tag LOCUS_12530 gene fusA 10861 12963 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_12530 13106 13699 gene locus_tag LOCUS_12540 13106 13699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 13913 15436 gene locus_tag LOCUS_12550 13913 15436 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_12550 15572 17605 gene locus_tag LOCUS_12560 gene htpG 15572 17605 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_12560 18062 17649 gene locus_tag LOCUS_12570 18062 17649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence0057 1091 21 gene locus_tag LOCUS_12580 1091 21 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812005.1 protein_id gnl|my_center|LOCUS_12580 2089 1076 gene locus_tag LOCUS_12590 2089 1076 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812003.1 protein_id gnl|my_center|LOCUS_12590 3146 2100 gene locus_tag LOCUS_12600 3146 2100 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812002.1 protein_id gnl|my_center|LOCUS_12600 4117 3200 gene locus_tag LOCUS_12610 4117 3200 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_12610 4561 4872 gene locus_tag LOCUS_12620 4561 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 4875 5942 gene locus_tag LOCUS_12630 4875 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 5939 7864 gene locus_tag LOCUS_12640 5939 7864 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_12640 7935 8366 gene locus_tag LOCUS_12650 7935 8366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 8378 8686 gene locus_tag LOCUS_12660 8378 8686 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_12660 8803 9384 gene locus_tag LOCUS_12670 8803 9384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 9384 11150 gene locus_tag LOCUS_12680 9384 11150 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_12680 11162 12589 gene locus_tag LOCUS_12690 11162 12589 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_12690 12592 13209 gene locus_tag LOCUS_12700 12592 13209 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_12700 13209 13904 gene locus_tag LOCUS_12710 13209 13904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 14957 13956 gene locus_tag LOCUS_12720 14957 13956 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015931.1 protein_id gnl|my_center|LOCUS_12720 15217 16893 gene locus_tag LOCUS_12730 15217 16893 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860825.1 protein_id gnl|my_center|LOCUS_12730 17819 16950 gene locus_tag LOCUS_12740 17819 16950 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870104.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence0058 2255 477 gene locus_tag LOCUS_12750 2255 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 3675 2269 gene locus_tag LOCUS_12760 3675 2269 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_12760 4792 3800 gene locus_tag LOCUS_12770 4792 3800 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875811.1 protein_id gnl|my_center|LOCUS_12770 7021 4808 gene locus_tag LOCUS_12780 7021 4808 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378512.1 protein_id gnl|my_center|LOCUS_12780 8010 7072 gene locus_tag LOCUS_12790 8010 7072 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_12790 9073 8012 gene locus_tag LOCUS_12800 9073 8012 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065256.1 protein_id gnl|my_center|LOCUS_12800 10117 9236 gene locus_tag LOCUS_12810 10117 9236 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_12810 11646 10471 gene locus_tag LOCUS_12820 gene hemA 11646 10471 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_12820 12938 11646 gene locus_tag LOCUS_12830 gene hemL 12938 11646 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167257.1 protein_id gnl|my_center|LOCUS_12830 14412 12919 gene locus_tag LOCUS_12840 gene cobA 14412 12919 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898657.1 protein_id gnl|my_center|LOCUS_12840 15340 14405 gene locus_tag LOCUS_12850 gene hemC 15340 14405 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258453.1 protein_id gnl|my_center|LOCUS_12850 16100 15333 gene locus_tag LOCUS_12860 16100 15333 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680703.1 protein_id gnl|my_center|LOCUS_12860 17071 16097 gene locus_tag LOCUS_12870 gene hemB 17071 16097 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881381.1 protein_id gnl|my_center|LOCUS_12870 17589 17083 gene locus_tag LOCUS_12880 17589 17083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence0059 53 1267 gene locus_tag LOCUS_12890 53 1267 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_12890 1271 2968 gene locus_tag LOCUS_12900 gene rho 1271 2968 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898714.1 protein_id gnl|my_center|LOCUS_12900 3034 4947 gene locus_tag LOCUS_12910 gene gyrB 3034 4947 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434229.1 protein_id gnl|my_center|LOCUS_12910 4956 7193 gene locus_tag LOCUS_12920 gene gyrA 4956 7193 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_12920 7373 8458 gene locus_tag LOCUS_12930 gene asd 7373 8458 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_12930 8638 9702 gene locus_tag LOCUS_12940 8638 9702 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107212.1 protein_id gnl|my_center|LOCUS_12940 9702 11696 gene locus_tag LOCUS_12950 9702 11696 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_12950 11700 12398 gene locus_tag LOCUS_12960 11700 12398 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_12960 13315 12437 gene locus_tag LOCUS_12970 13315 12437 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_12970 13514 15352 gene locus_tag LOCUS_12980 13514 15352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 15374 17251 gene locus_tag LOCUS_12990 15374 17251 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948262.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence0060 1501 209 gene locus_tag LOCUS_13000 1501 209 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_13000 3939 1603 gene locus_tag LOCUS_13010 3939 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 4266 4838 gene locus_tag LOCUS_13020 4266 4838 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205505.1 protein_id gnl|my_center|LOCUS_13020 6347 4887 gene locus_tag LOCUS_13030 6347 4887 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393430.1 protein_id gnl|my_center|LOCUS_13030 7071 6490 gene locus_tag LOCUS_13040 7071 6490 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420269.1 protein_id gnl|my_center|LOCUS_13040 7537 7178 gene locus_tag LOCUS_13050 7537 7178 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365398.1 protein_id gnl|my_center|LOCUS_13050 8639 7650 gene locus_tag LOCUS_13060 8639 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 9387 8656 gene locus_tag LOCUS_13070 9387 8656 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_13070 9879 10598 gene locus_tag LOCUS_13080 9879 10598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 10710 11522 gene locus_tag LOCUS_13090 10710 11522 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809818.1 protein_id gnl|my_center|LOCUS_13090 11639 12643 gene locus_tag LOCUS_13100 11639 12643 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072775411.1 protein_id gnl|my_center|LOCUS_13100 12733 13755 gene locus_tag LOCUS_13110 12733 13755 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809246.1 protein_id gnl|my_center|LOCUS_13110 13758 14798 gene locus_tag LOCUS_13120 13758 14798 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948409.1 protein_id gnl|my_center|LOCUS_13120 14808 15596 gene locus_tag LOCUS_13130 14808 15596 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948410.1 protein_id gnl|my_center|LOCUS_13130 15697 16314 gene locus_tag LOCUS_13140 15697 16314 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166986.1 protein_id gnl|my_center|LOCUS_13140 16311 17309 gene locus_tag LOCUS_13150 16311 17309 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448020.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence0061 1209 3989 gene locus_tag LOCUS_13160 1209 3989 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279797.1 protein_id gnl|my_center|LOCUS_13160 3992 4345 gene locus_tag LOCUS_13170 3992 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 4356 4559 gene locus_tag LOCUS_13180 4356 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 4872 5531 gene locus_tag LOCUS_13190 4872 5531 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384107.1 protein_id gnl|my_center|LOCUS_13190 5512 6189 gene locus_tag LOCUS_13200 5512 6189 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154147.1 protein_id gnl|my_center|LOCUS_13200 6212 6979 gene locus_tag LOCUS_13210 6212 6979 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858600.1 protein_id gnl|my_center|LOCUS_13210 7056 7925 gene locus_tag LOCUS_13220 7056 7925 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765262.1 protein_id gnl|my_center|LOCUS_13220 8302 9018 gene locus_tag LOCUS_13230 gene cas6 8302 9018 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016969.1 protein_id gnl|my_center|LOCUS_13230 9030 10481 gene locus_tag LOCUS_13240 gene cas8a1 9030 10481 CDS product type I CRISPR-associated protein Cas8a1/Csx8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016968.1 protein_id gnl|my_center|LOCUS_13240 10485 11378 gene locus_tag LOCUS_13250 gene cas7i 10485 11378 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016967.1 protein_id gnl|my_center|LOCUS_13250 11350 12456 gene locus_tag LOCUS_13260 gene cas5 11350 12456 CDS product CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779469.1 protein_id gnl|my_center|LOCUS_13260 12708 15077 gene locus_tag LOCUS_13270 12708 15077 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016965.1 protein_id gnl|my_center|LOCUS_13270 15074 15571 gene locus_tag LOCUS_13280 gene cas4 15074 15571 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016964.1 protein_id gnl|my_center|LOCUS_13280 15581 16573 gene locus_tag LOCUS_13290 gene cas1b 15581 16573 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896423.1 protein_id gnl|my_center|LOCUS_13290 16576 16851 gene locus_tag LOCUS_13300 gene cas2 16576 16851 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903132.1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence0062 21 308 gene locus_tag LOCUS_13310 21 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 317 718 gene locus_tag LOCUS_13320 317 718 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462228.1 protein_id gnl|my_center|LOCUS_13320 854 1753 gene locus_tag LOCUS_13330 854 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1975 2868 gene locus_tag LOCUS_13340 gene rfbA 1975 2868 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905191.1 protein_id gnl|my_center|LOCUS_13340 2957 3979 gene locus_tag LOCUS_13350 gene rfbB 2957 3979 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_13350 3979 4839 gene locus_tag LOCUS_13360 gene rfbD 3979 4839 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664653.1 protein_id gnl|my_center|LOCUS_13360 4839 6185 gene locus_tag LOCUS_13370 gene glmM 4839 6185 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 protein_id gnl|my_center|LOCUS_13370 6252 7916 gene locus_tag LOCUS_13380 gene leuA 6252 7916 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_13380 8154 9134 gene locus_tag LOCUS_13390 8154 9134 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775198.1 protein_id gnl|my_center|LOCUS_13390 9144 10022 gene locus_tag LOCUS_13400 9144 10022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 10031 11011 gene locus_tag LOCUS_13410 10031 11011 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003836797.1 protein_id gnl|my_center|LOCUS_13410 11011 12441 gene locus_tag LOCUS_13420 11011 12441 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202144.1 protein_id gnl|my_center|LOCUS_13420 12441 13448 gene locus_tag LOCUS_13430 12441 13448 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_13430 13462 14694 gene locus_tag LOCUS_13440 13462 14694 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922136.1 protein_id gnl|my_center|LOCUS_13440 14691 15626 gene locus_tag LOCUS_13450 gene rfbN 14691 15626 CDS product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 protein_id gnl|my_center|LOCUS_13450 15629 16318 gene locus_tag LOCUS_13460 15629 16318 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 protein_id gnl|my_center|LOCUS_13460 16320 16682 gene locus_tag LOCUS_13470 16320 16682 CDS product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379614.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence0063 426 58 gene locus_tag LOCUS_13480 426 58 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385301.1 protein_id gnl|my_center|LOCUS_13480 618 1901 gene locus_tag LOCUS_13490 618 1901 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289234.1 protein_id gnl|my_center|LOCUS_13490 1922 2398 gene locus_tag LOCUS_13500 1922 2398 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964912.1 protein_id gnl|my_center|LOCUS_13500 2401 2748 gene locus_tag LOCUS_13510 2401 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 2759 5401 gene locus_tag LOCUS_13520 gene polA 2759 5401 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_13520 5401 5973 gene locus_tag LOCUS_13530 gene coaE 5401 5973 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_13530 5978 6772 gene locus_tag LOCUS_13540 5978 6772 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048403.1 protein_id gnl|my_center|LOCUS_13540 6797 7069 gene locus_tag LOCUS_13550 6797 7069 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053740.1 protein_id gnl|my_center|LOCUS_13550 7079 8443 gene locus_tag LOCUS_13560 7079 8443 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_13560 9023 8484 gene locus_tag LOCUS_13570 gene lepB 9023 8484 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870097.1 protein_id gnl|my_center|LOCUS_13570 9345 11591 gene locus_tag LOCUS_13580 gene glgB 9345 11591 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_13580 11588 12568 gene locus_tag LOCUS_13590 gene mscS 11588 12568 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896747.1 protein_id gnl|my_center|LOCUS_13590 12661 13500 gene locus_tag LOCUS_13600 12661 13500 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_13600 13569 14219 gene locus_tag LOCUS_13610 13569 14219 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002940990.1 protein_id gnl|my_center|LOCUS_13610 14226 14981 gene locus_tag LOCUS_13620 14226 14981 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724134.1 protein_id gnl|my_center|LOCUS_13620 14998 16209 gene locus_tag LOCUS_13630 14998 16209 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_13630 16244 16495 gene locus_tag LOCUS_13640 16244 16495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence0064 1086 2306 gene locus_tag LOCUS_13650 1086 2306 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681571.1 protein_id gnl|my_center|LOCUS_13650 2321 3019 gene locus_tag LOCUS_13660 2321 3019 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672626.1 protein_id gnl|my_center|LOCUS_13660 3016 4050 gene locus_tag LOCUS_13670 3016 4050 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681570.1 protein_id gnl|my_center|LOCUS_13670 4008 4679 gene locus_tag LOCUS_13680 4008 4679 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665989.1 protein_id gnl|my_center|LOCUS_13680 4833 6683 gene locus_tag LOCUS_13690 gene hcp 4833 6683 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966698.1 protein_id gnl|my_center|LOCUS_13690 7407 6754 gene locus_tag LOCUS_13700 7407 6754 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837223.1 protein_id gnl|my_center|LOCUS_13700 8461 7409 gene locus_tag LOCUS_13710 8461 7409 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837222.1 protein_id gnl|my_center|LOCUS_13710 9232 8477 gene locus_tag LOCUS_13720 9232 8477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837221.1 protein_id gnl|my_center|LOCUS_13720 10042 9233 gene locus_tag LOCUS_13730 10042 9233 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837220.1 protein_id gnl|my_center|LOCUS_13730 10098 10283 gene locus_tag LOCUS_13740 10098 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 10434 11261 gene locus_tag LOCUS_13750 10434 11261 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809818.1 protein_id gnl|my_center|LOCUS_13750 11540 14119 gene locus_tag LOCUS_13760 gene xdh 11540 14119 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891588.1 protein_id gnl|my_center|LOCUS_13760 14283 14933 gene locus_tag LOCUS_13770 14283 14933 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170003.1 protein_id gnl|my_center|LOCUS_13770 14935 15846 gene locus_tag LOCUS_13780 14935 15846 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984924.1 protein_id gnl|my_center|LOCUS_13780 15855 16640 gene locus_tag LOCUS_13790 gene proC 15855 16640 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence0065 2185 554 gene locus_tag LOCUS_13800 gene treC 2185 554 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986524.1 protein_id gnl|my_center|LOCUS_13800 4131 2194 gene locus_tag LOCUS_13810 gene treP 4131 2194 CDS product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297133.1 protein_id gnl|my_center|LOCUS_13810 4355 5080 gene locus_tag LOCUS_13820 4355 5080 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861813.1 protein_id gnl|my_center|LOCUS_13820 6392 5136 gene locus_tag LOCUS_13830 6392 5136 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922165.1 protein_id gnl|my_center|LOCUS_13830 7065 6394 gene locus_tag LOCUS_13840 7065 6394 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263646.1 protein_id gnl|my_center|LOCUS_13840 7677 7069 gene locus_tag LOCUS_13850 7677 7069 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449640.1 protein_id gnl|my_center|LOCUS_13850 9134 7785 gene locus_tag LOCUS_13860 gene mgtE 9134 7785 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_13860 11265 9163 gene locus_tag LOCUS_13870 gene pnp 11265 9163 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_13870 11764 11498 gene locus_tag LOCUS_13880 gene rpsO 11764 11498 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419491.1 protein_id gnl|my_center|LOCUS_13880 12273 11899 gene locus_tag LOCUS_13890 12273 11899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 13376 12393 gene locus_tag LOCUS_13900 13376 12393 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_13900 14932 13592 gene locus_tag LOCUS_13910 14932 13592 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659213.1 protein_id gnl|my_center|LOCUS_13910 16019 15081 gene locus_tag LOCUS_13920 16019 15081 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence0066 2034 1297 gene locus_tag LOCUS_13930 2034 1297 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724134.1 protein_id gnl|my_center|LOCUS_13930 2716 2024 gene locus_tag LOCUS_13940 2716 2024 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_13940 3521 2718 gene locus_tag LOCUS_13950 3521 2718 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915025.1 protein_id gnl|my_center|LOCUS_13950 3994 3734 gene locus_tag LOCUS_13960 3994 3734 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_13960 4949 3987 gene locus_tag LOCUS_13970 gene whiA 4949 3987 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_13970 5833 4958 gene locus_tag LOCUS_13980 gene rapZ 5833 4958 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_13980 6722 5835 gene locus_tag LOCUS_13990 gene murB 6722 5835 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_13990 7692 6748 gene locus_tag LOCUS_14000 gene hprK 7692 6748 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_14000 11122 7709 gene locus_tag LOCUS_14010 11122 7709 CDS product SNF2 helicase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986302.1 protein_id gnl|my_center|LOCUS_14010 12441 11125 gene locus_tag LOCUS_14020 12441 11125 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357628.1 protein_id gnl|my_center|LOCUS_14020 13643 12555 gene locus_tag LOCUS_14030 13643 12555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 14775 13963 gene locus_tag LOCUS_14040 gene dapF 14775 13963 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_14040 15345 14794 gene locus_tag LOCUS_14050 15345 14794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 <16664 15420 gene locus_tag LOCUS_14060 <16664 15420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003231737.1:type I glutamate--ammonia ligase >Feature sequence0067 <1 1047 gene locus_tag LOCUS_14070 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869538.1:MBL fold metallo-hydrolase 1061 2149 gene locus_tag LOCUS_14080 1061 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 2146 4926 gene locus_tag LOCUS_14090 2146 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 6611 5031 gene locus_tag LOCUS_14100 6611 5031 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_14100 6792 7772 gene locus_tag LOCUS_14110 6792 7772 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_14110 7989 8663 gene locus_tag LOCUS_14120 7989 8663 CDS product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889567.1 protein_id gnl|my_center|LOCUS_14120 8663 9625 gene locus_tag LOCUS_14130 8663 9625 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433654.1 protein_id gnl|my_center|LOCUS_14130 9637 10284 gene locus_tag LOCUS_14140 gene pcp 9637 10284 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866927.1 protein_id gnl|my_center|LOCUS_14140 10461 10805 gene locus_tag LOCUS_14150 10461 10805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 10823 11431 gene locus_tag LOCUS_14160 10823 11431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964077.1 protein_id gnl|my_center|LOCUS_14160 11433 11996 gene locus_tag LOCUS_14170 11433 11996 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964078.1 protein_id gnl|my_center|LOCUS_14170 12130 13053 gene locus_tag LOCUS_14180 12130 13053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 13063 14772 gene locus_tag LOCUS_14190 13063 14772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 15747 14896 gene locus_tag LOCUS_14200 15747 14896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence0068 334 603 gene locus_tag LOCUS_14210 gene rpsR 334 603 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_14210 798 2141 gene locus_tag LOCUS_14220 798 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 2154 2564 gene locus_tag LOCUS_14230 2154 2564 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983376.1 protein_id gnl|my_center|LOCUS_14230 2564 3181 gene locus_tag LOCUS_14240 2564 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3653 5308 gene locus_tag LOCUS_14250 3653 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 5329 11610 gene locus_tag LOCUS_14260 5329 11610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 11697 16256 gene locus_tag LOCUS_14270 11697 16256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence0069 1312 638 gene locus_tag LOCUS_14280 1312 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 2021 1500 gene locus_tag LOCUS_14290 2021 1500 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318917.1 protein_id gnl|my_center|LOCUS_14290 3338 2025 gene locus_tag LOCUS_14300 3338 2025 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739314.1 protein_id gnl|my_center|LOCUS_14300 3558 4211 gene locus_tag LOCUS_14310 gene fsa 3558 4211 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964656.1 protein_id gnl|my_center|LOCUS_14310 4350 5504 gene locus_tag LOCUS_14320 4350 5504 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966322.1 protein_id gnl|my_center|LOCUS_14320 5594 6508 gene locus_tag LOCUS_14330 5594 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 6529 7398 gene locus_tag LOCUS_14340 6529 7398 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875982.1 protein_id gnl|my_center|LOCUS_14340 7370 8194 gene locus_tag LOCUS_14350 7370 8194 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_14350 8215 8784 gene locus_tag LOCUS_14360 8215 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14360 8792 8956 gene locus_tag LOCUS_14370 8792 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 8998 10008 gene locus_tag LOCUS_14380 8998 10008 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_14380 10030 11067 gene locus_tag LOCUS_14390 10030 11067 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194087.1 protein_id gnl|my_center|LOCUS_14390 11083 12330 gene locus_tag LOCUS_14400 11083 12330 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182976528.1 protein_id gnl|my_center|LOCUS_14400 12330 12689 gene locus_tag LOCUS_14410 12330 12689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 12708 13361 gene locus_tag LOCUS_14420 12708 13361 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107285.1 protein_id gnl|my_center|LOCUS_14420 13382 14263 gene locus_tag LOCUS_14430 13382 14263 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765594.1 protein_id gnl|my_center|LOCUS_14430 14277 15053 gene locus_tag LOCUS_14440 14277 15053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 15025 15444 gene locus_tag LOCUS_14450 15025 15444 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence0070 965 141 gene locus_tag LOCUS_14460 965 141 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837622.1 protein_id gnl|my_center|LOCUS_14460 2260 1076 gene locus_tag LOCUS_14470 2260 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 2930 2262 gene locus_tag LOCUS_14480 2930 2262 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_14480 3465 2980 gene locus_tag LOCUS_14490 3465 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 5808 3538 gene locus_tag LOCUS_14500 5808 3538 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546149.1 protein_id gnl|my_center|LOCUS_14500 7133 5805 gene locus_tag LOCUS_14510 7133 5805 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546148.1 protein_id gnl|my_center|LOCUS_14510 9150 7126 gene locus_tag LOCUS_14520 9150 7126 CDS product TerB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546145.1 protein_id gnl|my_center|LOCUS_14520 9903 9241 gene locus_tag LOCUS_14530 9903 9241 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766910.1 protein_id gnl|my_center|LOCUS_14530 11280 10039 gene locus_tag LOCUS_14540 11280 10039 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779468.1 protein_id gnl|my_center|LOCUS_14540 11759 11427 gene locus_tag LOCUS_14550 11759 11427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 12219 11905 gene locus_tag LOCUS_14560 12219 11905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 13494 12442 gene locus_tag LOCUS_14570 13494 12442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 14996 13494 gene locus_tag LOCUS_14580 14996 13494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 15586 15137 gene locus_tag LOCUS_14590 15586 15137 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028534.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence0071 2435 753 gene locus_tag LOCUS_14600 2435 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 3055 2645 gene locus_tag LOCUS_14610 3055 2645 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061570.1 protein_id gnl|my_center|LOCUS_14610 3341 4342 gene locus_tag LOCUS_14620 3341 4342 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_14620 4344 6578 gene locus_tag LOCUS_14630 4344 6578 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_14630 6652 7296 gene locus_tag LOCUS_14640 6652 7296 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_14640 7361 7954 gene locus_tag LOCUS_14650 7361 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 8061 8759 gene locus_tag LOCUS_14660 gene pyrH 8061 8759 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430597.1 protein_id gnl|my_center|LOCUS_14660 8804 9358 gene locus_tag LOCUS_14670 gene frr 8804 9358 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_14670 9454 10161 gene locus_tag LOCUS_14680 9454 10161 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424529.1 protein_id gnl|my_center|LOCUS_14680 10161 10961 gene locus_tag LOCUS_14690 10161 10961 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_14690 10966 12105 gene locus_tag LOCUS_14700 10966 12105 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_14700 12102 13139 gene locus_tag LOCUS_14710 gene rseP 12102 13139 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_14710 13136 14194 gene locus_tag LOCUS_14720 gene ispG 13136 14194 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861462.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence0072 1377 1021 gene locus_tag LOCUS_14730 1377 1021 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_14730 2114 1389 gene locus_tag LOCUS_14740 2114 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 3575 2124 gene locus_tag LOCUS_14750 3575 2124 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_14750 4650 3829 gene locus_tag LOCUS_14760 4650 3829 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986426.1 protein_id gnl|my_center|LOCUS_14760 5848 4661 gene locus_tag LOCUS_14770 gene deoB 5848 4661 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046067.1 protein_id gnl|my_center|LOCUS_14770 6831 5845 gene locus_tag LOCUS_14780 gene add 6831 5845 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368573.1 protein_id gnl|my_center|LOCUS_14780 7494 6835 gene locus_tag LOCUS_14790 gene deoC 7494 6835 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130468.1 protein_id gnl|my_center|LOCUS_14790 8437 7502 gene locus_tag LOCUS_14800 8437 7502 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008856.1 protein_id gnl|my_center|LOCUS_14800 9504 8437 gene locus_tag LOCUS_14810 9504 8437 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074497.1 protein_id gnl|my_center|LOCUS_14810 11014 9497 gene locus_tag LOCUS_14820 11014 9497 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289202.1 protein_id gnl|my_center|LOCUS_14820 11894 11052 gene locus_tag LOCUS_14830 11894 11052 CDS product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099548.1 protein_id gnl|my_center|LOCUS_14830 13438 11894 gene locus_tag LOCUS_14840 13438 11894 CDS product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099547.1 protein_id gnl|my_center|LOCUS_14840 14646 13534 gene locus_tag LOCUS_14850 14646 13534 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964021.1 protein_id gnl|my_center|LOCUS_14850 15578 14805 gene locus_tag LOCUS_14860 gene udp 15578 14805 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence0073 154 1161 gene locus_tag LOCUS_14870 gene asnA 154 1161 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476128.1 protein_id gnl|my_center|LOCUS_14870 1225 1533 gene locus_tag LOCUS_14880 1225 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 1535 3022 gene locus_tag LOCUS_14890 gene tilS 1535 3022 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434952.1 protein_id gnl|my_center|LOCUS_14890 3041 3571 gene locus_tag LOCUS_14900 gene hpt 3041 3571 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 protein_id gnl|my_center|LOCUS_14900 3583 5409 gene locus_tag LOCUS_14910 gene ftsH 3583 5409 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_14910 5410 7431 gene locus_tag LOCUS_14920 gene malZ 5410 7431 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482420.1 protein_id gnl|my_center|LOCUS_14920 7451 8818 gene locus_tag LOCUS_14930 7451 8818 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233074.1 protein_id gnl|my_center|LOCUS_14930 8820 9797 gene locus_tag LOCUS_14940 8820 9797 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948854.1 protein_id gnl|my_center|LOCUS_14940 9794 9973 gene locus_tag LOCUS_14950 9794 9973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 9973 10839 gene locus_tag LOCUS_14960 9973 10839 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286075.1 protein_id gnl|my_center|LOCUS_14960 10842 12302 gene locus_tag LOCUS_14970 10842 12302 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822525.1 protein_id gnl|my_center|LOCUS_14970 12299 13225 gene locus_tag LOCUS_14980 12299 13225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 13225 15465 gene locus_tag LOCUS_14990 13225 15465 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990137.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence0074 2507 372 gene locus_tag LOCUS_15000 gene pknB 2507 372 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986841.1 protein_id gnl|my_center|LOCUS_15000 3240 2512 gene locus_tag LOCUS_15010 3240 2512 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388610.1 protein_id gnl|my_center|LOCUS_15010 4300 3260 gene locus_tag LOCUS_15020 gene rlmN 4300 3260 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_15020 5627 4293 gene locus_tag LOCUS_15030 gene rsmB 5627 4293 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232068.1 protein_id gnl|my_center|LOCUS_15030 6340 5633 gene locus_tag LOCUS_15040 6340 5633 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383773.1 protein_id gnl|my_center|LOCUS_15040 7304 6363 gene locus_tag LOCUS_15050 gene fmt 7304 6363 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_15050 8790 7318 gene locus_tag LOCUS_15060 8790 7318 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296829.1 protein_id gnl|my_center|LOCUS_15060 9352 8843 gene locus_tag LOCUS_15070 gene def 9352 8843 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388617.1 protein_id gnl|my_center|LOCUS_15070 11596 9365 gene locus_tag LOCUS_15080 gene priA 11596 9365 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_15080 12977 11577 gene locus_tag LOCUS_15090 12977 11577 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965427.1 protein_id gnl|my_center|LOCUS_15090 14440 12953 gene locus_tag LOCUS_15100 14440 12953 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_15100 <15578 14476 gene locus_tag LOCUS_15110 <15578 14476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048375.1:formate--tetrahydrofolate ligase >Feature sequence0075 1 243 gene locus_tag LOCUS_15120 1 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 251 1111 gene locus_tag LOCUS_15130 251 1111 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888897.1 protein_id gnl|my_center|LOCUS_15130 1157 1951 gene locus_tag LOCUS_15140 1157 1951 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965361.1 protein_id gnl|my_center|LOCUS_15140 1944 2549 gene locus_tag LOCUS_15150 gene scpB 1944 2549 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428258.1 protein_id gnl|my_center|LOCUS_15150 2550 2981 gene locus_tag LOCUS_15160 gene dutA 2550 2981 CDS product dUTP diphosphatase DutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245820.1 protein_id gnl|my_center|LOCUS_15160 2953 3798 gene locus_tag LOCUS_15170 2953 3798 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288821.1 protein_id gnl|my_center|LOCUS_15170 3806 5053 gene locus_tag LOCUS_15180 3806 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 5148 5843 gene locus_tag LOCUS_15190 5148 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 5962 6612 gene locus_tag LOCUS_15200 5962 6612 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056290.1 protein_id gnl|my_center|LOCUS_15200 6633 7337 gene locus_tag LOCUS_15210 6633 7337 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286289.1 protein_id gnl|my_center|LOCUS_15210 7337 9682 gene locus_tag LOCUS_15220 7337 9682 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964842.1 protein_id gnl|my_center|LOCUS_15220 9685 11028 gene locus_tag LOCUS_15230 9685 11028 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945389.1 protein_id gnl|my_center|LOCUS_15230 11115 11759 gene locus_tag LOCUS_15240 11115 11759 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990008.1 protein_id gnl|my_center|LOCUS_15240 11789 12688 gene locus_tag LOCUS_15250 11789 12688 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294163.1 protein_id gnl|my_center|LOCUS_15250 12777 13892 gene locus_tag LOCUS_15260 12777 13892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 13902 14738 gene locus_tag LOCUS_15270 13902 14738 CDS product ketose 1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418474.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence0076 1837 1409 gene locus_tag LOCUS_15280 1837 1409 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965534.1 protein_id gnl|my_center|LOCUS_15280 2704 3789 gene locus_tag LOCUS_15290 2704 3789 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986628.1 protein_id gnl|my_center|LOCUS_15290 3794 4060 gene locus_tag LOCUS_15300 3794 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986627.1 protein_id gnl|my_center|LOCUS_15300 4078 4377 gene locus_tag LOCUS_15310 4078 4377 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358244.1 protein_id gnl|my_center|LOCUS_15310 4400 4717 gene locus_tag LOCUS_15320 4400 4717 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986626.1 protein_id gnl|my_center|LOCUS_15320 4741 6234 gene locus_tag LOCUS_15330 4741 6234 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986625.1 protein_id gnl|my_center|LOCUS_15330 6254 8794 gene locus_tag LOCUS_15340 gene cutC 6254 8794 CDS product choline trimethylamine-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358179.1 protein_id gnl|my_center|LOCUS_15340 8982 9929 gene locus_tag LOCUS_15350 gene cutD 8982 9929 CDS product choline TMA-lyase-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986624.1 protein_id gnl|my_center|LOCUS_15350 9940 10290 gene locus_tag LOCUS_15360 9940 10290 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358362.1 protein_id gnl|my_center|LOCUS_15360 10305 10730 gene locus_tag LOCUS_15370 10305 10730 CDS product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358207.1 protein_id gnl|my_center|LOCUS_15370 10749 11393 gene locus_tag LOCUS_15380 10749 11393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462299.1 protein_id gnl|my_center|LOCUS_15380 11396 12229 gene locus_tag LOCUS_15390 gene eutJ 11396 12229 CDS product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986622.1 protein_id gnl|my_center|LOCUS_15390 12239 12544 gene locus_tag LOCUS_15400 12239 12544 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815265.1 protein_id gnl|my_center|LOCUS_15400 12538 12816 gene locus_tag LOCUS_15410 12538 12816 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361873.1 protein_id gnl|my_center|LOCUS_15410 12818 14146 gene locus_tag LOCUS_15420 12818 14146 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462297.1 protein_id gnl|my_center|LOCUS_15420 14148 14696 gene locus_tag LOCUS_15430 14148 14696 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815271.1 protein_id gnl|my_center|LOCUS_15430 14756 15403 gene locus_tag LOCUS_15440 14756 15403 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986621.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence0077 <1 1270 gene locus_tag LOCUS_15450 <1 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546821.1:replication-associated recombination protein A 1272 2960 gene locus_tag LOCUS_15460 gene rho 1272 2960 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898714.1 protein_id gnl|my_center|LOCUS_15460 3033 4946 gene locus_tag LOCUS_15470 gene gyrB 3033 4946 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434229.1 protein_id gnl|my_center|LOCUS_15470 4955 7192 gene locus_tag LOCUS_15480 gene gyrA 4955 7192 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_15480 7361 8446 gene locus_tag LOCUS_15490 gene asd 7361 8446 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_15490 8654 9718 gene locus_tag LOCUS_15500 8654 9718 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206046.1 protein_id gnl|my_center|LOCUS_15500 9718 11700 gene locus_tag LOCUS_15510 9718 11700 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_15510 11712 12410 gene locus_tag LOCUS_15520 11712 12410 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_15520 13348 12476 gene locus_tag LOCUS_15530 13348 12476 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence0078 182 373 gene locus_tag LOCUS_15540 182 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 370 954 gene locus_tag LOCUS_15550 370 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802421.1 protein_id gnl|my_center|LOCUS_15550 955 1794 gene locus_tag LOCUS_15560 955 1794 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166377.1 protein_id gnl|my_center|LOCUS_15560 2097 2999 gene locus_tag LOCUS_15570 2097 2999 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285667.1 protein_id gnl|my_center|LOCUS_15570 3064 4539 gene locus_tag LOCUS_15580 3064 4539 CDS product TIGR02677 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459214.1 protein_id gnl|my_center|LOCUS_15580 4536 5672 gene locus_tag LOCUS_15590 4536 5672 CDS product TIGR02678 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068556302.1 protein_id gnl|my_center|LOCUS_15590 5669 9730 gene locus_tag LOCUS_15600 5669 9730 CDS product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459216.1 protein_id gnl|my_center|LOCUS_15600 9720 11024 gene locus_tag LOCUS_15610 9720 11024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 11231 11716 gene locus_tag LOCUS_15620 11231 11716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 12542 11847 gene locus_tag LOCUS_15630 12542 11847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 12746 14161 gene locus_tag LOCUS_15640 12746 14161 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666065.1 protein_id gnl|my_center|LOCUS_15640 14931 14236 gene locus_tag LOCUS_15650 gene ric 14931 14236 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948383.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence0079 1222 260 gene locus_tag LOCUS_15660 1222 260 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_15660 2565 1219 gene locus_tag LOCUS_15670 gene rsxC 2565 1219 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_15670 4799 3027 gene locus_tag LOCUS_15680 gene argS 4799 3027 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_15680 5465 4905 gene locus_tag LOCUS_15690 gene efp 5465 4905 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_15690 5981 5541 gene locus_tag LOCUS_15700 gene aroQ 5981 5541 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083137.1 protein_id gnl|my_center|LOCUS_15700 6853 5978 gene locus_tag LOCUS_15710 gene aroE 6853 5978 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870596.1 protein_id gnl|my_center|LOCUS_15710 7358 6846 gene locus_tag LOCUS_15720 7358 6846 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393068.1 protein_id gnl|my_center|LOCUS_15720 7816 7364 gene locus_tag LOCUS_15730 gene nrdR 7816 7364 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454958.1 protein_id gnl|my_center|LOCUS_15730 8230 7835 gene locus_tag LOCUS_15740 8230 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 9529 8243 gene locus_tag LOCUS_15750 gene galK 9529 8243 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583556.1 protein_id gnl|my_center|LOCUS_15750 10485 9643 gene locus_tag LOCUS_15760 10485 9643 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836880.1 protein_id gnl|my_center|LOCUS_15760 10692 11105 gene locus_tag LOCUS_15770 10692 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 13209 11149 gene locus_tag LOCUS_15780 gene htpG 13209 11149 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_15780 14858 13335 gene locus_tag LOCUS_15790 14858 13335 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence0080 267 509 gene locus_tag LOCUS_15800 267 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 929 1153 gene locus_tag LOCUS_15810 929 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 1382 2296 gene locus_tag LOCUS_15820 1382 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2296 3021 gene locus_tag LOCUS_15830 2296 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 3948 3559 gene locus_tag LOCUS_15840 3948 3559 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668728.1 protein_id gnl|my_center|LOCUS_15840 4147 3971 gene locus_tag LOCUS_15850 4147 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 4304 4119 gene locus_tag LOCUS_15860 4304 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 4438 4319 gene locus_tag LOCUS_15870 4438 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 5291 4908 gene locus_tag LOCUS_15880 5291 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 6322 5291 gene locus_tag LOCUS_15890 6322 5291 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027778.1 protein_id gnl|my_center|LOCUS_15890 7414 6350 gene locus_tag LOCUS_15900 7414 6350 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918104.1 protein_id gnl|my_center|LOCUS_15900 9276 7414 gene locus_tag LOCUS_15910 9276 7414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 9562 9927 gene locus_tag LOCUS_15920 9562 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 10564 9920 gene locus_tag LOCUS_15930 10564 9920 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428771.1 protein_id gnl|my_center|LOCUS_15930 11095 10574 gene locus_tag LOCUS_15940 11095 10574 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_15940 12945 11221 gene locus_tag LOCUS_15950 12945 11221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 14687 12969 gene locus_tag LOCUS_15960 14687 12969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence0081 1765 866 gene locus_tag LOCUS_15970 1765 866 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059807.1 protein_id gnl|my_center|LOCUS_15970 2035 3330 gene locus_tag LOCUS_15980 gene prdC 2035 3330 CDS product proline reductase-associated electron transfer protein PrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431873.1 protein_id gnl|my_center|LOCUS_15980 3397 5178 gene locus_tag LOCUS_15990 gene prdA 3397 5178 CDS product D-proline reductase (dithiol) proprotein PrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422104.1 protein_id gnl|my_center|LOCUS_15990 5204 5671 gene locus_tag LOCUS_16000 5204 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 5637 6362 gene locus_tag LOCUS_16010 gene prdB 5637 6362 CDS product D-proline reductase (dithiol) protein PrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861888.1 protein_id gnl|my_center|LOCUS_16010 6462 7703 gene locus_tag LOCUS_16020 6462 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 7720 8592 gene locus_tag LOCUS_16030 7720 8592 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451047.1 protein_id gnl|my_center|LOCUS_16030 10253 8646 gene locus_tag LOCUS_16040 gene pckA 10253 8646 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_16040 11138 10458 gene locus_tag LOCUS_16050 11138 10458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 11317 11247 gene locus_tag LOCUS_t00060 11317 11247 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11538 12881 gene locus_tag LOCUS_16060 gene ssnA 11538 12881 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359625.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence0082 296 208 gene locus_tag LOCUS_t00070 296 208 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2566 845 gene locus_tag LOCUS_16070 2566 845 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671107.1 protein_id gnl|my_center|LOCUS_16070 4392 2560 gene locus_tag LOCUS_16080 4392 2560 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_16080 5270 4665 gene locus_tag LOCUS_16090 5270 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 6436 5267 gene locus_tag LOCUS_16100 gene recA 6436 5267 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_16100 7991 6621 gene locus_tag LOCUS_16110 7991 6621 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965627.1 protein_id gnl|my_center|LOCUS_16110 9113 8151 gene locus_tag LOCUS_16120 gene dusB 9113 8151 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_16120 9532 9110 gene locus_tag LOCUS_16130 9532 9110 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_16130 9903 9535 gene locus_tag LOCUS_16140 9903 9535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 10873 9905 gene locus_tag LOCUS_16150 gene pfkA 10873 9905 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_16150 14733 11395 gene locus_tag LOCUS_16160 gene mfd 14733 11395 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425912.1 protein_id gnl|my_center|LOCUS_16160 14924 14742 gene locus_tag LOCUS_16170 14924 14742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence0083 2726 3007 gene locus_tag LOCUS_16180 2726 3007 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905402.1 protein_id gnl|my_center|LOCUS_16180 3007 3246 gene locus_tag LOCUS_16190 3007 3246 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_16190 3360 4247 gene locus_tag LOCUS_16200 3360 4247 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_16200 5635 4307 gene locus_tag LOCUS_16210 5635 4307 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739314.1 protein_id gnl|my_center|LOCUS_16210 6591 5632 gene locus_tag LOCUS_16220 6591 5632 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968826.1 protein_id gnl|my_center|LOCUS_16220 8048 6642 gene locus_tag LOCUS_16230 8048 6642 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262172.1 protein_id gnl|my_center|LOCUS_16230 9217 8273 gene locus_tag LOCUS_16240 9217 8273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 9727 9335 gene locus_tag LOCUS_16250 9727 9335 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958178.1 protein_id gnl|my_center|LOCUS_16250 12020 9921 gene locus_tag LOCUS_16260 12020 9921 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272522.1 protein_id gnl|my_center|LOCUS_16260 12225 13169 gene locus_tag LOCUS_16270 12225 13169 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153115.1 protein_id gnl|my_center|LOCUS_16270 14061 13198 gene locus_tag LOCUS_16280 gene sdaAA 14061 13198 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963993.1 protein_id gnl|my_center|LOCUS_16280 14735 14070 gene locus_tag LOCUS_16290 gene sdaAB 14735 14070 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963992.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence0084 782 2245 gene locus_tag LOCUS_16300 782 2245 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416108.1 protein_id gnl|my_center|LOCUS_16300 2232 4559 gene locus_tag LOCUS_16310 2232 4559 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107432.1 protein_id gnl|my_center|LOCUS_16310 4684 6054 gene locus_tag LOCUS_16320 4684 6054 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965017.1 protein_id gnl|my_center|LOCUS_16320 6047 7378 gene locus_tag LOCUS_16330 gene der 6047 7378 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_16330 7378 8016 gene locus_tag LOCUS_16340 gene plsY 7378 8016 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_16340 8013 9008 gene locus_tag LOCUS_16350 8013 9008 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_16350 9011 11704 gene locus_tag LOCUS_16360 gene mgtA 9011 11704 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861942.1 protein_id gnl|my_center|LOCUS_16360 13470 11728 gene locus_tag LOCUS_16370 13470 11728 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence0085 4401 3334 gene locus_tag LOCUS_16380 4401 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 4627 4403 gene locus_tag LOCUS_16390 4627 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 5006 4617 gene locus_tag LOCUS_16400 5006 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 7142 5025 gene locus_tag LOCUS_16410 7142 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 8269 7244 gene locus_tag LOCUS_16420 8269 7244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 9398 8286 gene locus_tag LOCUS_16430 gene essB 9398 8286 CDS product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931192.1 protein_id gnl|my_center|LOCUS_16430 9643 9395 gene locus_tag LOCUS_16440 9643 9395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 10034 9612 gene locus_tag LOCUS_16450 10034 9612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 10395 10027 gene locus_tag LOCUS_16460 10395 10027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 14670 10405 gene locus_tag LOCUS_16470 gene essC 14670 10405 CDS product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436727.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence0086 2378 870 gene locus_tag LOCUS_16480 2378 870 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_16480 3523 2447 gene locus_tag LOCUS_16490 3523 2447 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_16490 5158 3713 gene locus_tag LOCUS_16500 5158 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 6242 5148 gene locus_tag LOCUS_16510 6242 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 7034 6246 gene locus_tag LOCUS_16520 7034 6246 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_16520 7698 7021 gene locus_tag LOCUS_16530 7698 7021 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964614.1 protein_id gnl|my_center|LOCUS_16530 8876 7707 gene locus_tag LOCUS_16540 gene rpoD 8876 7707 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964612.1 protein_id gnl|my_center|LOCUS_16540 10629 8887 gene locus_tag LOCUS_16550 gene dnaG 10629 8887 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357766.1 protein_id gnl|my_center|LOCUS_16550 11651 10641 gene locus_tag LOCUS_16560 11651 10641 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_16560 13276 11654 gene locus_tag LOCUS_16570 13276 11654 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207749.1 protein_id gnl|my_center|LOCUS_16570 <14692 13400 gene locus_tag LOCUS_16580 <14692 13400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965527.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence0087 263 1021 gene locus_tag LOCUS_16590 263 1021 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681851.1 protein_id gnl|my_center|LOCUS_16590 1018 2982 gene locus_tag LOCUS_16600 1018 2982 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459160.1 protein_id gnl|my_center|LOCUS_16600 3103 4401 gene locus_tag LOCUS_16610 3103 4401 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_16610 4402 5637 gene locus_tag LOCUS_16620 4402 5637 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_16620 5694 6221 gene locus_tag LOCUS_16630 5694 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681674.1 protein_id gnl|my_center|LOCUS_16630 6418 6801 gene locus_tag LOCUS_16640 6418 6801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 6963 7478 gene locus_tag LOCUS_16650 6963 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 7752 8354 gene locus_tag LOCUS_16660 7752 8354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 9483 8593 gene locus_tag LOCUS_16670 9483 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 10396 9749 gene locus_tag LOCUS_16680 gene atoA 10396 9749 CDS product acetate CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339064.1 protein_id gnl|my_center|LOCUS_16680 11043 10393 gene locus_tag LOCUS_16690 11043 10393 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902988.1 protein_id gnl|my_center|LOCUS_16690 12227 11046 gene locus_tag LOCUS_16700 12227 11046 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966157.1 protein_id gnl|my_center|LOCUS_16700 12710 13486 gene locus_tag LOCUS_16710 12710 13486 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 protein_id gnl|my_center|LOCUS_16710 13558 14397 gene locus_tag LOCUS_16720 13558 14397 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901831.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence0088 1148 342 gene locus_tag LOCUS_16730 1148 342 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289130.1 protein_id gnl|my_center|LOCUS_16730 2031 1141 gene locus_tag LOCUS_16740 2031 1141 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289132.1 protein_id gnl|my_center|LOCUS_16740 3425 2100 gene locus_tag LOCUS_16750 3425 2100 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969763.1 protein_id gnl|my_center|LOCUS_16750 4721 3843 gene locus_tag LOCUS_16760 4721 3843 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_16760 4952 4758 gene locus_tag LOCUS_16770 4952 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 6085 5027 gene locus_tag LOCUS_16780 6085 5027 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_16780 6167 6889 gene locus_tag LOCUS_16790 6167 6889 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_16790 6972 8324 gene locus_tag LOCUS_16800 6972 8324 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243401.1 protein_id gnl|my_center|LOCUS_16800 8321 8590 gene locus_tag LOCUS_16810 8321 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 8630 9724 gene locus_tag LOCUS_16820 8630 9724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 9728 11011 gene locus_tag LOCUS_16830 9728 11011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 11031 11972 gene locus_tag LOCUS_16840 11031 11972 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_16840 12374 13081 gene locus_tag LOCUS_16850 12374 13081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence0089 184 474 gene locus_tag LOCUS_16860 184 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 471 971 gene locus_tag LOCUS_16870 471 971 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 protein_id gnl|my_center|LOCUS_16870 1072 1740 gene locus_tag LOCUS_16880 1072 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1742 2926 gene locus_tag LOCUS_16890 1742 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 2913 3758 gene locus_tag LOCUS_16900 2913 3758 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107914.1 protein_id gnl|my_center|LOCUS_16900 3880 4866 gene locus_tag LOCUS_16910 3880 4866 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_16910 4877 5821 gene locus_tag LOCUS_16920 4877 5821 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_16920 5838 6437 gene locus_tag LOCUS_16930 5838 6437 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_16930 6447 8114 gene locus_tag LOCUS_16940 6447 8114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 8125 8904 gene locus_tag LOCUS_16950 8125 8904 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_16950 8917 9660 gene locus_tag LOCUS_16960 8917 9660 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 protein_id gnl|my_center|LOCUS_16960 9653 10726 gene locus_tag LOCUS_16970 9653 10726 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965472.1 protein_id gnl|my_center|LOCUS_16970 10741 11721 gene locus_tag LOCUS_16980 gene pglE 10741 11721 CDS product (galactosaminyl)2-N,N'-diacetylbacillosaminyl-alpha1-diphospho-di-trans,octa-cis-undecaprenol synthase PglE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704837.1 protein_id gnl|my_center|LOCUS_16980 11731 14307 gene locus_tag LOCUS_16990 11731 14307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence0090 2853 1117 gene locus_tag LOCUS_17000 2853 1117 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836806.1 protein_id gnl|my_center|LOCUS_17000 4599 2863 gene locus_tag LOCUS_17010 4599 2863 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680646.1 protein_id gnl|my_center|LOCUS_17010 5231 4602 gene locus_tag LOCUS_17020 5231 4602 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305518.1 protein_id gnl|my_center|LOCUS_17020 7175 5364 gene locus_tag LOCUS_17030 gene ftsH 7175 5364 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_17030 9451 7310 gene locus_tag LOCUS_17040 9451 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 10283 9591 gene locus_tag LOCUS_17050 10283 9591 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_17050 10489 10962 gene locus_tag LOCUS_17060 gene tadA 10489 10962 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_17060 11477 10965 gene locus_tag LOCUS_17070 11477 10965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 11834 12496 gene locus_tag LOCUS_17080 11834 12496 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 protein_id gnl|my_center|LOCUS_17080 12535 13728 gene locus_tag LOCUS_17090 gene dpaL 12535 13728 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819571.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence0091 2488 1208 gene locus_tag LOCUS_17100 gene serS 2488 1208 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_17100 2837 2559 gene locus_tag LOCUS_17110 2837 2559 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165613498.1 protein_id gnl|my_center|LOCUS_17110 3087 2830 gene locus_tag LOCUS_17120 3087 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 4377 3265 gene locus_tag LOCUS_17130 4377 3265 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882793.1 protein_id gnl|my_center|LOCUS_17130 5372 4467 gene locus_tag LOCUS_17140 5372 4467 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101570.1 protein_id gnl|my_center|LOCUS_17140 6730 5525 gene locus_tag LOCUS_17150 6730 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 7400 6711 gene locus_tag LOCUS_17160 7400 6711 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438070.1 protein_id gnl|my_center|LOCUS_17160 9249 7390 gene locus_tag LOCUS_17170 9249 7390 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_17170 9799 9266 gene locus_tag LOCUS_17180 gene recU 9799 9266 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460152.1 protein_id gnl|my_center|LOCUS_17180 10794 9772 gene locus_tag LOCUS_17190 10794 9772 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_17190 11539 10823 gene locus_tag LOCUS_17200 11539 10823 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234947.1 protein_id gnl|my_center|LOCUS_17200 12899 11541 gene locus_tag LOCUS_17210 12899 11541 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_17210 13561 12995 gene locus_tag LOCUS_17220 13561 12995 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460509.1 protein_id gnl|my_center|LOCUS_17220 14052 13564 gene locus_tag LOCUS_17230 gene coaD 14052 13564 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence0092 1618 341 gene locus_tag LOCUS_17240 1618 341 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202935.1 protein_id gnl|my_center|LOCUS_17240 2574 1639 gene locus_tag LOCUS_17250 2574 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 3304 2591 gene locus_tag LOCUS_17260 3304 2591 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073072.1 protein_id gnl|my_center|LOCUS_17260 4287 3331 gene locus_tag LOCUS_17270 4287 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 4645 4274 gene locus_tag LOCUS_17280 4645 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 7046 4656 gene locus_tag LOCUS_17290 7046 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 7864 7070 gene locus_tag LOCUS_17300 7864 7070 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_17300 8918 7890 gene locus_tag LOCUS_17310 8918 7890 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549884.1 protein_id gnl|my_center|LOCUS_17310 9921 8908 gene locus_tag LOCUS_17320 9921 8908 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_17320 10401 11459 gene locus_tag LOCUS_17330 10401 11459 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963395.1 protein_id gnl|my_center|LOCUS_17330 11502 12830 gene locus_tag LOCUS_17340 11502 12830 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739314.1 protein_id gnl|my_center|LOCUS_17340 12834 13355 gene locus_tag LOCUS_17350 12834 13355 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318917.1 protein_id gnl|my_center|LOCUS_17350 13555 14235 gene locus_tag LOCUS_17360 13555 14235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence0093 966 13 gene locus_tag LOCUS_17370 966 13 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_17370 2086 968 gene locus_tag LOCUS_17380 2086 968 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_17380 3608 2076 gene locus_tag LOCUS_17390 3608 2076 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_17390 4101 3640 gene locus_tag LOCUS_17400 4101 3640 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_17400 4782 4390 gene locus_tag LOCUS_17410 4782 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 5004 4792 gene locus_tag LOCUS_17420 5004 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 5588 5001 gene locus_tag LOCUS_17430 5588 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 7506 5863 gene locus_tag LOCUS_17440 7506 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 8397 7528 gene locus_tag LOCUS_17450 gene rsmA 8397 7528 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_17450 9174 8404 gene locus_tag LOCUS_17460 9174 8404 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_17460 10135 9425 gene locus_tag LOCUS_17470 10135 9425 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_17470 12113 10125 gene locus_tag LOCUS_17480 gene metG 12113 10125 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_17480 12748 12218 gene locus_tag LOCUS_17490 12748 12218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 13259 12807 gene locus_tag LOCUS_17500 13259 12807 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966842.1 protein_id gnl|my_center|LOCUS_17500 <14354 13374 gene locus_tag LOCUS_17510 <14354 13374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259030.1:4-alpha-glucanotransferase >Feature sequence0094 691 200 gene locus_tag LOCUS_17520 691 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 818 681 gene locus_tag LOCUS_17530 818 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1632 838 gene locus_tag LOCUS_17540 1632 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2779 1715 gene locus_tag LOCUS_17550 2779 1715 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461454.1 protein_id gnl|my_center|LOCUS_17550 3911 2880 gene locus_tag LOCUS_17560 3911 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 4611 3886 gene locus_tag LOCUS_17570 4611 3886 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_17570 6460 4595 gene locus_tag LOCUS_17580 6460 4595 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099491.1 protein_id gnl|my_center|LOCUS_17580 8205 6475 gene locus_tag LOCUS_17590 8205 6475 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_17590 9932 8217 gene locus_tag LOCUS_17600 9932 8217 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_17600 10889 10056 gene locus_tag LOCUS_17610 10889 10056 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706548.1 protein_id gnl|my_center|LOCUS_17610 11592 10915 gene locus_tag LOCUS_17620 11592 10915 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416528.1 protein_id gnl|my_center|LOCUS_17620 12854 11748 gene locus_tag LOCUS_17630 12854 11748 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703952.1 protein_id gnl|my_center|LOCUS_17630 14030 13122 gene locus_tag LOCUS_17640 14030 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence0095 109 2712 gene locus_tag LOCUS_17650 109 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 2721 2915 gene locus_tag LOCUS_17660 2721 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17660 2925 3230 gene locus_tag LOCUS_17670 2925 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 3249 6239 gene locus_tag LOCUS_17680 3249 6239 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_17680 6232 7590 gene locus_tag LOCUS_17690 6232 7590 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861997.1 protein_id gnl|my_center|LOCUS_17690 7597 8178 gene locus_tag LOCUS_17700 7597 8178 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963621.1 protein_id gnl|my_center|LOCUS_17700 8182 9156 gene locus_tag LOCUS_17710 8182 9156 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_17710 9166 9975 gene locus_tag LOCUS_17720 9166 9975 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_17720 9991 10725 gene locus_tag LOCUS_17730 9991 10725 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963629.1 protein_id gnl|my_center|LOCUS_17730 10715 11563 gene locus_tag LOCUS_17740 gene rsmI 10715 11563 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947928.1 protein_id gnl|my_center|LOCUS_17740 11571 12020 gene locus_tag LOCUS_17750 gene rpiB 11571 12020 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721856.1 protein_id gnl|my_center|LOCUS_17750 12026 12388 gene locus_tag LOCUS_17760 12026 12388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 12401 12991 gene locus_tag LOCUS_17770 12401 12991 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837539.1 protein_id gnl|my_center|LOCUS_17770 13037 13876 gene locus_tag LOCUS_17780 13037 13876 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_17780 13873 14067 gene locus_tag LOCUS_17790 13873 14067 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815177.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence0096 149 1063 gene locus_tag LOCUS_17800 gene pfkB 149 1063 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861506.1 protein_id gnl|my_center|LOCUS_17800 1168 2268 gene locus_tag LOCUS_17810 1168 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 2395 3072 gene locus_tag LOCUS_17820 2395 3072 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_17820 3266 3745 gene locus_tag LOCUS_17830 3266 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 3874 4479 gene locus_tag LOCUS_17840 gene clpP 3874 4479 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_17840 4479 5960 gene locus_tag LOCUS_17850 4479 5960 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_17850 6026 8239 gene locus_tag LOCUS_17860 6026 8239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 9406 8366 gene locus_tag LOCUS_17870 9406 8366 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262368.1 protein_id gnl|my_center|LOCUS_17870 9754 10470 gene locus_tag LOCUS_17880 gene cas6 9754 10470 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016969.1 protein_id gnl|my_center|LOCUS_17880 10479 11939 gene locus_tag LOCUS_17890 gene cas8a1 10479 11939 CDS product type I CRISPR-associated protein Cas8a1/Csx8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016968.1 protein_id gnl|my_center|LOCUS_17890 11929 12822 gene locus_tag LOCUS_17900 gene cas7i 11929 12822 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016967.1 protein_id gnl|my_center|LOCUS_17900 12803 13900 gene locus_tag LOCUS_17910 gene cas5 12803 13900 CDS product CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779469.1 protein_id gnl|my_center|LOCUS_17910 13931 14122 gene locus_tag LOCUS_17920 13931 14122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence0097 1524 694 gene locus_tag LOCUS_17930 1524 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 3075 1534 gene locus_tag LOCUS_17940 3075 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 4341 3112 gene locus_tag LOCUS_17950 gene dinB 4341 3112 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989855.1 protein_id gnl|my_center|LOCUS_17950 5840 4377 gene locus_tag LOCUS_17960 5840 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 6364 5975 gene locus_tag LOCUS_17970 6364 5975 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_17970 7673 6480 gene locus_tag LOCUS_17980 7673 6480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 10991 7971 gene locus_tag LOCUS_17990 10991 7971 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262890.1 protein_id gnl|my_center|LOCUS_17990 11497 11066 gene locus_tag LOCUS_18000 11497 11066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 12105 11494 gene locus_tag LOCUS_18010 12105 11494 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221922.1 protein_id gnl|my_center|LOCUS_18010 <14073 12161 gene locus_tag LOCUS_18020 <14073 12161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000548846.1:restriction endonuclease subunit S >Feature sequence0098 350 823 gene locus_tag LOCUS_18030 350 823 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_18030 810 1607 gene locus_tag LOCUS_18040 810 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 1785 2999 gene locus_tag LOCUS_18050 1785 2999 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_18050 3280 3687 gene locus_tag LOCUS_18060 3280 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 3697 4785 gene locus_tag LOCUS_18070 3697 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 4798 5469 gene locus_tag LOCUS_18080 4798 5469 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832763.1 protein_id gnl|my_center|LOCUS_18080 5466 6296 gene locus_tag LOCUS_18090 5466 6296 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_18090 6514 8049 gene locus_tag LOCUS_18100 gene gpmI 6514 8049 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_18100 8360 9466 gene locus_tag LOCUS_18110 8360 9466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 9477 11204 gene locus_tag LOCUS_18120 9477 11204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 11204 11908 gene locus_tag LOCUS_18130 11204 11908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722723.1 protein_id gnl|my_center|LOCUS_18130 11892 13070 gene locus_tag LOCUS_18140 11892 13070 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931069.1 protein_id gnl|my_center|LOCUS_18140 13279 14007 gene locus_tag LOCUS_18150 13279 14007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence0099 1146 706 gene locus_tag LOCUS_18160 gene rimI 1146 706 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_18160 1846 1118 gene locus_tag LOCUS_18170 gene tsaB 1846 1118 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048262.1 protein_id gnl|my_center|LOCUS_18170 2285 1824 gene locus_tag LOCUS_18180 gene tsaE 2285 1824 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966123.1 protein_id gnl|my_center|LOCUS_18180 2784 2287 gene locus_tag LOCUS_18190 2784 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 4930 2777 gene locus_tag LOCUS_18200 4930 2777 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895217.1 protein_id gnl|my_center|LOCUS_18200 5297 4944 gene locus_tag LOCUS_18210 5297 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 5652 5311 gene locus_tag LOCUS_18220 5652 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 6908 5691 gene locus_tag LOCUS_18230 6908 5691 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_18230 7355 6912 gene locus_tag LOCUS_18240 7355 6912 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_18240 9206 7491 gene locus_tag LOCUS_18250 9206 7491 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_18250 10124 9270 gene locus_tag LOCUS_18260 10124 9270 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_18260 11013 10117 gene locus_tag LOCUS_18270 11013 10117 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861083.1 protein_id gnl|my_center|LOCUS_18270 11285 11013 gene locus_tag LOCUS_18280 11285 11013 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966918.1 protein_id gnl|my_center|LOCUS_18280 <13806 11285 gene locus_tag LOCUS_18290 <13806 11285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680864.1:heavy metal translocating P-type ATPase >Feature sequence0100 298 1482 gene locus_tag LOCUS_18300 298 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18300 1489 2145 gene locus_tag LOCUS_18310 1489 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18310 3329 2148 gene locus_tag LOCUS_18320 3329 2148 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964247.1 protein_id gnl|my_center|LOCUS_18320 3432 4349 gene locus_tag LOCUS_18330 3432 4349 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964246.1 protein_id gnl|my_center|LOCUS_18330 4427 4780 gene locus_tag LOCUS_18340 4427 4780 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003465043.1 protein_id gnl|my_center|LOCUS_18340 4897 5103 gene locus_tag LOCUS_18350 4897 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 6012 6170 gene locus_tag LOCUS_18360 6012 6170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18360 6240 6584 gene locus_tag LOCUS_18370 6240 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 6786 7010 gene locus_tag LOCUS_18380 6786 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18380 6964 7323 gene locus_tag LOCUS_18390 6964 7323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18390 7495 7620 gene locus_tag LOCUS_18400 7495 7620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 7682 7855 gene locus_tag LOCUS_18410 7682 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 10115 8523 gene locus_tag LOCUS_18420 10115 8523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 10492 10151 gene locus_tag LOCUS_18430 10492 10151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 11146 10859 gene locus_tag LOCUS_18440 11146 10859 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221356.1 protein_id gnl|my_center|LOCUS_18440 11387 11136 gene locus_tag LOCUS_18450 11387 11136 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250181.1 protein_id gnl|my_center|LOCUS_18450 13251 11470 gene locus_tag LOCUS_18460 13251 11470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence0101 1112 27 gene locus_tag LOCUS_18470 1112 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1374 1970 gene locus_tag LOCUS_18480 gene ruvA 1374 1970 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_18480 1982 2980 gene locus_tag LOCUS_18490 gene ruvB 1982 2980 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_18490 3000 5234 gene locus_tag LOCUS_18500 3000 5234 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 protein_id gnl|my_center|LOCUS_18500 5454 5888 gene locus_tag LOCUS_18510 5454 5888 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416968.1 protein_id gnl|my_center|LOCUS_18510 5914 6249 gene locus_tag LOCUS_18520 5914 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 6296 7558 gene locus_tag LOCUS_18530 6296 7558 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837286.1 protein_id gnl|my_center|LOCUS_18530 8311 7562 gene locus_tag LOCUS_18540 8311 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 8721 9644 gene locus_tag LOCUS_18550 gene pyrF 8721 9644 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_18550 9654 10427 gene locus_tag LOCUS_18560 9654 10427 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_18560 10424 11329 gene locus_tag LOCUS_18570 10424 11329 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 protein_id gnl|my_center|LOCUS_18570 11340 12011 gene locus_tag LOCUS_18580 gene pyrE 11340 12011 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_18580 12044 12193 gene locus_tag LOCUS_18590 12044 12193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 12337 12654 gene locus_tag LOCUS_18600 12337 12654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 12647 13048 gene locus_tag LOCUS_18610 12647 13048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence0102 113 1339 gene locus_tag LOCUS_18620 113 1339 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_18620 1544 1741 gene locus_tag LOCUS_18630 1544 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 1729 2586 gene locus_tag LOCUS_18640 1729 2586 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_18640 2811 3677 gene locus_tag LOCUS_18650 2811 3677 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_18650 3674 4486 gene locus_tag LOCUS_18660 3674 4486 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_18660 4479 5219 gene locus_tag LOCUS_18670 gene truA 4479 5219 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_18670 5434 5613 gene locus_tag LOCUS_18680 gene rpmF 5434 5613 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_18680 5688 6695 gene locus_tag LOCUS_18690 gene plsX 5688 6695 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_18690 6772 7473 gene locus_tag LOCUS_18700 gene rncS 6772 7473 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232030.1 protein_id gnl|my_center|LOCUS_18700 7483 11058 gene locus_tag LOCUS_18710 gene smc 7483 11058 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_18710 11071 12021 gene locus_tag LOCUS_18720 gene ftsY 11071 12021 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965059.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence0103 9 320 gene locus_tag LOCUS_18730 9 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1917 460 gene locus_tag LOCUS_18740 1917 460 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 protein_id gnl|my_center|LOCUS_18740 3779 2316 gene locus_tag LOCUS_18750 3779 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 4040 5065 gene locus_tag LOCUS_18760 gene selD 4040 5065 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462047.1 protein_id gnl|my_center|LOCUS_18760 5080 5700 gene locus_tag LOCUS_18770 gene yedF 5080 5700 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681889.1 protein_id gnl|my_center|LOCUS_18770 5700 6857 gene locus_tag LOCUS_18780 5700 6857 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811901.1 protein_id gnl|my_center|LOCUS_18780 6854 7090 gene locus_tag LOCUS_18790 6854 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 7381 8760 gene locus_tag LOCUS_18800 7381 8760 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052123.1 protein_id gnl|my_center|LOCUS_18800 8757 9473 gene locus_tag LOCUS_18810 gene yqeC 8757 9473 CDS product selenium cofactor biosynthesis protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459386.1 protein_id gnl|my_center|LOCUS_18810 9483 10283 gene locus_tag LOCUS_18820 gene yqeB 9483 10283 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393498.1 protein_id gnl|my_center|LOCUS_18820 10283 10870 gene locus_tag LOCUS_18830 10283 10870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 11203 12465 gene locus_tag LOCUS_18840 11203 12465 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896806.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence0104 4227 1021 gene locus_tag LOCUS_18850 gene carB 4227 1021 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862003.1 protein_id gnl|my_center|LOCUS_18850 5314 4229 gene locus_tag LOCUS_18860 gene carA 5314 4229 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_18860 6398 5574 gene locus_tag LOCUS_18870 gene dapF 6398 5574 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_18870 7652 6411 gene locus_tag LOCUS_18880 7652 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 8484 7663 gene locus_tag LOCUS_18890 8484 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 8912 8481 gene locus_tag LOCUS_18900 gene dutA 8912 8481 CDS product dUTP diphosphatase DutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245820.1 protein_id gnl|my_center|LOCUS_18900 10803 9016 gene locus_tag LOCUS_18910 10803 9016 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_18910 12292 10841 gene locus_tag LOCUS_18920 gene gltX 12292 10841 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_18920 13263 12289 gene locus_tag LOCUS_18930 13263 12289 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965112.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence0105 <1 1361 gene locus_tag LOCUS_18940 <1 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011017109.1:oxaloacetate decarboxylase subunit alpha 1421 2761 gene locus_tag LOCUS_18950 1421 2761 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_18950 2781 3470 gene locus_tag LOCUS_18960 2781 3470 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_18960 3457 4053 gene locus_tag LOCUS_18970 3457 4053 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_18970 4256 4606 gene locus_tag LOCUS_18980 4256 4606 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546929.1 protein_id gnl|my_center|LOCUS_18980 4650 5492 gene locus_tag LOCUS_18990 4650 5492 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948948.1 protein_id gnl|my_center|LOCUS_18990 5515 6960 gene locus_tag LOCUS_19000 5515 6960 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183512.1 protein_id gnl|my_center|LOCUS_19000 6947 7861 gene locus_tag LOCUS_19010 gene murQ 6947 7861 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948949.1 protein_id gnl|my_center|LOCUS_19010 7939 8250 gene locus_tag LOCUS_19020 7939 8250 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898113.1 protein_id gnl|my_center|LOCUS_19020 8252 9598 gene locus_tag LOCUS_19030 8252 9598 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363934.1 protein_id gnl|my_center|LOCUS_19030 9629 10723 gene locus_tag LOCUS_19040 9629 10723 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861793.1 protein_id gnl|my_center|LOCUS_19040 10720 11589 gene locus_tag LOCUS_19050 10720 11589 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439905.1 protein_id gnl|my_center|LOCUS_19050 11655 12683 gene locus_tag LOCUS_19060 11655 12683 CDS product RNA ligase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068264228.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence0106 137 1204 gene locus_tag LOCUS_19070 137 1204 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770826.1 protein_id gnl|my_center|LOCUS_19070 1240 1779 gene locus_tag LOCUS_19080 1240 1779 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837075.1 protein_id gnl|my_center|LOCUS_19080 2029 2670 gene locus_tag LOCUS_19090 gene sodA 2029 2670 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_19090 3011 3250 gene locus_tag LOCUS_19100 3011 3250 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893931.1 protein_id gnl|my_center|LOCUS_19100 3314 3493 gene locus_tag LOCUS_19110 3314 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 3575 4063 gene locus_tag LOCUS_19120 3575 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 4214 4417 gene locus_tag LOCUS_19130 4214 4417 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837579.1 protein_id gnl|my_center|LOCUS_19130 4826 6157 gene locus_tag LOCUS_19140 4826 6157 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_19140 6341 7468 gene locus_tag LOCUS_19150 6341 7468 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869908.1 protein_id gnl|my_center|LOCUS_19150 8739 7651 gene locus_tag LOCUS_19160 8739 7651 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_19160 9028 9177 gene locus_tag LOCUS_19170 gene rpmG 9028 9177 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_19170 9186 9383 gene locus_tag LOCUS_19180 9186 9383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 9392 9925 gene locus_tag LOCUS_19190 gene nusG 9392 9925 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966426.1 protein_id gnl|my_center|LOCUS_19190 10001 10426 gene locus_tag LOCUS_19200 gene rplK 10001 10426 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_19200 10444 11139 gene locus_tag LOCUS_19210 gene rplA 10444 11139 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_19210 11407 11733 gene locus_tag LOCUS_19220 11407 11733 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963892.1 protein_id gnl|my_center|LOCUS_19220 11735 12322 gene locus_tag LOCUS_19230 11735 12322 CDS product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963893.1 protein_id gnl|my_center|LOCUS_19230 12351 13226 gene locus_tag LOCUS_19240 12351 13226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence0107 2826 10019 gene locus_tag LOCUS_19250 2826 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 10209 10772 gene locus_tag LOCUS_19260 gene ahpC 10209 10772 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810052.1 protein_id gnl|my_center|LOCUS_19260 11132 12775 gene locus_tag LOCUS_19270 11132 12775 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810050.1 protein_id gnl|my_center|LOCUS_19270 >Feature sequence0108 3555 736 gene locus_tag LOCUS_19280 gene uvrA 3555 736 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462189.1 protein_id gnl|my_center|LOCUS_19280 4126 3617 gene locus_tag LOCUS_19290 4126 3617 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930588.1 protein_id gnl|my_center|LOCUS_19290 5245 4163 gene locus_tag LOCUS_19300 5245 4163 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_19300 7398 5248 gene locus_tag LOCUS_19310 gene gnpA 7398 5248 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389475.1 protein_id gnl|my_center|LOCUS_19310 9648 7537 gene locus_tag LOCUS_19320 9648 7537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 9957 10316 gene locus_tag LOCUS_19330 9957 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 11310 10336 gene locus_tag LOCUS_19340 11310 10336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 12334 11432 gene locus_tag LOCUS_19350 12334 11432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 >Feature sequence0109 1880 3661 gene locus_tag LOCUS_19360 1880 3661 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678765.1 protein_id gnl|my_center|LOCUS_19360 4493 3786 gene locus_tag LOCUS_19370 4493 3786 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434127.1 protein_id gnl|my_center|LOCUS_19370 5299 4505 gene locus_tag LOCUS_19380 5299 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 6340 5366 gene locus_tag LOCUS_19390 6340 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 7096 6344 gene locus_tag LOCUS_19400 7096 6344 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861281.1 protein_id gnl|my_center|LOCUS_19400 7613 7218 gene locus_tag LOCUS_19410 7613 7218 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224159.1 protein_id gnl|my_center|LOCUS_19410 8597 7659 gene locus_tag LOCUS_19420 8597 7659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 9767 8643 gene locus_tag LOCUS_19430 9767 8643 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987004.1 protein_id gnl|my_center|LOCUS_19430 10736 9789 gene locus_tag LOCUS_19440 10736 9789 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545190.1 protein_id gnl|my_center|LOCUS_19440 12674 10740 gene locus_tag LOCUS_19450 gene ilvB 12674 10740 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182646.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence0110 2583 427 gene locus_tag LOCUS_19460 gene nrdD 2583 427 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_19460 2975 2664 gene locus_tag LOCUS_19470 gene cas2 2975 2664 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414276.1 protein_id gnl|my_center|LOCUS_19470 3987 2983 gene locus_tag LOCUS_19480 gene cas1 3987 2983 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414279.1 protein_id gnl|my_center|LOCUS_19480 5142 3997 gene locus_tag LOCUS_19490 gene csm5 5142 3997 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414285.1 protein_id gnl|my_center|LOCUS_19490 6083 5142 gene locus_tag LOCUS_19500 gene csm4 6083 5142 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414288.1 protein_id gnl|my_center|LOCUS_19500 6759 6085 gene locus_tag LOCUS_19510 gene csm3 6759 6085 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917166.1 protein_id gnl|my_center|LOCUS_19510 7212 6772 gene locus_tag LOCUS_19520 gene csm2 7212 6772 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917164.1 protein_id gnl|my_center|LOCUS_19520 9420 7213 gene locus_tag LOCUS_19530 gene cas10 9420 7213 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900580.1 protein_id gnl|my_center|LOCUS_19530 10144 9413 gene locus_tag LOCUS_19540 gene cas6 10144 9413 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837017.1 protein_id gnl|my_center|LOCUS_19540 11529 10144 gene locus_tag LOCUS_19550 gene csm6 11529 10144 CDS product type III-A CRISPR-associated CARF protein Csm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899494.1 protein_id gnl|my_center|LOCUS_19550 12320 11688 gene locus_tag LOCUS_19560 12320 11688 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129999477.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence0111 1126 2292 gene locus_tag LOCUS_19570 1126 2292 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434490.1 protein_id gnl|my_center|LOCUS_19570 3888 2404 gene locus_tag LOCUS_19580 3888 2404 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903237.1 protein_id gnl|my_center|LOCUS_19580 4240 5340 gene locus_tag LOCUS_19590 4240 5340 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948973.1 protein_id gnl|my_center|LOCUS_19590 5843 5688 gene locus_tag LOCUS_19600 5843 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 5939 6496 gene locus_tag LOCUS_19610 5939 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 6626 7435 gene locus_tag LOCUS_19620 gene proC 6626 7435 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_19620 7496 8290 gene locus_tag LOCUS_19630 7496 8290 CDS product YhfC family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233198.1 protein_id gnl|my_center|LOCUS_19630 8311 8985 gene locus_tag LOCUS_19640 8311 8985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 9033 9767 gene locus_tag LOCUS_19650 9033 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 9879 12260 gene locus_tag LOCUS_19660 9879 12260 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297196.1 protein_id gnl|my_center|LOCUS_19660 12440 12757 gene locus_tag LOCUS_19670 12440 12757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence0112 221 484 gene locus_tag LOCUS_19680 gene rpsT 221 484 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890686.1 protein_id gnl|my_center|LOCUS_19680 1555 590 gene locus_tag LOCUS_19690 gene holA 1555 590 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320835.1 protein_id gnl|my_center|LOCUS_19690 4059 1720 gene locus_tag LOCUS_19700 4059 1720 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967776.1 protein_id gnl|my_center|LOCUS_19700 5456 4536 gene locus_tag LOCUS_19710 5456 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 6906 5446 gene locus_tag LOCUS_19720 6906 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 7778 6909 gene locus_tag LOCUS_19730 7778 6909 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254353.1 protein_id gnl|my_center|LOCUS_19730 8263 8024 gene locus_tag LOCUS_19740 8263 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 9542 8280 gene locus_tag LOCUS_19750 9542 8280 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048446.1 protein_id gnl|my_center|LOCUS_19750 10051 9539 gene locus_tag LOCUS_19760 10051 9539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19760 10723 10058 gene locus_tag LOCUS_19770 10723 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19770 11203 10856 gene locus_tag LOCUS_19780 11203 10856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 11756 11571 gene locus_tag LOCUS_19790 11756 11571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 12683 12147 gene locus_tag LOCUS_19800 12683 12147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 >Feature sequence0113 <1 767 gene locus_tag LOCUS_19810 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012774915.1:sugar ABC transporter substrate-binding protein 925 1815 gene locus_tag LOCUS_19820 925 1815 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939305.1 protein_id gnl|my_center|LOCUS_19820 1824 2636 gene locus_tag LOCUS_19830 1824 2636 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921761.1 protein_id gnl|my_center|LOCUS_19830 2652 4832 gene locus_tag LOCUS_19840 2652 4832 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584017.1 protein_id gnl|my_center|LOCUS_19840 5265 6503 gene locus_tag LOCUS_19850 5265 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 6503 7303 gene locus_tag LOCUS_19860 6503 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 7308 8162 gene locus_tag LOCUS_19870 7308 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 8226 8459 gene locus_tag LOCUS_19880 8226 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 8483 9169 gene locus_tag LOCUS_19890 8483 9169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence0114 52 1044 gene locus_tag LOCUS_19900 52 1044 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390188.1 protein_id gnl|my_center|LOCUS_19900 1061 1564 gene locus_tag LOCUS_19910 1061 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 1645 3651 gene locus_tag LOCUS_19920 1645 3651 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_19920 3754 5037 gene locus_tag LOCUS_19930 3754 5037 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476101.1 protein_id gnl|my_center|LOCUS_19930 5054 6766 gene locus_tag LOCUS_19940 5054 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 6763 7674 gene locus_tag LOCUS_19950 6763 7674 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795345.1 protein_id gnl|my_center|LOCUS_19950 7792 8844 gene locus_tag LOCUS_19960 7792 8844 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014568758.1 protein_id gnl|my_center|LOCUS_19960 8948 10249 gene locus_tag LOCUS_19970 8948 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 10269 11222 gene locus_tag LOCUS_19980 10269 11222 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_19980 11215 12675 gene locus_tag LOCUS_19990 gene wzx 11215 12675 CDS product O148 family O-antigen flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739384.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence0115 224 1450 gene locus_tag LOCUS_20000 224 1450 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393768.1 protein_id gnl|my_center|LOCUS_20000 1972 1481 gene locus_tag LOCUS_20010 gene leuD 1972 1481 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_20010 3243 1987 gene locus_tag LOCUS_20020 gene leuC 3243 1987 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895941.1 protein_id gnl|my_center|LOCUS_20020 3365 4255 gene locus_tag LOCUS_20030 3365 4255 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948372.1 protein_id gnl|my_center|LOCUS_20030 4956 4279 gene locus_tag LOCUS_20040 4956 4279 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680765.1 protein_id gnl|my_center|LOCUS_20040 7070 4956 gene locus_tag LOCUS_20050 7070 4956 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_20050 8181 7216 gene locus_tag LOCUS_20060 8181 7216 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949075.1 protein_id gnl|my_center|LOCUS_20060 8676 8191 gene locus_tag LOCUS_20070 8676 8191 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948465.1 protein_id gnl|my_center|LOCUS_20070 10233 8866 gene locus_tag LOCUS_20080 10233 8866 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_20080 10469 11947 gene locus_tag LOCUS_20090 10469 11947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence0116 1192 557 gene locus_tag LOCUS_20100 gene thiE 1192 557 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436488.1 protein_id gnl|my_center|LOCUS_20100 1994 1179 gene locus_tag LOCUS_20110 gene thiM 1994 1179 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_20110 3087 2254 gene locus_tag LOCUS_20120 3087 2254 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272216.1 protein_id gnl|my_center|LOCUS_20120 4113 3400 gene locus_tag LOCUS_20130 4113 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 4980 4204 gene locus_tag LOCUS_20140 4980 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 5641 5057 gene locus_tag LOCUS_20150 5641 5057 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439354.1 protein_id gnl|my_center|LOCUS_20150 6527 5721 gene locus_tag LOCUS_20160 6527 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 6698 6537 gene locus_tag LOCUS_20170 6698 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 7791 6715 gene locus_tag LOCUS_20180 7791 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 8734 7781 gene locus_tag LOCUS_20190 8734 7781 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_20190 9586 8840 gene locus_tag LOCUS_20200 gene pflA 9586 8840 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_20200 11916 9676 gene locus_tag LOCUS_20210 gene pflB 11916 9676 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_20210 12551 12258 gene locus_tag LOCUS_20220 12551 12258 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016687.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence0117 2646 1600 gene locus_tag LOCUS_20230 gene mcrC 2646 1600 CDS product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922381.1 protein_id gnl|my_center|LOCUS_20230 4799 2643 gene locus_tag LOCUS_20240 4799 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 8530 4877 gene locus_tag LOCUS_20250 gene brxC 8530 4877 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065383.1 protein_id gnl|my_center|LOCUS_20250 9117 8539 gene locus_tag LOCUS_20260 9117 8539 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272229.1 protein_id gnl|my_center|LOCUS_20260 9719 9117 gene locus_tag LOCUS_20270 9719 9117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 9987 10703 gene locus_tag LOCUS_20280 9987 10703 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138570.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence0118 44 976 gene locus_tag LOCUS_20290 gene cysK 44 976 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_20290 1110 2795 gene locus_tag LOCUS_20300 1110 2795 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428989.1 protein_id gnl|my_center|LOCUS_20300 2795 4216 gene locus_tag LOCUS_20310 2795 4216 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891874.1 protein_id gnl|my_center|LOCUS_20310 4203 4403 gene locus_tag LOCUS_20320 4203 4403 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359346.1 protein_id gnl|my_center|LOCUS_20320 5146 4454 gene locus_tag LOCUS_20330 5146 4454 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356156.1 protein_id gnl|my_center|LOCUS_20330 5561 5139 gene locus_tag LOCUS_20340 5561 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 7438 5570 gene locus_tag LOCUS_20350 7438 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 8511 7435 gene locus_tag LOCUS_20360 8511 7435 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545188.1 protein_id gnl|my_center|LOCUS_20360 9925 8534 gene locus_tag LOCUS_20370 gene asnS 9925 8534 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_20370 10270 11544 gene locus_tag LOCUS_20380 10270 11544 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082942.1 protein_id gnl|my_center|LOCUS_20380 >Feature sequence0119 333 61 gene locus_tag LOCUS_20390 333 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 1900 323 gene locus_tag LOCUS_20400 1900 323 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146974.1 protein_id gnl|my_center|LOCUS_20400 2749 1952 gene locus_tag LOCUS_20410 2749 1952 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809818.1 protein_id gnl|my_center|LOCUS_20410 2886 3917 gene locus_tag LOCUS_20420 2886 3917 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837220.1 protein_id gnl|my_center|LOCUS_20420 3917 4672 gene locus_tag LOCUS_20430 3917 4672 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837221.1 protein_id gnl|my_center|LOCUS_20430 4690 5739 gene locus_tag LOCUS_20440 4690 5739 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837222.1 protein_id gnl|my_center|LOCUS_20440 5741 6394 gene locus_tag LOCUS_20450 5741 6394 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837223.1 protein_id gnl|my_center|LOCUS_20450 6683 6459 gene locus_tag LOCUS_20460 6683 6459 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016226.1 protein_id gnl|my_center|LOCUS_20460 8635 6785 gene locus_tag LOCUS_20470 gene hcp 8635 6785 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966698.1 protein_id gnl|my_center|LOCUS_20470 9456 8785 gene locus_tag LOCUS_20480 9456 8785 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665989.1 protein_id gnl|my_center|LOCUS_20480 10448 9414 gene locus_tag LOCUS_20490 10448 9414 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681570.1 protein_id gnl|my_center|LOCUS_20490 11143 10445 gene locus_tag LOCUS_20500 11143 10445 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672626.1 protein_id gnl|my_center|LOCUS_20500 12363 11146 gene locus_tag LOCUS_20510 12363 11146 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681571.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence0120 359 646 gene locus_tag LOCUS_20520 gene rpsF 359 646 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023040534.1 protein_id gnl|my_center|LOCUS_20520 670 1119 gene locus_tag LOCUS_20530 670 1119 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902513.1 protein_id gnl|my_center|LOCUS_20530 1146 1415 gene locus_tag LOCUS_20540 gene rpsR 1146 1415 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_20540 1577 2920 gene locus_tag LOCUS_20550 1577 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 2931 3341 gene locus_tag LOCUS_20560 2931 3341 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016841.1 protein_id gnl|my_center|LOCUS_20560 3341 3955 gene locus_tag LOCUS_20570 3341 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 4075 4482 gene locus_tag LOCUS_20580 4075 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 4484 5440 gene locus_tag LOCUS_20590 4484 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 5437 6309 gene locus_tag LOCUS_20600 gene cdaA 5437 6309 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_20600 6293 7591 gene locus_tag LOCUS_20610 6293 7591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 7605 7874 gene locus_tag LOCUS_20620 7605 7874 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771768.1 protein_id gnl|my_center|LOCUS_20620 7888 9612 gene locus_tag LOCUS_20630 gene ptsP 7888 9612 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_20630 9606 10901 gene locus_tag LOCUS_20640 9606 10901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 10889 12238 gene locus_tag LOCUS_20650 10889 12238 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_20650 >Feature sequence0121 2029 638 gene locus_tag LOCUS_20660 gene gltA 2029 638 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_20660 2922 2029 gene locus_tag LOCUS_20670 2922 2029 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_20670 4087 3062 gene locus_tag LOCUS_20680 gene kdgK1 4087 3062 CDS product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902071.1 protein_id gnl|my_center|LOCUS_20680 4607 4113 gene locus_tag LOCUS_20690 4607 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 5232 4609 gene locus_tag LOCUS_20700 5232 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021681.1 protein_id gnl|my_center|LOCUS_20700 5665 5219 gene locus_tag LOCUS_20710 5665 5219 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416968.1 protein_id gnl|my_center|LOCUS_20710 7983 5734 gene locus_tag LOCUS_20720 7983 5734 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 protein_id gnl|my_center|LOCUS_20720 8984 7986 gene locus_tag LOCUS_20730 gene ruvB 8984 7986 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_20730 9599 9009 gene locus_tag LOCUS_20740 gene ruvA 9599 9009 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_20740 9699 10796 gene locus_tag LOCUS_20750 9699 10796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 11488 10940 gene locus_tag LOCUS_20760 11488 10940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 11716 11919 gene locus_tag LOCUS_20770 gene cspB 11716 11919 CDS product cold-shock protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723180.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence0122 131 1408 gene locus_tag LOCUS_20780 131 1408 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837602.1 protein_id gnl|my_center|LOCUS_20780 1479 2501 gene locus_tag LOCUS_20790 gene pheS 1479 2501 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_20790 2547 4967 gene locus_tag LOCUS_20800 gene pheT 2547 4967 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_20800 5040 6524 gene locus_tag LOCUS_20810 5040 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 6595 6825 gene locus_tag LOCUS_20820 6595 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 6892 9033 gene locus_tag LOCUS_20830 gene rnr 6892 9033 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_20830 9017 9478 gene locus_tag LOCUS_20840 gene smpB 9017 9478 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 protein_id gnl|my_center|LOCUS_20840 9606 9887 gene locus_tag LOCUS_20850 9606 9887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 10975 9917 gene locus_tag LOCUS_20860 10975 9917 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435347.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence0123 792 2417 gene locus_tag LOCUS_20870 792 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2431 3078 gene locus_tag LOCUS_20880 2431 3078 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893668.1 protein_id gnl|my_center|LOCUS_20880 3124 3888 gene locus_tag LOCUS_20890 3124 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 3899 4192 gene locus_tag LOCUS_20900 3899 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 4194 5387 gene locus_tag LOCUS_20910 4194 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 5387 6493 gene locus_tag LOCUS_20920 5387 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 6657 7892 gene locus_tag LOCUS_20930 6657 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 8069 8536 gene locus_tag LOCUS_20940 8069 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 8533 9519 gene locus_tag LOCUS_20950 8533 9519 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566022.1 protein_id gnl|my_center|LOCUS_20950 9528 10730 gene locus_tag LOCUS_20960 9528 10730 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_20960 11007 12014 gene locus_tag LOCUS_20970 11007 12014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence0124 1088 7951 gene locus_tag LOCUS_20980 1088 7951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence0125 1346 2404 gene locus_tag LOCUS_20990 1346 2404 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435347.1 protein_id gnl|my_center|LOCUS_20990 2715 2434 gene locus_tag LOCUS_21000 2715 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 3304 2843 gene locus_tag LOCUS_21010 gene smpB 3304 2843 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 protein_id gnl|my_center|LOCUS_21010 5429 3288 gene locus_tag LOCUS_21020 gene rnr 5429 3288 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_21020 5726 5496 gene locus_tag LOCUS_21030 5726 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 7281 5797 gene locus_tag LOCUS_21040 7281 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 9774 7354 gene locus_tag LOCUS_21050 gene pheT 9774 7354 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_21050 10842 9820 gene locus_tag LOCUS_21060 gene pheS 10842 9820 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_21060 <12027 10913 gene locus_tag LOCUS_21070 <12027 10913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003401829.1:adenylosuccinate synthase >Feature sequence0126 73 1119 gene locus_tag LOCUS_21080 73 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 1259 2140 gene locus_tag LOCUS_21090 1259 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2669 2205 gene locus_tag LOCUS_21100 gene moaC 2669 2205 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454438.1 protein_id gnl|my_center|LOCUS_21100 3712 2681 gene locus_tag LOCUS_21110 3712 2681 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379414.1 protein_id gnl|my_center|LOCUS_21110 4397 3714 gene locus_tag LOCUS_21120 gene modB 4397 3714 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888685.1 protein_id gnl|my_center|LOCUS_21120 5283 4375 gene locus_tag LOCUS_21130 gene modA 5283 4375 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243706.1 protein_id gnl|my_center|LOCUS_21130 6241 5312 gene locus_tag LOCUS_21140 6241 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 7214 6243 gene locus_tag LOCUS_21150 gene moaA 7214 6243 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187922030.1 protein_id gnl|my_center|LOCUS_21150 8245 7217 gene locus_tag LOCUS_21160 8245 7217 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144034111.1 protein_id gnl|my_center|LOCUS_21160 9296 8265 gene locus_tag LOCUS_21170 9296 8265 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435117.1 protein_id gnl|my_center|LOCUS_21170 10911 9520 gene locus_tag LOCUS_21180 gene hydA 10911 9520 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891590.1 protein_id gnl|my_center|LOCUS_21180 <11926 10986 gene locus_tag LOCUS_21190 <11926 10986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002387142.1:putative selenate reductase subunit YgfK >Feature sequence0127 1903 557 gene locus_tag LOCUS_21200 1903 557 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_21200 2329 1904 gene locus_tag LOCUS_21210 gene fabZ 2329 1904 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048424.1 protein_id gnl|my_center|LOCUS_21210 2791 2357 gene locus_tag LOCUS_21220 gene accB 2791 2357 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472869.1 protein_id gnl|my_center|LOCUS_21220 4048 2813 gene locus_tag LOCUS_21230 gene fabF 4048 2813 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_21230 4806 4060 gene locus_tag LOCUS_21240 gene fabG 4806 4060 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_21240 5720 4803 gene locus_tag LOCUS_21250 gene fabD 5720 4803 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_21250 6662 5724 gene locus_tag LOCUS_21260 gene fabK 6662 5724 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048429.1 protein_id gnl|my_center|LOCUS_21260 6949 6713 gene locus_tag LOCUS_21270 gene acpP 6949 6713 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_21270 7951 7010 gene locus_tag LOCUS_21280 7951 7010 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_21280 8279 9817 gene locus_tag LOCUS_21290 8279 9817 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890565.1 protein_id gnl|my_center|LOCUS_21290 9897 10814 gene locus_tag LOCUS_21300 9897 10814 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434205.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence0128 36 1940 gene locus_tag LOCUS_21310 36 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 1945 2700 gene locus_tag LOCUS_21320 1945 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 2718 4358 gene locus_tag LOCUS_21330 2718 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 4465 6945 gene locus_tag LOCUS_21340 4465 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 6958 8046 gene locus_tag LOCUS_21350 6958 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 8070 9167 gene locus_tag LOCUS_21360 8070 9167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 9180 10814 gene locus_tag LOCUS_21370 9180 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 10902 11561 gene locus_tag LOCUS_21380 10902 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence0129 2854 2378 gene locus_tag LOCUS_21390 gene rlmH 2854 2378 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435703.1 protein_id gnl|my_center|LOCUS_21390 3552 2857 gene locus_tag LOCUS_21400 gene yycF 3552 2857 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701473.1 protein_id gnl|my_center|LOCUS_21400 4155 3562 gene locus_tag LOCUS_21410 gene comEA 4155 3562 CDS product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398514.1 protein_id gnl|my_center|LOCUS_21410 5083 4232 gene locus_tag LOCUS_21420 5083 4232 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 protein_id gnl|my_center|LOCUS_21420 5709 5080 gene locus_tag LOCUS_21430 5709 5080 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948818.1 protein_id gnl|my_center|LOCUS_21430 6050 5709 gene locus_tag LOCUS_21440 6050 5709 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963739.1 protein_id gnl|my_center|LOCUS_21440 6977 6087 gene locus_tag LOCUS_21450 6977 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 7285 6974 gene locus_tag LOCUS_21460 7285 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 8041 7313 gene locus_tag LOCUS_21470 8041 7313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 8603 8064 gene locus_tag LOCUS_21480 gene pgsA 8603 8064 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_21480 9922 8600 gene locus_tag LOCUS_21490 gene rimO 9922 8600 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_21490 10230 9985 gene locus_tag LOCUS_21500 10230 9985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 10863 10231 gene locus_tag LOCUS_21510 gene gmk 10863 10231 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830096.1 protein_id gnl|my_center|LOCUS_21510 11749 10871 gene locus_tag LOCUS_21520 11749 10871 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence0130 263 889 gene locus_tag LOCUS_21530 263 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 896 2269 gene locus_tag LOCUS_21540 896 2269 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461820.1 protein_id gnl|my_center|LOCUS_21540 2635 3957 gene locus_tag LOCUS_21550 2635 3957 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_21550 4026 5102 gene locus_tag LOCUS_21560 4026 5102 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927236.1 protein_id gnl|my_center|LOCUS_21560 5099 6049 gene locus_tag LOCUS_21570 5099 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 6046 7446 gene locus_tag LOCUS_21580 6046 7446 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461820.1 protein_id gnl|my_center|LOCUS_21580 7443 8840 gene locus_tag LOCUS_21590 7443 8840 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461820.1 protein_id gnl|my_center|LOCUS_21590 9012 9167 gene locus_tag LOCUS_21600 9012 9167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 9186 10061 gene locus_tag LOCUS_21610 9186 10061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 10255 10641 gene locus_tag LOCUS_21620 10255 10641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 <11774 10786 gene locus_tag LOCUS_21630 <11774 10786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103283.1:ABC transporter permease >Feature sequence0131 551 180 gene locus_tag LOCUS_21640 551 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 1784 774 gene locus_tag LOCUS_21650 1784 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 3334 2000 gene locus_tag LOCUS_21660 3334 2000 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676360.1 protein_id gnl|my_center|LOCUS_21660 4831 3536 gene locus_tag LOCUS_21670 4831 3536 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898268.1 protein_id gnl|my_center|LOCUS_21670 5364 4828 gene locus_tag LOCUS_21680 5364 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 6513 5419 gene locus_tag LOCUS_21690 6513 5419 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566022.1 protein_id gnl|my_center|LOCUS_21690 7353 6637 gene locus_tag LOCUS_21700 7353 6637 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222616.1 protein_id gnl|my_center|LOCUS_21700 8833 7367 gene locus_tag LOCUS_21710 8833 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 9562 8924 gene locus_tag LOCUS_21720 9562 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 10115 9567 gene locus_tag LOCUS_21730 gene nrdG 10115 9567 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_21730 11143 10115 gene locus_tag LOCUS_21740 11143 10115 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_21740 >Feature sequence0132 8938 2018 gene locus_tag LOCUS_21750 8938 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 9874 9485 gene locus_tag LOCUS_21760 9874 9485 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675091.1 protein_id gnl|my_center|LOCUS_21760 10729 9884 gene locus_tag LOCUS_21770 10729 9884 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679293.1 protein_id gnl|my_center|LOCUS_21770 10932 11447 gene locus_tag LOCUS_21780 10932 11447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 11461 11682 gene locus_tag LOCUS_21790 11461 11682 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262994.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence0133 925 389 gene locus_tag LOCUS_21800 925 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 1957 929 gene locus_tag LOCUS_21810 1957 929 CDS product 2-keto-3-deoxygluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395562.1 protein_id gnl|my_center|LOCUS_21810 3331 1982 gene locus_tag LOCUS_21820 3331 1982 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047749.1 protein_id gnl|my_center|LOCUS_21820 4359 3337 gene locus_tag LOCUS_21830 gene pdxA 4359 3337 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016238.1 protein_id gnl|my_center|LOCUS_21830 4674 5477 gene locus_tag LOCUS_21840 4674 5477 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969784.1 protein_id gnl|my_center|LOCUS_21840 5481 6245 gene locus_tag LOCUS_21850 5481 6245 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262764.1 protein_id gnl|my_center|LOCUS_21850 6405 7991 gene locus_tag LOCUS_21860 6405 7991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 8002 8970 gene locus_tag LOCUS_21870 8002 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 8967 10382 gene locus_tag LOCUS_21880 8967 10382 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082693.1 protein_id gnl|my_center|LOCUS_21880 10494 11513 gene locus_tag LOCUS_21890 10494 11513 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389119.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence0134 2831 1191 gene locus_tag LOCUS_21900 2831 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 3604 2849 gene locus_tag LOCUS_21910 3604 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 5513 3609 gene locus_tag LOCUS_21920 5513 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 9124 5681 gene locus_tag LOCUS_21930 9124 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 11293 9251 gene locus_tag LOCUS_21940 11293 9251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 >Feature sequence0135 340 819 gene locus_tag LOCUS_21950 340 819 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067975.1 protein_id gnl|my_center|LOCUS_21950 1775 864 gene locus_tag LOCUS_21960 1775 864 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681428.1 protein_id gnl|my_center|LOCUS_21960 2141 2213 gene locus_tag LOCUS_t00080 2141 2213 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2357 3439 gene locus_tag LOCUS_21970 2357 3439 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201892.1 protein_id gnl|my_center|LOCUS_21970 3451 5001 gene locus_tag LOCUS_21980 gene dnaX 3451 5001 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421622.1 protein_id gnl|my_center|LOCUS_21980 5015 5359 gene locus_tag LOCUS_21990 5015 5359 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_21990 5359 5955 gene locus_tag LOCUS_22000 gene recR 5359 5955 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_22000 5997 9137 gene locus_tag LOCUS_22010 5997 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 9137 9829 gene locus_tag LOCUS_22020 9137 9829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 9843 11492 gene locus_tag LOCUS_22030 9843 11492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 >Feature sequence0136 372 971 gene locus_tag LOCUS_22040 372 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 968 2722 gene locus_tag LOCUS_22050 968 2722 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005399341.1 protein_id gnl|my_center|LOCUS_22050 2706 4427 gene locus_tag LOCUS_22060 2706 4427 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358584.1 protein_id gnl|my_center|LOCUS_22060 4437 5018 gene locus_tag LOCUS_22070 4437 5018 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368971.1 protein_id gnl|my_center|LOCUS_22070 5018 5710 gene locus_tag LOCUS_22080 5018 5710 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141952.1 protein_id gnl|my_center|LOCUS_22080 5698 7086 gene locus_tag LOCUS_22090 5698 7086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229353.1 protein_id gnl|my_center|LOCUS_22090 7233 7397 gene locus_tag LOCUS_22100 7233 7397 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895603.1 protein_id gnl|my_center|LOCUS_22100 7709 8479 gene locus_tag LOCUS_22110 7709 8479 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681611.1 protein_id gnl|my_center|LOCUS_22110 8525 8959 gene locus_tag LOCUS_22120 8525 8959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 9097 9327 gene locus_tag LOCUS_22130 9097 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 9553 9765 gene locus_tag LOCUS_22140 9553 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 >Feature sequence0137 20 715 gene locus_tag LOCUS_22150 gene pyrH 20 715 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430597.1 protein_id gnl|my_center|LOCUS_22150 729 1283 gene locus_tag LOCUS_22160 gene frr 729 1283 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430598.1 protein_id gnl|my_center|LOCUS_22160 1453 2226 gene locus_tag LOCUS_22170 1453 2226 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_22170 2226 3032 gene locus_tag LOCUS_22180 2226 3032 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_22180 3043 4176 gene locus_tag LOCUS_22190 3043 4176 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_22190 4180 5238 gene locus_tag LOCUS_22200 gene rseP 4180 5238 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384669.1 protein_id gnl|my_center|LOCUS_22200 5253 6317 gene locus_tag LOCUS_22210 gene ispG 5253 6317 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861462.1 protein_id gnl|my_center|LOCUS_22210 6289 10755 gene locus_tag LOCUS_22220 gene polC 6289 10755 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966712.1 protein_id gnl|my_center|LOCUS_22220 11112 11348 gene locus_tag LOCUS_22230 11112 11348 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837579.1 protein_id gnl|my_center|LOCUS_22230 >Feature sequence0138 184 1167 gene locus_tag LOCUS_22240 184 1167 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_22240 1355 1696 gene locus_tag LOCUS_22250 1355 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 1822 2145 gene locus_tag LOCUS_22260 1822 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 2247 2612 gene locus_tag LOCUS_22270 2247 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 3287 2676 gene locus_tag LOCUS_22280 3287 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 3640 3347 gene locus_tag LOCUS_22290 3640 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 3959 4225 gene locus_tag LOCUS_22300 gene rpsO 3959 4225 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419491.1 protein_id gnl|my_center|LOCUS_22300 4515 6617 gene locus_tag LOCUS_22310 gene pnp 4515 6617 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_22310 6662 8011 gene locus_tag LOCUS_22320 gene mgtE 6662 8011 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_22320 8120 8752 gene locus_tag LOCUS_22330 8120 8752 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263645.1 protein_id gnl|my_center|LOCUS_22330 8733 9404 gene locus_tag LOCUS_22340 8733 9404 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837367.1 protein_id gnl|my_center|LOCUS_22340 9406 10671 gene locus_tag LOCUS_22350 9406 10671 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289573.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence0139 <1 1215 gene locus_tag LOCUS_22360 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949036.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase 1196 3421 gene locus_tag LOCUS_22370 gene priA 1196 3421 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_22370 3408 3932 gene locus_tag LOCUS_22380 gene def 3408 3932 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388617.1 protein_id gnl|my_center|LOCUS_22380 3929 4876 gene locus_tag LOCUS_22390 gene fmt 3929 4876 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_22390 4912 5622 gene locus_tag LOCUS_22400 4912 5622 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383773.1 protein_id gnl|my_center|LOCUS_22400 5625 6959 gene locus_tag LOCUS_22410 gene rsmB 5625 6959 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232068.1 protein_id gnl|my_center|LOCUS_22410 6952 8007 gene locus_tag LOCUS_22420 gene rlmN 6952 8007 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986842.1 protein_id gnl|my_center|LOCUS_22420 8009 8737 gene locus_tag LOCUS_22430 8009 8737 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_22430 8742 10919 gene locus_tag LOCUS_22440 gene pknB 8742 10919 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986841.1 protein_id gnl|my_center|LOCUS_22440 >Feature sequence0140 2179 1610 gene locus_tag LOCUS_22450 2179 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 2766 2374 gene locus_tag LOCUS_22460 2766 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 3470 2790 gene locus_tag LOCUS_22470 3470 2790 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_22470 5259 3520 gene locus_tag LOCUS_22480 5259 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 7017 5299 gene locus_tag LOCUS_22490 7017 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 8963 7344 gene locus_tag LOCUS_22500 8963 7344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 10363 8978 gene locus_tag LOCUS_22510 10363 8978 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860945.1 protein_id gnl|my_center|LOCUS_22510 11171 10779 gene locus_tag LOCUS_22520 gene rpsI 11171 10779 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence0141 <1 1040 gene locus_tag LOCUS_22530 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272582.1:D-alanyl-D-alanine carboxypeptidase family protein 1048 1908 gene locus_tag LOCUS_22540 1048 1908 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888897.1 protein_id gnl|my_center|LOCUS_22540 1959 2753 gene locus_tag LOCUS_22550 1959 2753 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965361.1 protein_id gnl|my_center|LOCUS_22550 2746 3351 gene locus_tag LOCUS_22560 gene scpB 2746 3351 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_22560 3353 3784 gene locus_tag LOCUS_22570 gene dutA 3353 3784 CDS product dUTP diphosphatase DutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245820.1 protein_id gnl|my_center|LOCUS_22570 3756 4601 gene locus_tag LOCUS_22580 3756 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 4609 5856 gene locus_tag LOCUS_22590 4609 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 5943 6638 gene locus_tag LOCUS_22600 5943 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 6754 7371 gene locus_tag LOCUS_22610 6754 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 7358 8251 gene locus_tag LOCUS_22620 7358 8251 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945371.1 protein_id gnl|my_center|LOCUS_22620 8316 8960 gene locus_tag LOCUS_22630 8316 8960 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965593.1 protein_id gnl|my_center|LOCUS_22630 8990 9886 gene locus_tag LOCUS_22640 8990 9886 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294163.1 protein_id gnl|my_center|LOCUS_22640 9979 11094 gene locus_tag LOCUS_22650 9979 11094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence0142 643 1386 gene locus_tag LOCUS_22660 643 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 1427 2458 gene locus_tag LOCUS_22670 1427 2458 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770826.1 protein_id gnl|my_center|LOCUS_22670 2687 3358 gene locus_tag LOCUS_22680 2687 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 3384 3506 gene locus_tag LOCUS_22690 3384 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 4347 3565 gene locus_tag LOCUS_22700 4347 3565 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048211.1 protein_id gnl|my_center|LOCUS_22700 5518 4370 gene locus_tag LOCUS_22710 5518 4370 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681416.1 protein_id gnl|my_center|LOCUS_22710 6589 5780 gene locus_tag LOCUS_22720 6589 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 6799 7644 gene locus_tag LOCUS_22730 6799 7644 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861356.1 protein_id gnl|my_center|LOCUS_22730 9255 7771 gene locus_tag LOCUS_22740 9255 7771 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903237.1 protein_id gnl|my_center|LOCUS_22740 10316 9555 gene locus_tag LOCUS_22750 10316 9555 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023916573.1 protein_id gnl|my_center|LOCUS_22750 10483 11040 gene locus_tag LOCUS_22760 10483 11040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence0143 <1 1066 gene locus_tag LOCUS_22770 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001074497.1:ABC transporter permease 1066 2001 gene locus_tag LOCUS_22780 1066 2001 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964024.1 protein_id gnl|my_center|LOCUS_22780 2009 2665 gene locus_tag LOCUS_22790 gene deoC 2009 2665 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949107.1 protein_id gnl|my_center|LOCUS_22790 2679 3647 gene locus_tag LOCUS_22800 gene add 2679 3647 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948672.1 protein_id gnl|my_center|LOCUS_22800 3690 4877 gene locus_tag LOCUS_22810 gene deoB 3690 4877 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046067.1 protein_id gnl|my_center|LOCUS_22810 4899 5720 gene locus_tag LOCUS_22820 4899 5720 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986426.1 protein_id gnl|my_center|LOCUS_22820 5947 7398 gene locus_tag LOCUS_22830 5947 7398 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250573.1 protein_id gnl|my_center|LOCUS_22830 7408 8121 gene locus_tag LOCUS_22840 7408 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 8133 8498 gene locus_tag LOCUS_22850 8133 8498 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_22850 8517 9668 gene locus_tag LOCUS_22860 8517 9668 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_22860 >Feature sequence0144 731 156 gene locus_tag LOCUS_22870 731 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 1467 814 gene locus_tag LOCUS_22880 1467 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 1838 1488 gene locus_tag LOCUS_22890 1838 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 2493 1888 gene locus_tag LOCUS_22900 2493 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 4986 2752 gene locus_tag LOCUS_22910 gene gyrA 4986 2752 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_22910 6914 5001 gene locus_tag LOCUS_22920 gene gyrB 6914 5001 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868886.1 protein_id gnl|my_center|LOCUS_22920 7280 8329 gene locus_tag LOCUS_22930 7280 8329 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435347.1 protein_id gnl|my_center|LOCUS_22930 10218 8596 gene locus_tag LOCUS_22940 gene groL 10218 8596 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435012.1 protein_id gnl|my_center|LOCUS_22940 10526 10242 gene locus_tag LOCUS_22950 gene groES 10526 10242 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965991.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence0145 288 470 gene locus_tag LOCUS_22960 288 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 588 1556 gene locus_tag LOCUS_22970 gene pfkA 588 1556 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_22970 1558 1932 gene locus_tag LOCUS_22980 1558 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 1929 2357 gene locus_tag LOCUS_22990 1929 2357 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476244.1 protein_id gnl|my_center|LOCUS_22990 2350 3312 gene locus_tag LOCUS_23000 gene dusB 2350 3312 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_23000 3454 4827 gene locus_tag LOCUS_23010 3454 4827 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965627.1 protein_id gnl|my_center|LOCUS_23010 4960 6129 gene locus_tag LOCUS_23020 gene recA 4960 6129 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_23020 6126 6731 gene locus_tag LOCUS_23030 6126 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 6995 8827 gene locus_tag LOCUS_23040 6995 8827 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_23040 8821 10542 gene locus_tag LOCUS_23050 8821 10542 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671107.1 protein_id gnl|my_center|LOCUS_23050 >Feature sequence0146 1006 608 gene locus_tag LOCUS_23060 1006 608 CDS product DUF2634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861039.1 protein_id gnl|my_center|LOCUS_23060 1310 1011 gene locus_tag LOCUS_23070 1310 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2268 1303 gene locus_tag LOCUS_23080 2268 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 2936 2265 gene locus_tag LOCUS_23090 2936 2265 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861037.1 protein_id gnl|my_center|LOCUS_23090 4921 2936 gene locus_tag LOCUS_23100 4921 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 5543 5115 gene locus_tag LOCUS_23110 5543 5115 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429853.1 protein_id gnl|my_center|LOCUS_23110 6034 5558 gene locus_tag LOCUS_23120 6034 5558 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429851.1 protein_id gnl|my_center|LOCUS_23120 7358 6048 gene locus_tag LOCUS_23130 7358 6048 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861032.1 protein_id gnl|my_center|LOCUS_23130 7531 7358 gene locus_tag LOCUS_23140 7531 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 7958 7533 gene locus_tag LOCUS_23150 7958 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 8391 7945 gene locus_tag LOCUS_23160 8391 7945 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861030.1 protein_id gnl|my_center|LOCUS_23160 8762 8391 gene locus_tag LOCUS_23170 8762 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429844.1 protein_id gnl|my_center|LOCUS_23170 9145 8756 gene locus_tag LOCUS_23180 9145 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220482838.1 protein_id gnl|my_center|LOCUS_23180 10241 9147 gene locus_tag LOCUS_23190 10241 9147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 10867 10262 gene locus_tag LOCUS_23200 10867 10262 CDS product phage scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003769956.1 protein_id gnl|my_center|LOCUS_23200 >Feature sequence0147 <1 744 gene locus_tag LOCUS_23210 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003704837.1:(galactosaminyl)2-N,N'-diacetylbacillosaminyl-alpha1-diphospho-di-trans,octa-cis-undecaprenol synthase PglE 777 4166 gene locus_tag LOCUS_23220 777 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 4163 5230 gene locus_tag LOCUS_23230 4163 5230 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212366851.1 protein_id gnl|my_center|LOCUS_23230 5309 7375 gene locus_tag LOCUS_23240 5309 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 7517 8530 gene locus_tag LOCUS_23250 7517 8530 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_23250 8543 9580 gene locus_tag LOCUS_23260 8543 9580 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194087.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence0148 128 754 gene locus_tag LOCUS_23270 128 754 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305518.1 protein_id gnl|my_center|LOCUS_23270 757 2493 gene locus_tag LOCUS_23280 757 2493 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680646.1 protein_id gnl|my_center|LOCUS_23280 2504 4240 gene locus_tag LOCUS_23290 2504 4240 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836806.1 protein_id gnl|my_center|LOCUS_23290 4502 6130 gene locus_tag LOCUS_23300 4502 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 6152 6790 gene locus_tag LOCUS_23310 6152 6790 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477224.1 protein_id gnl|my_center|LOCUS_23310 6793 7533 gene locus_tag LOCUS_23320 6793 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 7545 7892 gene locus_tag LOCUS_23330 7545 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 7892 9082 gene locus_tag LOCUS_23340 7892 9082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 9107 10183 gene locus_tag LOCUS_23350 9107 10183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 >Feature sequence0149 75 959 gene locus_tag LOCUS_23360 75 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 1023 2057 gene locus_tag LOCUS_23370 1023 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 2096 3049 gene locus_tag LOCUS_23380 2096 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 3111 4064 gene locus_tag LOCUS_23390 3111 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 4131 5081 gene locus_tag LOCUS_23400 4131 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 5149 6114 gene locus_tag LOCUS_23410 5149 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 6411 7430 gene locus_tag LOCUS_23420 gene pheS 6411 7430 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_23420 7466 9880 gene locus_tag LOCUS_23430 gene pheT 7466 9880 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_23430 9900 10085 gene locus_tag LOCUS_23440 9900 10085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 10224 10478 gene locus_tag LOCUS_23450 10224 10478 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813972.1 protein_id gnl|my_center|LOCUS_23450 10483 10746 gene locus_tag LOCUS_23460 10483 10746 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812263.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence0150 221 2539 gene locus_tag LOCUS_23470 221 2539 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181512.1 protein_id gnl|my_center|LOCUS_23470 2508 4847 gene locus_tag LOCUS_23480 2508 4847 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181512.1 protein_id gnl|my_center|LOCUS_23480 4857 7235 gene locus_tag LOCUS_23490 4857 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 7232 8299 gene locus_tag LOCUS_23500 7232 8299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 8292 9299 gene locus_tag LOCUS_23510 8292 9299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 9289 9573 gene locus_tag LOCUS_23520 9289 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 9727 10071 gene locus_tag LOCUS_23530 9727 10071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 10077 10361 gene locus_tag LOCUS_23540 10077 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 10590 10766 gene locus_tag LOCUS_23550 10590 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23550 >Feature sequence0151 <1 2056 gene locus_tag LOCUS_23560 <1 2056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964962.1:phosphoribosylformylglycinamidine synthase 2075 3394 gene locus_tag LOCUS_23570 2075 3394 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_23570 3435 4625 gene locus_tag LOCUS_23580 3435 4625 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_23580 4618 5289 gene locus_tag LOCUS_23590 gene cmk 4618 5289 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 protein_id gnl|my_center|LOCUS_23590 5286 6134 gene locus_tag LOCUS_23600 5286 6134 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439450.1 protein_id gnl|my_center|LOCUS_23600 6115 7221 gene locus_tag LOCUS_23610 gene rpsA 6115 7221 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986222.1 protein_id gnl|my_center|LOCUS_23610 7311 8141 gene locus_tag LOCUS_23620 7311 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 8138 9142 gene locus_tag LOCUS_23630 gene cbiG 8138 9142 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948632.1 protein_id gnl|my_center|LOCUS_23630 9144 9398 gene locus_tag LOCUS_23640 9144 9398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 9515 10507 gene locus_tag LOCUS_23650 gene plsX 9515 10507 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_23650 10521 10757 gene locus_tag LOCUS_23660 gene acpP 10521 10757 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence0152 209 1087 gene locus_tag LOCUS_23670 209 1087 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_23670 1095 1727 gene locus_tag LOCUS_23680 gene gmk 1095 1727 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257738.1 protein_id gnl|my_center|LOCUS_23680 1728 1973 gene locus_tag LOCUS_23690 1728 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 2050 3372 gene locus_tag LOCUS_23700 gene rimO 2050 3372 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_23700 3369 3908 gene locus_tag LOCUS_23710 gene pgsA 3369 3908 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_23710 3931 4659 gene locus_tag LOCUS_23720 3931 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 4684 4995 gene locus_tag LOCUS_23730 4684 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 4992 5873 gene locus_tag LOCUS_23740 4992 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 5909 6250 gene locus_tag LOCUS_23750 5909 6250 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963739.1 protein_id gnl|my_center|LOCUS_23750 6250 6879 gene locus_tag LOCUS_23760 6250 6879 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432265.1 protein_id gnl|my_center|LOCUS_23760 6876 7715 gene locus_tag LOCUS_23770 6876 7715 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 protein_id gnl|my_center|LOCUS_23770 7800 8390 gene locus_tag LOCUS_23780 7800 8390 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583465.1 protein_id gnl|my_center|LOCUS_23780 8400 9095 gene locus_tag LOCUS_23790 gene yycF 8400 9095 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701473.1 protein_id gnl|my_center|LOCUS_23790 9100 9576 gene locus_tag LOCUS_23800 gene rlmH 9100 9576 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435703.1 protein_id gnl|my_center|LOCUS_23800 >Feature sequence0153 252 1211 gene locus_tag LOCUS_23810 252 1211 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_23810 2420 1632 gene locus_tag LOCUS_23820 2420 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 3223 2567 gene locus_tag LOCUS_23830 3223 2567 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904004.1 protein_id gnl|my_center|LOCUS_23830 3823 5508 gene locus_tag LOCUS_23840 3823 5508 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904005.1 protein_id gnl|my_center|LOCUS_23840 5590 6936 gene locus_tag LOCUS_23850 5590 6936 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490912.1 protein_id gnl|my_center|LOCUS_23850 7064 7534 gene locus_tag LOCUS_23860 7064 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 7702 8733 gene locus_tag LOCUS_23870 gene hrcA 7702 8733 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_23870 8745 9362 gene locus_tag LOCUS_23880 gene grpE 8745 9362 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence0154 174 1367 gene locus_tag LOCUS_23890 174 1367 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949084.1 protein_id gnl|my_center|LOCUS_23890 1606 2823 gene locus_tag LOCUS_23900 1606 2823 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_23900 2848 3678 gene locus_tag LOCUS_23910 2848 3678 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949086.1 protein_id gnl|my_center|LOCUS_23910 3879 4301 gene locus_tag LOCUS_23920 3879 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 4440 5447 gene locus_tag LOCUS_23930 gene asnA 4440 5447 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641196.1 protein_id gnl|my_center|LOCUS_23930 5519 5827 gene locus_tag LOCUS_23940 5519 5827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 5829 7325 gene locus_tag LOCUS_23950 gene tilS 5829 7325 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434952.1 protein_id gnl|my_center|LOCUS_23950 7328 7867 gene locus_tag LOCUS_23960 gene hpt 7328 7867 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 protein_id gnl|my_center|LOCUS_23960 7867 9693 gene locus_tag LOCUS_23970 gene ftsH 7867 9693 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_23970 >Feature sequence0155 313 1404 gene locus_tag LOCUS_23980 gene gcvT 313 1404 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_23980 1443 1817 gene locus_tag LOCUS_23990 gene gcvH 1443 1817 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723327.1 protein_id gnl|my_center|LOCUS_23990 1963 3276 gene locus_tag LOCUS_24000 gene gcvPA 1963 3276 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678346.1 protein_id gnl|my_center|LOCUS_24000 3276 4700 gene locus_tag LOCUS_24010 gene gcvPB 3276 4700 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679310.1 protein_id gnl|my_center|LOCUS_24010 4824 5822 gene locus_tag LOCUS_24020 4824 5822 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812232.1 protein_id gnl|my_center|LOCUS_24020 5954 7357 gene locus_tag LOCUS_24030 gene lpdA 5954 7357 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582893.1 protein_id gnl|my_center|LOCUS_24030 7511 9190 gene locus_tag LOCUS_24040 7511 9190 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_24040 9206 9838 gene locus_tag LOCUS_24050 9206 9838 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948818.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence0156 737 159 gene locus_tag LOCUS_24060 737 159 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_24060 2434 737 gene locus_tag LOCUS_24070 2434 737 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027392.1 protein_id gnl|my_center|LOCUS_24070 6004 2558 gene locus_tag LOCUS_24080 gene addA 6004 2558 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861079.1 protein_id gnl|my_center|LOCUS_24080 9359 5994 gene locus_tag LOCUS_24090 gene addB 9359 5994 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151864400.1 protein_id gnl|my_center|LOCUS_24090 10592 9444 gene locus_tag LOCUS_24100 10592 9444 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_24100 >Feature sequence0157 828 10 gene locus_tag LOCUS_24110 828 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 2048 819 gene locus_tag LOCUS_24120 2048 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 5667 2110 gene locus_tag LOCUS_24130 5667 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 5845 6372 gene locus_tag LOCUS_24140 5845 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 7107 6397 gene locus_tag LOCUS_24150 7107 6397 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_24150 7868 7116 gene locus_tag LOCUS_24160 7868 7116 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_24160 8827 7868 gene locus_tag LOCUS_24170 8827 7868 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 protein_id gnl|my_center|LOCUS_24170 9716 8835 gene locus_tag LOCUS_24180 9716 8835 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_24180 <10634 9837 gene locus_tag LOCUS_24190 <10634 9837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902269.1:ABC transporter substrate-binding protein >Feature sequence0158 1145 237 gene locus_tag LOCUS_24200 1145 237 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819234.1 protein_id gnl|my_center|LOCUS_24200 1338 1586 gene locus_tag LOCUS_24210 1338 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 2923 1595 gene locus_tag LOCUS_24220 2923 1595 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_24220 4133 3027 gene locus_tag LOCUS_24230 gene aroC 4133 3027 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938193.1 protein_id gnl|my_center|LOCUS_24230 5191 4133 gene locus_tag LOCUS_24240 5191 4133 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368569.1 protein_id gnl|my_center|LOCUS_24240 6250 5315 gene locus_tag LOCUS_24250 gene metA 6250 5315 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_24250 8239 6290 gene locus_tag LOCUS_24260 gene ligA 8239 6290 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_24260 8960 8232 gene locus_tag LOCUS_24270 8960 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 9804 8947 gene locus_tag LOCUS_24280 gene lgt 9804 8947 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924246.1 protein_id gnl|my_center|LOCUS_24280 10441 10208 gene locus_tag LOCUS_24290 10441 10208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 >Feature sequence0159 737 156 gene locus_tag LOCUS_24300 737 156 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669155.1 protein_id gnl|my_center|LOCUS_24300 1460 759 gene locus_tag LOCUS_24310 1460 759 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679272.1 protein_id gnl|my_center|LOCUS_24310 2964 1453 gene locus_tag LOCUS_24320 2964 1453 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679275.1 protein_id gnl|my_center|LOCUS_24320 4697 2973 gene locus_tag LOCUS_24330 4697 2973 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679276.1 protein_id gnl|my_center|LOCUS_24330 6447 4690 gene locus_tag LOCUS_24340 6447 4690 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679279.1 protein_id gnl|my_center|LOCUS_24340 7142 6504 gene locus_tag LOCUS_24350 7142 6504 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679286.1 protein_id gnl|my_center|LOCUS_24350 7750 7388 gene locus_tag LOCUS_24360 gene acpS 7750 7388 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861979.1 protein_id gnl|my_center|LOCUS_24360 8792 7929 gene locus_tag LOCUS_24370 gene lgt 8792 7929 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048192.1 protein_id gnl|my_center|LOCUS_24370 9068 10165 gene locus_tag LOCUS_24380 gene ychF 9068 10165 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_24380 >Feature sequence0160 1476 118 gene locus_tag LOCUS_24390 gene trkA 1476 118 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_24390 1637 1873 gene locus_tag LOCUS_24400 1637 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 2194 1967 gene locus_tag LOCUS_24410 2194 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 2637 2191 gene locus_tag LOCUS_24420 2637 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 3207 2749 gene locus_tag LOCUS_24430 3207 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 3502 3332 gene locus_tag LOCUS_24440 3502 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 3651 3511 gene locus_tag LOCUS_24450 3651 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 3994 3665 gene locus_tag LOCUS_24460 3994 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 4340 4029 gene locus_tag LOCUS_24470 4340 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 4654 4352 gene locus_tag LOCUS_24480 4654 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 4918 4670 gene locus_tag LOCUS_24490 4918 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 9831 4915 gene locus_tag LOCUS_24500 9831 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 10521 9835 gene locus_tag LOCUS_24510 10521 9835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence0161 2331 61 gene locus_tag LOCUS_24520 2331 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 6620 2364 gene locus_tag LOCUS_24530 gene essC 6620 2364 CDS product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436727.1 protein_id gnl|my_center|LOCUS_24530 7813 6620 gene locus_tag LOCUS_24540 gene essB 7813 6620 CDS product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837666.1 protein_id gnl|my_center|LOCUS_24540 8058 7810 gene locus_tag LOCUS_24550 8058 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 8488 8030 gene locus_tag LOCUS_24560 8488 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 8862 8509 gene locus_tag LOCUS_24570 8862 8509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 10026 9010 gene locus_tag LOCUS_24580 10026 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 >Feature sequence0162 1261 272 gene locus_tag LOCUS_24590 1261 272 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836854.1 protein_id gnl|my_center|LOCUS_24590 2144 1281 gene locus_tag LOCUS_24600 2144 1281 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004121002.1 protein_id gnl|my_center|LOCUS_24600 5158 2162 gene locus_tag LOCUS_24610 gene ebgA 5158 2162 CDS product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706828.1 protein_id gnl|my_center|LOCUS_24610 5415 6644 gene locus_tag LOCUS_24620 5415 6644 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114397.1 protein_id gnl|my_center|LOCUS_24620 6712 7557 gene locus_tag LOCUS_24630 6712 7557 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114399.1 protein_id gnl|my_center|LOCUS_24630 7560 8381 gene locus_tag LOCUS_24640 7560 8381 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114402.1 protein_id gnl|my_center|LOCUS_24640 >Feature sequence0163 1 933 gene locus_tag LOCUS_24650 1 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 935 2374 gene locus_tag LOCUS_24660 935 2374 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948739.1 protein_id gnl|my_center|LOCUS_24660 2383 3636 gene locus_tag LOCUS_24670 2383 3636 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948740.1 protein_id gnl|my_center|LOCUS_24670 3638 4012 gene locus_tag LOCUS_24680 3638 4012 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925454.1 protein_id gnl|my_center|LOCUS_24680 4366 4088 gene locus_tag LOCUS_24690 4366 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 4480 5415 gene locus_tag LOCUS_24700 4480 5415 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454768.1 protein_id gnl|my_center|LOCUS_24700 5419 6459 gene locus_tag LOCUS_24710 5419 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 6559 7203 gene locus_tag LOCUS_24720 6559 7203 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459616.1 protein_id gnl|my_center|LOCUS_24720 7906 7340 gene locus_tag LOCUS_24730 gene mdaB 7906 7340 CDS product NAD(P)H-dependent oxidoreductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263120.1 protein_id gnl|my_center|LOCUS_24730 8499 7903 gene locus_tag LOCUS_24740 8499 7903 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263121.1 protein_id gnl|my_center|LOCUS_24740 8662 9102 gene locus_tag LOCUS_24750 8662 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 9190 9645 gene locus_tag LOCUS_24760 9190 9645 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770492.1 protein_id gnl|my_center|LOCUS_24760 9976 9758 gene locus_tag LOCUS_24770 9976 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence0164 190 681 gene locus_tag LOCUS_24780 190 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24780 681 1961 gene locus_tag LOCUS_24790 681 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 1975 2991 gene locus_tag LOCUS_24800 1975 2991 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245542.1 protein_id gnl|my_center|LOCUS_24800 3004 3678 gene locus_tag LOCUS_24810 3004 3678 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967029.1 protein_id gnl|my_center|LOCUS_24810 4274 3771 gene locus_tag LOCUS_24820 4274 3771 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094953.1 protein_id gnl|my_center|LOCUS_24820 5075 4347 gene locus_tag LOCUS_24830 5075 4347 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927987.1 protein_id gnl|my_center|LOCUS_24830 5442 6113 gene locus_tag LOCUS_24840 5442 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 6291 7688 gene locus_tag LOCUS_24850 6291 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329694.1 protein_id gnl|my_center|LOCUS_24850 7715 9844 gene locus_tag LOCUS_24860 7715 9844 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329693.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence0165 2274 289 gene locus_tag LOCUS_24870 2274 289 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459160.1 protein_id gnl|my_center|LOCUS_24870 3032 2283 gene locus_tag LOCUS_24880 3032 2283 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922409.1 protein_id gnl|my_center|LOCUS_24880 4182 3142 gene locus_tag LOCUS_24890 4182 3142 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_24890 4843 4172 gene locus_tag LOCUS_24900 4843 4172 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_24900 4994 4836 gene locus_tag LOCUS_24910 4994 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 5793 5191 gene locus_tag LOCUS_24920 5793 5191 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272615.1 protein_id gnl|my_center|LOCUS_24920 6638 5814 gene locus_tag LOCUS_24930 6638 5814 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809174.1 protein_id gnl|my_center|LOCUS_24930 7475 6642 gene locus_tag LOCUS_24940 7475 6642 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461187.1 protein_id gnl|my_center|LOCUS_24940 8448 7465 gene locus_tag LOCUS_24950 8448 7465 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461571.1 protein_id gnl|my_center|LOCUS_24950 10114 8462 gene locus_tag LOCUS_24960 10114 8462 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461189.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence0166 190 1254 gene locus_tag LOCUS_24970 190 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 1378 4749 gene locus_tag LOCUS_24980 1378 4749 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948403.1 protein_id gnl|my_center|LOCUS_24980 4887 6488 gene locus_tag LOCUS_24990 4887 6488 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948862.1 protein_id gnl|my_center|LOCUS_24990 6497 7453 gene locus_tag LOCUS_25000 6497 7453 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948861.1 protein_id gnl|my_center|LOCUS_25000 7480 8349 gene locus_tag LOCUS_25010 7480 8349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989353.1 protein_id gnl|my_center|LOCUS_25010 8342 9352 gene locus_tag LOCUS_25020 8342 9352 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966899.1 protein_id gnl|my_center|LOCUS_25020 9342 10325 gene locus_tag LOCUS_25030 9342 10325 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544125.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence0167 713 447 gene locus_tag LOCUS_25040 713 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 3523 1355 gene locus_tag LOCUS_25050 3523 1355 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423561.1 protein_id gnl|my_center|LOCUS_25050 5058 3541 gene locus_tag LOCUS_25060 5058 3541 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814148.1 protein_id gnl|my_center|LOCUS_25060 6324 5071 gene locus_tag LOCUS_25070 6324 5071 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_25070 7308 6334 gene locus_tag LOCUS_25080 7308 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 8062 7310 gene locus_tag LOCUS_25090 8062 7310 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616588.1 protein_id gnl|my_center|LOCUS_25090 9557 8079 gene locus_tag LOCUS_25100 gene cls 9557 8079 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571549.1 protein_id gnl|my_center|LOCUS_25100 10343 9678 gene locus_tag LOCUS_25110 10343 9678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 >Feature sequence0168 722 186 gene locus_tag LOCUS_25120 722 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 1205 1348 gene locus_tag LOCUS_25130 1205 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 1678 2046 gene locus_tag LOCUS_25140 1678 2046 CDS product EXLDI protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262962.1 protein_id gnl|my_center|LOCUS_25140 2673 2146 gene locus_tag LOCUS_25150 2673 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 3868 2705 gene locus_tag LOCUS_25160 3868 2705 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_25160 4960 3878 gene locus_tag LOCUS_25170 gene serC 4960 3878 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_25170 6719 5031 gene locus_tag LOCUS_25180 gene ilvB 6719 5031 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_25180 8404 6728 gene locus_tag LOCUS_25190 gene ilvD 8404 6728 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_25190 9524 8439 gene locus_tag LOCUS_25200 gene leuB 9524 8439 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861060.1 protein_id gnl|my_center|LOCUS_25200 9983 9855 gene locus_tag LOCUS_25210 9983 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 10130 10057 gene locus_tag LOCUS_t00090 10130 10057 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 10210 10136 gene locus_tag LOCUS_t00100 10210 10136 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0169 <1 555 gene locus_tag LOCUS_25220 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681416.1:double-cubane-cluster-containing anaerobic reductase 567 1352 gene locus_tag LOCUS_25230 567 1352 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048211.1 protein_id gnl|my_center|LOCUS_25230 1451 2170 gene locus_tag LOCUS_25240 1451 2170 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138570.1 protein_id gnl|my_center|LOCUS_25240 2163 4745 gene locus_tag LOCUS_25250 gene mprF 2163 4745 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733236.1 protein_id gnl|my_center|LOCUS_25250 6172 4823 gene locus_tag LOCUS_25260 6172 4823 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_25260 7489 6236 gene locus_tag LOCUS_25270 gene hemW 7489 6236 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016482.1 protein_id gnl|my_center|LOCUS_25270 9045 7555 gene locus_tag LOCUS_25280 gene ypwA 9045 7555 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215104.1 protein_id gnl|my_center|LOCUS_25280 9947 9237 gene locus_tag LOCUS_25290 9947 9237 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028388.1 protein_id gnl|my_center|LOCUS_25290 >Feature sequence0170 303 1526 gene locus_tag LOCUS_25300 gene rpoD 303 1526 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861220.1 protein_id gnl|my_center|LOCUS_25300 1523 2182 gene locus_tag LOCUS_25310 1523 2182 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_25310 2212 2820 gene locus_tag LOCUS_25320 2212 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25320 2830 3927 gene locus_tag LOCUS_25330 2830 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 4019 4285 gene locus_tag LOCUS_25340 4019 4285 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_25340 4390 4632 gene locus_tag LOCUS_25350 4390 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 4722 5264 gene locus_tag LOCUS_25360 gene ispF 4722 5264 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963756.1 protein_id gnl|my_center|LOCUS_25360 5276 6685 gene locus_tag LOCUS_25370 gene cysS 5276 6685 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_25370 6670 7119 gene locus_tag LOCUS_25380 6670 7119 CDS product ribonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860630.1 protein_id gnl|my_center|LOCUS_25380 7116 7871 gene locus_tag LOCUS_25390 gene rlmB 7116 7871 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_25390 7861 8814 gene locus_tag LOCUS_25400 7861 8814 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715339.1 protein_id gnl|my_center|LOCUS_25400 8933 9790 gene locus_tag LOCUS_25410 8933 9790 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402124.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence0171 518 72 gene locus_tag LOCUS_25420 518 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 740 1261 gene locus_tag LOCUS_25430 740 1261 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_25430 1472 3199 gene locus_tag LOCUS_25440 1472 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 3199 4257 gene locus_tag LOCUS_25450 3199 4257 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918104.1 protein_id gnl|my_center|LOCUS_25450 4271 5302 gene locus_tag LOCUS_25460 4271 5302 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836504.1 protein_id gnl|my_center|LOCUS_25460 5302 5706 gene locus_tag LOCUS_25470 5302 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 7643 5778 gene locus_tag LOCUS_25480 7643 5778 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861246.1 protein_id gnl|my_center|LOCUS_25480 8385 7630 gene locus_tag LOCUS_25490 8385 7630 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439795.1 protein_id gnl|my_center|LOCUS_25490 9528 8536 gene locus_tag LOCUS_25500 9528 8536 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765327.1 protein_id gnl|my_center|LOCUS_25500 10204 9518 gene locus_tag LOCUS_25510 10204 9518 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429090.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence0172 632 489 gene locus_tag LOCUS_25520 632 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 1230 871 gene locus_tag LOCUS_25530 1230 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 1696 1289 gene locus_tag LOCUS_25540 1696 1289 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227398.1 protein_id gnl|my_center|LOCUS_25540 2435 1689 gene locus_tag LOCUS_25550 2435 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 3328 2444 gene locus_tag LOCUS_25560 3328 2444 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765594.1 protein_id gnl|my_center|LOCUS_25560 4578 3337 gene locus_tag LOCUS_25570 4578 3337 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937602.1 protein_id gnl|my_center|LOCUS_25570 5725 4688 gene locus_tag LOCUS_25580 5725 4688 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194087.1 protein_id gnl|my_center|LOCUS_25580 6751 5738 gene locus_tag LOCUS_25590 6751 5738 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_25590 8973 6895 gene locus_tag LOCUS_25600 8973 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 >Feature sequence0173 911 144 gene locus_tag LOCUS_25610 911 144 CDS product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213043995.1 protein_id gnl|my_center|LOCUS_25610 1168 935 gene locus_tag LOCUS_25620 1168 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 1426 1217 gene locus_tag LOCUS_25630 1426 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 1639 1863 gene locus_tag LOCUS_25640 1639 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 3541 2579 gene locus_tag LOCUS_25650 3541 2579 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_25650 3964 5571 gene locus_tag LOCUS_25660 3964 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 5582 6250 gene locus_tag LOCUS_25670 gene narL 5582 6250 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705476.1 protein_id gnl|my_center|LOCUS_25670 6276 7061 gene locus_tag LOCUS_25680 6276 7061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 7070 7516 gene locus_tag LOCUS_25690 7070 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 7509 8699 gene locus_tag LOCUS_25700 7509 8699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 8696 9781 gene locus_tag LOCUS_25710 8696 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 >Feature sequence0174 1091 3 gene locus_tag LOCUS_25720 gene aroB 1091 3 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262699.1 protein_id gnl|my_center|LOCUS_25720 1917 1159 gene locus_tag LOCUS_25730 1917 1159 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897805.1 protein_id gnl|my_center|LOCUS_25730 2506 1922 gene locus_tag LOCUS_25740 2506 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 3200 2511 gene locus_tag LOCUS_25750 3200 2511 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_25750 4583 3210 gene locus_tag LOCUS_25760 4583 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 5264 4845 gene locus_tag LOCUS_25770 5264 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 6301 5342 gene locus_tag LOCUS_25780 6301 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 6740 6342 gene locus_tag LOCUS_25790 gene mgsA 6740 6342 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230640.1 protein_id gnl|my_center|LOCUS_25790 8016 6868 gene locus_tag LOCUS_25800 gene rodA 8016 6868 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_25800 <10151 8029 gene locus_tag LOCUS_25810 <10151 8029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942721.1:penicillin-binding protein 2 >Feature sequence0175 295 1803 gene locus_tag LOCUS_25820 295 1803 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948022.1 protein_id gnl|my_center|LOCUS_25820 1805 2353 gene locus_tag LOCUS_25830 1805 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 2638 3156 gene locus_tag LOCUS_25840 gene trmL 2638 3156 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 protein_id gnl|my_center|LOCUS_25840 3895 3122 gene locus_tag LOCUS_25850 3895 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 5517 4120 gene locus_tag LOCUS_25860 5517 4120 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_25860 6227 5514 gene locus_tag LOCUS_25870 6227 5514 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_25870 8597 6243 gene locus_tag LOCUS_25880 8597 6243 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_25880 8829 10091 gene locus_tag LOCUS_25890 8829 10091 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475476.1 protein_id gnl|my_center|LOCUS_25890 >Feature sequence0176 966 322 gene locus_tag LOCUS_25900 gene atoA 966 322 CDS product acetate CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339064.1 protein_id gnl|my_center|LOCUS_25900 1616 966 gene locus_tag LOCUS_25910 1616 966 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902988.1 protein_id gnl|my_center|LOCUS_25910 2800 1613 gene locus_tag LOCUS_25920 2800 1613 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921819.1 protein_id gnl|my_center|LOCUS_25920 3275 4051 gene locus_tag LOCUS_25930 3275 4051 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 protein_id gnl|my_center|LOCUS_25930 4121 4957 gene locus_tag LOCUS_25940 4121 4957 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901831.1 protein_id gnl|my_center|LOCUS_25940 5132 6286 gene locus_tag LOCUS_25950 5132 6286 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_25950 6313 7095 gene locus_tag LOCUS_25960 6313 7095 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965997.1 protein_id gnl|my_center|LOCUS_25960 7109 8161 gene locus_tag LOCUS_25970 7109 8161 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 protein_id gnl|my_center|LOCUS_25970 >Feature sequence0177 653 243 gene locus_tag LOCUS_25980 653 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 1810 656 gene locus_tag LOCUS_25990 1810 656 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437815.1 protein_id gnl|my_center|LOCUS_25990 2934 1813 gene locus_tag LOCUS_26000 2934 1813 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_26000 3819 2938 gene locus_tag LOCUS_26010 gene ftsX 3819 2938 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732506.1 protein_id gnl|my_center|LOCUS_26010 4498 3812 gene locus_tag LOCUS_26020 gene ftsE 4498 3812 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_26020 5358 4573 gene locus_tag LOCUS_26030 5358 4573 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837680.1 protein_id gnl|my_center|LOCUS_26030 7207 5591 gene locus_tag LOCUS_26040 7207 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 9034 7295 gene locus_tag LOCUS_26050 gene dnaG 9034 7295 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_26050 9943 9302 gene locus_tag LOCUS_26060 9943 9302 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905410.1 protein_id gnl|my_center|LOCUS_26060 >Feature sequence0178 4773 409 gene locus_tag LOCUS_26070 gene essC 4773 409 CDS product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549287.1 protein_id gnl|my_center|LOCUS_26070 5938 4790 gene locus_tag LOCUS_26080 gene essB 5938 4790 CDS product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240338.1 protein_id gnl|my_center|LOCUS_26080 6185 5925 gene locus_tag LOCUS_26090 6185 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 6607 6185 gene locus_tag LOCUS_26100 6607 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 9516 6607 gene locus_tag LOCUS_26110 9516 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 9707 9573 gene locus_tag LOCUS_26120 9707 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 >Feature sequence0179 3500 648 gene locus_tag LOCUS_26130 3500 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 5139 3838 gene locus_tag LOCUS_26140 5139 3838 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_26140 5803 5606 gene locus_tag LOCUS_26150 5803 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 7171 5945 gene locus_tag LOCUS_26160 7171 5945 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404919.1 protein_id gnl|my_center|LOCUS_26160 7929 7186 gene locus_tag LOCUS_26170 7929 7186 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_26170 9340 7916 gene locus_tag LOCUS_26180 9340 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 9983 9798 gene locus_tag LOCUS_26190 9983 9798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 >Feature sequence0180 207 788 gene locus_tag LOCUS_26200 207 788 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420269.1 protein_id gnl|my_center|LOCUS_26200 965 2437 gene locus_tag LOCUS_26210 965 2437 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393430.1 protein_id gnl|my_center|LOCUS_26210 3047 2475 gene locus_tag LOCUS_26220 3047 2475 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943862.1 protein_id gnl|my_center|LOCUS_26220 3216 5378 gene locus_tag LOCUS_26230 3216 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 5531 7867 gene locus_tag LOCUS_26240 5531 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 7983 9275 gene locus_tag LOCUS_26250 7983 9275 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_26250 9427 9513 gene locus_tag LOCUS_t00110 9427 9513 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9571 9659 gene locus_tag LOCUS_t00120 9571 9659 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0181 1786 1100 gene locus_tag LOCUS_26260 1786 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 2909 1968 gene locus_tag LOCUS_26270 2909 1968 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_26270 4161 2920 gene locus_tag LOCUS_26280 4161 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 5258 4158 gene locus_tag LOCUS_26290 5258 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 5550 5284 gene locus_tag LOCUS_26300 5550 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 6904 5552 gene locus_tag LOCUS_26310 6904 5552 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103658.1 protein_id gnl|my_center|LOCUS_26310 7746 7054 gene locus_tag LOCUS_26320 7746 7054 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_26320 7885 8943 gene locus_tag LOCUS_26330 7885 8943 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence0182 2338 281 gene locus_tag LOCUS_26340 2338 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 3554 2640 gene locus_tag LOCUS_26350 3554 2640 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_26350 4726 3551 gene locus_tag LOCUS_26360 4726 3551 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161951924.1 protein_id gnl|my_center|LOCUS_26360 5704 4745 gene locus_tag LOCUS_26370 5704 4745 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707197.1 protein_id gnl|my_center|LOCUS_26370 7190 5685 gene locus_tag LOCUS_26380 gene gguA 7190 5685 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_26380 8396 7227 gene locus_tag LOCUS_26390 8396 7227 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243020.1 protein_id gnl|my_center|LOCUS_26390 9247 8435 gene locus_tag LOCUS_26400 9247 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 >Feature sequence0183 356 988 gene locus_tag LOCUS_26410 356 988 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728647.1 protein_id gnl|my_center|LOCUS_26410 1418 2200 gene locus_tag LOCUS_26420 1418 2200 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_26420 2311 3300 gene locus_tag LOCUS_26430 2311 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 3294 3788 gene locus_tag LOCUS_26440 3294 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 3869 5098 gene locus_tag LOCUS_26450 3869 5098 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_26450 5345 9100 gene locus_tag LOCUS_26460 5345 9100 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_26460 >Feature sequence0184 878 279 gene locus_tag LOCUS_26470 878 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 1265 942 gene locus_tag LOCUS_26480 1265 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 2242 1292 gene locus_tag LOCUS_26490 2242 1292 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438310.1 protein_id gnl|my_center|LOCUS_26490 3139 2255 gene locus_tag LOCUS_26500 gene truB 3139 2255 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_26500 4079 3132 gene locus_tag LOCUS_26510 4079 3132 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016831.1 protein_id gnl|my_center|LOCUS_26510 4443 4072 gene locus_tag LOCUS_26520 gene rbfA 4443 4072 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_26520 7357 4457 gene locus_tag LOCUS_26530 7357 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 7666 7361 gene locus_tag LOCUS_26540 7666 7361 CDS product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020853.1 protein_id gnl|my_center|LOCUS_26540 7970 7653 gene locus_tag LOCUS_26550 7970 7653 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419469.1 protein_id gnl|my_center|LOCUS_26550 9102 7915 gene locus_tag LOCUS_26560 gene nusA 9102 7915 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_26560 9585 9121 gene locus_tag LOCUS_26570 9585 9121 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_26570 >Feature sequence0185 4828 1271 gene locus_tag LOCUS_26580 4828 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 5014 5544 gene locus_tag LOCUS_26590 5014 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 6277 5567 gene locus_tag LOCUS_26600 6277 5567 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_26600 7038 6286 gene locus_tag LOCUS_26610 7038 6286 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017145.1 protein_id gnl|my_center|LOCUS_26610 7997 7038 gene locus_tag LOCUS_26620 7997 7038 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 protein_id gnl|my_center|LOCUS_26620 8886 8005 gene locus_tag LOCUS_26630 8886 8005 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_26630 <9792 9007 gene locus_tag LOCUS_26640 <9792 9007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902269.1:ABC transporter substrate-binding protein >Feature sequence0186 <1 1337 gene locus_tag LOCUS_26650 <1 1337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533633.1:sugar ABC transporter ATP-binding protein 1341 2498 gene locus_tag LOCUS_26660 gene gguB 1341 2498 CDS product sugar ABC transporter permease GguB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311699.1 protein_id gnl|my_center|LOCUS_26660 2562 3731 gene locus_tag LOCUS_26670 2562 3731 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608374.1 protein_id gnl|my_center|LOCUS_26670 3724 5139 gene locus_tag LOCUS_26680 gene nhaC 3724 5139 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696045.1 protein_id gnl|my_center|LOCUS_26680 5260 5655 gene locus_tag LOCUS_26690 5260 5655 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_26690 5655 6170 gene locus_tag LOCUS_26700 5655 6170 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641270.1 protein_id gnl|my_center|LOCUS_26700 6277 7464 gene locus_tag LOCUS_26710 6277 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 7479 8420 gene locus_tag LOCUS_26720 7479 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 8428 8835 gene locus_tag LOCUS_26730 8428 8835 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230049.1 protein_id gnl|my_center|LOCUS_26730 >Feature sequence0187 857 78 gene locus_tag LOCUS_26740 gene proC 857 78 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048171.1 protein_id gnl|my_center|LOCUS_26740 1778 867 gene locus_tag LOCUS_26750 1778 867 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775137.1 protein_id gnl|my_center|LOCUS_26750 2425 1775 gene locus_tag LOCUS_26760 2425 1775 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170003.1 protein_id gnl|my_center|LOCUS_26760 5099 2520 gene locus_tag LOCUS_26770 gene xdh 5099 2520 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891588.1 protein_id gnl|my_center|LOCUS_26770 7841 5616 gene locus_tag LOCUS_26780 7841 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 8309 7896 gene locus_tag LOCUS_26790 8309 7896 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_26790 8798 8319 gene locus_tag LOCUS_26800 8798 8319 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_26800 9138 8935 gene locus_tag LOCUS_26810 9138 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 9623 9189 gene locus_tag LOCUS_26820 9623 9189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 >Feature sequence0188 112 702 gene locus_tag LOCUS_26830 gene ruvA 112 702 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830895.1 protein_id gnl|my_center|LOCUS_26830 720 1718 gene locus_tag LOCUS_26840 gene ruvB 720 1718 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_26840 1721 3970 gene locus_tag LOCUS_26850 1721 3970 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 protein_id gnl|my_center|LOCUS_26850 4039 4485 gene locus_tag LOCUS_26860 4039 4485 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416968.1 protein_id gnl|my_center|LOCUS_26860 4472 5095 gene locus_tag LOCUS_26870 4472 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021681.1 protein_id gnl|my_center|LOCUS_26870 5097 5591 gene locus_tag LOCUS_26880 5097 5591 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166043.1 protein_id gnl|my_center|LOCUS_26880 5609 6634 gene locus_tag LOCUS_26890 gene kdgK1 5609 6634 CDS product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902071.1 protein_id gnl|my_center|LOCUS_26890 6776 7669 gene locus_tag LOCUS_26900 6776 7669 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_26900 7669 9066 gene locus_tag LOCUS_26910 gene gltA 7669 9066 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence0189 125 1834 gene locus_tag LOCUS_26920 125 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 1831 3372 gene locus_tag LOCUS_26930 1831 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 3441 4313 gene locus_tag LOCUS_26940 3441 4313 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_26940 4318 5118 gene locus_tag LOCUS_26950 4318 5118 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819520.1 protein_id gnl|my_center|LOCUS_26950 5122 6921 gene locus_tag LOCUS_26960 5122 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 6994 8319 gene locus_tag LOCUS_26970 6994 8319 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152358733.1 protein_id gnl|my_center|LOCUS_26970 8749 9435 gene locus_tag LOCUS_26980 8749 9435 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970639.1 protein_id gnl|my_center|LOCUS_26980 >Feature sequence0190 1057 548 gene locus_tag LOCUS_26990 gene purE 1057 548 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_26990 3140 1068 gene locus_tag LOCUS_27000 3140 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 3529 3104 gene locus_tag LOCUS_27010 3529 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 3978 3526 gene locus_tag LOCUS_27020 3978 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 4129 3980 gene locus_tag LOCUS_27030 4129 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 4816 4145 gene locus_tag LOCUS_27040 gene pyrE 4816 4145 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_27040 5737 4832 gene locus_tag LOCUS_27050 5737 4832 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_27050 6498 5734 gene locus_tag LOCUS_27060 6498 5734 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989827.1 protein_id gnl|my_center|LOCUS_27060 7409 6501 gene locus_tag LOCUS_27070 gene pyrF 7409 6501 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_27070 7501 8238 gene locus_tag LOCUS_27080 7501 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 8405 9193 gene locus_tag LOCUS_27090 8405 9193 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_27090 >Feature sequence0191 1261 872 gene locus_tag LOCUS_27100 1261 872 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537677.1 protein_id gnl|my_center|LOCUS_27100 2458 1331 gene locus_tag LOCUS_27110 2458 1331 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987004.1 protein_id gnl|my_center|LOCUS_27110 3468 2512 gene locus_tag LOCUS_27120 3468 2512 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545190.1 protein_id gnl|my_center|LOCUS_27120 5395 3461 gene locus_tag LOCUS_27130 5395 3461 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898889.1 protein_id gnl|my_center|LOCUS_27130 5653 6000 gene locus_tag LOCUS_27140 5653 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 6799 6200 gene locus_tag LOCUS_27150 6799 6200 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130597.1 protein_id gnl|my_center|LOCUS_27150 6972 7053 gene locus_tag LOCUS_t00130 6972 7053 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7196 8545 gene locus_tag LOCUS_27160 7196 8545 CDS product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869156.1 protein_id gnl|my_center|LOCUS_27160 8721 9569 gene locus_tag LOCUS_27170 8721 9569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 >Feature sequence0192 1014 1445 gene locus_tag LOCUS_27180 1014 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27180 6441 2818 gene locus_tag LOCUS_27190 6441 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 7116 6805 gene locus_tag LOCUS_27200 7116 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 8654 7761 gene locus_tag LOCUS_27210 8654 7761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 8861 8658 gene locus_tag LOCUS_27220 8861 8658 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885335.1 protein_id gnl|my_center|LOCUS_27220 9408 9052 gene locus_tag LOCUS_27230 gene mobC 9408 9052 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860794.1 protein_id gnl|my_center|LOCUS_27230 >Feature sequence0193 299 30 gene locus_tag LOCUS_27240 299 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 2688 523 gene locus_tag LOCUS_27250 2688 523 CDS product DUF6449 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110941629.1 protein_id gnl|my_center|LOCUS_27250 3562 2663 gene locus_tag LOCUS_27260 3562 2663 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_27260 3939 3559 gene locus_tag LOCUS_27270 3939 3559 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_27270 4093 5928 gene locus_tag LOCUS_27280 gene typA 4093 5928 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_27280 6095 9061 gene locus_tag LOCUS_27290 6095 9061 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880372.1 protein_id gnl|my_center|LOCUS_27290 >Feature sequence0194 33 254 gene locus_tag LOCUS_27300 33 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 500 1288 gene locus_tag LOCUS_27310 gene rpsB 500 1288 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_27310 1373 2323 gene locus_tag LOCUS_27320 gene tsf 1373 2323 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_27320 2394 2618 gene locus_tag LOCUS_27330 2394 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 2692 3345 gene locus_tag LOCUS_27340 2692 3345 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_27340 3388 4776 gene locus_tag LOCUS_27350 3388 4776 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_27350 4769 5632 gene locus_tag LOCUS_27360 4769 5632 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681080.1 protein_id gnl|my_center|LOCUS_27360 6976 5741 gene locus_tag LOCUS_27370 6976 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 7288 9255 gene locus_tag LOCUS_27380 gene uvrB 7288 9255 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891935.1 protein_id gnl|my_center|LOCUS_27380 >Feature sequence0195 210 1187 gene locus_tag LOCUS_27390 210 1187 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037097.1 protein_id gnl|my_center|LOCUS_27390 1209 1559 gene locus_tag LOCUS_27400 1209 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 1569 4196 gene locus_tag LOCUS_27410 gene polA 1569 4196 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048038.1 protein_id gnl|my_center|LOCUS_27410 4205 4813 gene locus_tag LOCUS_27420 gene coaE 4205 4813 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014305.1 protein_id gnl|my_center|LOCUS_27420 5132 5929 gene locus_tag LOCUS_27430 5132 5929 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_27430 6161 7741 gene locus_tag LOCUS_27440 6161 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 8069 8947 gene locus_tag LOCUS_27450 8069 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 >Feature sequence0196 1413 727 gene locus_tag LOCUS_27460 1413 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 2030 1413 gene locus_tag LOCUS_27470 2030 1413 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_27470 3460 2033 gene locus_tag LOCUS_27480 3460 2033 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869268.1 protein_id gnl|my_center|LOCUS_27480 5237 3471 gene locus_tag LOCUS_27490 5237 3471 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_27490 5818 5237 gene locus_tag LOCUS_27500 5818 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 6192 5884 gene locus_tag LOCUS_27510 6192 5884 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_27510 6628 6203 gene locus_tag LOCUS_27520 6628 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 8588 6663 gene locus_tag LOCUS_27530 8588 6663 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_27530 >Feature sequence0197 545 1543 gene locus_tag LOCUS_27540 545 1543 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 protein_id gnl|my_center|LOCUS_27540 1631 2116 gene locus_tag LOCUS_27550 1631 2116 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389893.1 protein_id gnl|my_center|LOCUS_27550 2118 3401 gene locus_tag LOCUS_27560 2118 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27560 3471 4220 gene locus_tag LOCUS_27570 3471 4220 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113203.1 protein_id gnl|my_center|LOCUS_27570 4234 4698 gene locus_tag LOCUS_27580 4234 4698 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463773.1 protein_id gnl|my_center|LOCUS_27580 4725 5723 gene locus_tag LOCUS_27590 gene pdhA 4725 5723 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_27590 5720 6697 gene locus_tag LOCUS_27600 5720 6697 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_27600 6711 7925 gene locus_tag LOCUS_27610 6711 7925 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263119.1 protein_id gnl|my_center|LOCUS_27610 7942 9345 gene locus_tag LOCUS_27620 gene lpdA 7942 9345 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949165.1 protein_id gnl|my_center|LOCUS_27620 >Feature sequence0198 <1 695 gene locus_tag LOCUS_27630 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963596.1:2-isopropylmalate synthase 774 1766 gene locus_tag LOCUS_27640 774 1766 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775198.1 protein_id gnl|my_center|LOCUS_27640 1763 2641 gene locus_tag LOCUS_27650 1763 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 2650 3630 gene locus_tag LOCUS_27660 2650 3630 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003836797.1 protein_id gnl|my_center|LOCUS_27660 3630 5063 gene locus_tag LOCUS_27670 3630 5063 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202144.1 protein_id gnl|my_center|LOCUS_27670 5123 6130 gene locus_tag LOCUS_27680 5123 6130 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_27680 6143 7375 gene locus_tag LOCUS_27690 6143 7375 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922136.1 protein_id gnl|my_center|LOCUS_27690 7372 8307 gene locus_tag LOCUS_27700 gene rfbN 7372 8307 CDS product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 protein_id gnl|my_center|LOCUS_27700 8310 9002 gene locus_tag LOCUS_27710 8310 9002 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899987.1 protein_id gnl|my_center|LOCUS_27710 8999 9358 gene locus_tag LOCUS_27720 8999 9358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 >Feature sequence0199 1080 220 gene locus_tag LOCUS_27730 gene dinD 1080 220 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460715.1 protein_id gnl|my_center|LOCUS_27730 2921 1125 gene locus_tag LOCUS_27740 2921 1125 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058062.1 protein_id gnl|my_center|LOCUS_27740 4237 2921 gene locus_tag LOCUS_27750 4237 2921 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262887.1 protein_id gnl|my_center|LOCUS_27750 5487 4234 gene locus_tag LOCUS_27760 5487 4234 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101621619.1 protein_id gnl|my_center|LOCUS_27760 8506 5480 gene locus_tag LOCUS_27770 8506 5480 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058064.1 protein_id gnl|my_center|LOCUS_27770 8742 8527 gene locus_tag LOCUS_27780 8742 8527 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994645.1 protein_id gnl|my_center|LOCUS_27780 8972 8841 gene locus_tag LOCUS_27790 8972 8841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 >Feature sequence0200 471 866 gene locus_tag LOCUS_27800 gene mgsA 471 866 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230640.1 protein_id gnl|my_center|LOCUS_27800 872 1855 gene locus_tag LOCUS_27810 872 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 1940 2359 gene locus_tag LOCUS_27820 1940 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 2538 3929 gene locus_tag LOCUS_27830 2538 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 3938 4618 gene locus_tag LOCUS_27840 3938 4618 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965420.1 protein_id gnl|my_center|LOCUS_27840 4642 5172 gene locus_tag LOCUS_27850 4642 5172 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565171.1 protein_id gnl|my_center|LOCUS_27850 5175 5924 gene locus_tag LOCUS_27860 5175 5924 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358628.1 protein_id gnl|my_center|LOCUS_27860 5935 7023 gene locus_tag LOCUS_27870 gene aroB 5935 7023 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021364.1 protein_id gnl|my_center|LOCUS_27870 7008 7508 gene locus_tag LOCUS_27880 gene lspA 7008 7508 CDS product lipoprotein signal peptidase LspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642181.1 protein_id gnl|my_center|LOCUS_27880 7526 8440 gene locus_tag LOCUS_27890 7526 8440 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965413.1 protein_id gnl|my_center|LOCUS_27890 8614 9240 gene locus_tag LOCUS_27900 8614 9240 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_27900 >Feature sequence0201 1423 764 gene locus_tag LOCUS_27910 1423 764 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261882.1 protein_id gnl|my_center|LOCUS_27910 1628 1506 gene locus_tag LOCUS_27920 1628 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 3154 2060 gene locus_tag LOCUS_27930 3154 2060 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986532.1 protein_id gnl|my_center|LOCUS_27930 4274 3357 gene locus_tag LOCUS_27940 4274 3357 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188032.1 protein_id gnl|my_center|LOCUS_27940 4706 4293 gene locus_tag LOCUS_27950 4706 4293 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_27950 5600 4854 gene locus_tag LOCUS_27960 gene gpmA 5600 4854 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670958.1 protein_id gnl|my_center|LOCUS_27960 6277 5810 gene locus_tag LOCUS_27970 6277 5810 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896783.1 protein_id gnl|my_center|LOCUS_27970 6825 6430 gene locus_tag LOCUS_27980 gene mscL 6825 6430 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658680.1 protein_id gnl|my_center|LOCUS_27980 7797 7057 gene locus_tag LOCUS_27990 7797 7057 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837550.1 protein_id gnl|my_center|LOCUS_27990 8497 7799 gene locus_tag LOCUS_28000 8497 7799 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263654.1 protein_id gnl|my_center|LOCUS_28000 9211 8510 gene locus_tag LOCUS_28010 9211 8510 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907938.1 protein_id gnl|my_center|LOCUS_28010 >Feature sequence0202 1922 642 gene locus_tag LOCUS_28020 1922 642 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_28020 2892 1915 gene locus_tag LOCUS_28030 gene miaA 2892 1915 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_28030 4847 2889 gene locus_tag LOCUS_28040 gene mutL 4847 2889 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861409.1 protein_id gnl|my_center|LOCUS_28040 7524 4882 gene locus_tag LOCUS_28050 gene mutS 7524 4882 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_28050 8952 7525 gene locus_tag LOCUS_28060 gene miaB 8952 7525 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_28060 <9468 8963 gene locus_tag LOCUS_28070 <9468 8963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905169.1:5-formyltetrahydrofolate cyclo-ligase >Feature sequence0203 457 146 gene locus_tag LOCUS_28080 457 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 608 826 gene locus_tag LOCUS_28090 608 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 895 1812 gene locus_tag LOCUS_28100 895 1812 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_28100 1919 2914 gene locus_tag LOCUS_28110 1919 2914 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812002.1 protein_id gnl|my_center|LOCUS_28110 2926 3945 gene locus_tag LOCUS_28120 2926 3945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812003.1 protein_id gnl|my_center|LOCUS_28120 3938 4990 gene locus_tag LOCUS_28130 3938 4990 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812005.1 protein_id gnl|my_center|LOCUS_28130 5036 6694 gene locus_tag LOCUS_28140 5036 6694 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812007.1 protein_id gnl|my_center|LOCUS_28140 6726 8378 gene locus_tag LOCUS_28150 6726 8378 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812007.1 protein_id gnl|my_center|LOCUS_28150 8907 8674 gene locus_tag LOCUS_28160 8907 8674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 9209 8904 gene locus_tag LOCUS_28170 9209 8904 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811036.1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence0204 331 1728 gene locus_tag LOCUS_28180 331 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 2165 2767 gene locus_tag LOCUS_28190 2165 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 2767 3345 gene locus_tag LOCUS_28200 2767 3345 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272229.1 protein_id gnl|my_center|LOCUS_28200 3356 7009 gene locus_tag LOCUS_28210 gene brxC 3356 7009 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065383.1 protein_id gnl|my_center|LOCUS_28210 >Feature sequence0205 81 1949 gene locus_tag LOCUS_28220 gene dnaK 81 1949 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_28220 1965 3074 gene locus_tag LOCUS_28230 gene dnaJ 1965 3074 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565745.1 protein_id gnl|my_center|LOCUS_28230 3203 3754 gene locus_tag LOCUS_28240 gene rfbC 3203 3754 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_28240 3778 4587 gene locus_tag LOCUS_28250 3778 4587 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356900.1 protein_id gnl|my_center|LOCUS_28250 4596 5924 gene locus_tag LOCUS_28260 4596 5924 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103412.1 protein_id gnl|my_center|LOCUS_28260 >Feature sequence0206 545 2539 gene locus_tag LOCUS_28270 545 2539 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_28270 2539 2985 gene locus_tag LOCUS_28280 gene rplI 2539 2985 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_28280 2985 4316 gene locus_tag LOCUS_28290 gene dnaB 2985 4316 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_28290 4625 4458 gene locus_tag LOCUS_28300 4625 4458 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963626.1 protein_id gnl|my_center|LOCUS_28300 4870 5373 gene locus_tag LOCUS_28310 4870 5373 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359469.1 protein_id gnl|my_center|LOCUS_28310 5432 6184 gene locus_tag LOCUS_28320 5432 6184 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873069.1 protein_id gnl|my_center|LOCUS_28320 6185 7069 gene locus_tag LOCUS_28330 gene hslO 6185 7069 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048141.1 protein_id gnl|my_center|LOCUS_28330 7345 7142 gene locus_tag LOCUS_28340 gene cspB 7345 7142 CDS product cold-shock protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723180.1 protein_id gnl|my_center|LOCUS_28340 7573 8121 gene locus_tag LOCUS_28350 7573 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 9338 8265 gene locus_tag LOCUS_28360 9338 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 >Feature sequence0207 1240 161 gene locus_tag LOCUS_28370 1240 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 2212 2376 gene locus_tag LOCUS_28380 2212 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 2440 2601 gene locus_tag LOCUS_28390 2440 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 2920 4308 gene locus_tag LOCUS_28400 gene csm6 2920 4308 CDS product type III-A CRISPR-associated CARF protein Csm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899494.1 protein_id gnl|my_center|LOCUS_28400 4302 5033 gene locus_tag LOCUS_28410 gene cas6 4302 5033 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837017.1 protein_id gnl|my_center|LOCUS_28410 5026 7242 gene locus_tag LOCUS_28420 gene cas10 5026 7242 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900580.1 protein_id gnl|my_center|LOCUS_28420 7243 7722 gene locus_tag LOCUS_28430 gene csm2 7243 7722 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917164.1 protein_id gnl|my_center|LOCUS_28430 7735 8412 gene locus_tag LOCUS_28440 gene csm3 7735 8412 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917166.1 protein_id gnl|my_center|LOCUS_28440 8414 9355 gene locus_tag LOCUS_28450 gene csm4 8414 9355 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414288.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence0208 509 30 gene locus_tag LOCUS_28460 509 30 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905642.1 protein_id gnl|my_center|LOCUS_28460 1183 578 gene locus_tag LOCUS_28470 1183 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 2242 1205 gene locus_tag LOCUS_28480 gene queA 2242 1205 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_28480 3050 2232 gene locus_tag LOCUS_28490 3050 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 3284 3358 gene locus_tag LOCUS_t00140 3284 3358 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3372 4355 gene locus_tag LOCUS_28500 3372 4355 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948775.1 protein_id gnl|my_center|LOCUS_28500 4497 4425 gene locus_tag LOCUS_t00150 4497 4425 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4622 4897 gene locus_tag LOCUS_28510 4622 4897 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595964.1 protein_id gnl|my_center|LOCUS_28510 4991 5410 gene locus_tag LOCUS_28520 4991 5410 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461668.1 protein_id gnl|my_center|LOCUS_28520 6708 5473 gene locus_tag LOCUS_28530 gene pepT 6708 5473 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475995.1 protein_id gnl|my_center|LOCUS_28530 7870 6689 gene locus_tag LOCUS_28540 7870 6689 CDS product cyclic nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990029.1 protein_id gnl|my_center|LOCUS_28540 9051 7906 gene locus_tag LOCUS_28550 9051 7906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 9221 9051 gene locus_tag LOCUS_28560 9221 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 >Feature sequence0209 915 115 gene locus_tag LOCUS_28570 gene murI 915 115 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_28570 1970 921 gene locus_tag LOCUS_28580 1970 921 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_28580 2650 1970 gene locus_tag LOCUS_28590 2650 1970 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_28590 3545 2667 gene locus_tag LOCUS_28600 gene ispE 3545 2667 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894070.1 protein_id gnl|my_center|LOCUS_28600 4293 3667 gene locus_tag LOCUS_28610 4293 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 4789 4271 gene locus_tag LOCUS_28620 4789 4271 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_28620 6400 4964 gene locus_tag LOCUS_28630 gene pyk 6400 4964 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_28630 7324 6506 gene locus_tag LOCUS_28640 7324 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 7776 8690 gene locus_tag LOCUS_28650 7776 8690 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948090.1 protein_id gnl|my_center|LOCUS_28650 9073 8918 gene locus_tag LOCUS_28660 9073 8918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 >Feature sequence0210 527 937 gene locus_tag LOCUS_28670 527 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 947 1336 gene locus_tag LOCUS_28680 947 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 2212 1358 gene locus_tag LOCUS_28690 gene nudC 2212 1358 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206107.1 protein_id gnl|my_center|LOCUS_28690 3690 2227 gene locus_tag LOCUS_28700 3690 2227 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_28700 4364 3759 gene locus_tag LOCUS_28710 4364 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 4764 4441 gene locus_tag LOCUS_28720 4764 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 5725 4775 gene locus_tag LOCUS_28730 5725 4775 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438310.1 protein_id gnl|my_center|LOCUS_28730 6622 5738 gene locus_tag LOCUS_28740 gene truB 6622 5738 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_28740 7574 6615 gene locus_tag LOCUS_28750 7574 6615 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082036.1 protein_id gnl|my_center|LOCUS_28750 7926 7555 gene locus_tag LOCUS_28760 gene rbfA 7926 7555 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_28760 9250 7940 gene locus_tag LOCUS_28770 9250 7940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 >Feature sequence0211 956 303 gene locus_tag LOCUS_28780 956 303 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721591.1 protein_id gnl|my_center|LOCUS_28780 2479 968 gene locus_tag LOCUS_28790 2479 968 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437761.1 protein_id gnl|my_center|LOCUS_28790 3516 2476 gene locus_tag LOCUS_28800 3516 2476 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948603.1 protein_id gnl|my_center|LOCUS_28800 4264 3503 gene locus_tag LOCUS_28810 gene cobM 4264 3503 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016784.1 protein_id gnl|my_center|LOCUS_28810 5271 4249 gene locus_tag LOCUS_28820 gene cbiB 5271 4249 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861967.1 protein_id gnl|my_center|LOCUS_28820 6035 5277 gene locus_tag LOCUS_28830 gene cobS 6035 5277 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680312.1 protein_id gnl|my_center|LOCUS_28830 6556 6038 gene locus_tag LOCUS_28840 gene cobU 6556 6038 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964692.1 protein_id gnl|my_center|LOCUS_28840 7713 6553 gene locus_tag LOCUS_28850 gene cobT 7713 6553 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_28850 9055 7706 gene locus_tag LOCUS_28860 9055 7706 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741259.1 protein_id gnl|my_center|LOCUS_28860 >Feature sequence0212 273 755 gene locus_tag LOCUS_28870 273 755 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948465.1 protein_id gnl|my_center|LOCUS_28870 765 1751 gene locus_tag LOCUS_28880 765 1751 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949075.1 protein_id gnl|my_center|LOCUS_28880 1926 4040 gene locus_tag LOCUS_28890 1926 4040 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_28890 4043 4702 gene locus_tag LOCUS_28900 4043 4702 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680765.1 protein_id gnl|my_center|LOCUS_28900 5643 4753 gene locus_tag LOCUS_28910 5643 4753 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948372.1 protein_id gnl|my_center|LOCUS_28910 5799 7055 gene locus_tag LOCUS_28920 gene leuC 5799 7055 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_28920 7069 7560 gene locus_tag LOCUS_28930 gene leuD 7069 7560 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_28930 8857 7625 gene locus_tag LOCUS_28940 8857 7625 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_28940 >Feature sequence0213 2 766 gene locus_tag LOCUS_28950 2 766 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461832.1 protein_id gnl|my_center|LOCUS_28950 750 1754 gene locus_tag LOCUS_28960 750 1754 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461831.1 protein_id gnl|my_center|LOCUS_28960 1729 2496 gene locus_tag LOCUS_28970 1729 2496 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184185.1 protein_id gnl|my_center|LOCUS_28970 3394 2549 gene locus_tag LOCUS_28980 3394 2549 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814367.1 protein_id gnl|my_center|LOCUS_28980 3640 4317 gene locus_tag LOCUS_28990 3640 4317 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732773.1 protein_id gnl|my_center|LOCUS_28990 4342 5175 gene locus_tag LOCUS_29000 4342 5175 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289121.1 protein_id gnl|my_center|LOCUS_29000 5291 7015 gene locus_tag LOCUS_29010 5291 7015 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_29010 7017 8747 gene locus_tag LOCUS_29020 7017 8747 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_29020 >Feature sequence0214 391 1977 gene locus_tag LOCUS_29030 391 1977 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_29030 1990 3393 gene locus_tag LOCUS_29040 gene pepV 1990 3393 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459801.1 protein_id gnl|my_center|LOCUS_29040 3402 4424 gene locus_tag LOCUS_29050 gene metN 3402 4424 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242531.1 protein_id gnl|my_center|LOCUS_29050 4426 5073 gene locus_tag LOCUS_29060 4426 5073 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112597.1 protein_id gnl|my_center|LOCUS_29060 5180 6055 gene locus_tag LOCUS_29070 5180 6055 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_29070 6059 7189 gene locus_tag LOCUS_29080 6059 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 9110 7260 gene locus_tag LOCUS_29090 9110 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 >Feature sequence0215 <1 704 gene locus_tag LOCUS_29100 <1 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860870.1:heavy metal translocating P-type ATPase 857 1222 gene locus_tag LOCUS_29110 857 1222 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_29110 1379 2596 gene locus_tag LOCUS_29120 1379 2596 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964082.1 protein_id gnl|my_center|LOCUS_29120 2884 4839 gene locus_tag LOCUS_29130 gene thrS 2884 4839 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_29130 5373 4891 gene locus_tag LOCUS_29140 5373 4891 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436247.1 protein_id gnl|my_center|LOCUS_29140 5595 6401 gene locus_tag LOCUS_29150 5595 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 7705 6455 gene locus_tag LOCUS_29160 gene aroA 7705 6455 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246068.1 protein_id gnl|my_center|LOCUS_29160 8807 7716 gene locus_tag LOCUS_29170 gene tyrA 8807 7716 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228138.1 protein_id gnl|my_center|LOCUS_29170 >Feature sequence0216 1136 189 gene locus_tag LOCUS_29180 1136 189 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_29180 2407 1148 gene locus_tag LOCUS_29190 2407 1148 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641660.1 protein_id gnl|my_center|LOCUS_29190 3638 2535 gene locus_tag LOCUS_29200 3638 2535 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667244.1 protein_id gnl|my_center|LOCUS_29200 4647 3643 gene locus_tag LOCUS_29210 4647 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681648.1 protein_id gnl|my_center|LOCUS_29210 5199 4654 gene locus_tag LOCUS_29220 5199 4654 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_29220 5951 5199 gene locus_tag LOCUS_29230 5951 5199 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_29230 6996 5953 gene locus_tag LOCUS_29240 6996 5953 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_29240 7663 7112 gene locus_tag LOCUS_29250 7663 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 8942 7752 gene locus_tag LOCUS_29260 8942 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 >Feature sequence0217 1290 298 gene locus_tag LOCUS_29270 1290 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 1501 3501 gene locus_tag LOCUS_29280 1501 3501 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_29280 4079 3612 gene locus_tag LOCUS_29290 4079 3612 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_29290 4618 4091 gene locus_tag LOCUS_29300 4618 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 4635 4823 gene locus_tag LOCUS_29310 4635 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 4963 8502 gene locus_tag LOCUS_29320 gene nifJ 4963 8502 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_29320 >Feature sequence0218 2936 420 gene locus_tag LOCUS_29330 2936 420 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817010.1 protein_id gnl|my_center|LOCUS_29330 5429 2937 gene locus_tag LOCUS_29340 5429 2937 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097446.1 protein_id gnl|my_center|LOCUS_29340 6760 5441 gene locus_tag LOCUS_29350 6760 5441 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378953.1 protein_id gnl|my_center|LOCUS_29350 7237 6761 gene locus_tag LOCUS_29360 7237 6761 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379064.1 protein_id gnl|my_center|LOCUS_29360 8268 7246 gene locus_tag LOCUS_29370 8268 7246 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_29370 8914 8342 gene locus_tag LOCUS_29380 8914 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 >Feature sequence0219 2059 1247 gene locus_tag LOCUS_29390 2059 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 3282 2050 gene locus_tag LOCUS_29400 3282 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 6890 3300 gene locus_tag LOCUS_29410 6890 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 7401 7925 gene locus_tag LOCUS_29420 7401 7925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 7935 8912 gene locus_tag LOCUS_29430 7935 8912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 >Feature sequence0220 404 943 gene locus_tag LOCUS_29440 gene lepB 404 943 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870097.1 protein_id gnl|my_center|LOCUS_29440 2374 1010 gene locus_tag LOCUS_29450 2374 1010 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_29450 2655 2383 gene locus_tag LOCUS_29460 2655 2383 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_29460 3470 2676 gene locus_tag LOCUS_29470 3470 2676 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_29470 4035 3475 gene locus_tag LOCUS_29480 gene coaE 4035 3475 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881297.1 protein_id gnl|my_center|LOCUS_29480 6677 4035 gene locus_tag LOCUS_29490 gene polA 6677 4035 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_29490 7023 6688 gene locus_tag LOCUS_29500 7023 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 7502 7026 gene locus_tag LOCUS_29510 7502 7026 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964912.1 protein_id gnl|my_center|LOCUS_29510 8845 7532 gene locus_tag LOCUS_29520 8845 7532 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356656.1 protein_id gnl|my_center|LOCUS_29520 >Feature sequence0221 141 1295 gene locus_tag LOCUS_29530 141 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 1315 1983 gene locus_tag LOCUS_29540 1315 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 2163 2903 gene locus_tag LOCUS_29550 2163 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 3007 3666 gene locus_tag LOCUS_29560 3007 3666 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989471.1 protein_id gnl|my_center|LOCUS_29560 3684 4682 gene locus_tag LOCUS_29570 3684 4682 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363756.1 protein_id gnl|my_center|LOCUS_29570 4750 5232 gene locus_tag LOCUS_29580 4750 5232 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_29580 5229 5786 gene locus_tag LOCUS_29590 5229 5786 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_29590 5852 7339 gene locus_tag LOCUS_29600 gene galT 5852 7339 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_29600 7624 7836 gene locus_tag LOCUS_29610 7624 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 7836 8696 gene locus_tag LOCUS_29620 7836 8696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 >Feature sequence0222 2232 958 gene locus_tag LOCUS_29630 2232 958 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082942.1 protein_id gnl|my_center|LOCUS_29630 2575 3966 gene locus_tag LOCUS_29640 gene asnS 2575 3966 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_29640 3992 5068 gene locus_tag LOCUS_29650 3992 5068 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545188.1 protein_id gnl|my_center|LOCUS_29650 5065 6930 gene locus_tag LOCUS_29660 5065 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 6938 7303 gene locus_tag LOCUS_29670 gene lrgA 6938 7303 CDS product antiholin-like murein hydrolase modulator LrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104900.1 protein_id gnl|my_center|LOCUS_29670 7308 8000 gene locus_tag LOCUS_29680 7308 8000 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356156.1 protein_id gnl|my_center|LOCUS_29680 8292 8092 gene locus_tag LOCUS_29690 8292 8092 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359346.1 protein_id gnl|my_center|LOCUS_29690 <8976 8295 gene locus_tag LOCUS_29700 <8976 8295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000891874.1:PLP-dependent aminotransferase family protein >Feature sequence0223 2823 1552 gene locus_tag LOCUS_29710 2823 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379688.1 protein_id gnl|my_center|LOCUS_29710 3679 2804 gene locus_tag LOCUS_29720 3679 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 4619 3669 gene locus_tag LOCUS_29730 4619 3669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_29730 7058 4620 gene locus_tag LOCUS_29740 7058 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 8172 7027 gene locus_tag LOCUS_29750 8172 7027 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369660.1 protein_id gnl|my_center|LOCUS_29750 8857 8150 gene locus_tag LOCUS_29760 8857 8150 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929879.1 protein_id gnl|my_center|LOCUS_29760 >Feature sequence0224 <1 629 gene locus_tag LOCUS_29770 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081188.1:glycosyltransferase 653 1627 gene locus_tag LOCUS_29780 gene ghy 653 1627 CDS product glycosyl hydrolase Ghy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207635.1 protein_id gnl|my_center|LOCUS_29780 1639 2862 gene locus_tag LOCUS_29790 1639 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 2840 3766 gene locus_tag LOCUS_29800 2840 3766 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_29800 3733 4911 gene locus_tag LOCUS_29810 3733 4911 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983041.1 protein_id gnl|my_center|LOCUS_29810 4908 6008 gene locus_tag LOCUS_29820 4908 6008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 6011 7087 gene locus_tag LOCUS_29830 6011 7087 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143696.1 protein_id gnl|my_center|LOCUS_29830 7113 8702 gene locus_tag LOCUS_29840 7113 8702 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476089.1 protein_id gnl|my_center|LOCUS_29840 >Feature sequence0225 1453 176 gene locus_tag LOCUS_29850 1453 176 CDS product IS110-like element ISDha12 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808714.1 protein_id gnl|my_center|LOCUS_29850 2207 2881 gene locus_tag LOCUS_29860 2207 2881 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434705.1 protein_id gnl|my_center|LOCUS_29860 2868 3845 gene locus_tag LOCUS_29870 2868 3845 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860822.1 protein_id gnl|my_center|LOCUS_29870 3956 4645 gene locus_tag LOCUS_29880 3956 4645 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888282.1 protein_id gnl|my_center|LOCUS_29880 4632 7136 gene locus_tag LOCUS_29890 4632 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 8364 7333 gene locus_tag LOCUS_29900 8364 7333 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770826.1 protein_id gnl|my_center|LOCUS_29900 8367 8515 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tccctgcacttcctctcagat >Feature sequence0226 1288 170 gene locus_tag LOCUS_29910 1288 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 1954 1298 gene locus_tag LOCUS_29920 1954 1298 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948611.1 protein_id gnl|my_center|LOCUS_29920 3599 2088 gene locus_tag LOCUS_29930 3599 2088 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836536.1 protein_id gnl|my_center|LOCUS_29930 4666 3599 gene locus_tag LOCUS_29940 gene cobD 4666 3599 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926914.1 protein_id gnl|my_center|LOCUS_29940 5420 4668 gene locus_tag LOCUS_29950 gene cobM 5420 4668 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016784.1 protein_id gnl|my_center|LOCUS_29950 6802 5435 gene locus_tag LOCUS_29960 gene radA 6802 5435 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_29960 7225 6806 gene locus_tag LOCUS_29970 7225 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 <8868 7564 gene locus_tag LOCUS_29980 <8868 7564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000971179.1:ATP-dependent protease ATP-binding subunit ClpC >Feature sequence0227 1958 1203 gene locus_tag LOCUS_29990 1958 1203 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724134.1 protein_id gnl|my_center|LOCUS_29990 2615 1965 gene locus_tag LOCUS_30000 2615 1965 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722217.1 protein_id gnl|my_center|LOCUS_30000 3608 2763 gene locus_tag LOCUS_30010 3608 2763 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_30010 5478 3838 gene locus_tag LOCUS_30020 gene malQ 5478 3838 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745458.1 protein_id gnl|my_center|LOCUS_30020 6462 5491 gene locus_tag LOCUS_30030 6462 5491 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_30030 8705 6459 gene locus_tag LOCUS_30040 gene glgB 8705 6459 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_30040 >Feature sequence0228 1628 579 gene locus_tag LOCUS_30050 1628 579 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_30050 2308 1628 gene locus_tag LOCUS_30060 2308 1628 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_30060 3207 2329 gene locus_tag LOCUS_30070 gene ispE 3207 2329 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894070.1 protein_id gnl|my_center|LOCUS_30070 4001 3366 gene locus_tag LOCUS_30080 4001 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 4497 3979 gene locus_tag LOCUS_30090 4497 3979 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_30090 6093 4657 gene locus_tag LOCUS_30100 gene pyk 6093 4657 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_30100 6997 6176 gene locus_tag LOCUS_30110 6997 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 7295 8245 gene locus_tag LOCUS_30120 7295 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 >Feature sequence0229 1772 114 gene locus_tag LOCUS_30130 1772 114 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681065.1 protein_id gnl|my_center|LOCUS_30130 3570 1774 gene locus_tag LOCUS_30140 3570 1774 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681067.1 protein_id gnl|my_center|LOCUS_30140 5015 3615 gene locus_tag LOCUS_30150 5015 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681074.1 protein_id gnl|my_center|LOCUS_30150 5868 5332 gene locus_tag LOCUS_30160 5868 5332 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_30160 7190 5943 gene locus_tag LOCUS_30170 7190 5943 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_30170 <8769 7250 gene locus_tag LOCUS_30180 <8769 7250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043943623.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence0230 1813 269 gene locus_tag LOCUS_30190 1813 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 2673 2068 gene locus_tag LOCUS_30200 2673 2068 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357340.1 protein_id gnl|my_center|LOCUS_30200 3509 2712 gene locus_tag LOCUS_30210 gene proC 3509 2712 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048171.1 protein_id gnl|my_center|LOCUS_30210 5951 3576 gene locus_tag LOCUS_30220 5951 3576 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903701.1 protein_id gnl|my_center|LOCUS_30220 6855 5953 gene locus_tag LOCUS_30230 6855 5953 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432388.1 protein_id gnl|my_center|LOCUS_30230 7195 6914 gene locus_tag LOCUS_30240 7195 6914 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048170.1 protein_id gnl|my_center|LOCUS_30240 >Feature sequence0231 3882 1582 gene locus_tag LOCUS_30250 3882 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 4561 3866 gene locus_tag LOCUS_30260 4561 3866 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_30260 4735 5202 gene locus_tag LOCUS_30270 gene tadA 4735 5202 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_30270 5792 5271 gene locus_tag LOCUS_30280 5792 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 6098 6760 gene locus_tag LOCUS_30290 6098 6760 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 protein_id gnl|my_center|LOCUS_30290 6798 7991 gene locus_tag LOCUS_30300 gene dpaL 6798 7991 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819571.1 protein_id gnl|my_center|LOCUS_30300 >Feature sequence0232 2372 1149 gene locus_tag LOCUS_30310 2372 1149 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_30310 2621 2388 gene locus_tag LOCUS_30320 2621 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 2906 2649 gene locus_tag LOCUS_30330 2906 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 3387 2908 gene locus_tag LOCUS_30340 3387 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 4351 3374 gene locus_tag LOCUS_30350 4351 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 5140 4361 gene locus_tag LOCUS_30360 5140 4361 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_30360 5598 5140 gene locus_tag LOCUS_30370 5598 5140 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 protein_id gnl|my_center|LOCUS_30370 6080 5595 gene locus_tag LOCUS_30380 6080 5595 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459433.1 protein_id gnl|my_center|LOCUS_30380 7519 6077 gene locus_tag LOCUS_30390 gene glgA 7519 6077 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_30390 <8706 7533 gene locus_tag LOCUS_30400 <8706 7533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009896126.1:DNA repair protein RecN >Feature sequence0233 <1 1703 gene locus_tag LOCUS_30410 <1 1703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262518.1:glycoside hydrolase family 13 protein 1726 3984 gene locus_tag LOCUS_30420 gene glgP 1726 3984 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950133.1 protein_id gnl|my_center|LOCUS_30420 3995 5461 gene locus_tag LOCUS_30430 gene malQ 3995 5461 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003028948.1 protein_id gnl|my_center|LOCUS_30430 5705 5550 gene locus_tag LOCUS_30440 5705 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 5887 6699 gene locus_tag LOCUS_30450 gene cbiQ 5887 6699 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812266.1 protein_id gnl|my_center|LOCUS_30450 6724 7569 gene locus_tag LOCUS_30460 6724 7569 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392733.1 protein_id gnl|my_center|LOCUS_30460 7594 8346 gene locus_tag LOCUS_30470 7594 8346 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812271.1 protein_id gnl|my_center|LOCUS_30470 8346 8657 gene locus_tag LOCUS_30480 8346 8657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 >Feature sequence0234 3 491 gene locus_tag LOCUS_30490 3 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 513 1454 gene locus_tag LOCUS_30500 513 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 1462 1875 gene locus_tag LOCUS_30510 1462 1875 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230049.1 protein_id gnl|my_center|LOCUS_30510 1895 3814 gene locus_tag LOCUS_30520 1895 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 3843 5675 gene locus_tag LOCUS_30530 3843 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 7189 5720 gene locus_tag LOCUS_30540 7189 5720 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_30540 7402 8364 gene locus_tag LOCUS_30550 7402 8364 CDS product DUF4300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837147.1 protein_id gnl|my_center|LOCUS_30550 >Feature sequence0235 295 672 gene locus_tag LOCUS_30560 295 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 821 1222 gene locus_tag LOCUS_30570 821 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 1237 2151 gene locus_tag LOCUS_30580 1237 2151 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_30580 3604 2204 gene locus_tag LOCUS_30590 3604 2204 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_30590 4308 3601 gene locus_tag LOCUS_30600 4308 3601 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966496.1 protein_id gnl|my_center|LOCUS_30600 6684 4327 gene locus_tag LOCUS_30610 6684 4327 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_30610 7860 6817 gene locus_tag LOCUS_30620 7860 6817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 <8673 7864 gene locus_tag LOCUS_30630 <8673 7864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947996.1:preprotein translocase subunit SecA >Feature sequence0236 1605 226 gene locus_tag LOCUS_30640 1605 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 2443 1613 gene locus_tag LOCUS_30650 2443 1613 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582872.1 protein_id gnl|my_center|LOCUS_30650 3346 2462 gene locus_tag LOCUS_30660 3346 2462 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582871.1 protein_id gnl|my_center|LOCUS_30660 4641 3415 gene locus_tag LOCUS_30670 4641 3415 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396179.1 protein_id gnl|my_center|LOCUS_30670 5746 4769 gene locus_tag LOCUS_30680 5746 4769 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582922.1 protein_id gnl|my_center|LOCUS_30680 6788 5904 gene locus_tag LOCUS_30690 6788 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 7324 6923 gene locus_tag LOCUS_30700 7324 6923 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462228.1 protein_id gnl|my_center|LOCUS_30700 <8591 7333 gene locus_tag LOCUS_30710 <8591 7333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393855.1:F0F1 ATP synthase subunit beta >Feature sequence0237 1939 1598 gene locus_tag LOCUS_30720 1939 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 2671 1949 gene locus_tag LOCUS_30730 2671 1949 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 protein_id gnl|my_center|LOCUS_30730 3602 2655 gene locus_tag LOCUS_30740 3602 2655 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113718.1 protein_id gnl|my_center|LOCUS_30740 5020 3779 gene locus_tag LOCUS_30750 5020 3779 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775569.1 protein_id gnl|my_center|LOCUS_30750 6474 5032 gene locus_tag LOCUS_30760 6474 5032 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_30760 7410 6487 gene locus_tag LOCUS_30770 7410 6487 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003836797.1 protein_id gnl|my_center|LOCUS_30770 8506 7607 gene locus_tag LOCUS_30780 8506 7607 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592816.1 protein_id gnl|my_center|LOCUS_30780 >Feature sequence0238 301 999 gene locus_tag LOCUS_30790 301 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 1012 2406 gene locus_tag LOCUS_30800 1012 2406 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 protein_id gnl|my_center|LOCUS_30800 2437 3666 gene locus_tag LOCUS_30810 2437 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 3666 4463 gene locus_tag LOCUS_30820 3666 4463 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_30820 4497 5201 gene locus_tag LOCUS_30830 gene cysE 4497 5201 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459083.1 protein_id gnl|my_center|LOCUS_30830 5201 5536 gene locus_tag LOCUS_30840 5201 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 5514 6164 gene locus_tag LOCUS_30850 5514 6164 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_30850 6263 6844 gene locus_tag LOCUS_30860 6263 6844 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_30860 6891 7319 gene locus_tag LOCUS_30870 6891 7319 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902921.1 protein_id gnl|my_center|LOCUS_30870 7795 8277 gene locus_tag LOCUS_30880 gene greA 7795 8277 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_30880 >Feature sequence0239 1093 359 gene locus_tag LOCUS_30890 gene rlmB 1093 359 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_30890 1587 1174 gene locus_tag LOCUS_30900 1587 1174 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567914.1 protein_id gnl|my_center|LOCUS_30900 2981 1572 gene locus_tag LOCUS_30910 gene cysS 2981 1572 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_30910 3536 3003 gene locus_tag LOCUS_30920 gene ispF 3536 3003 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963756.1 protein_id gnl|my_center|LOCUS_30920 4468 3554 gene locus_tag LOCUS_30930 4468 3554 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294549.1 protein_id gnl|my_center|LOCUS_30930 6236 4854 gene locus_tag LOCUS_30940 6236 4854 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047962.1 protein_id gnl|my_center|LOCUS_30940 6331 6516 gene locus_tag LOCUS_30950 6331 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 6801 6875 gene locus_tag LOCUS_t00160 6801 6875 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6893 6968 gene locus_tag LOCUS_t00170 6893 6968 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8336 7140 gene locus_tag LOCUS_30960 8336 7140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 >Feature sequence0240 <1 1130 gene locus_tag LOCUS_30970 <1 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_132377852.1:AI-2E family transporter 1376 3529 gene locus_tag LOCUS_30980 1376 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 3899 5914 gene locus_tag LOCUS_30990 3899 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 6299 7741 gene locus_tag LOCUS_31000 6299 7741 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 protein_id gnl|my_center|LOCUS_31000 7918 8361 gene locus_tag LOCUS_31010 7918 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 >Feature sequence0241 50 427 gene locus_tag LOCUS_31020 50 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 608 853 gene locus_tag LOCUS_31030 608 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 1663 1058 gene locus_tag LOCUS_31040 1663 1058 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809017.1 protein_id gnl|my_center|LOCUS_31040 1870 3645 gene locus_tag LOCUS_31050 1870 3645 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461147.1 protein_id gnl|my_center|LOCUS_31050 4485 4306 gene locus_tag LOCUS_31060 4485 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 4595 5383 gene locus_tag LOCUS_31070 4595 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 5417 6019 gene locus_tag LOCUS_31080 5417 6019 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680633.1 protein_id gnl|my_center|LOCUS_31080 6350 6222 gene locus_tag LOCUS_31090 6350 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 6319 6753 gene locus_tag LOCUS_31100 6319 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 6784 8256 gene locus_tag LOCUS_31110 6784 8256 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462215.1 protein_id gnl|my_center|LOCUS_31110 >Feature sequence0242 2814 1852 gene locus_tag LOCUS_31120 gene nrdF 2814 1852 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896021.1 protein_id gnl|my_center|LOCUS_31120 5007 2830 gene locus_tag LOCUS_31130 gene nrdE 5007 2830 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355358.1 protein_id gnl|my_center|LOCUS_31130 5368 5000 gene locus_tag LOCUS_31140 gene nrdI 5368 5000 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355359.1 protein_id gnl|my_center|LOCUS_31140 5573 5373 gene locus_tag LOCUS_31150 gene nrdH 5573 5373 CDS product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098419.1 protein_id gnl|my_center|LOCUS_31150 6765 5587 gene locus_tag LOCUS_31160 6765 5587 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_31160 7313 6849 gene locus_tag LOCUS_31170 gene lspA 7313 6849 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454916.1 protein_id gnl|my_center|LOCUS_31170 7825 7313 gene locus_tag LOCUS_31180 7825 7313 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288030.1 protein_id gnl|my_center|LOCUS_31180 8417 7827 gene locus_tag LOCUS_31190 8417 7827 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357527.1 protein_id gnl|my_center|LOCUS_31190 >Feature sequence0243 3 464 gene locus_tag LOCUS_31200 3 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 473 1123 gene locus_tag LOCUS_31210 473 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 1230 2099 gene locus_tag LOCUS_31220 1230 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 2196 2567 gene locus_tag LOCUS_31230 2196 2567 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403434.1 protein_id gnl|my_center|LOCUS_31230 2560 3258 gene locus_tag LOCUS_31240 2560 3258 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_31240 3252 4088 gene locus_tag LOCUS_31250 3252 4088 CDS product lantibiotic ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836751.1 protein_id gnl|my_center|LOCUS_31250 4206 4802 gene locus_tag LOCUS_31260 4206 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 5015 6046 gene locus_tag LOCUS_31270 5015 6046 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_31270 6438 7127 gene locus_tag LOCUS_31280 6438 7127 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_31280 >Feature sequence0244 2051 123 gene locus_tag LOCUS_31290 gene pulA 2051 123 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994410.1 protein_id gnl|my_center|LOCUS_31290 2923 2054 gene locus_tag LOCUS_31300 2923 2054 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360454.1 protein_id gnl|my_center|LOCUS_31300 4305 2926 gene locus_tag LOCUS_31310 4305 2926 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113788.1 protein_id gnl|my_center|LOCUS_31310 5555 4317 gene locus_tag LOCUS_31320 5555 4317 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399406.1 protein_id gnl|my_center|LOCUS_31320 5833 6855 gene locus_tag LOCUS_31330 gene cytR 5833 6855 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421065.1 protein_id gnl|my_center|LOCUS_31330 8133 6961 gene locus_tag LOCUS_31340 gene cytX 8133 6961 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225706.1 protein_id gnl|my_center|LOCUS_31340 >Feature sequence0245 1253 480 gene locus_tag LOCUS_31350 1253 480 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454242.1 protein_id gnl|my_center|LOCUS_31350 2023 1268 gene locus_tag LOCUS_31360 2023 1268 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247643.1 protein_id gnl|my_center|LOCUS_31360 2939 2016 gene locus_tag LOCUS_31370 2939 2016 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861095.1 protein_id gnl|my_center|LOCUS_31370 3972 3043 gene locus_tag LOCUS_31380 3972 3043 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861096.1 protein_id gnl|my_center|LOCUS_31380 4673 3981 gene locus_tag LOCUS_31390 4673 3981 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861097.1 protein_id gnl|my_center|LOCUS_31390 4941 5981 gene locus_tag LOCUS_31400 4941 5981 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922574.1 protein_id gnl|my_center|LOCUS_31400 6843 6214 gene locus_tag LOCUS_31410 6843 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 8009 6843 gene locus_tag LOCUS_31420 8009 6843 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_31420 >Feature sequence0246 90 362 gene locus_tag LOCUS_31430 90 362 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966918.1 protein_id gnl|my_center|LOCUS_31430 362 1261 gene locus_tag LOCUS_31440 362 1261 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_31440 1254 2102 gene locus_tag LOCUS_31450 1254 2102 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_31450 2174 3889 gene locus_tag LOCUS_31460 2174 3889 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_31460 4012 4455 gene locus_tag LOCUS_31470 4012 4455 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_31470 4459 5676 gene locus_tag LOCUS_31480 4459 5676 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876856.1 protein_id gnl|my_center|LOCUS_31480 5758 6066 gene locus_tag LOCUS_31490 5758 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 6080 6433 gene locus_tag LOCUS_31500 6080 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 >Feature sequence0247 1935 901 gene locus_tag LOCUS_31510 gene kdd 1935 901 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_31510 2766 1948 gene locus_tag LOCUS_31520 2766 1948 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_31520 3167 2778 gene locus_tag LOCUS_31530 3167 2778 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_31530 4636 3476 gene locus_tag LOCUS_31540 4636 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 6097 4649 gene locus_tag LOCUS_31550 6097 4649 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015882.1 protein_id gnl|my_center|LOCUS_31550 7112 6099 gene locus_tag LOCUS_31560 7112 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367345.1 protein_id gnl|my_center|LOCUS_31560 8017 7112 gene locus_tag LOCUS_31570 8017 7112 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_31570 >Feature sequence0248 930 325 gene locus_tag LOCUS_31580 gene clpP 930 325 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_31580 1143 1898 gene locus_tag LOCUS_31590 1143 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 3902 1962 gene locus_tag LOCUS_31600 3902 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 5177 3912 gene locus_tag LOCUS_31610 5177 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 5560 5853 gene locus_tag LOCUS_31620 5560 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 5879 6259 gene locus_tag LOCUS_31630 5879 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 6256 6984 gene locus_tag LOCUS_31640 gene atpB 6256 6984 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_31640 7064 7321 gene locus_tag LOCUS_31650 gene atpE 7064 7321 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 protein_id gnl|my_center|LOCUS_31650 7334 7849 gene locus_tag LOCUS_31660 7334 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 7837 8370 gene locus_tag LOCUS_31670 7837 8370 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_31670 >Feature sequence0249 1765 38 gene locus_tag LOCUS_31680 1765 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 2883 1777 gene locus_tag LOCUS_31690 2883 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 2998 3180 gene locus_tag LOCUS_31700 2998 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 4723 3188 gene locus_tag LOCUS_31710 gene gpmI 4723 3188 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_31710 5783 4953 gene locus_tag LOCUS_31720 5783 4953 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_31720 6451 5780 gene locus_tag LOCUS_31730 6451 5780 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832763.1 protein_id gnl|my_center|LOCUS_31730 7539 6463 gene locus_tag LOCUS_31740 7539 6463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 7956 7549 gene locus_tag LOCUS_31750 7956 7549 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140785.1 protein_id gnl|my_center|LOCUS_31750 >Feature sequence0250 281 1174 gene locus_tag LOCUS_31760 281 1174 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582771.1 protein_id gnl|my_center|LOCUS_31760 1186 2046 gene locus_tag LOCUS_31770 1186 2046 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776379.1 protein_id gnl|my_center|LOCUS_31770 2071 3042 gene locus_tag LOCUS_31780 2071 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 3083 3772 gene locus_tag LOCUS_31790 3083 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 3798 4628 gene locus_tag LOCUS_31800 3798 4628 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776771.1 protein_id gnl|my_center|LOCUS_31800 4658 6841 gene locus_tag LOCUS_31810 4658 6841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 6862 7923 gene locus_tag LOCUS_31820 6862 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 >Feature sequence0251 1618 5028 gene locus_tag LOCUS_31830 gene addB 1618 5028 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948191.1 protein_id gnl|my_center|LOCUS_31830 >Feature sequence0252 256 1536 gene locus_tag LOCUS_31840 256 1536 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986541.1 protein_id gnl|my_center|LOCUS_31840 1822 2991 gene locus_tag LOCUS_31850 1822 2991 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016940.1 protein_id gnl|my_center|LOCUS_31850 3379 3666 gene locus_tag LOCUS_31860 3379 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 4008 4292 gene locus_tag LOCUS_31870 4008 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 5128 4439 gene locus_tag LOCUS_31880 5128 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 5613 6929 gene locus_tag LOCUS_31890 5613 6929 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779468.1 protein_id gnl|my_center|LOCUS_31890 7518 7195 gene locus_tag LOCUS_31900 7518 7195 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994766.1 protein_id gnl|my_center|LOCUS_31900 7826 7524 gene locus_tag LOCUS_31910 7826 7524 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004133089.1 protein_id gnl|my_center|LOCUS_31910 >Feature sequence0253 455 841 gene locus_tag LOCUS_31920 455 841 CDS product GrdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948883.1 protein_id gnl|my_center|LOCUS_31920 929 1630 gene locus_tag LOCUS_31930 929 1630 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903848.1 protein_id gnl|my_center|LOCUS_31930 2024 3310 gene locus_tag LOCUS_31940 gene grdG 2024 3310 CDS product sarcosine reductase complex component B subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454406.1 protein_id gnl|my_center|LOCUS_31940 3328 4647 gene locus_tag LOCUS_31950 gene grdF 3328 4647 CDS product sarcosine reductase complex component B subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084481329.1 transl_except (pos:4375..4377,aa:Sec) note codon on position 350 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_31950 4673 5812 gene locus_tag LOCUS_31960 4673 5812 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425444.1 protein_id gnl|my_center|LOCUS_31960 6214 6672 gene locus_tag LOCUS_31970 6214 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 6669 7667 gene locus_tag LOCUS_31980 6669 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 >Feature sequence0254 1186 1599 gene locus_tag LOCUS_31990 1186 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 3717 1669 gene locus_tag LOCUS_32000 gene htpG 3717 1669 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_32000 5374 3851 gene locus_tag LOCUS_32010 5374 3851 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_32010 6228 5617 gene locus_tag LOCUS_32020 6228 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 <8237 6373 gene locus_tag LOCUS_32030 <8237 6373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201627021.1:elongation factor G >Feature sequence0255 177 1673 gene locus_tag LOCUS_32040 177 1673 CDS product TIGR02677 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459214.1 protein_id gnl|my_center|LOCUS_32040 1670 2806 gene locus_tag LOCUS_32050 1670 2806 CDS product TIGR02678 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068556302.1 protein_id gnl|my_center|LOCUS_32050 2803 6867 gene locus_tag LOCUS_32060 2803 6867 CDS product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459216.1 protein_id gnl|my_center|LOCUS_32060 6857 8170 gene locus_tag LOCUS_32070 6857 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 >Feature sequence0256 <1 953 gene locus_tag LOCUS_32080 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080052.1:mannosylglucosylglycerate synthase 2968 1043 gene locus_tag LOCUS_32090 2968 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 4279 2978 gene locus_tag LOCUS_32100 4279 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 4641 4934 gene locus_tag LOCUS_32110 4641 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 4960 5340 gene locus_tag LOCUS_32120 4960 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 5337 6065 gene locus_tag LOCUS_32130 gene atpB 5337 6065 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_32130 6145 6402 gene locus_tag LOCUS_32140 gene atpE 6145 6402 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 protein_id gnl|my_center|LOCUS_32140 6415 6930 gene locus_tag LOCUS_32150 6415 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 6918 7451 gene locus_tag LOCUS_32160 6918 7451 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_32160 >Feature sequence0257 1691 201 gene locus_tag LOCUS_32170 1691 201 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861629.1 protein_id gnl|my_center|LOCUS_32170 3379 1709 gene locus_tag LOCUS_32180 3379 1709 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048375.1 protein_id gnl|my_center|LOCUS_32180 6317 3393 gene locus_tag LOCUS_32190 6317 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 7581 6424 gene locus_tag LOCUS_32200 7581 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 7839 8120 gene locus_tag LOCUS_32210 7839 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 >Feature sequence0258 1416 667 gene locus_tag LOCUS_32220 1416 667 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358628.1 protein_id gnl|my_center|LOCUS_32220 1946 1419 gene locus_tag LOCUS_32230 1946 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 2652 1972 gene locus_tag LOCUS_32240 2652 1972 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360698.1 protein_id gnl|my_center|LOCUS_32240 4052 2661 gene locus_tag LOCUS_32250 4052 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 4648 4229 gene locus_tag LOCUS_32260 4648 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 5745 4732 gene locus_tag LOCUS_32270 5745 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 6115 5720 gene locus_tag LOCUS_32280 gene mgsA 6115 5720 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230640.1 protein_id gnl|my_center|LOCUS_32280 7252 6131 gene locus_tag LOCUS_32290 gene rodA 7252 6131 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_32290 <8148 7331 gene locus_tag LOCUS_32300 <8148 7331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942721.1:penicillin-binding protein 2 >Feature sequence0259 105 608 gene locus_tag LOCUS_32310 105 608 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359469.1 protein_id gnl|my_center|LOCUS_32310 873 682 gene locus_tag LOCUS_32320 873 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 952 1704 gene locus_tag LOCUS_32330 952 1704 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_32330 1724 2608 gene locus_tag LOCUS_32340 gene hslO 1724 2608 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_32340 2767 3357 gene locus_tag LOCUS_32350 2767 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 3445 4902 gene locus_tag LOCUS_32360 3445 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 4919 6772 gene locus_tag LOCUS_32370 4919 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 6753 7880 gene locus_tag LOCUS_32380 6753 7880 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_32380 >Feature sequence0260 10 651 gene locus_tag LOCUS_32390 10 651 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679286.1 protein_id gnl|my_center|LOCUS_32390 710 2461 gene locus_tag LOCUS_32400 710 2461 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679279.1 protein_id gnl|my_center|LOCUS_32400 2462 4186 gene locus_tag LOCUS_32410 2462 4186 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679276.1 protein_id gnl|my_center|LOCUS_32410 4195 5703 gene locus_tag LOCUS_32420 4195 5703 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679275.1 protein_id gnl|my_center|LOCUS_32420 5700 6401 gene locus_tag LOCUS_32430 5700 6401 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679272.1 protein_id gnl|my_center|LOCUS_32430 6419 7000 gene locus_tag LOCUS_32440 6419 7000 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669155.1 protein_id gnl|my_center|LOCUS_32440 7252 7599 gene locus_tag LOCUS_32450 7252 7599 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185623697.1 protein_id gnl|my_center|LOCUS_32450 >Feature sequence0261 447 707 gene locus_tag LOCUS_32460 447 707 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868899.1 protein_id gnl|my_center|LOCUS_32460 700 1818 gene locus_tag LOCUS_32470 gene hydE 700 1818 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433972.1 protein_id gnl|my_center|LOCUS_32470 1800 3248 gene locus_tag LOCUS_32480 gene hydG 1800 3248 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_32480 3250 4452 gene locus_tag LOCUS_32490 gene hydF 3250 4452 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_32490 5048 4503 gene locus_tag LOCUS_32500 5048 4503 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185961073.1 protein_id gnl|my_center|LOCUS_32500 5108 5353 gene locus_tag LOCUS_32510 5108 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 5350 5874 gene locus_tag LOCUS_32520 gene cobO 5350 5874 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251080.1 protein_id gnl|my_center|LOCUS_32520 5890 7554 gene locus_tag LOCUS_32530 5890 7554 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_32530 7684 7878 gene locus_tag LOCUS_32540 7684 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 >Feature sequence0262 2346 688 gene locus_tag LOCUS_32550 2346 688 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_32550 3929 2658 gene locus_tag LOCUS_32560 3929 2658 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905867.1 protein_id gnl|my_center|LOCUS_32560 6416 3942 gene locus_tag LOCUS_32570 gene gyrA 6416 3942 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_32570 <8029 6433 gene locus_tag LOCUS_32580 <8029 6433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003226808.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence0263 107 535 gene locus_tag LOCUS_32590 107 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 636 842 gene locus_tag LOCUS_32600 gene rpmE 636 842 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_32600 918 1844 gene locus_tag LOCUS_32610 918 1844 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947980.1 protein_id gnl|my_center|LOCUS_32610 1846 2691 gene locus_tag LOCUS_32620 gene prmC 1846 2691 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_32620 2707 3777 gene locus_tag LOCUS_32630 gene prfA 2707 3777 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_32630 3790 4815 gene locus_tag LOCUS_32640 3790 4815 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_32640 4794 6446 gene locus_tag LOCUS_32650 4794 6446 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_32650 7692 6517 gene locus_tag LOCUS_32660 7692 6517 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_32660 >Feature sequence0264 278 144 gene locus_tag LOCUS_32670 278 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 944 537 gene locus_tag LOCUS_32680 944 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 1736 993 gene locus_tag LOCUS_32690 1736 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 2325 1957 gene locus_tag LOCUS_32700 2325 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 2743 2498 gene locus_tag LOCUS_32710 2743 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 3439 3020 gene locus_tag LOCUS_32720 3439 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 4243 3557 gene locus_tag LOCUS_32730 4243 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 4757 4230 gene locus_tag LOCUS_32740 4757 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 5836 4868 gene locus_tag LOCUS_32750 5836 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 7521 6376 gene locus_tag LOCUS_32760 7521 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 >Feature sequence0265 609 1823 gene locus_tag LOCUS_32770 609 1823 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_32770 3059 2208 gene locus_tag LOCUS_32780 gene pgeF 3059 2208 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_32780 3434 3072 gene locus_tag LOCUS_32790 3434 3072 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017105.1 protein_id gnl|my_center|LOCUS_32790 4068 3403 gene locus_tag LOCUS_32800 4068 3403 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_32800 4916 4068 gene locus_tag LOCUS_32810 gene ylqF 4916 4068 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296988.1 protein_id gnl|my_center|LOCUS_32810 5323 4976 gene locus_tag LOCUS_32820 gene rplS 5323 4976 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_32820 6628 5429 gene locus_tag LOCUS_32830 gene ackA 6628 5429 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_32830 7928 6936 gene locus_tag LOCUS_32840 gene pta 7928 6936 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_32840 >Feature sequence0266 5362 1094 gene locus_tag LOCUS_32850 5362 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 5632 6915 gene locus_tag LOCUS_32860 5632 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 <7988 7366 gene locus_tag LOCUS_32870 <7988 7366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000483126.1:Rpn family recombination-promoting nuclease/putative transposase >Feature sequence0267 1531 1193 gene locus_tag LOCUS_32880 1531 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 2931 1528 gene locus_tag LOCUS_32890 gene argH 2931 1528 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_32890 5752 3002 gene locus_tag LOCUS_32900 5752 3002 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106612643.1 protein_id gnl|my_center|LOCUS_32900 5886 6689 gene locus_tag LOCUS_32910 5886 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 6849 7346 gene locus_tag LOCUS_32920 gene ilvN 6849 7346 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_32920 >Feature sequence0268 2877 1762 gene locus_tag LOCUS_32930 gene essB 2877 1762 CDS product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447056.1 protein_id gnl|my_center|LOCUS_32930 3122 2874 gene locus_tag LOCUS_32940 3122 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 3522 3091 gene locus_tag LOCUS_32950 3522 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 3883 3515 gene locus_tag LOCUS_32960 3883 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 <7913 3895 gene locus_tag LOCUS_32970 <7913 3895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000436748.1:type VII secretion protein EssC >Feature sequence0269 1332 541 gene locus_tag LOCUS_32980 1332 541 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_32980 3199 1322 gene locus_tag LOCUS_32990 gene dxs 3199 1322 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_32990 4098 3208 gene locus_tag LOCUS_33000 4098 3208 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965380.1 protein_id gnl|my_center|LOCUS_33000 4300 4091 gene locus_tag LOCUS_33010 4300 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 5492 4314 gene locus_tag LOCUS_33020 gene xseA 5492 4314 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_33020 5939 5499 gene locus_tag LOCUS_33030 gene nusB 5939 5499 CDS product N utilization substance protein NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830247.1 protein_id gnl|my_center|LOCUS_33030 6111 6785 gene locus_tag LOCUS_33040 6111 6785 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127552.1 protein_id gnl|my_center|LOCUS_33040 6904 7899 gene locus_tag LOCUS_33050 6904 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 >Feature sequence0270 269 1030 gene locus_tag LOCUS_33060 gene soj 269 1030 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_33060 1048 1935 gene locus_tag LOCUS_33070 1048 1935 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_33070 1947 2435 gene locus_tag LOCUS_33080 1947 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 3105 2578 gene locus_tag LOCUS_33090 3105 2578 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131681.1 protein_id gnl|my_center|LOCUS_33090 3684 4568 gene locus_tag LOCUS_33100 3684 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 4941 6035 gene locus_tag LOCUS_33110 4941 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 6366 6440 gene locus_tag LOCUS_t00180 6366 6440 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6917 7255 gene locus_tag LOCUS_33120 6917 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 7429 7782 gene locus_tag LOCUS_33130 7429 7782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 >Feature sequence0271 1248 400 gene locus_tag LOCUS_33140 1248 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 1407 2672 gene locus_tag LOCUS_33150 1407 2672 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861133.1 protein_id gnl|my_center|LOCUS_33150 2863 4011 gene locus_tag LOCUS_33160 2863 4011 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811901.1 protein_id gnl|my_center|LOCUS_33160 4013 5104 gene locus_tag LOCUS_33170 gene yedE 4013 5104 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680420.1 protein_id gnl|my_center|LOCUS_33170 5117 5323 gene locus_tag LOCUS_33180 5117 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 5326 5541 gene locus_tag LOCUS_33190 5326 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 5623 5859 gene locus_tag LOCUS_33200 5623 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 5936 5864 gene locus_tag LOCUS_t00190 5936 5864 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6208 6137 gene locus_tag LOCUS_t00200 6208 6137 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6795 6478 gene locus_tag LOCUS_33210 6795 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 7311 6979 gene locus_tag LOCUS_33220 gene rsfS 7311 6979 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416416.1 protein_id gnl|my_center|LOCUS_33220 <7875 7313 gene locus_tag LOCUS_33230 <7875 7313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964575.1:bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK >Feature sequence0272 3595 2618 gene locus_tag LOCUS_33240 gene pglE 3595 2618 CDS product (galactosaminyl)2-N,N'-diacetylbacillosaminyl-alpha1-diphospho-di-trans,octa-cis-undecaprenol synthase PglE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704837.1 protein_id gnl|my_center|LOCUS_33240 4683 3610 gene locus_tag LOCUS_33250 4683 3610 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141615041.1 protein_id gnl|my_center|LOCUS_33250 5419 4676 gene locus_tag LOCUS_33260 5419 4676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 protein_id gnl|my_center|LOCUS_33260 6211 5432 gene locus_tag LOCUS_33270 6211 5432 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_33270 7799 6222 gene locus_tag LOCUS_33280 7799 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 >Feature sequence0273 991 101 gene locus_tag LOCUS_33290 991 101 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286852.1 protein_id gnl|my_center|LOCUS_33290 1218 2846 gene locus_tag LOCUS_33300 1218 2846 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_33300 2920 3849 gene locus_tag LOCUS_33310 2920 3849 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867267.1 protein_id gnl|my_center|LOCUS_33310 3849 4700 gene locus_tag LOCUS_33320 3849 4700 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_33320 4700 5674 gene locus_tag LOCUS_33330 4700 5674 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963503.1 protein_id gnl|my_center|LOCUS_33330 5667 6455 gene locus_tag LOCUS_33340 5667 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 6466 7548 gene locus_tag LOCUS_33350 6466 7548 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064463.1 protein_id gnl|my_center|LOCUS_33350 >Feature sequence0274 120 962 gene locus_tag LOCUS_33360 120 962 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836880.1 protein_id gnl|my_center|LOCUS_33360 1092 2390 gene locus_tag LOCUS_33370 gene galK 1092 2390 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583556.1 protein_id gnl|my_center|LOCUS_33370 2387 2767 gene locus_tag LOCUS_33380 2387 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 2830 3246 gene locus_tag LOCUS_33390 gene nrdR 2830 3246 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454958.1 protein_id gnl|my_center|LOCUS_33390 3252 3761 gene locus_tag LOCUS_33400 3252 3761 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393068.1 protein_id gnl|my_center|LOCUS_33400 3758 4633 gene locus_tag LOCUS_33410 gene aroE 3758 4633 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812091.1 protein_id gnl|my_center|LOCUS_33410 4630 5067 gene locus_tag LOCUS_33420 gene aroQ 4630 5067 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083137.1 protein_id gnl|my_center|LOCUS_33420 5132 5692 gene locus_tag LOCUS_33430 gene efp 5132 5692 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_33430 5773 7542 gene locus_tag LOCUS_33440 gene argS 5773 7542 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_33440 >Feature sequence0275 <1 836 gene locus_tag LOCUS_33450 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966178.1:D-alanine--D-alanine ligase family protein 839 1654 gene locus_tag LOCUS_33460 gene murI 839 1654 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_33460 1671 2099 gene locus_tag LOCUS_33470 1671 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 2662 2219 gene locus_tag LOCUS_33480 2662 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 3086 6973 gene locus_tag LOCUS_33490 gene rpoB 3086 6973 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436174.1 protein_id gnl|my_center|LOCUS_33490 >Feature sequence0276 3288 2548 gene locus_tag LOCUS_33500 3288 2548 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138570.1 protein_id gnl|my_center|LOCUS_33500 3834 4733 gene locus_tag LOCUS_33510 3834 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 4675 4881 gene locus_tag LOCUS_33520 4675 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 5019 6338 gene locus_tag LOCUS_33530 5019 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 6319 7629 gene locus_tag LOCUS_33540 6319 7629 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174705273.1 protein_id gnl|my_center|LOCUS_33540 >Feature sequence0277 1431 1078 gene locus_tag LOCUS_33550 1431 1078 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760124.1 protein_id gnl|my_center|LOCUS_33550 4025 1620 gene locus_tag LOCUS_33560 4025 1620 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688713.1 protein_id gnl|my_center|LOCUS_33560 4776 4129 gene locus_tag LOCUS_33570 gene pgmB 4776 4129 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965902.1 protein_id gnl|my_center|LOCUS_33570 7087 4799 gene locus_tag LOCUS_33580 7087 4799 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990086.1 protein_id gnl|my_center|LOCUS_33580 <7780 7099 gene locus_tag LOCUS_33590 <7780 7099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003569669.1:carbohydrate ABC transporter permease >Feature sequence0278 674 93 gene locus_tag LOCUS_33600 674 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 1306 671 gene locus_tag LOCUS_33610 1306 671 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994403.1 protein_id gnl|my_center|LOCUS_33610 2372 1311 gene locus_tag LOCUS_33620 2372 1311 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721423.1 protein_id gnl|my_center|LOCUS_33620 2636 3583 gene locus_tag LOCUS_33630 2636 3583 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775210.1 protein_id gnl|my_center|LOCUS_33630 3586 4485 gene locus_tag LOCUS_33640 3586 4485 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_33640 4506 6182 gene locus_tag LOCUS_33650 4506 6182 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_33650 6191 7684 gene locus_tag LOCUS_33660 6191 7684 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582926.1 protein_id gnl|my_center|LOCUS_33660 >Feature sequence0279 1118 1543 gene locus_tag LOCUS_33670 1118 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 1564 1992 gene locus_tag LOCUS_33680 1564 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 2172 2699 gene locus_tag LOCUS_33690 2172 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 2710 3201 gene locus_tag LOCUS_33700 2710 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 3313 4137 gene locus_tag LOCUS_33710 3313 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 4152 6002 gene locus_tag LOCUS_33720 4152 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 6083 7384 gene locus_tag LOCUS_33730 6083 7384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 >Feature sequence0280 217 1176 gene locus_tag LOCUS_33740 217 1176 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039866225.1 protein_id gnl|my_center|LOCUS_33740 1357 1935 gene locus_tag LOCUS_33750 1357 1935 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671086.1 protein_id gnl|my_center|LOCUS_33750 1935 2615 gene locus_tag LOCUS_33760 1935 2615 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957006.1 protein_id gnl|my_center|LOCUS_33760 2632 4077 gene locus_tag LOCUS_33770 2632 4077 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679287.1 protein_id gnl|my_center|LOCUS_33770 4109 5836 gene locus_tag LOCUS_33780 4109 5836 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462083.1 protein_id gnl|my_center|LOCUS_33780 5820 7556 gene locus_tag LOCUS_33790 5820 7556 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462084.1 protein_id gnl|my_center|LOCUS_33790 >Feature sequence0281 <1 680 gene locus_tag LOCUS_33800 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101492.1:tryptophan synthase subunit beta 673 1443 gene locus_tag LOCUS_33810 gene trpA 673 1443 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_33810 1731 5993 gene locus_tag LOCUS_33820 1731 5993 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484061.1 protein_id gnl|my_center|LOCUS_33820 6984 6145 gene locus_tag LOCUS_33830 6984 6145 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775600.1 protein_id gnl|my_center|LOCUS_33830 7574 6981 gene locus_tag LOCUS_33840 7574 6981 CDS product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 protein_id gnl|my_center|LOCUS_33840 >Feature sequence0282 76 456 gene locus_tag LOCUS_33850 76 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 1280 873 gene locus_tag LOCUS_33860 1280 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 2917 1442 gene locus_tag LOCUS_33870 gene malQ 2917 1442 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028588.1 protein_id gnl|my_center|LOCUS_33870 3947 2931 gene locus_tag LOCUS_33880 3947 2931 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498680.1 protein_id gnl|my_center|LOCUS_33880 4808 3963 gene locus_tag LOCUS_33890 4808 3963 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_33890 5650 4808 gene locus_tag LOCUS_33900 5650 4808 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_33900 7313 5964 gene locus_tag LOCUS_33910 7313 5964 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_33910 >Feature sequence0283 <1 876 gene locus_tag LOCUS_33920 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003425912.1:transcription-repair coupling factor 1029 2174 gene locus_tag LOCUS_33930 1029 2174 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892066.1 protein_id gnl|my_center|LOCUS_33930 3893 2211 gene locus_tag LOCUS_33940 3893 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 5580 3901 gene locus_tag LOCUS_33950 5580 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 5815 7596 gene locus_tag LOCUS_33960 5815 7596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 >Feature sequence0284 4978 29 gene locus_tag LOCUS_33970 4978 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 <7713 4996 gene locus_tag LOCUS_33980 <7713 4996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000753855.1:choline-binding protein PcpA >Feature sequence0285 111 1085 gene locus_tag LOCUS_33990 111 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 1101 1895 gene locus_tag LOCUS_34000 1101 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 1905 2612 gene locus_tag LOCUS_34010 1905 2612 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434127.1 protein_id gnl|my_center|LOCUS_34010 4436 2655 gene locus_tag LOCUS_34020 4436 2655 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678765.1 protein_id gnl|my_center|LOCUS_34020 4699 6357 gene locus_tag LOCUS_34030 4699 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 6714 7109 gene locus_tag LOCUS_34040 gene mscL 6714 7109 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658680.1 protein_id gnl|my_center|LOCUS_34040 7119 7490 gene locus_tag LOCUS_34050 7119 7490 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_34050 7494 7652 gene locus_tag LOCUS_34060 7494 7652 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670545.1 protein_id gnl|my_center|LOCUS_34060 >Feature sequence0286 282 464 gene locus_tag LOCUS_34070 282 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 656 1513 gene locus_tag LOCUS_34080 gene lgt 656 1513 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897834.1 protein_id gnl|my_center|LOCUS_34080 1500 2228 gene locus_tag LOCUS_34090 1500 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 2221 4173 gene locus_tag LOCUS_34100 gene ligA 2221 4173 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_34100 4225 5160 gene locus_tag LOCUS_34110 gene metA 4225 5160 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_34110 5281 6339 gene locus_tag LOCUS_34120 5281 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 6339 7445 gene locus_tag LOCUS_34130 gene aroC 6339 7445 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_34130 >Feature sequence0287 1144 293 gene locus_tag LOCUS_34140 1144 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 1508 1173 gene locus_tag LOCUS_34150 1508 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033414.1 protein_id gnl|my_center|LOCUS_34150 1872 1555 gene locus_tag LOCUS_34160 1872 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 2781 1990 gene locus_tag LOCUS_34170 gene codY 2781 1990 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362579.1 protein_id gnl|my_center|LOCUS_34170 4187 3036 gene locus_tag LOCUS_34180 gene nagA 4187 3036 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292242.1 protein_id gnl|my_center|LOCUS_34180 4903 4178 gene locus_tag LOCUS_34190 gene nagB 4903 4178 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_34190 7483 4916 gene locus_tag LOCUS_34200 gene alaS 7483 4916 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_34200 >Feature sequence0288 <1 777 gene locus_tag LOCUS_34210 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010247013.1:type IV secretory system conjugative DNA transfer family protein 977 1756 gene locus_tag LOCUS_34220 977 1756 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_34220 2302 2427 gene locus_tag LOCUS_34230 2302 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 2500 2835 gene locus_tag LOCUS_34240 2500 2835 CDS product single-strand DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005541371.1 protein_id gnl|my_center|LOCUS_34240 2849 3064 gene locus_tag LOCUS_34250 2849 3064 CDS product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861358.1 protein_id gnl|my_center|LOCUS_34250 3066 3929 gene locus_tag LOCUS_34260 3066 3929 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466908.1 protein_id gnl|my_center|LOCUS_34260 4002 4499 gene locus_tag LOCUS_34270 4002 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 4502 4909 gene locus_tag LOCUS_34280 4502 4909 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860787.1 protein_id gnl|my_center|LOCUS_34280 4869 7346 gene locus_tag LOCUS_34290 4869 7346 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007789938.1 protein_id gnl|my_center|LOCUS_34290 >Feature sequence0289 518 72 gene locus_tag LOCUS_34300 518 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 740 1261 gene locus_tag LOCUS_34310 740 1261 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_34310 1472 3199 gene locus_tag LOCUS_34320 1472 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 3199 4257 gene locus_tag LOCUS_34330 3199 4257 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918104.1 protein_id gnl|my_center|LOCUS_34330 4271 5302 gene locus_tag LOCUS_34340 4271 5302 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836504.1 protein_id gnl|my_center|LOCUS_34340 5302 5706 gene locus_tag LOCUS_34350 5302 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 7169 5778 gene locus_tag LOCUS_34360 7169 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 7273 7593 gene locus_tag LOCUS_34370 7273 7593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 >Feature sequence0290 570 2456 gene locus_tag LOCUS_34380 570 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 2479 3570 gene locus_tag LOCUS_34390 gene vioA 2479 3570 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998544.1 protein_id gnl|my_center|LOCUS_34390 3587 4177 gene locus_tag LOCUS_34400 3587 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 4180 5235 gene locus_tag LOCUS_34410 4180 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 5428 6084 gene locus_tag LOCUS_34420 gene gmhA 5428 6084 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566736.1 protein_id gnl|my_center|LOCUS_34420 6154 7284 gene locus_tag LOCUS_34430 6154 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 7463 7317 gene locus_tag LOCUS_34440 7463 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 >Feature sequence0291 1605 352 gene locus_tag LOCUS_34450 1605 352 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_34450 2907 1609 gene locus_tag LOCUS_34460 2907 1609 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_34460 4977 3028 gene locus_tag LOCUS_34470 4977 3028 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470142.1 protein_id gnl|my_center|LOCUS_34470 5732 4974 gene locus_tag LOCUS_34480 5732 4974 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681851.1 protein_id gnl|my_center|LOCUS_34480 6724 5837 gene locus_tag LOCUS_34490 gene nsaS 6724 5837 CDS product nisin susceptibility-associated two-component system sensor histidine kinase NsaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143425.1 protein_id gnl|my_center|LOCUS_34490 7398 6727 gene locus_tag LOCUS_34500 gene nsaR 7398 6727 CDS product nisin susceptibility-associated two-component system response regulator NsaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697877.1 protein_id gnl|my_center|LOCUS_34500 >Feature sequence0292 4868 3546 gene locus_tag LOCUS_34510 4868 3546 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103412.1 protein_id gnl|my_center|LOCUS_34510 5686 4877 gene locus_tag LOCUS_34520 5686 4877 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289081.1 protein_id gnl|my_center|LOCUS_34520 6380 5820 gene locus_tag LOCUS_34530 gene rfbC 6380 5820 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_34530 <7638 6623 gene locus_tag LOCUS_34540 <7638 6623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002357822.1:molecular chaperone DnaJ >Feature sequence0293 1910 555 gene locus_tag LOCUS_34550 gene brnQ 1910 555 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361550.1 protein_id gnl|my_center|LOCUS_34550 2556 2020 gene locus_tag LOCUS_34560 gene rplQ 2556 2020 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723675.1 protein_id gnl|my_center|LOCUS_34560 3579 2626 gene locus_tag LOCUS_34570 3579 2626 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225835.1 protein_id gnl|my_center|LOCUS_34570 4389 3796 gene locus_tag LOCUS_34580 gene rpsD 4389 3796 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_34580 4803 4405 gene locus_tag LOCUS_34590 gene rpsK 4803 4405 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101799.1 protein_id gnl|my_center|LOCUS_34590 5248 4880 gene locus_tag LOCUS_34600 gene rpsM 5248 4880 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_34600 5698 5480 gene locus_tag LOCUS_34610 gene infA 5698 5480 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689399.1 protein_id gnl|my_center|LOCUS_34610 5969 5691 gene locus_tag LOCUS_34620 5969 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 6740 5985 gene locus_tag LOCUS_34630 gene map 6740 5985 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_34630 7379 6747 gene locus_tag LOCUS_34640 7379 6747 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357697.1 protein_id gnl|my_center|LOCUS_34640 >Feature sequence0294 1469 315 gene locus_tag LOCUS_34650 1469 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 2586 1480 gene locus_tag LOCUS_34660 gene hadC 2586 1480 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_34660 3826 2597 gene locus_tag LOCUS_34670 gene fldB 3826 2597 CDS product phenyllactyl-CoA dehydratase subunit FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048237.1 protein_id gnl|my_center|LOCUS_34670 4627 3857 gene locus_tag LOCUS_34680 gene fldI 4627 3857 CDS product phenyllactyl-CoA dehydratase activase FldI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357618.1 protein_id gnl|my_center|LOCUS_34680 5632 4946 gene locus_tag LOCUS_34690 5632 4946 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970639.1 protein_id gnl|my_center|LOCUS_34690 6237 5755 gene locus_tag LOCUS_34700 6237 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 6641 6453 gene locus_tag LOCUS_34710 6641 6453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 >Feature sequence0295 1092 1652 gene locus_tag LOCUS_34720 1092 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 1880 2986 gene locus_tag LOCUS_34730 1880 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 2997 4775 gene locus_tag LOCUS_34740 2997 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 4775 5479 gene locus_tag LOCUS_34750 4775 5479 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722723.1 protein_id gnl|my_center|LOCUS_34750 5463 6641 gene locus_tag LOCUS_34760 5463 6641 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583204.1 protein_id gnl|my_center|LOCUS_34760 6761 7540 gene locus_tag LOCUS_34770 6761 7540 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234069.1 protein_id gnl|my_center|LOCUS_34770 >Feature sequence0296 153 290 gene locus_tag LOCUS_34780 153 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 398 2995 gene locus_tag LOCUS_34790 398 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 3100 3984 gene locus_tag LOCUS_34800 3100 3984 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285679.1 protein_id gnl|my_center|LOCUS_34800 4891 4196 gene locus_tag LOCUS_34810 4891 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 5074 6489 gene locus_tag LOCUS_34820 5074 6489 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666065.1 protein_id gnl|my_center|LOCUS_34820 7246 6551 gene locus_tag LOCUS_34830 gene ric 7246 6551 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948383.1 protein_id gnl|my_center|LOCUS_34830 >Feature sequence0297 1621 251 gene locus_tag LOCUS_34840 1621 251 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229353.1 protein_id gnl|my_center|LOCUS_34840 2301 1615 gene locus_tag LOCUS_34850 2301 1615 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141952.1 protein_id gnl|my_center|LOCUS_34850 2882 2301 gene locus_tag LOCUS_34860 2882 2301 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368971.1 protein_id gnl|my_center|LOCUS_34860 4634 2910 gene locus_tag LOCUS_34870 4634 2910 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065725.1 protein_id gnl|my_center|LOCUS_34870 6396 4639 gene locus_tag LOCUS_34880 6396 4639 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048173276.1 protein_id gnl|my_center|LOCUS_34880 >Feature sequence0298 639 103 gene locus_tag LOCUS_34890 gene raiA 639 103 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_34890 2290 1079 gene locus_tag LOCUS_34900 2290 1079 CDS product DUF3322 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459256.1 protein_id gnl|my_center|LOCUS_34900 2573 2740 gene locus_tag LOCUS_34910 2573 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 5997 2671 gene locus_tag LOCUS_34920 5997 2671 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392027.1 protein_id gnl|my_center|LOCUS_34920 6569 5994 gene locus_tag LOCUS_34930 6569 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 >Feature sequence0299 <1 2287 gene locus_tag LOCUS_34940 <1 2287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861850.1:helicase-related protein 2292 4646 gene locus_tag LOCUS_34950 2292 4646 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861851.1 protein_id gnl|my_center|LOCUS_34950 4648 6348 gene locus_tag LOCUS_34960 4648 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 7110 7517 gene locus_tag LOCUS_34970 7110 7517 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138156903.1 protein_id gnl|my_center|LOCUS_34970 >Feature sequence0300 1188 340 gene locus_tag LOCUS_34980 1188 340 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289254.1 protein_id gnl|my_center|LOCUS_34980 2076 1222 gene locus_tag LOCUS_34990 2076 1222 CDS product tagatose-bisphosphate aldolase subunit GatY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861804.1 protein_id gnl|my_center|LOCUS_34990 3295 2096 gene locus_tag LOCUS_35000 3295 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 4180 3320 gene locus_tag LOCUS_35010 4180 3320 CDS product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431312.1 protein_id gnl|my_center|LOCUS_35010 5036 4200 gene locus_tag LOCUS_35020 5036 4200 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532946.1 protein_id gnl|my_center|LOCUS_35020 5924 5040 gene locus_tag LOCUS_35030 5924 5040 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532947.1 protein_id gnl|my_center|LOCUS_35030 7307 5982 gene locus_tag LOCUS_35040 7307 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 >Feature sequence0301 2044 539 gene locus_tag LOCUS_35050 2044 539 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437761.1 protein_id gnl|my_center|LOCUS_35050 3081 2050 gene locus_tag LOCUS_35060 gene cobD 3081 2050 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926914.1 protein_id gnl|my_center|LOCUS_35060 3829 3068 gene locus_tag LOCUS_35070 gene cobM 3829 3068 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016784.1 protein_id gnl|my_center|LOCUS_35070 4458 3814 gene locus_tag LOCUS_35080 4458 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 5601 4843 gene locus_tag LOCUS_35090 gene cobS 5601 4843 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680312.1 protein_id gnl|my_center|LOCUS_35090 6122 5598 gene locus_tag LOCUS_35100 gene cobU 6122 5598 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338347.1 protein_id gnl|my_center|LOCUS_35100 7276 6119 gene locus_tag LOCUS_35110 gene cobT 7276 6119 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_35110 >Feature sequence0302 663 2144 gene locus_tag LOCUS_35120 663 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272391.1 protein_id gnl|my_center|LOCUS_35120 2159 2488 gene locus_tag LOCUS_35130 2159 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 2490 2780 gene locus_tag LOCUS_35140 2490 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 2780 3109 gene locus_tag LOCUS_35150 2780 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 3109 3747 gene locus_tag LOCUS_35160 3109 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 3744 4211 gene locus_tag LOCUS_35170 3744 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 4211 4573 gene locus_tag LOCUS_35180 4211 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 4560 6014 gene locus_tag LOCUS_35190 4560 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460135.1 protein_id gnl|my_center|LOCUS_35190 6014 6529 gene locus_tag LOCUS_35200 6014 6529 CDS product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004840221.1 protein_id gnl|my_center|LOCUS_35200 6625 6945 gene locus_tag LOCUS_35210 6625 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 6948 7097 gene locus_tag LOCUS_35220 6948 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 >Feature sequence0303 1692 406 gene locus_tag LOCUS_35230 1692 406 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_35230 2943 2104 gene locus_tag LOCUS_35240 2943 2104 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775600.1 protein_id gnl|my_center|LOCUS_35240 3533 2940 gene locus_tag LOCUS_35250 3533 2940 CDS product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 protein_id gnl|my_center|LOCUS_35250 4263 3814 gene locus_tag LOCUS_35260 4263 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 4614 4264 gene locus_tag LOCUS_35270 4614 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 7334 4611 gene locus_tag LOCUS_35280 7334 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 >Feature sequence0304 582 46 gene locus_tag LOCUS_35290 gene raiA 582 46 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_35290 2238 1012 gene locus_tag LOCUS_35300 2238 1012 CDS product DUF3322 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459256.1 protein_id gnl|my_center|LOCUS_35300 5554 2225 gene locus_tag LOCUS_35310 5554 2225 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392027.1 protein_id gnl|my_center|LOCUS_35310 6126 5551 gene locus_tag LOCUS_35320 6126 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 7367 6126 gene locus_tag LOCUS_35330 7367 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 >Feature sequence0305 1706 840 gene locus_tag LOCUS_35340 1706 840 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888897.1 protein_id gnl|my_center|LOCUS_35340 3061 1694 gene locus_tag LOCUS_35350 3061 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 3951 3301 gene locus_tag LOCUS_35360 3951 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 5314 4295 gene locus_tag LOCUS_35370 5314 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 6462 5311 gene locus_tag LOCUS_35380 gene hemW 6462 5311 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454756.1 protein_id gnl|my_center|LOCUS_35380 <7477 6480 gene locus_tag LOCUS_35390 <7477 6480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003416556.1:translation elongation factor 4 >Feature sequence0306 461 1210 gene locus_tag LOCUS_35400 461 1210 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242850.1 protein_id gnl|my_center|LOCUS_35400 1345 1563 gene locus_tag LOCUS_35410 1345 1563 CDS product DUF1902 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666045.1 protein_id gnl|my_center|LOCUS_35410 1563 1757 gene locus_tag LOCUS_35420 1563 1757 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681551.1 protein_id gnl|my_center|LOCUS_35420 1810 2421 gene locus_tag LOCUS_35430 1810 2421 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966864.1 protein_id gnl|my_center|LOCUS_35430 2423 3073 gene locus_tag LOCUS_35440 gene sdaAB 2423 3073 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671219.1 protein_id gnl|my_center|LOCUS_35440 3066 3929 gene locus_tag LOCUS_35450 gene sdaAA 3066 3929 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_35450 4023 4766 gene locus_tag LOCUS_35460 4023 4766 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 protein_id gnl|my_center|LOCUS_35460 4784 5194 gene locus_tag LOCUS_35470 4784 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 5191 6135 gene locus_tag LOCUS_35480 5191 6135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 6144 7037 gene locus_tag LOCUS_35490 gene cdaA 6144 7037 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_35490 >Feature sequence0307 302 619 gene locus_tag LOCUS_35500 gene rpsJ 302 619 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357250.1 protein_id gnl|my_center|LOCUS_35500 676 1356 gene locus_tag LOCUS_35510 gene rplC 676 1356 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966412.1 protein_id gnl|my_center|LOCUS_35510 1382 2002 gene locus_tag LOCUS_35520 gene rplD 1382 2002 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_35520 2002 2301 gene locus_tag LOCUS_35530 gene rplW 2002 2301 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966410.1 protein_id gnl|my_center|LOCUS_35530 2377 3222 gene locus_tag LOCUS_35540 gene rplB 2377 3222 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701306.1 protein_id gnl|my_center|LOCUS_35540 3234 3512 gene locus_tag LOCUS_35550 gene rpsS 3234 3512 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357326.1 protein_id gnl|my_center|LOCUS_35550 3542 3931 gene locus_tag LOCUS_35560 gene rplV 3542 3931 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081826.1 protein_id gnl|my_center|LOCUS_35560 3944 4600 gene locus_tag LOCUS_35570 gene rpsC 3944 4600 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_35570 4603 5040 gene locus_tag LOCUS_35580 gene rplP 4603 5040 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_35580 5030 5236 gene locus_tag LOCUS_35590 gene rpmC 5030 5236 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722500.1 protein_id gnl|my_center|LOCUS_35590 5255 5512 gene locus_tag LOCUS_35600 gene rpsQ 5255 5512 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357552.1 protein_id gnl|my_center|LOCUS_35600 5534 5902 gene locus_tag LOCUS_35610 gene rplN 5534 5902 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892852.1 protein_id gnl|my_center|LOCUS_35610 5916 6221 gene locus_tag LOCUS_35620 gene rplX 5916 6221 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728539.1 protein_id gnl|my_center|LOCUS_35620 6242 6781 gene locus_tag LOCUS_35630 gene rplE 6242 6781 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_35630 6799 6984 gene locus_tag LOCUS_35640 6799 6984 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393924.1 protein_id gnl|my_center|LOCUS_35640 7045 7446 gene locus_tag LOCUS_35650 gene rpsH 7045 7446 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357687.1 protein_id gnl|my_center|LOCUS_35650 >Feature sequence0308 855 70 gene locus_tag LOCUS_35660 gene trpA 855 70 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_35660 2044 848 gene locus_tag LOCUS_35670 gene trpB 2044 848 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966435.1 protein_id gnl|my_center|LOCUS_35670 2660 2037 gene locus_tag LOCUS_35680 2660 2037 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_35680 3438 2653 gene locus_tag LOCUS_35690 gene trpC 3438 2653 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_35690 4530 3520 gene locus_tag LOCUS_35700 gene trpD 4530 3520 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_35700 5297 4728 gene locus_tag LOCUS_35710 5297 4728 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966439.1 protein_id gnl|my_center|LOCUS_35710 6784 5297 gene locus_tag LOCUS_35720 gene trpE 6784 5297 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 protein_id gnl|my_center|LOCUS_35720 >Feature sequence0309 772 2 gene locus_tag LOCUS_35730 gene trpA 772 2 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_35730 1955 765 gene locus_tag LOCUS_35740 gene trpB 1955 765 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_35740 2550 1942 gene locus_tag LOCUS_35750 2550 1942 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_35750 3334 2537 gene locus_tag LOCUS_35760 gene trpC 3334 2537 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_35760 4343 3327 gene locus_tag LOCUS_35770 gene trpD 4343 3327 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_35770 4912 4340 gene locus_tag LOCUS_35780 4912 4340 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966439.1 protein_id gnl|my_center|LOCUS_35780 6360 4909 gene locus_tag LOCUS_35790 gene trpE 6360 4909 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 protein_id gnl|my_center|LOCUS_35790 7383 6370 gene locus_tag LOCUS_35800 gene aroF 7383 6370 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_35800 >Feature sequence0310 1354 278 gene locus_tag LOCUS_35810 1354 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 2759 1518 gene locus_tag LOCUS_35820 2759 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 4169 3177 gene locus_tag LOCUS_35830 4169 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 4642 4166 gene locus_tag LOCUS_35840 4642 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 5653 4688 gene locus_tag LOCUS_35850 5653 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 6475 5699 gene locus_tag LOCUS_35860 6475 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 >Feature sequence0311 150 19 gene locus_tag LOCUS_35870 150 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 1332 217 gene locus_tag LOCUS_35880 1332 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 1616 1461 gene locus_tag LOCUS_35890 1616 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 2408 1716 gene locus_tag LOCUS_35900 2408 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 4335 2842 gene locus_tag LOCUS_35910 4335 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 6482 4797 gene locus_tag LOCUS_35920 6482 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 7054 6482 gene locus_tag LOCUS_35930 7054 6482 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_35930 >Feature sequence0312 447 1 gene locus_tag LOCUS_35940 gene dtd 447 1 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547036.1 protein_id gnl|my_center|LOCUS_35940 961 458 gene locus_tag LOCUS_35950 gene greA 961 458 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399078.1 protein_id gnl|my_center|LOCUS_35950 1559 1155 gene locus_tag LOCUS_35960 1559 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 3018 1612 gene locus_tag LOCUS_35970 gene atpD 3018 1612 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_35970 3909 3046 gene locus_tag LOCUS_35980 gene atpG 3909 3046 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_35980 5424 3925 gene locus_tag LOCUS_35990 gene atpA 5424 3925 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462231.1 protein_id gnl|my_center|LOCUS_35990 6034 5486 gene locus_tag LOCUS_36000 6034 5486 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931712.1 protein_id gnl|my_center|LOCUS_36000 6537 6022 gene locus_tag LOCUS_36010 6537 6022 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931713.1 protein_id gnl|my_center|LOCUS_36010 6817 6560 gene locus_tag LOCUS_36020 gene atpE 6817 6560 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 protein_id gnl|my_center|LOCUS_36020 >Feature sequence0313 <1 990 gene locus_tag LOCUS_36030 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775387.1:zinc ABC transporter substrate-binding protein 993 1706 gene locus_tag LOCUS_36040 993 1706 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678718.1 protein_id gnl|my_center|LOCUS_36040 1723 2601 gene locus_tag LOCUS_36050 1723 2601 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775385.1 protein_id gnl|my_center|LOCUS_36050 2606 3712 gene locus_tag LOCUS_36060 2606 3712 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678716.1 protein_id gnl|my_center|LOCUS_36060 3727 4368 gene locus_tag LOCUS_36070 3727 4368 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358896.1 protein_id gnl|my_center|LOCUS_36070 4480 4854 gene locus_tag LOCUS_36080 4480 4854 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_36080 4851 5750 gene locus_tag LOCUS_36090 4851 5750 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_36090 >Feature sequence0314 168 1058 gene locus_tag LOCUS_36100 168 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 1578 1114 gene locus_tag LOCUS_36110 gene moaC 1578 1114 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454438.1 protein_id gnl|my_center|LOCUS_36110 2622 1591 gene locus_tag LOCUS_36120 2622 1591 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_36120 3307 2624 gene locus_tag LOCUS_36130 gene modB 3307 2624 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888685.1 protein_id gnl|my_center|LOCUS_36130 4190 3285 gene locus_tag LOCUS_36140 gene modA 4190 3285 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243706.1 protein_id gnl|my_center|LOCUS_36140 5145 4216 gene locus_tag LOCUS_36150 5145 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 6022 5150 gene locus_tag LOCUS_36160 gene moaA 6022 5150 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546124.1 protein_id gnl|my_center|LOCUS_36160 7158 6130 gene locus_tag LOCUS_36170 7158 6130 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144034111.1 protein_id gnl|my_center|LOCUS_36170 >Feature sequence0315 484 2118 gene locus_tag LOCUS_36180 484 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016608.1 protein_id gnl|my_center|LOCUS_36180 2121 5183 gene locus_tag LOCUS_36190 2121 5183 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016607.1 protein_id gnl|my_center|LOCUS_36190 5307 5969 gene locus_tag LOCUS_36200 5307 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 7219 6128 gene locus_tag LOCUS_36210 7219 6128 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_36210 >Feature sequence0316 1558 596 gene locus_tag LOCUS_36220 1558 596 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963746.1 protein_id gnl|my_center|LOCUS_36220 3055 1577 gene locus_tag LOCUS_36230 3055 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 4092 3079 gene locus_tag LOCUS_36240 4092 3079 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860722.1 protein_id gnl|my_center|LOCUS_36240 5593 4094 gene locus_tag LOCUS_36250 5593 4094 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582804.1 protein_id gnl|my_center|LOCUS_36250 6735 5737 gene locus_tag LOCUS_36260 6735 5737 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975799.1 protein_id gnl|my_center|LOCUS_36260 >Feature sequence0317 2958 469 gene locus_tag LOCUS_36270 gene clpC 2958 469 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971183.1 protein_id gnl|my_center|LOCUS_36270 4002 2971 gene locus_tag LOCUS_36280 4002 2971 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 protein_id gnl|my_center|LOCUS_36280 4561 3992 gene locus_tag LOCUS_36290 4561 3992 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421255.1 protein_id gnl|my_center|LOCUS_36290 4959 4570 gene locus_tag LOCUS_36300 4959 4570 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963919.1 protein_id gnl|my_center|LOCUS_36300 5856 5425 gene locus_tag LOCUS_36310 5856 5425 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004309783.1 protein_id gnl|my_center|LOCUS_36310 7177 5879 gene locus_tag LOCUS_36320 7177 5879 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_36320 >Feature sequence0318 880 2112 gene locus_tag LOCUS_36330 880 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 2135 2773 gene locus_tag LOCUS_36340 2135 2773 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262393.1 protein_id gnl|my_center|LOCUS_36340 2777 3514 gene locus_tag LOCUS_36350 2777 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 3524 3802 gene locus_tag LOCUS_36360 3524 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 3802 4992 gene locus_tag LOCUS_36370 3802 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 5013 6089 gene locus_tag LOCUS_36380 5013 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 6215 7240 gene locus_tag LOCUS_36390 6215 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 >Feature sequence0319 162 1124 gene locus_tag LOCUS_36400 162 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 1134 2132 gene locus_tag LOCUS_36410 1134 2132 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965779.1 protein_id gnl|my_center|LOCUS_36410 2136 2738 gene locus_tag LOCUS_36420 2136 2738 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889235.1 protein_id gnl|my_center|LOCUS_36420 3134 2835 gene locus_tag LOCUS_36430 3134 2835 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720075.1 protein_id gnl|my_center|LOCUS_36430 3283 4251 gene locus_tag LOCUS_36440 gene potA 3283 4251 CDS product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720321.1 protein_id gnl|my_center|LOCUS_36440 4241 5095 gene locus_tag LOCUS_36450 gene potB 4241 5095 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261915.1 protein_id gnl|my_center|LOCUS_36450 5092 5859 gene locus_tag LOCUS_36460 5092 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36460 5886 6992 gene locus_tag LOCUS_36470 5886 6992 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984738.1 protein_id gnl|my_center|LOCUS_36470 7051 7275 gene locus_tag LOCUS_36480 7051 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 >Feature sequence0320 1 1500 gene locus_tag LOCUS_36490 1 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 1587 2402 gene locus_tag LOCUS_36500 1587 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 2480 4009 gene locus_tag LOCUS_36510 2480 4009 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549479.1 protein_id gnl|my_center|LOCUS_36510 4002 5069 gene locus_tag LOCUS_36520 4002 5069 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969639.1 protein_id gnl|my_center|LOCUS_36520 5066 5995 gene locus_tag LOCUS_36530 5066 5995 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_36530 6019 7068 gene locus_tag LOCUS_36540 6019 7068 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989701.1 protein_id gnl|my_center|LOCUS_36540 >Feature sequence0321 845 2386 gene locus_tag LOCUS_36550 845 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 2398 3231 gene locus_tag LOCUS_36560 2398 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 3235 4329 gene locus_tag LOCUS_36570 3235 4329 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_36570 4339 6567 gene locus_tag LOCUS_36580 4339 6567 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109016.1 protein_id gnl|my_center|LOCUS_36580 >Feature sequence0322 181 50 gene locus_tag LOCUS_36590 181 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 264 1130 gene locus_tag LOCUS_36600 264 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 1292 3310 gene locus_tag LOCUS_36610 1292 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 3342 5396 gene locus_tag LOCUS_36620 3342 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 >Feature sequence0323 866 72 gene locus_tag LOCUS_36630 866 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 1634 975 gene locus_tag LOCUS_36640 1634 975 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904004.1 protein_id gnl|my_center|LOCUS_36640 2282 3967 gene locus_tag LOCUS_36650 2282 3967 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904005.1 protein_id gnl|my_center|LOCUS_36650 4049 5395 gene locus_tag LOCUS_36660 4049 5395 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490912.1 protein_id gnl|my_center|LOCUS_36660 5564 6595 gene locus_tag LOCUS_36670 gene hrcA 5564 6595 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_36670 6608 7225 gene locus_tag LOCUS_36680 gene grpE 6608 7225 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_36680 >Feature sequence0324 2131 347 gene locus_tag LOCUS_36690 2131 347 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671107.1 protein_id gnl|my_center|LOCUS_36690 3954 2125 gene locus_tag LOCUS_36700 3954 2125 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_36700 4718 5809 gene locus_tag LOCUS_36710 4718 5809 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_36710 5790 6557 gene locus_tag LOCUS_36720 5790 6557 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_36720 6580 7188 gene locus_tag LOCUS_36730 6580 7188 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_36730 >Feature sequence0325 3190 2594 gene locus_tag LOCUS_36740 gene recR 3190 2594 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_36740 3534 3190 gene locus_tag LOCUS_36750 3534 3190 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_36750 5093 3546 gene locus_tag LOCUS_36760 gene dnaX 5093 3546 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421622.1 protein_id gnl|my_center|LOCUS_36760 6187 5105 gene locus_tag LOCUS_36770 6187 5105 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201892.1 protein_id gnl|my_center|LOCUS_36770 6403 6329 gene locus_tag LOCUS_t00210 6403 6329 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0326 1299 253 gene locus_tag LOCUS_36780 1299 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 2801 1299 gene locus_tag LOCUS_36790 2801 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 3761 3123 gene locus_tag LOCUS_36800 3761 3123 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964398.1 protein_id gnl|my_center|LOCUS_36800 4102 3830 gene locus_tag LOCUS_36810 4102 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 4961 4116 gene locus_tag LOCUS_36820 4961 4116 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108784.1 protein_id gnl|my_center|LOCUS_36820 5828 4971 gene locus_tag LOCUS_36830 5828 4971 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_36830 6457 5843 gene locus_tag LOCUS_36840 6457 5843 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052445.1 protein_id gnl|my_center|LOCUS_36840 <7210 6596 gene locus_tag LOCUS_36850 <7210 6596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458920.1:cation-translocating P-type ATPase >Feature sequence0327 146 520 gene locus_tag LOCUS_36860 146 520 CDS product GrdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897539.1 protein_id gnl|my_center|LOCUS_36860 607 924 gene locus_tag LOCUS_36870 607 924 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416870.1 protein_id gnl|my_center|LOCUS_36870 1176 2462 gene locus_tag LOCUS_36880 1176 2462 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416871.1 protein_id gnl|my_center|LOCUS_36880 2515 2979 gene locus_tag LOCUS_36890 gene grdA 2515 2979 CDS product glycine/sarcosine/betaine reductase complex selenoprotein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012064674.1 transl_except (pos:2644..2646,aa:Sec) note codon on position 44 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_36890 3006 4313 gene locus_tag LOCUS_36900 gene grdB 3006 4313 CDS product glycine reductase complex selenoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861534.1 transl_except (pos:4050..4052,aa:Sec) note codon on position 349 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_36900 4339 5874 gene locus_tag LOCUS_36910 gene grdC 4339 5874 CDS product glycine/sarcosine/betaine reductase complex component C subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897537.1 protein_id gnl|my_center|LOCUS_36910 5886 7040 gene locus_tag LOCUS_36920 gene grdD 5886 7040 CDS product glycine/sarcosine/betaine reductase complex component C subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430750.1 protein_id gnl|my_center|LOCUS_36920 >Feature sequence0328 <1 1355 gene locus_tag LOCUS_36930 <1 1355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459230.1:BREX-1 system adenine-specific DNA-methyltransferase PglX 1387 1818 gene locus_tag LOCUS_36940 1387 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 1819 4341 gene locus_tag LOCUS_36950 gene pglZ 1819 4341 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022339.1 protein_id gnl|my_center|LOCUS_36950 4381 5448 gene locus_tag LOCUS_36960 gene cobT 4381 5448 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_36960 5740 6264 gene locus_tag LOCUS_36970 gene cobU 5740 6264 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202889.1 protein_id gnl|my_center|LOCUS_36970 6251 7003 gene locus_tag LOCUS_36980 gene cobS 6251 7003 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437766.1 protein_id gnl|my_center|LOCUS_36980 >Feature sequence0329 2708 420 gene locus_tag LOCUS_36990 gene lon 2708 420 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435613.1 protein_id gnl|my_center|LOCUS_36990 4045 2762 gene locus_tag LOCUS_37000 gene clpX 4045 2762 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_37000 4636 4055 gene locus_tag LOCUS_37010 gene clpP 4636 4055 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965928.1 protein_id gnl|my_center|LOCUS_37010 6005 4719 gene locus_tag LOCUS_37020 gene tig 6005 4719 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_37020 6385 6843 gene locus_tag LOCUS_37030 6385 6843 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962372.1 protein_id gnl|my_center|LOCUS_37030 >Feature sequence0330 <1 1415 gene locus_tag LOCUS_37040 <1 1415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000432606.1:sugar ABC transporter ATP-binding protein 1417 2445 gene locus_tag LOCUS_37050 gene lsrC 1417 2445 CDS product autoinducer 2 ABC transporter permease LsrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209191.1 protein_id gnl|my_center|LOCUS_37050 2438 3454 gene locus_tag LOCUS_37060 2438 3454 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878507.1 protein_id gnl|my_center|LOCUS_37060 3506 4669 gene locus_tag LOCUS_37070 gene lsrB 3506 4669 CDS product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823631.1 protein_id gnl|my_center|LOCUS_37070 4730 5614 gene locus_tag LOCUS_37080 gene lsrF 4730 5614 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933433.1 protein_id gnl|my_center|LOCUS_37080 >Feature sequence0331 257 1939 gene locus_tag LOCUS_37090 257 1939 CDS product DUF2142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963353.1 protein_id gnl|my_center|LOCUS_37090 2042 3709 gene locus_tag LOCUS_37100 2042 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 3847 4641 gene locus_tag LOCUS_37110 3847 4641 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917001.1 protein_id gnl|my_center|LOCUS_37110 4650 6500 gene locus_tag LOCUS_37120 4650 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 >Feature sequence0332 3600 1846 gene locus_tag LOCUS_37130 3600 1846 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_37130 4819 3593 gene locus_tag LOCUS_37140 4819 3593 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681391.1 protein_id gnl|my_center|LOCUS_37140 5128 4835 gene locus_tag LOCUS_37150 5128 4835 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016687.1 protein_id gnl|my_center|LOCUS_37150 6155 5214 gene locus_tag LOCUS_37160 gene tsf 6155 5214 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_37160 6951 6196 gene locus_tag LOCUS_37170 gene rpsB 6951 6196 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111485.1 protein_id gnl|my_center|LOCUS_37170 >Feature sequence0333 1336 719 gene locus_tag LOCUS_37180 1336 719 CDS product phage scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047641.1 protein_id gnl|my_center|LOCUS_37180 1636 1475 gene locus_tag LOCUS_37190 1636 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 4257 1633 gene locus_tag LOCUS_37200 4257 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 5704 4244 gene locus_tag LOCUS_37210 5704 4244 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861027.1 protein_id gnl|my_center|LOCUS_37210 6993 5701 gene locus_tag LOCUS_37220 6993 5701 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_37220 >Feature sequence0334 158 1480 gene locus_tag LOCUS_37230 158 1480 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896135.1 protein_id gnl|my_center|LOCUS_37230 1803 2444 gene locus_tag LOCUS_37240 gene deoC 1803 2444 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439345.1 protein_id gnl|my_center|LOCUS_37240 2657 3361 gene locus_tag LOCUS_37250 2657 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 3487 4647 gene locus_tag LOCUS_37260 3487 4647 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_37260 4653 5618 gene locus_tag LOCUS_37270 gene add 4653 5618 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368573.1 protein_id gnl|my_center|LOCUS_37270 6190 7011 gene locus_tag LOCUS_37280 6190 7011 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861146.1 protein_id gnl|my_center|LOCUS_37280 >Feature sequence0335 1984 1664 gene locus_tag LOCUS_37290 1984 1664 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898763.1 protein_id gnl|my_center|LOCUS_37290 2942 1977 gene locus_tag LOCUS_37300 2942 1977 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439726.1 protein_id gnl|my_center|LOCUS_37300 3550 2954 gene locus_tag LOCUS_37310 3550 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 4073 3582 gene locus_tag LOCUS_37320 4073 3582 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_37320 6132 4066 gene locus_tag LOCUS_37330 6132 4066 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898067.1 protein_id gnl|my_center|LOCUS_37330 6471 6148 gene locus_tag LOCUS_37340 6471 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 >Feature sequence0336 170 1462 gene locus_tag LOCUS_37350 170 1462 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836619.1 protein_id gnl|my_center|LOCUS_37350 1893 2246 gene locus_tag LOCUS_37360 1893 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 2511 3119 gene locus_tag LOCUS_37370 2511 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 3183 3881 gene locus_tag LOCUS_37380 3183 3881 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437036.1 protein_id gnl|my_center|LOCUS_37380 3878 5149 gene locus_tag LOCUS_37390 3878 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 5517 6377 gene locus_tag LOCUS_37400 5517 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016828.1 protein_id gnl|my_center|LOCUS_37400 >Feature sequence0337 220 582 gene locus_tag LOCUS_37410 220 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 1024 1287 gene locus_tag LOCUS_37420 1024 1287 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812614.1 protein_id gnl|my_center|LOCUS_37420 1280 1582 gene locus_tag LOCUS_37430 1280 1582 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812612.1 protein_id gnl|my_center|LOCUS_37430 1843 2910 gene locus_tag LOCUS_37440 gene uxuA 1843 2910 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082566.1 protein_id gnl|my_center|LOCUS_37440 3138 3707 gene locus_tag LOCUS_37450 3138 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 3857 4294 gene locus_tag LOCUS_37460 3857 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 4391 5326 gene locus_tag LOCUS_37470 4391 5326 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966723.1 protein_id gnl|my_center|LOCUS_37470 5507 5971 gene locus_tag LOCUS_37480 5507 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 6089 6781 gene locus_tag LOCUS_37490 6089 6781 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970639.1 protein_id gnl|my_center|LOCUS_37490 >Feature sequence0338 66 1412 gene locus_tag LOCUS_37500 66 1412 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440033.1 protein_id gnl|my_center|LOCUS_37500 1828 2550 gene locus_tag LOCUS_37510 1828 2550 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 protein_id gnl|my_center|LOCUS_37510 2550 3830 gene locus_tag LOCUS_37520 2550 3830 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860860.1 protein_id gnl|my_center|LOCUS_37520 4261 4641 gene locus_tag LOCUS_37530 4261 4641 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_37530 4649 5194 gene locus_tag LOCUS_37540 4649 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 5528 5692 gene locus_tag LOCUS_37550 5528 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 5931 6338 gene locus_tag LOCUS_37560 5931 6338 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002933016.1 protein_id gnl|my_center|LOCUS_37560 >Feature sequence0339 1498 881 gene locus_tag LOCUS_37570 1498 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 1472 1750 gene locus_tag LOCUS_37580 1472 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 1802 2041 gene locus_tag LOCUS_37590 1802 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 2156 2284 gene locus_tag LOCUS_37600 2156 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 2678 3589 gene locus_tag LOCUS_37610 2678 3589 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775137.1 protein_id gnl|my_center|LOCUS_37610 3714 5981 gene locus_tag LOCUS_37620 gene metE 3714 5981 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864555.1 protein_id gnl|my_center|LOCUS_37620 6104 6406 gene locus_tag LOCUS_37630 gene citD 6104 6406 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547011.1 protein_id gnl|my_center|LOCUS_37630 6403 6849 gene locus_tag LOCUS_37640 6403 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37640 6856 7077 gene locus_tag LOCUS_37650 6856 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37650 >Feature sequence0340 2020 893 gene locus_tag LOCUS_37660 2020 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 3360 2299 gene locus_tag LOCUS_37670 3360 2299 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986692.1 protein_id gnl|my_center|LOCUS_37670 4158 3373 gene locus_tag LOCUS_37680 gene etfB 4158 3373 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986693.1 protein_id gnl|my_center|LOCUS_37680 5337 4204 gene locus_tag LOCUS_37690 gene acdB 5337 4204 CDS product putative isocaproyl-CoA dehydrogenase AcdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986694.1 protein_id gnl|my_center|LOCUS_37690 6571 5450 gene locus_tag LOCUS_37700 6571 5450 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986695.1 protein_id gnl|my_center|LOCUS_37700 >Feature sequence0341 <1 1652 gene locus_tag LOCUS_37710 <1 1652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963395.1:acyltransferase family protein 1663 2442 gene locus_tag LOCUS_37720 1663 2442 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_37720 2455 3198 gene locus_tag LOCUS_37730 2455 3198 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 protein_id gnl|my_center|LOCUS_37730 3191 4264 gene locus_tag LOCUS_37740 3191 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 4278 5258 gene locus_tag LOCUS_37750 gene pglE 4278 5258 CDS product (galactosaminyl)2-N,N'-diacetylbacillosaminyl-alpha1-diphospho-di-trans,octa-cis-undecaprenol synthase PglE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704837.1 protein_id gnl|my_center|LOCUS_37750 >Feature sequence0342 893 66 gene locus_tag LOCUS_37760 893 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 1714 905 gene locus_tag LOCUS_37770 1714 905 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_37770 3599 1683 gene locus_tag LOCUS_37780 gene dxs 3599 1683 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_37780 4553 3645 gene locus_tag LOCUS_37790 4553 3645 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_37790 4767 4573 gene locus_tag LOCUS_37800 4767 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 5977 4760 gene locus_tag LOCUS_37810 gene xseA 5977 4760 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_37810 6644 6216 gene locus_tag LOCUS_37820 gene nusB 6644 6216 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_37820 >Feature sequence0343 <1 2264 gene locus_tag LOCUS_37830 <1 2264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861890.1:valine--tRNA ligase 2279 2425 gene locus_tag LOCUS_37840 2279 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 2425 3744 gene locus_tag LOCUS_37850 2425 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 6625 3992 gene locus_tag LOCUS_37860 6625 3992 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880372.1 protein_id gnl|my_center|LOCUS_37860 >Feature sequence0344 526 194 gene locus_tag LOCUS_37870 526 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 3429 610 gene locus_tag LOCUS_37880 gene uvrA 3429 610 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_37880 3804 5576 gene locus_tag LOCUS_37890 3804 5576 CDS product glycerophosphoryl diester phosphodiesterase membrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822589.1 protein_id gnl|my_center|LOCUS_37890 6671 5547 gene locus_tag LOCUS_37900 6671 5547 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_37900 >Feature sequence0345 331 945 gene locus_tag LOCUS_37910 331 945 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582751.1 protein_id gnl|my_center|LOCUS_37910 1053 2822 gene locus_tag LOCUS_37920 1053 2822 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948724.1 protein_id gnl|my_center|LOCUS_37920 2819 4543 gene locus_tag LOCUS_37930 2819 4543 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202746.1 protein_id gnl|my_center|LOCUS_37930 4569 5159 gene locus_tag LOCUS_37940 4569 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 5159 5887 gene locus_tag LOCUS_37950 5159 5887 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922610.1 protein_id gnl|my_center|LOCUS_37950 5884 6882 gene locus_tag LOCUS_37960 5884 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 >Feature sequence0346 116 661 gene locus_tag LOCUS_37970 116 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 725 1315 gene locus_tag LOCUS_37980 725 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37980 1772 3148 gene locus_tag LOCUS_37990 1772 3148 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679363.1 protein_id gnl|my_center|LOCUS_37990 3234 4451 gene locus_tag LOCUS_38000 3234 4451 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455004.1 protein_id gnl|my_center|LOCUS_38000 5281 4574 gene locus_tag LOCUS_38010 5281 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 5861 6319 gene locus_tag LOCUS_38020 5861 6319 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001861299.1 protein_id gnl|my_center|LOCUS_38020 >Feature sequence0347 316 1014 gene locus_tag LOCUS_38030 316 1014 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706813.1 protein_id gnl|my_center|LOCUS_38030 1046 2335 gene locus_tag LOCUS_38040 1046 2335 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989565.1 protein_id gnl|my_center|LOCUS_38040 2414 3331 gene locus_tag LOCUS_38050 2414 3331 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_38050 3352 4185 gene locus_tag LOCUS_38060 3352 4185 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223061.1 protein_id gnl|my_center|LOCUS_38060 4188 5738 gene locus_tag LOCUS_38070 4188 5738 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 protein_id gnl|my_center|LOCUS_38070 5965 6087 gene locus_tag LOCUS_38080 5965 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 >Feature sequence0348 1567 182 gene locus_tag LOCUS_38090 1567 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 2587 1748 gene locus_tag LOCUS_38100 2587 1748 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873680.1 protein_id gnl|my_center|LOCUS_38100 2858 2544 gene locus_tag LOCUS_38110 2858 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 3291 2995 gene locus_tag LOCUS_38120 3291 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 4023 3397 gene locus_tag LOCUS_38130 4023 3397 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329401.1 protein_id gnl|my_center|LOCUS_38130 5302 4313 gene locus_tag LOCUS_38140 5302 4313 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986275.1 protein_id gnl|my_center|LOCUS_38140 6158 5289 gene locus_tag LOCUS_38150 gene lipA 6158 5289 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222888.1 protein_id gnl|my_center|LOCUS_38150 6576 6343 gene locus_tag LOCUS_38160 6576 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 >Feature sequence0349 283 47 gene locus_tag LOCUS_38170 gene acpP 283 47 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_38170 1289 297 gene locus_tag LOCUS_38180 gene plsX 1289 297 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_38180 1660 1406 gene locus_tag LOCUS_38190 1660 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 2666 1662 gene locus_tag LOCUS_38200 gene cbiG 2666 1662 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948632.1 protein_id gnl|my_center|LOCUS_38200 3493 2663 gene locus_tag LOCUS_38210 3493 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 4689 3583 gene locus_tag LOCUS_38220 gene rpsA 4689 3583 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986222.1 protein_id gnl|my_center|LOCUS_38220 5518 4670 gene locus_tag LOCUS_38230 5518 4670 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439450.1 protein_id gnl|my_center|LOCUS_38230 6186 5515 gene locus_tag LOCUS_38240 gene cmk 6186 5515 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 protein_id gnl|my_center|LOCUS_38240 <6931 6179 gene locus_tag LOCUS_38250 <6931 6179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965154.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence0350 1023 616 gene locus_tag LOCUS_38260 1023 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 1710 1087 gene locus_tag LOCUS_38270 gene scpB 1710 1087 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_38270 2501 1707 gene locus_tag LOCUS_38280 2501 1707 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965361.1 protein_id gnl|my_center|LOCUS_38280 3470 2604 gene locus_tag LOCUS_38290 3470 2604 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888897.1 protein_id gnl|my_center|LOCUS_38290 4804 3458 gene locus_tag LOCUS_38300 4804 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 5731 5072 gene locus_tag LOCUS_38310 5731 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 >Feature sequence0351 1347 415 gene locus_tag LOCUS_38320 1347 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 2614 1358 gene locus_tag LOCUS_38330 gene yidC 2614 1358 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777156.1 protein_id gnl|my_center|LOCUS_38330 2907 2671 gene locus_tag LOCUS_38340 gene yidD 2907 2671 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081754.1 protein_id gnl|my_center|LOCUS_38340 3241 2888 gene locus_tag LOCUS_38350 gene rnpA 3241 2888 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_38350 3538 3404 gene locus_tag LOCUS_38360 3538 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 4286 3657 gene locus_tag LOCUS_38370 4286 3657 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 protein_id gnl|my_center|LOCUS_38370 4807 6195 gene locus_tag LOCUS_38380 gene dnaA 4807 6195 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963330.1 protein_id gnl|my_center|LOCUS_38380 >Feature sequence0352 1488 1036 gene locus_tag LOCUS_38390 1488 1036 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_38390 2795 1500 gene locus_tag LOCUS_38400 2795 1500 CDS product DUF4026 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453709.1 protein_id gnl|my_center|LOCUS_38400 4303 2795 gene locus_tag LOCUS_38410 4303 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 5909 4518 gene locus_tag LOCUS_38420 5909 4518 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681107.1 protein_id gnl|my_center|LOCUS_38420 6578 6138 gene locus_tag LOCUS_38430 6578 6138 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993892.1 protein_id gnl|my_center|LOCUS_38430 >Feature sequence0353 706 350 gene locus_tag LOCUS_38440 gene mobC 706 350 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426139.1 protein_id gnl|my_center|LOCUS_38440 1483 929 gene locus_tag LOCUS_38450 1483 929 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092482714.1 protein_id gnl|my_center|LOCUS_38450 1893 1483 gene locus_tag LOCUS_38460 1893 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 2086 2649 gene locus_tag LOCUS_38470 2086 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 2932 3345 gene locus_tag LOCUS_38480 2932 3345 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426191.1 protein_id gnl|my_center|LOCUS_38480 3957 4157 gene locus_tag LOCUS_38490 3957 4157 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905235.1 protein_id gnl|my_center|LOCUS_38490 4254 5504 gene locus_tag LOCUS_38500 4254 5504 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610375.1 protein_id gnl|my_center|LOCUS_38500 5660 6127 gene locus_tag LOCUS_38510 5660 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 6353 6664 gene locus_tag LOCUS_38520 6353 6664 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811036.1 protein_id gnl|my_center|LOCUS_38520 >Feature sequence0354 314 96 gene locus_tag LOCUS_38530 gene infA 314 96 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_38530 568 293 gene locus_tag LOCUS_38540 568 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 1323 565 gene locus_tag LOCUS_38550 gene map 1323 565 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_38550 1980 1339 gene locus_tag LOCUS_38560 1980 1339 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_38560 3373 2057 gene locus_tag LOCUS_38570 gene secY 3373 2057 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_38570 3813 3373 gene locus_tag LOCUS_38580 gene rplO 3813 3373 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_38580 4009 3830 gene locus_tag LOCUS_38590 gene rpmD 4009 3830 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_38590 4531 4022 gene locus_tag LOCUS_38600 gene rpsE 4531 4022 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003328273.1 protein_id gnl|my_center|LOCUS_38600 4917 4549 gene locus_tag LOCUS_38610 gene rplR 4917 4549 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_38610 5475 4933 gene locus_tag LOCUS_38620 gene rplF 5475 4933 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_38620 6006 5605 gene locus_tag LOCUS_38630 gene rpsH 6006 5605 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_38630 6251 6066 gene locus_tag LOCUS_38640 6251 6066 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_38640 6808 6269 gene locus_tag LOCUS_38650 gene rplE 6808 6269 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_38650 >Feature sequence0355 <1 759 gene locus_tag LOCUS_38660 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003426579.1:Holliday junction branch migration DNA helicase RuvB 776 2065 gene locus_tag LOCUS_38670 776 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 2081 3115 gene locus_tag LOCUS_38680 gene queA 2081 3115 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_38680 3957 3181 gene locus_tag LOCUS_38690 3957 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 5266 3938 gene locus_tag LOCUS_38700 5266 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 5715 5278 gene locus_tag LOCUS_38710 5715 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 <6875 6064 gene locus_tag LOCUS_38720 <6875 6064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003429485.1:DNA-directed RNA polymerase subunit beta' >Feature sequence0356 245 1534 gene locus_tag LOCUS_38730 245 1534 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948768.1 protein_id gnl|my_center|LOCUS_38730 1536 2393 gene locus_tag LOCUS_38740 1536 2393 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948769.1 protein_id gnl|my_center|LOCUS_38740 2395 3201 gene locus_tag LOCUS_38750 2395 3201 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948770.1 protein_id gnl|my_center|LOCUS_38750 3307 4236 gene locus_tag LOCUS_38760 3307 4236 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948771.1 protein_id gnl|my_center|LOCUS_38760 4352 4513 gene locus_tag LOCUS_38770 4352 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 4527 5399 gene locus_tag LOCUS_38780 4527 5399 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986930.1 protein_id gnl|my_center|LOCUS_38780 5526 6740 gene locus_tag LOCUS_38790 5526 6740 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_38790 >Feature sequence0357 103 285 gene locus_tag LOCUS_38800 103 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 535 1209 gene locus_tag LOCUS_38810 535 1209 CDS product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889567.1 protein_id gnl|my_center|LOCUS_38810 1209 2171 gene locus_tag LOCUS_38820 1209 2171 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433654.1 protein_id gnl|my_center|LOCUS_38820 2195 2842 gene locus_tag LOCUS_38830 gene pcp 2195 2842 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866927.1 protein_id gnl|my_center|LOCUS_38830 3066 3674 gene locus_tag LOCUS_38840 3066 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964077.1 protein_id gnl|my_center|LOCUS_38840 3676 4239 gene locus_tag LOCUS_38850 3676 4239 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964078.1 protein_id gnl|my_center|LOCUS_38850 4648 5796 gene locus_tag LOCUS_38860 4648 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 5803 6339 gene locus_tag LOCUS_38870 5803 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 6527 6766 gene locus_tag LOCUS_38880 6527 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 >Feature sequence0358 1415 6 gene locus_tag LOCUS_38890 1415 6 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028321.1 protein_id gnl|my_center|LOCUS_38890 2239 1412 gene locus_tag LOCUS_38900 2239 1412 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256268.1 protein_id gnl|my_center|LOCUS_38900 3117 2248 gene locus_tag LOCUS_38910 3117 2248 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256269.1 protein_id gnl|my_center|LOCUS_38910 4484 3183 gene locus_tag LOCUS_38920 4484 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 5945 4497 gene locus_tag LOCUS_38930 5945 4497 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296810.1 protein_id gnl|my_center|LOCUS_38930 >Feature sequence0359 1444 92 gene locus_tag LOCUS_38940 1444 92 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_38940 1907 1482 gene locus_tag LOCUS_38950 gene fabZ 1907 1482 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048424.1 protein_id gnl|my_center|LOCUS_38950 2372 1917 gene locus_tag LOCUS_38960 gene accB 2372 1917 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966835.1 protein_id gnl|my_center|LOCUS_38960 3619 2381 gene locus_tag LOCUS_38970 gene fabF 3619 2381 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_38970 4590 3847 gene locus_tag LOCUS_38980 gene fabG 4590 3847 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_38980 5563 4643 gene locus_tag LOCUS_38990 gene fabD 5563 4643 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_38990 6617 5676 gene locus_tag LOCUS_39000 gene fabK 6617 5676 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_39000 6854 6723 gene locus_tag LOCUS_39010 6854 6723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 >Feature sequence0360 784 1119 gene locus_tag LOCUS_tm00010 784 1119 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1267 1875 gene locus_tag LOCUS_39020 gene lexA 1267 1875 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208755.1 protein_id gnl|my_center|LOCUS_39020 2270 1920 gene locus_tag LOCUS_39030 gene rplS 2270 1920 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_39030 2860 2408 gene locus_tag LOCUS_39040 2860 2408 CDS product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793164.1 protein_id gnl|my_center|LOCUS_39040 3290 2850 gene locus_tag LOCUS_39050 3290 2850 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861965.1 protein_id gnl|my_center|LOCUS_39050 3584 3964 gene locus_tag LOCUS_39060 3584 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 5237 4383 gene locus_tag LOCUS_39070 5237 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 6727 5264 gene locus_tag LOCUS_39080 6727 5264 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_39080 >Feature sequence0361 <1 629 gene locus_tag LOCUS_39090 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393881.1:class II fructose-1,6-bisphosphate aldolase 652 1500 gene locus_tag LOCUS_39100 652 1500 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080056.1 protein_id gnl|my_center|LOCUS_39100 2788 2294 gene locus_tag LOCUS_39110 2788 2294 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435609.1 protein_id gnl|my_center|LOCUS_39110 3371 2769 gene locus_tag LOCUS_39120 3371 2769 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357527.1 protein_id gnl|my_center|LOCUS_39120 4537 3386 gene locus_tag LOCUS_39130 4537 3386 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423769.1 protein_id gnl|my_center|LOCUS_39130 5075 4521 gene locus_tag LOCUS_39140 gene yfcE 5075 4521 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966036.1 protein_id gnl|my_center|LOCUS_39140 5664 5077 gene locus_tag LOCUS_39150 5664 5077 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947081.1 protein_id gnl|my_center|LOCUS_39150 6665 5697 gene locus_tag LOCUS_39160 gene holA 6665 5697 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282563.1 protein_id gnl|my_center|LOCUS_39160 >Feature sequence0362 2499 1075 gene locus_tag LOCUS_39170 2499 1075 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_39170 3158 2496 gene locus_tag LOCUS_39180 3158 2496 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871221.1 protein_id gnl|my_center|LOCUS_39180 5440 3158 gene locus_tag LOCUS_39190 5440 3158 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_39190 5812 5690 gene locus_tag LOCUS_39200 5812 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 6616 5873 gene locus_tag LOCUS_39210 6616 5873 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948000.1 protein_id gnl|my_center|LOCUS_39210 6697 6828 gene locus_tag LOCUS_39220 6697 6828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 >Feature sequence0363 132 205 gene locus_tag LOCUS_t00220 132 205 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 497 655 gene locus_tag LOCUS_39230 497 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 846 637 gene locus_tag LOCUS_39240 846 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 878 997 gene locus_tag LOCUS_39250 878 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 1582 2799 gene locus_tag LOCUS_39260 gene megL 1582 2799 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_39260 2826 3620 gene locus_tag LOCUS_39270 2826 3620 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057194.1 protein_id gnl|my_center|LOCUS_39270 3915 5042 gene locus_tag LOCUS_39280 3915 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 5097 5861 gene locus_tag LOCUS_39290 5097 5861 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748363.1 protein_id gnl|my_center|LOCUS_39290 6102 6683 gene locus_tag LOCUS_39300 6102 6683 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986495.1 protein_id gnl|my_center|LOCUS_39300 >Feature sequence0364 277 1995 gene locus_tag LOCUS_39310 277 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 2018 3211 gene locus_tag LOCUS_39320 2018 3211 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430617.1 protein_id gnl|my_center|LOCUS_39320 3236 4192 gene locus_tag LOCUS_39330 3236 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 4687 4355 gene locus_tag LOCUS_39340 4687 4355 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047981.1 protein_id gnl|my_center|LOCUS_39340 6294 4765 gene locus_tag LOCUS_39350 6294 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 6764 6345 gene locus_tag LOCUS_39360 6764 6345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 >Feature sequence0365 243 1472 gene locus_tag LOCUS_39370 243 1472 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108668.1 protein_id gnl|my_center|LOCUS_39370 1465 2163 gene locus_tag LOCUS_39380 1465 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 2195 3616 gene locus_tag LOCUS_39390 2195 3616 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011285619.1 protein_id gnl|my_center|LOCUS_39390 3678 4163 gene locus_tag LOCUS_39400 3678 4163 CDS product DUF4355 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288694.1 protein_id gnl|my_center|LOCUS_39400 4167 5048 gene locus_tag LOCUS_39410 4167 5048 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922461.1 protein_id gnl|my_center|LOCUS_39410 5051 5236 gene locus_tag LOCUS_39420 5051 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 5245 5652 gene locus_tag LOCUS_39430 5245 5652 CDS product phage Gp19/Gp15/Gp42 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180800.1 protein_id gnl|my_center|LOCUS_39430 5630 5971 gene locus_tag LOCUS_39440 5630 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093651380.1 protein_id gnl|my_center|LOCUS_39440 5964 6197 gene locus_tag LOCUS_39450 5964 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 6194 6532 gene locus_tag LOCUS_39460 6194 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573598.1 protein_id gnl|my_center|LOCUS_39460 >Feature sequence0366 <1 1235 gene locus_tag LOCUS_39470 <1 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965043.1:ATP-dependent DNA helicase RecG 1246 2805 gene locus_tag LOCUS_39480 1246 2805 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_39480 2809 3363 gene locus_tag LOCUS_39490 gene rsmD 2809 3363 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_39490 3366 3869 gene locus_tag LOCUS_39500 gene coaD 3366 3869 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074274.1 protein_id gnl|my_center|LOCUS_39500 3862 4527 gene locus_tag LOCUS_39510 3862 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454870.1 protein_id gnl|my_center|LOCUS_39510 4594 6000 gene locus_tag LOCUS_39520 4594 6000 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_39520 6000 6701 gene locus_tag LOCUS_39530 6000 6701 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989966.1 protein_id gnl|my_center|LOCUS_39530 >Feature sequence0367 >Feature sequence0368 196 1395 gene locus_tag LOCUS_39540 gene coaBC 196 1395 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911730.1 protein_id gnl|my_center|LOCUS_39540 1395 2984 gene locus_tag LOCUS_39550 1395 2984 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_39550 2997 4400 gene locus_tag LOCUS_39560 gene pepV 2997 4400 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459801.1 protein_id gnl|my_center|LOCUS_39560 4409 5431 gene locus_tag LOCUS_39570 gene metN 4409 5431 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242531.1 protein_id gnl|my_center|LOCUS_39570 5433 6080 gene locus_tag LOCUS_39580 5433 6080 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112597.1 protein_id gnl|my_center|LOCUS_39580 >Feature sequence0369 3766 725 gene locus_tag LOCUS_39590 3766 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 4989 3838 gene locus_tag LOCUS_39600 4989 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 5232 5618 gene locus_tag LOCUS_39610 5232 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 6457 5672 gene locus_tag LOCUS_39620 gene proC 6457 5672 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 protein_id gnl|my_center|LOCUS_39620 >Feature sequence0370 1565 906 gene locus_tag LOCUS_39630 gene sdaAB 1565 906 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671219.1 protein_id gnl|my_center|LOCUS_39630 3434 1572 gene locus_tag LOCUS_39640 3434 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 3887 3525 gene locus_tag LOCUS_39650 3887 3525 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104332.1 protein_id gnl|my_center|LOCUS_39650 4649 3891 gene locus_tag LOCUS_39660 4649 3891 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989811.1 protein_id gnl|my_center|LOCUS_39660 6308 4671 gene locus_tag LOCUS_39670 6308 4671 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_39670 >Feature sequence0371 1402 1695 gene locus_tag LOCUS_39680 1402 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 1688 2740 gene locus_tag LOCUS_39690 1688 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 2972 4501 gene locus_tag LOCUS_39700 2972 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 4899 5084 gene locus_tag LOCUS_39710 4899 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 5093 6142 gene locus_tag LOCUS_39720 5093 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 >Feature sequence0372 342 1232 gene locus_tag LOCUS_39730 342 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 1348 2277 gene locus_tag LOCUS_39740 1348 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 2288 4000 gene locus_tag LOCUS_39750 2288 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 4043 5095 gene locus_tag LOCUS_39760 4043 5095 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388243.1 protein_id gnl|my_center|LOCUS_39760 <6700 5379 gene locus_tag LOCUS_39770 <6700 5379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203365.1:VWA domain-containing protein >Feature sequence0373 3774 2959 gene locus_tag LOCUS_39780 3774 2959 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_39780 4361 3786 gene locus_tag LOCUS_39790 gene rsxA 4361 3786 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_39790 5101 4361 gene locus_tag LOCUS_39800 5101 4361 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761246.1 protein_id gnl|my_center|LOCUS_39800 5722 5111 gene locus_tag LOCUS_39810 5722 5111 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869097.1 protein_id gnl|my_center|LOCUS_39810 6678 5719 gene locus_tag LOCUS_39820 6678 5719 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_39820 >Feature sequence0374 331 699 gene locus_tag LOCUS_39830 gene acpS 331 699 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963811.1 protein_id gnl|my_center|LOCUS_39830 717 1595 gene locus_tag LOCUS_39840 717 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 1582 2760 gene locus_tag LOCUS_39850 gene alr 1582 2760 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048315.1 protein_id gnl|my_center|LOCUS_39850 2802 4136 gene locus_tag LOCUS_39860 2802 4136 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_39860 4156 5514 gene locus_tag LOCUS_39870 4156 5514 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_39870 5561 6289 gene locus_tag LOCUS_39880 5561 6289 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_39880 6291 6467 gene locus_tag LOCUS_39890 6291 6467 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405297.1 protein_id gnl|my_center|LOCUS_39890 >Feature sequence0375 456 1667 gene locus_tag LOCUS_39900 456 1667 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_39900 1652 2347 gene locus_tag LOCUS_39910 gene azlC 1652 2347 CDS product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969035.1 protein_id gnl|my_center|LOCUS_39910 2340 2669 gene locus_tag LOCUS_39920 gene azlD 2340 2669 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_39920 2740 4014 gene locus_tag LOCUS_39930 2740 4014 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442178.1 protein_id gnl|my_center|LOCUS_39930 5270 4077 gene locus_tag LOCUS_39940 5270 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 5964 5392 gene locus_tag LOCUS_39950 5964 5392 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964199.1 protein_id gnl|my_center|LOCUS_39950 6392 6144 gene locus_tag LOCUS_39960 6392 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 >Feature sequence0376 3 182 gene locus_tag LOCUS_39970 3 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 263 1762 gene locus_tag LOCUS_39980 263 1762 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_39980 1759 2820 gene locus_tag LOCUS_39990 1759 2820 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_39990 2810 3829 gene locus_tag LOCUS_40000 gene yjfF 2810 3829 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815317.1 protein_id gnl|my_center|LOCUS_40000 >Feature sequence0377 975 58 gene locus_tag LOCUS_40010 975 58 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867268.1 protein_id gnl|my_center|LOCUS_40010 1904 981 gene locus_tag LOCUS_40020 1904 981 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_40020 3616 1988 gene locus_tag LOCUS_40030 3616 1988 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868765.1 protein_id gnl|my_center|LOCUS_40030 5789 3744 gene locus_tag LOCUS_40040 5789 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 6049 5965 gene locus_tag LOCUS_t00230 6049 5965 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6142 6072 gene locus_tag LOCUS_t00240 6142 6072 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6237 6163 gene locus_tag LOCUS_t00250 6237 6163 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0378 554 1216 gene locus_tag LOCUS_40050 554 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 1226 3820 gene locus_tag LOCUS_40060 gene clpB 1226 3820 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_40060 4537 3929 gene locus_tag LOCUS_40070 4537 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 >Feature sequence0379 <1 611 gene locus_tag LOCUS_40080 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726619.1:protein phosphatase 2C domain-containing protein 704 1237 gene locus_tag LOCUS_40090 704 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 1286 3064 gene locus_tag LOCUS_40100 1286 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 3194 5245 gene locus_tag LOCUS_40110 3194 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 5276 6613 gene locus_tag LOCUS_40120 5276 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 >Feature sequence0380 <1 656 gene locus_tag LOCUS_40130 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263595.1:AEC family transporter 901 1059 gene locus_tag LOCUS_40140 901 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 1213 1593 gene locus_tag LOCUS_40150 1213 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 1753 2265 gene locus_tag LOCUS_40160 1753 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 2543 3136 gene locus_tag LOCUS_40170 2543 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 4322 3429 gene locus_tag LOCUS_40180 4322 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 4723 5571 gene locus_tag LOCUS_40190 4723 5571 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_40190 <6645 5699 gene locus_tag LOCUS_40200 <6645 5699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015878.1:short-chain fatty acid transporter >Feature sequence0381 675 1652 gene locus_tag LOCUS_40210 675 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 1793 2827 gene locus_tag LOCUS_40220 1793 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 2974 3972 gene locus_tag LOCUS_40230 2974 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 4158 5159 gene locus_tag LOCUS_40240 4158 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 5229 6242 gene locus_tag LOCUS_40250 5229 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 >Feature sequence0382 1565 3016 gene locus_tag LOCUS_40260 1565 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 3151 3819 gene locus_tag LOCUS_40270 3151 3819 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713757.1 protein_id gnl|my_center|LOCUS_40270 >Feature sequence0383 2305 83 gene locus_tag LOCUS_40280 gene priA 2305 83 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_40280 3690 2308 gene locus_tag LOCUS_40290 3690 2308 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272578.1 protein_id gnl|my_center|LOCUS_40290 5153 3690 gene locus_tag LOCUS_40300 5153 3690 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_40300 6594 5332 gene locus_tag LOCUS_40310 6594 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 >Feature sequence0384 477 2012 gene locus_tag LOCUS_40320 477 2012 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_40320 2009 3202 gene locus_tag LOCUS_40330 2009 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 3195 3881 gene locus_tag LOCUS_40340 gene cobI 3195 3881 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 protein_id gnl|my_center|LOCUS_40340 3878 4609 gene locus_tag LOCUS_40350 gene cobJ 3878 4609 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903755.1 protein_id gnl|my_center|LOCUS_40350 4602 5351 gene locus_tag LOCUS_40360 gene cobK 4602 5351 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915112.1 protein_id gnl|my_center|LOCUS_40360 5364 6572 gene locus_tag LOCUS_40370 5364 6572 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943626.1 protein_id gnl|my_center|LOCUS_40370 >Feature sequence0385 427 1440 gene locus_tag LOCUS_40380 427 1440 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_40380 1528 2457 gene locus_tag LOCUS_40390 gene rbsK 1528 2457 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_40390 2506 2946 gene locus_tag LOCUS_40400 2506 2946 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993892.1 protein_id gnl|my_center|LOCUS_40400 2959 4044 gene locus_tag LOCUS_40410 2959 4044 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_40410 4064 5575 gene locus_tag LOCUS_40420 4064 5575 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582804.1 protein_id gnl|my_center|LOCUS_40420 5585 6553 gene locus_tag LOCUS_40430 5585 6553 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583990.1 protein_id gnl|my_center|LOCUS_40430 >Feature sequence0386 1515 73 gene locus_tag LOCUS_40440 gene gtfA 1515 73 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775657.1 protein_id gnl|my_center|LOCUS_40440 1785 1636 gene locus_tag LOCUS_40450 1785 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 1896 3122 gene locus_tag LOCUS_40460 1896 3122 CDS product IS110-like element ISDha12 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808714.1 protein_id gnl|my_center|LOCUS_40460 3820 3242 gene locus_tag LOCUS_40470 3820 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 3969 3823 gene locus_tag LOCUS_40480 3969 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 5670 4402 gene locus_tag LOCUS_40490 5670 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 6395 5670 gene locus_tag LOCUS_40500 6395 5670 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 protein_id gnl|my_center|LOCUS_40500 >Feature sequence0387 1827 1387 gene locus_tag LOCUS_40510 1827 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678829.1 protein_id gnl|my_center|LOCUS_40510 2930 2001 gene locus_tag LOCUS_40520 2930 2001 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003822229.1 protein_id gnl|my_center|LOCUS_40520 6166 2996 gene locus_tag LOCUS_40530 6166 2996 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390017.1 protein_id gnl|my_center|LOCUS_40530 >Feature sequence0388 1018 269 gene locus_tag LOCUS_40540 1018 269 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023383.1 protein_id gnl|my_center|LOCUS_40540 2239 1019 gene locus_tag LOCUS_40550 2239 1019 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990827.1 protein_id gnl|my_center|LOCUS_40550 3008 2259 gene locus_tag LOCUS_40560 3008 2259 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065320.1 protein_id gnl|my_center|LOCUS_40560 3601 3005 gene locus_tag LOCUS_40570 3601 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 3516 3773 gene locus_tag LOCUS_40580 3516 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 6455 4785 gene locus_tag LOCUS_40590 6455 4785 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430205.1 protein_id gnl|my_center|LOCUS_40590 >Feature sequence0389 929 312 gene locus_tag LOCUS_40600 929 312 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_40600 2345 960 gene locus_tag LOCUS_40610 2345 960 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_40610 4124 2358 gene locus_tag LOCUS_40620 4124 2358 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876586.1 protein_id gnl|my_center|LOCUS_40620 4710 4117 gene locus_tag LOCUS_40630 4710 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 5051 4743 gene locus_tag LOCUS_40640 5051 4743 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_40640 5493 5065 gene locus_tag LOCUS_40650 5493 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 <6526 5677 gene locus_tag LOCUS_40660 <6526 5677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869273.1:V-type ATPase 116kDa subunit family protein >Feature sequence0390 1363 326 gene locus_tag LOCUS_40670 1363 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 1627 1367 gene locus_tag LOCUS_40680 1627 1367 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612434.1 protein_id gnl|my_center|LOCUS_40680 2949 1627 gene locus_tag LOCUS_40690 2949 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 4252 3203 gene locus_tag LOCUS_40700 4252 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 5501 4518 gene locus_tag LOCUS_40710 5501 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 5744 6079 gene locus_tag LOCUS_40720 5744 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 >Feature sequence0391 189 2477 gene locus_tag LOCUS_40730 189 2477 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_40730 2477 3139 gene locus_tag LOCUS_40740 2477 3139 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871221.1 protein_id gnl|my_center|LOCUS_40740 3136 4560 gene locus_tag LOCUS_40750 3136 4560 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_40750 4547 5806 gene locus_tag LOCUS_40760 gene hisS 4547 5806 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964121.1 protein_id gnl|my_center|LOCUS_40760 >Feature sequence0392 2270 945 gene locus_tag LOCUS_40770 2270 945 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357628.1 protein_id gnl|my_center|LOCUS_40770 3462 2374 gene locus_tag LOCUS_40780 3462 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 4592 3789 gene locus_tag LOCUS_40790 gene dapF 4592 3789 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_40790 5162 4611 gene locus_tag LOCUS_40800 5162 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 <6505 5205 gene locus_tag LOCUS_40810 <6505 5205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003231737.1:type I glutamate--ammonia ligase >Feature sequence0393 436 1716 gene locus_tag LOCUS_40820 gene cls 436 1716 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571549.1 protein_id gnl|my_center|LOCUS_40820 1735 2478 gene locus_tag LOCUS_40830 1735 2478 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948182.1 protein_id gnl|my_center|LOCUS_40830 2485 3474 gene locus_tag LOCUS_40840 2485 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 3499 4773 gene locus_tag LOCUS_40850 3499 4773 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_40850 4787 6304 gene locus_tag LOCUS_40860 4787 6304 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814148.1 protein_id gnl|my_center|LOCUS_40860 >Feature sequence0394 268 1143 gene locus_tag LOCUS_40870 gene aroE 268 1143 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870596.1 protein_id gnl|my_center|LOCUS_40870 1216 1533 gene locus_tag LOCUS_40880 gene trxA 1216 1533 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_40880 1536 1952 gene locus_tag LOCUS_40890 1536 1952 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289215.1 protein_id gnl|my_center|LOCUS_40890 2163 2774 gene locus_tag LOCUS_40900 2163 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964077.1 protein_id gnl|my_center|LOCUS_40900 2779 3198 gene locus_tag LOCUS_40910 2779 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 3522 4754 gene locus_tag LOCUS_40920 3522 4754 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681571.1 protein_id gnl|my_center|LOCUS_40920 4754 5446 gene locus_tag LOCUS_40930 4754 5446 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672626.1 protein_id gnl|my_center|LOCUS_40930 5447 6457 gene locus_tag LOCUS_40940 5447 6457 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681570.1 protein_id gnl|my_center|LOCUS_40940 >Feature sequence0395 777 505 gene locus_tag LOCUS_40950 777 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 3050 849 gene locus_tag LOCUS_40960 gene pcrA 3050 849 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163769.1 protein_id gnl|my_center|LOCUS_40960 4004 3111 gene locus_tag LOCUS_40970 4004 3111 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_40970 4675 4220 gene locus_tag LOCUS_40980 4675 4220 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_40980 5546 4677 gene locus_tag LOCUS_40990 5546 4677 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459274.1 protein_id gnl|my_center|LOCUS_40990 6079 5585 gene locus_tag LOCUS_41000 6079 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 >Feature sequence0396 <1 1162 gene locus_tag LOCUS_41010 <1 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064243020.1:substrate-binding domain-containing protein 1209 2714 gene locus_tag LOCUS_41020 1209 2714 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582804.1 protein_id gnl|my_center|LOCUS_41020 2695 3654 gene locus_tag LOCUS_41030 2695 3654 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707197.1 protein_id gnl|my_center|LOCUS_41030 3673 4848 gene locus_tag LOCUS_41040 3673 4848 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161951924.1 protein_id gnl|my_center|LOCUS_41040 4845 5759 gene locus_tag LOCUS_41050 4845 5759 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_41050 >Feature sequence0397 5669 4002 gene locus_tag LOCUS_41060 5669 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 >Feature sequence0398 2602 1583 gene locus_tag LOCUS_41070 2602 1583 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170440.1 protein_id gnl|my_center|LOCUS_41070 3554 2613 gene locus_tag LOCUS_41080 3554 2613 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860722.1 protein_id gnl|my_center|LOCUS_41080 5062 3557 gene locus_tag LOCUS_41090 5062 3557 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582804.1 protein_id gnl|my_center|LOCUS_41090 6341 5193 gene locus_tag LOCUS_41100 6341 5193 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298583.1 protein_id gnl|my_center|LOCUS_41100 >Feature sequence0399 100 219 gene locus_tag LOCUS_41110 100 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 227 2884 gene locus_tag LOCUS_41120 gene alaS 227 2884 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986885.1 protein_id gnl|my_center|LOCUS_41120 2894 3619 gene locus_tag LOCUS_41130 gene nagB 2894 3619 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_41130 3610 4773 gene locus_tag LOCUS_41140 gene nagA 3610 4773 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292242.1 protein_id gnl|my_center|LOCUS_41140 5027 5812 gene locus_tag LOCUS_41150 gene codY 5027 5812 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965092.1 protein_id gnl|my_center|LOCUS_41150 5923 6240 gene locus_tag LOCUS_41160 5923 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 >Feature sequence0400 283 762 gene locus_tag LOCUS_41170 283 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 772 2061 gene locus_tag LOCUS_41180 772 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 2180 3133 gene locus_tag LOCUS_41190 2180 3133 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969404.1 protein_id gnl|my_center|LOCUS_41190 3135 4001 gene locus_tag LOCUS_41200 gene aroE 3135 4001 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989932.1 protein_id gnl|my_center|LOCUS_41200 4383 5207 gene locus_tag LOCUS_41210 4383 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 5380 6198 gene locus_tag LOCUS_41220 5380 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 >Feature sequence0401 2304 724 gene locus_tag LOCUS_41230 2304 724 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901104.1 protein_id gnl|my_center|LOCUS_41230 3185 2391 gene locus_tag LOCUS_41240 3185 2391 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903784.1 protein_id gnl|my_center|LOCUS_41240 4125 3175 gene locus_tag LOCUS_41250 4125 3175 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016909.1 protein_id gnl|my_center|LOCUS_41250 5229 4291 gene locus_tag LOCUS_41260 5229 4291 CDS product FMN-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254509.1 protein_id gnl|my_center|LOCUS_41260 >Feature sequence0402 326 706 gene locus_tag LOCUS_41270 326 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 711 2084 gene locus_tag LOCUS_41280 711 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 2303 2992 gene locus_tag LOCUS_41290 2303 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 3222 3794 gene locus_tag LOCUS_41300 3222 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 3795 4604 gene locus_tag LOCUS_41310 3795 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 4795 6207 gene locus_tag LOCUS_41320 4795 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 >Feature sequence0403 351 115 gene locus_tag LOCUS_41330 351 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 512 1870 gene locus_tag LOCUS_41340 gene trkA 512 1870 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_41340 1870 3318 gene locus_tag LOCUS_41350 1870 3318 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_41350 3400 4434 gene locus_tag LOCUS_41360 3400 4434 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356948.1 protein_id gnl|my_center|LOCUS_41360 4427 5107 gene locus_tag LOCUS_41370 4427 5107 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293786.1 protein_id gnl|my_center|LOCUS_41370 5179 6084 gene locus_tag LOCUS_41380 5179 6084 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383735.1 protein_id gnl|my_center|LOCUS_41380 >Feature sequence0404 459 175 gene locus_tag LOCUS_41390 459 175 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650837.1 protein_id gnl|my_center|LOCUS_41390 2269 614 gene locus_tag LOCUS_41400 2269 614 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948012.1 protein_id gnl|my_center|LOCUS_41400 3273 2248 gene locus_tag LOCUS_41410 3273 2248 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_41410 4353 3283 gene locus_tag LOCUS_41420 gene prfA 4353 3283 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_41420 5212 4379 gene locus_tag LOCUS_41430 gene prmC 5212 4379 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_41430 6140 5214 gene locus_tag LOCUS_41440 6140 5214 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947980.1 protein_id gnl|my_center|LOCUS_41440 >Feature sequence0405 1052 264 gene locus_tag LOCUS_41450 1052 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 2184 1069 gene locus_tag LOCUS_41460 2184 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 3355 2162 gene locus_tag LOCUS_41470 3355 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 4051 3356 gene locus_tag LOCUS_41480 4051 3356 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837642.1 protein_id gnl|my_center|LOCUS_41480 5730 4072 gene locus_tag LOCUS_41490 5730 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 >Feature sequence0406 3257 2943 gene locus_tag LOCUS_41500 3257 2943 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419470.1 protein_id gnl|my_center|LOCUS_41500 3522 3250 gene locus_tag LOCUS_41510 3522 3250 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419469.1 protein_id gnl|my_center|LOCUS_41510 4740 3544 gene locus_tag LOCUS_41520 gene nusA 4740 3544 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_41520 5253 4783 gene locus_tag LOCUS_41530 5253 4783 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_41530 <6307 5519 gene locus_tag LOCUS_41540 <6307 5519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003230615.1:prephenate dehydrogenase >Feature sequence0407 1698 130 gene locus_tag LOCUS_41550 1698 130 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949051.1 protein_id gnl|my_center|LOCUS_41550 2613 1948 gene locus_tag LOCUS_41560 2613 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 3270 2623 gene locus_tag LOCUS_41570 3270 2623 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949054.1 protein_id gnl|my_center|LOCUS_41570 4978 3260 gene locus_tag LOCUS_41580 4978 3260 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861596.1 protein_id gnl|my_center|LOCUS_41580 >Feature sequence0408 1983 448 gene locus_tag LOCUS_41590 1983 448 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816711.1 protein_id gnl|my_center|LOCUS_41590 3352 2144 gene locus_tag LOCUS_41600 3352 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 3743 4747 gene locus_tag LOCUS_41610 3743 4747 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989641.1 protein_id gnl|my_center|LOCUS_41610 5283 4777 gene locus_tag LOCUS_41620 5283 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 <6284 5332 gene locus_tag LOCUS_41630 <6284 5332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080052.1:mannosylglucosylglycerate synthase >Feature sequence0409 1837 554 gene locus_tag LOCUS_41640 1837 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 3585 1840 gene locus_tag LOCUS_41650 3585 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 4780 3839 gene locus_tag LOCUS_41660 4780 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 6138 4789 gene locus_tag LOCUS_41670 6138 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 >Feature sequence0410 107 1210 gene locus_tag LOCUS_41680 gene ribD 107 1210 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284101.1 protein_id gnl|my_center|LOCUS_41680 1210 1905 gene locus_tag LOCUS_41690 1210 1905 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_41690 2082 3281 gene locus_tag LOCUS_41700 2082 3281 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456640.1 protein_id gnl|my_center|LOCUS_41700 3391 3855 gene locus_tag LOCUS_41710 gene ribE 3391 3855 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454467.1 protein_id gnl|my_center|LOCUS_41710 4025 4615 gene locus_tag LOCUS_41720 4025 4615 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546311.1 protein_id gnl|my_center|LOCUS_41720 5121 6206 gene locus_tag LOCUS_41730 5121 6206 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924429.1 protein_id gnl|my_center|LOCUS_41730 >Feature sequence0411 2 967 gene locus_tag LOCUS_41740 2 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 1014 1346 gene locus_tag LOCUS_41750 1014 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 1363 2859 gene locus_tag LOCUS_41760 gene glpK 1363 2859 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_41760 3205 2921 gene locus_tag LOCUS_41770 3205 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 3395 4330 gene locus_tag LOCUS_41780 3395 4330 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454768.1 protein_id gnl|my_center|LOCUS_41780 4335 5378 gene locus_tag LOCUS_41790 4335 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 5439 6083 gene locus_tag LOCUS_41800 5439 6083 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459616.1 protein_id gnl|my_center|LOCUS_41800 >Feature sequence0412 331 621 gene locus_tag LOCUS_41810 331 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 829 2325 gene locus_tag LOCUS_41820 gene ypwA 829 2325 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398513.1 protein_id gnl|my_center|LOCUS_41820 2418 3464 gene locus_tag LOCUS_41830 2418 3464 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 protein_id gnl|my_center|LOCUS_41830 3760 5373 gene locus_tag LOCUS_41840 3760 5373 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_41840 5387 5557 gene locus_tag LOCUS_41850 5387 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 5701 5880 gene locus_tag LOCUS_41860 5701 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 >Feature sequence0413 3612 2476 gene locus_tag LOCUS_41870 3612 2476 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733226.1 protein_id gnl|my_center|LOCUS_41870 3796 4200 gene locus_tag LOCUS_41880 3796 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 4187 4678 gene locus_tag LOCUS_41890 4187 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 4743 5615 gene locus_tag LOCUS_41900 4743 5615 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943315.1 protein_id gnl|my_center|LOCUS_41900 5633 6088 gene locus_tag LOCUS_41910 5633 6088 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_41910 >Feature sequence0414 <1 602 gene locus_tag LOCUS_41920 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001832399.1:urease subunit alpha 679 1119 gene locus_tag LOCUS_41930 679 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 1116 1829 gene locus_tag LOCUS_41940 1116 1829 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565254.1 protein_id gnl|my_center|LOCUS_41940 1844 2458 gene locus_tag LOCUS_41950 gene ureG 1844 2458 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002477667.1 protein_id gnl|my_center|LOCUS_41950 2459 3292 gene locus_tag LOCUS_41960 2459 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 3341 4333 gene locus_tag LOCUS_41970 gene cbiM 3341 4333 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641709.1 protein_id gnl|my_center|LOCUS_41970 4311 5111 gene locus_tag LOCUS_41980 4311 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 5108 5833 gene locus_tag LOCUS_41990 5108 5833 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964091.1 protein_id gnl|my_center|LOCUS_41990 >Feature sequence0415 1253 147 gene locus_tag LOCUS_42000 1253 147 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894435.1 protein_id gnl|my_center|LOCUS_42000 2111 1272 gene locus_tag LOCUS_42010 2111 1272 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898776.1 protein_id gnl|my_center|LOCUS_42010 2995 2108 gene locus_tag LOCUS_42020 2995 2108 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237985.1 protein_id gnl|my_center|LOCUS_42020 4400 3051 gene locus_tag LOCUS_42030 4400 3051 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738763.1 protein_id gnl|my_center|LOCUS_42030 5556 4699 gene locus_tag LOCUS_42040 5556 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 >Feature sequence0416 311 2425 gene locus_tag LOCUS_42050 311 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 2542 4182 gene locus_tag LOCUS_42060 2542 4182 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_42060 4263 5186 gene locus_tag LOCUS_42070 4263 5186 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_42070 5194 6105 gene locus_tag LOCUS_42080 5194 6105 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867268.1 protein_id gnl|my_center|LOCUS_42080 >Feature sequence0417 <1 517 gene locus_tag LOCUS_42090 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459386.1:selenium cofactor biosynthesis protein YqeC 532 1332 gene locus_tag LOCUS_42100 gene yqeB 532 1332 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393498.1 protein_id gnl|my_center|LOCUS_42100 1332 1919 gene locus_tag LOCUS_42110 gene mocA 1332 1919 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047953.1 protein_id gnl|my_center|LOCUS_42110 2245 3513 gene locus_tag LOCUS_42120 2245 3513 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896806.1 protein_id gnl|my_center|LOCUS_42120 3620 5911 gene locus_tag LOCUS_42130 gene xdhA 3620 5911 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_42130 >Feature sequence0418 541 849 gene locus_tag LOCUS_42140 541 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 866 2152 gene locus_tag LOCUS_42150 866 2152 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_42150 2152 3789 gene locus_tag LOCUS_42160 2152 3789 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966231.1 protein_id gnl|my_center|LOCUS_42160 3782 4558 gene locus_tag LOCUS_42170 3782 4558 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989811.1 protein_id gnl|my_center|LOCUS_42170 >Feature sequence0419 3464 1206 gene locus_tag LOCUS_42180 gene glgP 3464 1206 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950133.1 protein_id gnl|my_center|LOCUS_42180 5236 3482 gene locus_tag LOCUS_42190 5236 3482 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262518.1 protein_id gnl|my_center|LOCUS_42190 <6190 5236 gene locus_tag LOCUS_42200 <6190 5236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001167510.1:type I pullulanase >Feature sequence0420 1592 63 gene locus_tag LOCUS_42210 gene gpmI 1592 63 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_42210 2614 1784 gene locus_tag LOCUS_42220 2614 1784 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_42220 3282 2611 gene locus_tag LOCUS_42230 3282 2611 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832763.1 protein_id gnl|my_center|LOCUS_42230 4256 3294 gene locus_tag LOCUS_42240 4256 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 4672 4253 gene locus_tag LOCUS_42250 gene perR 4672 4253 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002002038.1 protein_id gnl|my_center|LOCUS_42250 6082 4868 gene locus_tag LOCUS_42260 6082 4868 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_42260 >Feature sequence0421 3 512 gene locus_tag LOCUS_42270 3 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 499 1476 gene locus_tag LOCUS_42280 499 1476 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048435.1 protein_id gnl|my_center|LOCUS_42280 1532 2710 gene locus_tag LOCUS_42290 1532 2710 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_42290 2720 3433 gene locus_tag LOCUS_42300 2720 3433 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_42300 3457 4233 gene locus_tag LOCUS_42310 3457 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 4261 4455 gene locus_tag LOCUS_42320 4261 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 4491 6119 gene locus_tag LOCUS_42330 4491 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 >Feature sequence0422 1521 169 gene locus_tag LOCUS_42340 1521 169 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103658.1 protein_id gnl|my_center|LOCUS_42340 2330 1617 gene locus_tag LOCUS_42350 2330 1617 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_42350 2415 3473 gene locus_tag LOCUS_42360 2415 3473 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_42360 3814 5142 gene locus_tag LOCUS_42370 3814 5142 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527981.1 protein_id gnl|my_center|LOCUS_42370 5217 6107 gene locus_tag LOCUS_42380 5217 6107 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289132.1 protein_id gnl|my_center|LOCUS_42380 >Feature sequence0423 <1 932 gene locus_tag LOCUS_42390 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986842.1:23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN 969 1697 gene locus_tag LOCUS_42400 969 1697 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_42400 1703 3859 gene locus_tag LOCUS_42410 gene pknB 1703 3859 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986841.1 protein_id gnl|my_center|LOCUS_42410 3861 4739 gene locus_tag LOCUS_42420 gene rsgA 3861 4739 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_42420 4740 5399 gene locus_tag LOCUS_42430 gene rpe 4740 5399 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965037.1 protein_id gnl|my_center|LOCUS_42430 5403 6062 gene locus_tag LOCUS_42440 5403 6062 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965038.1 protein_id gnl|my_center|LOCUS_42440 >Feature sequence0424 1117 20 gene locus_tag LOCUS_42450 gene serC 1117 20 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_42450 2853 1165 gene locus_tag LOCUS_42460 gene ilvB 2853 1165 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_42460 4538 2862 gene locus_tag LOCUS_42470 gene ilvD 4538 2862 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_42470 5660 4575 gene locus_tag LOCUS_42480 gene leuB 5660 4575 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_42480 6039 5911 gene locus_tag LOCUS_42490 6039 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 >Feature sequence0425 2362 2595 gene locus_tag LOCUS_42500 2362 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 2601 2876 gene locus_tag LOCUS_42510 2601 2876 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356545.1 protein_id gnl|my_center|LOCUS_42510 4212 3148 gene locus_tag LOCUS_42520 4212 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 4624 4184 gene locus_tag LOCUS_42530 4624 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 5916 4924 gene locus_tag LOCUS_42540 5916 4924 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986893.1 protein_id gnl|my_center|LOCUS_42540 >Feature sequence0426 1491 61 gene locus_tag LOCUS_42550 1491 61 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608887.1 protein_id gnl|my_center|LOCUS_42550 2488 1493 gene locus_tag LOCUS_42560 2488 1493 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582922.1 protein_id gnl|my_center|LOCUS_42560 3365 2520 gene locus_tag LOCUS_42570 3365 2520 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383582.1 protein_id gnl|my_center|LOCUS_42570 4273 3374 gene locus_tag LOCUS_42580 4273 3374 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032532.1 protein_id gnl|my_center|LOCUS_42580 5667 4339 gene locus_tag LOCUS_42590 5667 4339 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254171.1 protein_id gnl|my_center|LOCUS_42590 >Feature sequence0427 198 1268 gene locus_tag LOCUS_42600 198 1268 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545188.1 protein_id gnl|my_center|LOCUS_42600 1272 3128 gene locus_tag LOCUS_42610 1272 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 4655 3432 gene locus_tag LOCUS_42620 4655 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 5040 4636 gene locus_tag LOCUS_42630 5040 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 5502 5050 gene locus_tag LOCUS_42640 5502 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 >Feature sequence0428 443 261 gene locus_tag LOCUS_42650 443 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 2070 706 gene locus_tag LOCUS_42660 2070 706 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681330.1 protein_id gnl|my_center|LOCUS_42660 4542 2071 gene locus_tag LOCUS_42670 4542 2071 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681327.1 protein_id gnl|my_center|LOCUS_42670 5198 4602 gene locus_tag LOCUS_42680 5198 4602 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681326.1 protein_id gnl|my_center|LOCUS_42680 <6123 5390 gene locus_tag LOCUS_42690 <6123 5390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020582.1:PepSY domain-containing protein >Feature sequence0429 422 1015 gene locus_tag LOCUS_42700 422 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 1016 2851 gene locus_tag LOCUS_42710 gene uvrC 1016 2851 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_42710 2906 3199 gene locus_tag LOCUS_42720 2906 3199 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016687.1 protein_id gnl|my_center|LOCUS_42720 3677 4207 gene locus_tag LOCUS_42730 gene thiW 3677 4207 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829480.1 protein_id gnl|my_center|LOCUS_42730 4201 5016 gene locus_tag LOCUS_42740 gene thiM 4201 5016 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_42740 5003 5638 gene locus_tag LOCUS_42750 gene thiE 5003 5638 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_42750 >Feature sequence0430 1991 1032 gene locus_tag LOCUS_42760 1991 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 2382 3200 gene locus_tag LOCUS_42770 2382 3200 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386049.1 protein_id gnl|my_center|LOCUS_42770 3212 4966 gene locus_tag LOCUS_42780 3212 4966 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047951.1 protein_id gnl|my_center|LOCUS_42780 >Feature sequence0431 <1 593 gene locus_tag LOCUS_42790 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289132.1:sugar ABC transporter permease 586 1392 gene locus_tag LOCUS_42800 586 1392 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289130.1 protein_id gnl|my_center|LOCUS_42800 1492 4647 gene locus_tag LOCUS_42810 1492 4647 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475723.1 protein_id gnl|my_center|LOCUS_42810 4869 5891 gene locus_tag LOCUS_42820 4869 5891 CDS product DUF4325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682079.1 protein_id gnl|my_center|LOCUS_42820 >Feature sequence0432 1359 529 gene locus_tag LOCUS_42830 gene modA 1359 529 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860975.1 protein_id gnl|my_center|LOCUS_42830 2361 3005 gene locus_tag LOCUS_42840 2361 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 3387 3929 gene locus_tag LOCUS_42850 3387 3929 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016918.1 protein_id gnl|my_center|LOCUS_42850 3947 5734 gene locus_tag LOCUS_42860 3947 5734 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042338789.1 protein_id gnl|my_center|LOCUS_42860 >Feature sequence0433 403 17 gene locus_tag LOCUS_42870 403 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 1238 504 gene locus_tag LOCUS_42880 1238 504 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047750.1 protein_id gnl|my_center|LOCUS_42880 2910 1501 gene locus_tag LOCUS_42890 2910 1501 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047747.1 protein_id gnl|my_center|LOCUS_42890 4052 3051 gene locus_tag LOCUS_42900 gene pdxA 4052 3051 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047748.1 protein_id gnl|my_center|LOCUS_42900 5370 4066 gene locus_tag LOCUS_42910 5370 4066 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047749.1 protein_id gnl|my_center|LOCUS_42910 >Feature sequence0434 <1 4029 gene locus_tag LOCUS_42920 <1 4029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000753855.1:choline-binding protein PcpA >Feature sequence0435 786 91 gene locus_tag LOCUS_42930 786 91 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977136.1 protein_id gnl|my_center|LOCUS_42930 2721 961 gene locus_tag LOCUS_42940 2721 961 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963614.1 protein_id gnl|my_center|LOCUS_42940 5086 2711 gene locus_tag LOCUS_42950 5086 2711 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_42950 5744 5076 gene locus_tag LOCUS_42960 5744 5076 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 protein_id gnl|my_center|LOCUS_42960 >Feature sequence0436 1306 734 gene locus_tag LOCUS_42970 gene leuD 1306 734 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433181.1 protein_id gnl|my_center|LOCUS_42970 2696 1320 gene locus_tag LOCUS_42980 gene leuC 2696 1320 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989859.1 protein_id gnl|my_center|LOCUS_42980 4065 3019 gene locus_tag LOCUS_42990 gene leuB 4065 3019 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162527.1 protein_id gnl|my_center|LOCUS_42990 5573 4068 gene locus_tag LOCUS_43000 5573 4068 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_43000 >Feature sequence0437 365 1048 gene locus_tag LOCUS_43010 365 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 1049 2239 gene locus_tag LOCUS_43020 1049 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 2217 3341 gene locus_tag LOCUS_43030 2217 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 3546 4376 gene locus_tag LOCUS_43040 3546 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 4386 5411 gene locus_tag LOCUS_43050 4386 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 >Feature sequence0438 2 1441 gene locus_tag LOCUS_43060 2 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 1453 2541 gene locus_tag LOCUS_43070 1453 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 2564 3667 gene locus_tag LOCUS_43080 2564 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 3680 5323 gene locus_tag LOCUS_43090 3680 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 5351 6010 gene locus_tag LOCUS_43100 5351 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 >Feature sequence0439 500 967 gene locus_tag LOCUS_43110 gene ybaK 500 967 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_43110 977 3583 gene locus_tag LOCUS_43120 977 3583 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_43120 3793 3653 gene locus_tag LOCUS_43130 3793 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 5975 3822 gene locus_tag LOCUS_43140 gene feoB 5975 3822 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460242.1 protein_id gnl|my_center|LOCUS_43140 >Feature sequence0440 375 791 gene locus_tag LOCUS_43150 375 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 785 1168 gene locus_tag LOCUS_43160 785 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429844.1 protein_id gnl|my_center|LOCUS_43160 1168 1614 gene locus_tag LOCUS_43170 1168 1614 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861030.1 protein_id gnl|my_center|LOCUS_43170 1601 2026 gene locus_tag LOCUS_43180 1601 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047646.1 protein_id gnl|my_center|LOCUS_43180 2029 2202 gene locus_tag LOCUS_43190 2029 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 2202 3512 gene locus_tag LOCUS_43200 2202 3512 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861032.1 protein_id gnl|my_center|LOCUS_43200 3528 4004 gene locus_tag LOCUS_43210 3528 4004 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429851.1 protein_id gnl|my_center|LOCUS_43210 4016 4444 gene locus_tag LOCUS_43220 4016 4444 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429853.1 protein_id gnl|my_center|LOCUS_43220 >Feature sequence0441 1196 276 gene locus_tag LOCUS_43230 1196 276 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897528.1 protein_id gnl|my_center|LOCUS_43230 1337 1504 gene locus_tag LOCUS_43240 1337 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 1539 2594 gene locus_tag LOCUS_43250 gene nirJ1 1539 2594 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966081.1 protein_id gnl|my_center|LOCUS_43250 2599 3087 gene locus_tag LOCUS_43260 2599 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 3102 4067 gene locus_tag LOCUS_43270 3102 4067 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227818.1 protein_id gnl|my_center|LOCUS_43270 4274 3963 gene locus_tag LOCUS_43280 4274 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 4485 4252 gene locus_tag LOCUS_43290 4485 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 5288 4413 gene locus_tag LOCUS_43300 5288 4413 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_43300 >Feature sequence0442 1037 15 gene locus_tag LOCUS_43310 1037 15 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_43310 1300 2538 gene locus_tag LOCUS_43320 1300 2538 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399406.1 protein_id gnl|my_center|LOCUS_43320 2551 3930 gene locus_tag LOCUS_43330 2551 3930 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113788.1 protein_id gnl|my_center|LOCUS_43330 3933 4802 gene locus_tag LOCUS_43340 3933 4802 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360454.1 protein_id gnl|my_center|LOCUS_43340 >Feature sequence0443 447 626 gene locus_tag LOCUS_43350 gene rpmD 447 626 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057241.1 protein_id gnl|my_center|LOCUS_43350 643 1083 gene locus_tag LOCUS_43360 gene rplO 643 1083 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_43360 1083 2399 gene locus_tag LOCUS_43370 gene secY 1083 2399 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_43370 2477 3118 gene locus_tag LOCUS_43380 2477 3118 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_43380 3134 3892 gene locus_tag LOCUS_43390 gene map 3134 3892 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_43390 3889 4164 gene locus_tag LOCUS_43400 3889 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 4143 4361 gene locus_tag LOCUS_43410 gene infA 4143 4361 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_43410 4585 4953 gene locus_tag LOCUS_43420 gene rpsM 4585 4953 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_43420 5050 5448 gene locus_tag LOCUS_43430 gene rpsK 5050 5448 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101799.1 protein_id gnl|my_center|LOCUS_43430 >Feature sequence0444 1969 329 gene locus_tag LOCUS_43440 1969 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 3563 2010 gene locus_tag LOCUS_43450 3563 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 5923 3563 gene locus_tag LOCUS_43460 5923 3563 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721496.1 protein_id gnl|my_center|LOCUS_43460 >Feature sequence0445 503 2062 gene locus_tag LOCUS_43470 503 2062 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_43470 2055 2846 gene locus_tag LOCUS_43480 2055 2846 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_43480 2857 3381 gene locus_tag LOCUS_43490 gene cobO 2857 3381 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081762.1 protein_id gnl|my_center|LOCUS_43490 3397 5049 gene locus_tag LOCUS_43500 3397 5049 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_43500 5179 5373 gene locus_tag LOCUS_43510 5179 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 >Feature sequence0446 1302 109 gene locus_tag LOCUS_43520 gene ftsZ 1302 109 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888997.1 protein_id gnl|my_center|LOCUS_43520 2485 1766 gene locus_tag LOCUS_43530 2485 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 3578 2499 gene locus_tag LOCUS_43540 gene murG 3578 2499 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893705.1 protein_id gnl|my_center|LOCUS_43540 4324 3779 gene locus_tag LOCUS_43550 4324 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 4209 4538 gene locus_tag LOCUS_43560 4209 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 4892 4671 gene locus_tag LOCUS_43570 4892 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 5354 5536 gene locus_tag LOCUS_43580 5354 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 5661 5843 gene locus_tag LOCUS_43590 5661 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 >Feature sequence0447 2249 1734 gene locus_tag LOCUS_43600 2249 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 3475 2252 gene locus_tag LOCUS_43610 3475 2252 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258138.1 protein_id gnl|my_center|LOCUS_43610 5481 3472 gene locus_tag LOCUS_43620 5481 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 >Feature sequence0448 <1 531 gene locus_tag LOCUS_43630 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002669020.1:FTR1 family iron permease 552 1232 gene locus_tag LOCUS_43640 552 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 1372 2604 gene locus_tag LOCUS_43650 1372 2604 CDS product Fe-S-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671216.1 protein_id gnl|my_center|LOCUS_43650 2619 3899 gene locus_tag LOCUS_43660 2619 3899 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679164.1 protein_id gnl|my_center|LOCUS_43660 3909 5045 gene locus_tag LOCUS_43670 3909 5045 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671214.1 protein_id gnl|my_center|LOCUS_43670 5060 5779 gene locus_tag LOCUS_43680 5060 5779 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669030.1 protein_id gnl|my_center|LOCUS_43680 >Feature sequence0449 <1 775 gene locus_tag LOCUS_43690 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496424.1:ATP synthase subunit A 788 2158 gene locus_tag LOCUS_43700 788 2158 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_43700 2161 2775 gene locus_tag LOCUS_43710 2161 2775 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_43710 4419 3121 gene locus_tag LOCUS_43720 gene eno 4419 3121 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829595.1 protein_id gnl|my_center|LOCUS_43720 5329 4583 gene locus_tag LOCUS_43730 gene tpiA 5329 4583 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861867.1 protein_id gnl|my_center|LOCUS_43730 5904 5383 gene locus_tag LOCUS_43740 5904 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 >Feature sequence0450 1780 1286 gene locus_tag LOCUS_43750 1780 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 2067 1777 gene locus_tag LOCUS_43760 2067 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 2857 2189 gene locus_tag LOCUS_43770 2857 2189 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_43770 5176 2954 gene locus_tag LOCUS_43780 5176 2954 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546149.1 protein_id gnl|my_center|LOCUS_43780 <5939 5173 gene locus_tag LOCUS_43790 <5939 5173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546148.1:ATP-binding protein >Feature sequence0451 220 489 gene locus_tag LOCUS_43800 220 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 482 2194 gene locus_tag LOCUS_43810 gene recJ 482 2194 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943623.1 protein_id gnl|my_center|LOCUS_43810 2260 3504 gene locus_tag LOCUS_43820 2260 3504 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_43820 3525 4049 gene locus_tag LOCUS_43830 3525 4049 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_43830 4036 5331 gene locus_tag LOCUS_43840 4036 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 >Feature sequence0452 811 401 gene locus_tag LOCUS_43850 811 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 1201 2991 gene locus_tag LOCUS_43860 1201 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 3157 4167 gene locus_tag LOCUS_43870 3157 4167 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_43870 >Feature sequence0453 416 1345 gene locus_tag LOCUS_43880 416 1345 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536791.1 protein_id gnl|my_center|LOCUS_43880 1378 2430 gene locus_tag LOCUS_43890 1378 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 2447 2929 gene locus_tag LOCUS_43900 2447 2929 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510078.1 protein_id gnl|my_center|LOCUS_43900 3280 4461 gene locus_tag LOCUS_43910 3280 4461 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391959.1 protein_id gnl|my_center|LOCUS_43910 4473 5282 gene locus_tag LOCUS_43920 4473 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 >Feature sequence0454 1568 753 gene locus_tag LOCUS_43930 gene murI 1568 753 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902800.1 protein_id gnl|my_center|LOCUS_43930 3502 2168 gene locus_tag LOCUS_43940 gene gltS 3502 2168 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392508.1 protein_id gnl|my_center|LOCUS_43940 5268 3793 gene locus_tag LOCUS_43950 5268 3793 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_43950 <5904 5352 gene locus_tag LOCUS_43960 <5904 5352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861614.1:RluA family pseudouridine synthase >Feature sequence0455 2666 1056 gene locus_tag LOCUS_43970 2666 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 2936 4294 gene locus_tag LOCUS_43980 gene rlmD 2936 4294 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861959.1 protein_id gnl|my_center|LOCUS_43980 >Feature sequence0456 1739 225 gene locus_tag LOCUS_43990 1739 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 2831 1743 gene locus_tag LOCUS_44000 2831 1743 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966511.1 protein_id gnl|my_center|LOCUS_44000 3902 3060 gene locus_tag LOCUS_44010 3902 3060 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722640.1 protein_id gnl|my_center|LOCUS_44010 4778 3945 gene locus_tag LOCUS_44020 4778 3945 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986367.1 protein_id gnl|my_center|LOCUS_44020 5570 4863 gene locus_tag LOCUS_44030 5570 4863 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048437.1 protein_id gnl|my_center|LOCUS_44030 5866 5792 gene locus_tag LOCUS_t00260 5866 5792 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0457 207 1316 gene locus_tag LOCUS_44040 207 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 1339 2706 gene locus_tag LOCUS_44050 1339 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 2708 3313 gene locus_tag LOCUS_44060 2708 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 3328 3639 gene locus_tag LOCUS_44070 3328 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 3658 5736 gene locus_tag LOCUS_44080 3658 5736 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948909.1 protein_id gnl|my_center|LOCUS_44080 >Feature sequence0458 1745 1476 gene locus_tag LOCUS_44090 1745 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 4025 1818 gene locus_tag LOCUS_44100 gene pcrA 4025 1818 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989805.1 protein_id gnl|my_center|LOCUS_44100 4983 4087 gene locus_tag LOCUS_44110 4983 4087 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_44110 5612 5157 gene locus_tag LOCUS_44120 5612 5157 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_44120 >Feature sequence0459 1038 2012 gene locus_tag LOCUS_44130 1038 2012 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948090.1 protein_id gnl|my_center|LOCUS_44130 2228 3166 gene locus_tag LOCUS_44140 2228 3166 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024132.1 protein_id gnl|my_center|LOCUS_44140 3159 3722 gene locus_tag LOCUS_44150 3159 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44150 3761 3967 gene locus_tag LOCUS_44160 3761 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44160 3970 4758 gene locus_tag LOCUS_44170 3970 4758 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173871.1 protein_id gnl|my_center|LOCUS_44170 4760 5539 gene locus_tag LOCUS_44180 4760 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 >Feature sequence0460 273 1118 gene locus_tag LOCUS_44190 273 1118 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811992.1 protein_id gnl|my_center|LOCUS_44190 1111 2040 gene locus_tag LOCUS_44200 1111 2040 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_44200 2128 2355 gene locus_tag LOCUS_44210 2128 2355 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809979.1 protein_id gnl|my_center|LOCUS_44210 3838 2342 gene locus_tag LOCUS_44220 3838 2342 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678766.1 protein_id gnl|my_center|LOCUS_44220 4026 4571 gene locus_tag LOCUS_44230 4026 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 4568 5530 gene locus_tag LOCUS_44240 4568 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 >Feature sequence0461 60 1112 gene locus_tag LOCUS_44250 60 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 1128 2120 gene locus_tag LOCUS_44260 1128 2120 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875811.1 protein_id gnl|my_center|LOCUS_44260 2245 3651 gene locus_tag LOCUS_44270 2245 3651 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_44270 3665 5383 gene locus_tag LOCUS_44280 3665 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 >Feature sequence0462 364 522 gene locus_tag LOCUS_44290 364 522 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670545.1 protein_id gnl|my_center|LOCUS_44290 681 905 gene locus_tag LOCUS_44300 681 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 905 1075 gene locus_tag LOCUS_44310 905 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 1075 2223 gene locus_tag LOCUS_44320 1075 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 2237 3388 gene locus_tag LOCUS_44330 2237 3388 CDS product cyclic nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990029.1 protein_id gnl|my_center|LOCUS_44330 3401 4627 gene locus_tag LOCUS_44340 gene pepT 3401 4627 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360428.1 protein_id gnl|my_center|LOCUS_44340 >Feature sequence0463 448 23 gene locus_tag LOCUS_44350 448 23 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682353.1 protein_id gnl|my_center|LOCUS_44350 990 463 gene locus_tag LOCUS_44360 990 463 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436147.1 protein_id gnl|my_center|LOCUS_44360 1929 1165 gene locus_tag LOCUS_44370 1929 1165 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922614.1 protein_id gnl|my_center|LOCUS_44370 2902 1919 gene locus_tag LOCUS_44380 2902 1919 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036831.1 protein_id gnl|my_center|LOCUS_44380 3929 3033 gene locus_tag LOCUS_44390 gene isdE 3929 3033 CDS product heme ABC transporter substrate-binding protein IsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922615.1 protein_id gnl|my_center|LOCUS_44390 4555 3965 gene locus_tag LOCUS_44400 4555 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 5421 5032 gene locus_tag LOCUS_44410 5421 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 >Feature sequence0464 471 839 gene locus_tag LOCUS_44420 471 839 CDS product ornithine aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434665.1 protein_id gnl|my_center|LOCUS_44420 843 3056 gene locus_tag LOCUS_44430 gene oraE 843 3056 CDS product D-ornithine 4,5-aminomutase subunit OraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895465.1 protein_id gnl|my_center|LOCUS_44430 3090 4502 gene locus_tag LOCUS_44440 3090 4502 CDS product GlmL-related ornithine degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895468.1 protein_id gnl|my_center|LOCUS_44440 4480 5547 gene locus_tag LOCUS_44450 gene orr 4480 5547 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860813.1 protein_id gnl|my_center|LOCUS_44450 >Feature sequence0465 2634 961 gene locus_tag LOCUS_44460 gene malL 2634 961 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415176.1 protein_id gnl|my_center|LOCUS_44460 2884 3996 gene locus_tag LOCUS_44470 gene ugpC 2884 3996 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_44470 4064 4906 gene locus_tag LOCUS_44480 4064 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 4899 5387 gene locus_tag LOCUS_44490 4899 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 >Feature sequence0466 1235 660 gene locus_tag LOCUS_44500 1235 660 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454633.1 protein_id gnl|my_center|LOCUS_44500 2669 1584 gene locus_tag LOCUS_44510 2669 1584 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861645.1 protein_id gnl|my_center|LOCUS_44510 2983 4257 gene locus_tag LOCUS_44520 2983 4257 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861165.1 protein_id gnl|my_center|LOCUS_44520 4271 4786 gene locus_tag LOCUS_44530 4271 4786 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918072.1 protein_id gnl|my_center|LOCUS_44530 >Feature sequence0467 461 186 gene locus_tag LOCUS_44540 461 186 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392154.1 protein_id gnl|my_center|LOCUS_44540 733 479 gene locus_tag LOCUS_44550 733 479 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_44550 1450 1371 gene locus_tag LOCUS_t00270 1450 1371 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2860 1841 gene locus_tag LOCUS_44560 2860 1841 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582778.1 protein_id gnl|my_center|LOCUS_44560 3863 2919 gene locus_tag LOCUS_44570 3863 2919 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392152.1 protein_id gnl|my_center|LOCUS_44570 4917 4111 gene locus_tag LOCUS_44580 4917 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 5581 5018 gene locus_tag LOCUS_44590 5581 5018 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899842.1 protein_id gnl|my_center|LOCUS_44590 >Feature sequence0468 778 200 gene locus_tag LOCUS_44600 778 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 1696 962 gene locus_tag LOCUS_44610 1696 962 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861813.1 protein_id gnl|my_center|LOCUS_44610 2039 3991 gene locus_tag LOCUS_44620 gene treP 2039 3991 CDS product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297133.1 protein_id gnl|my_center|LOCUS_44620 4000 5640 gene locus_tag LOCUS_44630 gene treC 4000 5640 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986524.1 protein_id gnl|my_center|LOCUS_44630 >Feature sequence0469 1963 404 gene locus_tag LOCUS_44640 1963 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 2758 2111 gene locus_tag LOCUS_44650 2758 2111 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_44650 3579 2782 gene locus_tag LOCUS_44660 3579 2782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_44660 4546 3623 gene locus_tag LOCUS_44670 4546 3623 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884162.1 protein_id gnl|my_center|LOCUS_44670 <5837 5077 gene locus_tag LOCUS_44680 <5837 5077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811776.1:ABC transporter substrate-binding protein >Feature sequence0470 <1 1203 gene locus_tag LOCUS_44690 <1 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976402.1:sugar ABC transporter substrate-binding protein 1298 2851 gene locus_tag LOCUS_44700 gene gguA 1298 2851 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533633.1 protein_id gnl|my_center|LOCUS_44700 2861 4018 gene locus_tag LOCUS_44710 gene gguB 2861 4018 CDS product sugar ABC transporter permease GguB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311699.1 protein_id gnl|my_center|LOCUS_44710 4091 5260 gene locus_tag LOCUS_44720 4091 5260 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608374.1 protein_id gnl|my_center|LOCUS_44720 >Feature sequence0471 145 384 gene locus_tag LOCUS_44730 145 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 826 674 gene locus_tag LOCUS_44740 826 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44740 1060 1833 gene locus_tag LOCUS_44750 1060 1833 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_44750 1823 3877 gene locus_tag LOCUS_44760 1823 3877 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897838.1 protein_id gnl|my_center|LOCUS_44760 3906 4586 gene locus_tag LOCUS_44770 3906 4586 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_44770 4579 5577 gene locus_tag LOCUS_44780 4579 5577 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860749.1 protein_id gnl|my_center|LOCUS_44780 >Feature sequence0472 419 544 gene locus_tag LOCUS_44790 419 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 831 3476 gene locus_tag LOCUS_44800 gene alaS 831 3476 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986885.1 protein_id gnl|my_center|LOCUS_44800 3763 4119 gene locus_tag LOCUS_44810 3763 4119 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903552.1 protein_id gnl|my_center|LOCUS_44810 4536 5114 gene locus_tag LOCUS_44820 4536 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 >Feature sequence0473 2531 81 gene locus_tag LOCUS_44830 gene gyrA 2531 81 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_44830 4460 2544 gene locus_tag LOCUS_44840 gene gyrB 4460 2544 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_44840 5602 4478 gene locus_tag LOCUS_44850 gene recF 5602 4478 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 protein_id gnl|my_center|LOCUS_44850 5789 5577 gene locus_tag LOCUS_44860 gene yaaA 5789 5577 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359394.1 protein_id gnl|my_center|LOCUS_44860 >Feature sequence0474 2824 1859 gene locus_tag LOCUS_44870 2824 1859 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986747.1 protein_id gnl|my_center|LOCUS_44870 4283 2835 gene locus_tag LOCUS_44880 4283 2835 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462215.1 protein_id gnl|my_center|LOCUS_44880 5021 4302 gene locus_tag LOCUS_44890 5021 4302 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815503.1 protein_id gnl|my_center|LOCUS_44890 5617 5021 gene locus_tag LOCUS_44900 5617 5021 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815501.1 protein_id gnl|my_center|LOCUS_44900 >Feature sequence0475 1050 100 gene locus_tag LOCUS_44910 1050 100 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_44910 2527 1064 gene locus_tag LOCUS_44920 2527 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 3623 2529 gene locus_tag LOCUS_44930 3623 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 3822 4088 gene locus_tag LOCUS_44940 3822 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 5441 4092 gene locus_tag LOCUS_44950 5441 4092 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435635.1 protein_id gnl|my_center|LOCUS_44950 >Feature sequence0476 2318 1194 gene locus_tag LOCUS_44960 2318 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 4267 2684 gene locus_tag LOCUS_44970 4267 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 <5784 4393 gene locus_tag LOCUS_44980 <5784 4393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860945.1:extracellular solute-binding protein >Feature sequence0477 283 1608 gene locus_tag LOCUS_44990 283 1608 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454961.1 protein_id gnl|my_center|LOCUS_44990 1767 2588 gene locus_tag LOCUS_45000 1767 2588 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532947.1 protein_id gnl|my_center|LOCUS_45000 2591 3427 gene locus_tag LOCUS_45010 2591 3427 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532946.1 protein_id gnl|my_center|LOCUS_45010 3451 4311 gene locus_tag LOCUS_45020 3451 4311 CDS product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431312.1 protein_id gnl|my_center|LOCUS_45020 4335 5525 gene locus_tag LOCUS_45030 4335 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 >Feature sequence0478 <1 921 gene locus_tag LOCUS_45040 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_030871104.1:sugar ABC transporter permease 947 1780 gene locus_tag LOCUS_45050 947 1780 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_45050 1787 3340 gene locus_tag LOCUS_45060 1787 3340 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 protein_id gnl|my_center|LOCUS_45060 3340 4173 gene locus_tag LOCUS_45070 3340 4173 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360347.1 protein_id gnl|my_center|LOCUS_45070 4166 5692 gene locus_tag LOCUS_45080 4166 5692 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 protein_id gnl|my_center|LOCUS_45080 >Feature sequence0479 568 1443 gene locus_tag LOCUS_45090 568 1443 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083266.1 protein_id gnl|my_center|LOCUS_45090 1469 2443 gene locus_tag LOCUS_45100 1469 2443 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948181.1 protein_id gnl|my_center|LOCUS_45100 2463 3431 gene locus_tag LOCUS_45110 2463 3431 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726680.1 protein_id gnl|my_center|LOCUS_45110 3449 3928 gene locus_tag LOCUS_45120 3449 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 3942 5441 gene locus_tag LOCUS_45130 3942 5441 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582707.1 protein_id gnl|my_center|LOCUS_45130 >Feature sequence0480 276 1706 gene locus_tag LOCUS_45140 gene purB 276 1706 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_45140 1914 3191 gene locus_tag LOCUS_45150 1914 3191 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100223.1 protein_id gnl|my_center|LOCUS_45150 3416 5344 gene locus_tag LOCUS_45160 3416 5344 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_45160 5359 5562 gene locus_tag LOCUS_45170 5359 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 >Feature sequence0481 1381 239 gene locus_tag LOCUS_45180 1381 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 2429 1392 gene locus_tag LOCUS_45190 2429 1392 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986692.1 protein_id gnl|my_center|LOCUS_45190 3229 2441 gene locus_tag LOCUS_45200 gene etfB 3229 2441 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986693.1 protein_id gnl|my_center|LOCUS_45200 4409 3270 gene locus_tag LOCUS_45210 gene acdB 4409 3270 CDS product putative isocaproyl-CoA dehydrogenase AcdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986694.1 protein_id gnl|my_center|LOCUS_45210 5562 4432 gene locus_tag LOCUS_45220 5562 4432 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986695.1 protein_id gnl|my_center|LOCUS_45220 5720 5559 gene locus_tag LOCUS_45230 5720 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 >Feature sequence0482 <1 5090 gene locus_tag LOCUS_45240 <1 5090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000753855.1:choline-binding protein PcpA >Feature sequence0483 2757 448 gene locus_tag LOCUS_45250 2757 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 3598 2759 gene locus_tag LOCUS_45260 3598 2759 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776741.1 protein_id gnl|my_center|LOCUS_45260 4498 3605 gene locus_tag LOCUS_45270 4498 3605 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_45270 <5711 4505 gene locus_tag LOCUS_45280 <5711 4505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584153.1:ABC transporter substrate-binding protein >Feature sequence0484 4487 3342 gene locus_tag LOCUS_45290 4487 3342 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016775.1 protein_id gnl|my_center|LOCUS_45290 5407 4652 gene locus_tag LOCUS_45300 5407 4652 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242850.1 protein_id gnl|my_center|LOCUS_45300 >Feature sequence0485 1778 21 gene locus_tag LOCUS_45310 gene pyk 1778 21 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_45310 2902 1943 gene locus_tag LOCUS_45320 gene pfkA 2902 1943 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429132.1 protein_id gnl|my_center|LOCUS_45320 4080 3064 gene locus_tag LOCUS_45330 gene gpsA 4080 3064 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230566.1 protein_id gnl|my_center|LOCUS_45330 4680 4090 gene locus_tag LOCUS_45340 gene plsY 4680 4090 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392834.1 protein_id gnl|my_center|LOCUS_45340 5577 4705 gene locus_tag LOCUS_45350 5577 4705 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_45350 >Feature sequence0486 631 1227 gene locus_tag LOCUS_45360 631 1227 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681326.1 protein_id gnl|my_center|LOCUS_45360 1252 3732 gene locus_tag LOCUS_45370 1252 3732 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681327.1 protein_id gnl|my_center|LOCUS_45370 3747 5105 gene locus_tag LOCUS_45380 3747 5105 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681330.1 protein_id gnl|my_center|LOCUS_45380 >Feature sequence0487 526 900 gene locus_tag LOCUS_45390 526 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 1047 1448 gene locus_tag LOCUS_45400 1047 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 1472 2383 gene locus_tag LOCUS_45410 1472 2383 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_45410 3837 2437 gene locus_tag LOCUS_45420 3837 2437 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_45420 4541 3834 gene locus_tag LOCUS_45430 4541 3834 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966496.1 protein_id gnl|my_center|LOCUS_45430 <5695 4556 gene locus_tag LOCUS_45440 <5695 4556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965637.1:endonuclease MutS2 >Feature sequence0488 776 336 gene locus_tag LOCUS_45450 776 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 1891 788 gene locus_tag LOCUS_45460 1891 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 2437 2700 gene locus_tag LOCUS_45470 2437 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 5397 2977 gene locus_tag LOCUS_45480 gene leuS 5397 2977 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 protein_id gnl|my_center|LOCUS_45480 >Feature sequence0489 91 1203 gene locus_tag LOCUS_45490 gene ugpC 91 1203 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_45490 1292 2152 gene locus_tag LOCUS_45500 1292 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 2145 2633 gene locus_tag LOCUS_45510 2145 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 4630 2681 gene locus_tag LOCUS_45520 4630 2681 CDS product PTS beta-glucoside transporter subunit IIBCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027722.1 protein_id gnl|my_center|LOCUS_45520 5645 4893 gene locus_tag LOCUS_45530 5645 4893 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103675601.1 protein_id gnl|my_center|LOCUS_45530 >Feature sequence0490 1007 120 gene locus_tag LOCUS_45540 1007 120 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385464.1 protein_id gnl|my_center|LOCUS_45540 1654 1007 gene locus_tag LOCUS_45550 1654 1007 CDS product dihydroxyacetone kinase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680280.1 protein_id gnl|my_center|LOCUS_45550 2653 1664 gene locus_tag LOCUS_45560 2653 1664 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674237.1 protein_id gnl|my_center|LOCUS_45560 3856 2765 gene locus_tag LOCUS_45570 gene mtnA 3856 2765 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025237.1 protein_id gnl|my_center|LOCUS_45570 5077 3857 gene locus_tag LOCUS_45580 gene mtnK 5077 3857 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033250.1 protein_id gnl|my_center|LOCUS_45580 <5673 5095 gene locus_tag LOCUS_45590 <5673 5095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097621.1:ABC transporter permease >Feature sequence0491 2133 223 gene locus_tag LOCUS_45600 2133 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 2499 3380 gene locus_tag LOCUS_45610 2499 3380 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948342.1 protein_id gnl|my_center|LOCUS_45610 4399 3779 gene locus_tag LOCUS_45620 4399 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 <5671 4416 gene locus_tag LOCUS_45630 <5671 4416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080857.1:O-antigen ligase >Feature sequence0492 28 2010 gene locus_tag LOCUS_45640 gene uvrB 28 2010 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891935.1 protein_id gnl|my_center|LOCUS_45640 2012 2794 gene locus_tag LOCUS_45650 2012 2794 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549818.1 protein_id gnl|my_center|LOCUS_45650 2791 3285 gene locus_tag LOCUS_45660 2791 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 3352 4284 gene locus_tag LOCUS_45670 3352 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 4289 5320 gene locus_tag LOCUS_45680 gene queA 4289 5320 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_45680 >Feature sequence0493 2815 1541 gene locus_tag LOCUS_45690 2815 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379688.1 protein_id gnl|my_center|LOCUS_45690 3671 2796 gene locus_tag LOCUS_45700 3671 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 4611 3661 gene locus_tag LOCUS_45710 4611 3661 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_45710 >Feature sequence0494 2786 1836 gene locus_tag LOCUS_45720 2786 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 4829 2802 gene locus_tag LOCUS_45730 4829 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 >Feature sequence0495 294 148 gene locus_tag LOCUS_45740 294 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 712 344 gene locus_tag LOCUS_45750 712 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 <5586 723 gene locus_tag LOCUS_45760 <5586 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105498.1:RHS repeat-associated core domain-containing protein >Feature sequence0496 1 660 gene locus_tag LOCUS_45770 1 660 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272454.1 protein_id gnl|my_center|LOCUS_45770 641 1651 gene locus_tag LOCUS_45780 641 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 1668 2372 gene locus_tag LOCUS_45790 1668 2372 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460538.1 protein_id gnl|my_center|LOCUS_45790 2559 3911 gene locus_tag LOCUS_45800 2559 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 3923 4921 gene locus_tag LOCUS_45810 3923 4921 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012100493.1 protein_id gnl|my_center|LOCUS_45810 4924 5352 gene locus_tag LOCUS_45820 4924 5352 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358219.1 protein_id gnl|my_center|LOCUS_45820 >Feature sequence0497 442 684 gene locus_tag LOCUS_45830 442 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 1309 2427 gene locus_tag LOCUS_45840 1309 2427 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198708.1 protein_id gnl|my_center|LOCUS_45840 2447 3445 gene locus_tag LOCUS_45850 2447 3445 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459473.1 protein_id gnl|my_center|LOCUS_45850 3442 4461 gene locus_tag LOCUS_45860 3442 4461 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814109.1 protein_id gnl|my_center|LOCUS_45860 4461 5273 gene locus_tag LOCUS_45870 4461 5273 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814111.1 protein_id gnl|my_center|LOCUS_45870 >Feature sequence0498 <1 917 gene locus_tag LOCUS_45880 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001035315.1:pneumococcal surface protein A 927 2681 gene locus_tag LOCUS_45890 927 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 3640 2819 gene locus_tag LOCUS_45900 3640 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 4790 3630 gene locus_tag LOCUS_45910 4790 3630 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156275681.1 protein_id gnl|my_center|LOCUS_45910 5554 4802 gene locus_tag LOCUS_45920 5554 4802 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496386.1 protein_id gnl|my_center|LOCUS_45920 >Feature sequence0499 631 290 gene locus_tag LOCUS_45930 631 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45930 1288 644 gene locus_tag LOCUS_45940 gene pgmB 1288 644 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965902.1 protein_id gnl|my_center|LOCUS_45940 2123 1476 gene locus_tag LOCUS_45950 2123 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 3357 2110 gene locus_tag LOCUS_45960 3357 2110 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_45960 4211 3528 gene locus_tag LOCUS_45970 4211 3528 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830337.1 protein_id gnl|my_center|LOCUS_45970 5515 4208 gene locus_tag LOCUS_45980 5515 4208 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964765.1 protein_id gnl|my_center|LOCUS_45980 >Feature sequence0500 2091 1639 gene locus_tag LOCUS_45990 2091 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 4070 2091 gene locus_tag LOCUS_46000 4070 2091 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963726.1 protein_id gnl|my_center|LOCUS_46000 4839 4081 gene locus_tag LOCUS_46010 4839 4081 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963364.1 protein_id gnl|my_center|LOCUS_46010 <5569 4843 gene locus_tag LOCUS_46020 <5569 4843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963365.1:DUF6382 domain-containing protein >Feature sequence0501 1233 127 gene locus_tag LOCUS_46030 1233 127 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241723.1 protein_id gnl|my_center|LOCUS_46030 2094 1255 gene locus_tag LOCUS_46040 2094 1255 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898776.1 protein_id gnl|my_center|LOCUS_46040 2978 2091 gene locus_tag LOCUS_46050 2978 2091 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237985.1 protein_id gnl|my_center|LOCUS_46050 4388 3039 gene locus_tag LOCUS_46060 4388 3039 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894432.1 protein_id gnl|my_center|LOCUS_46060 5547 4690 gene locus_tag LOCUS_46070 5547 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 >Feature sequence0502 3030 592 gene locus_tag LOCUS_46080 3030 592 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948003.1 protein_id gnl|my_center|LOCUS_46080 3313 3023 gene locus_tag LOCUS_46090 3313 3023 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355819.1 protein_id gnl|my_center|LOCUS_46090 4302 5246 gene locus_tag LOCUS_46100 4302 5246 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016429.1 protein_id gnl|my_center|LOCUS_46100 >Feature sequence0503 2072 1416 gene locus_tag LOCUS_46110 2072 1416 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871236.1 protein_id gnl|my_center|LOCUS_46110 4403 2103 gene locus_tag LOCUS_46120 4403 2103 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_46120 >Feature sequence0504 <1 1610 gene locus_tag LOCUS_46130 <1 1610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047904.1:putative manganese-dependent inorganic diphosphatase 1612 2109 gene locus_tag LOCUS_46140 1612 2109 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_46140 2203 2694 gene locus_tag LOCUS_46150 2203 2694 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_46150 3150 4532 gene locus_tag LOCUS_46160 gene murC 3150 4532 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_46160 >Feature sequence0505 933 3272 gene locus_tag LOCUS_46170 gene recJ 933 3272 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861665.1 protein_id gnl|my_center|LOCUS_46170 3284 3805 gene locus_tag LOCUS_46180 3284 3805 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_46180 >Feature sequence0506 854 375 gene locus_tag LOCUS_46190 854 375 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696696.1 protein_id gnl|my_center|LOCUS_46190 1554 961 gene locus_tag LOCUS_46200 1554 961 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117417247.1 protein_id gnl|my_center|LOCUS_46200 2603 1578 gene locus_tag LOCUS_46210 gene queA 2603 1578 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_46210 3408 2605 gene locus_tag LOCUS_46220 3408 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 3528 3602 gene locus_tag LOCUS_t00280 3528 3602 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3632 4615 gene locus_tag LOCUS_46230 3632 4615 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948775.1 protein_id gnl|my_center|LOCUS_46230 4722 4650 gene locus_tag LOCUS_t00290 4722 4650 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0507 1542 526 gene locus_tag LOCUS_46240 1542 526 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964762.1 protein_id gnl|my_center|LOCUS_46240 2491 1742 gene locus_tag LOCUS_46250 2491 1742 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890514.1 protein_id gnl|my_center|LOCUS_46250 3394 2558 gene locus_tag LOCUS_46260 3394 2558 CDS product ketose 1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418474.1 protein_id gnl|my_center|LOCUS_46260 4512 3397 gene locus_tag LOCUS_46270 4512 3397 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319540.1 protein_id gnl|my_center|LOCUS_46270 5501 4605 gene locus_tag LOCUS_46280 5501 4605 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294163.1 protein_id gnl|my_center|LOCUS_46280 >Feature sequence0508 819 304 gene locus_tag LOCUS_46290 819 304 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358971.1 protein_id gnl|my_center|LOCUS_46290 1123 2169 gene locus_tag LOCUS_46300 1123 2169 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356948.1 protein_id gnl|my_center|LOCUS_46300 2150 2830 gene locus_tag LOCUS_46310 2150 2830 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293786.1 protein_id gnl|my_center|LOCUS_46310 3065 3970 gene locus_tag LOCUS_46320 3065 3970 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390147.1 protein_id gnl|my_center|LOCUS_46320 4217 4351 gene locus_tag LOCUS_46330 4217 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 4348 5520 gene locus_tag LOCUS_46340 4348 5520 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 protein_id gnl|my_center|LOCUS_46340 >Feature sequence0509 2225 2034 gene locus_tag LOCUS_46350 2225 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 3509 2694 gene locus_tag LOCUS_46360 3509 2694 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_46360 4098 3520 gene locus_tag LOCUS_46370 gene rsxA 4098 3520 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_46370 4919 4098 gene locus_tag LOCUS_46380 4919 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 <5526 4929 gene locus_tag LOCUS_46390 <5526 4929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869097.1:RnfABCDGE type electron transport complex subunit G >Feature sequence0510 118 903 gene locus_tag LOCUS_46400 118 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 1223 858 gene locus_tag LOCUS_46410 1223 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 1464 1210 gene locus_tag LOCUS_46420 1464 1210 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681231.1 protein_id gnl|my_center|LOCUS_46420 2652 1561 gene locus_tag LOCUS_46430 2652 1561 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459712.1 protein_id gnl|my_center|LOCUS_46430 3460 2672 gene locus_tag LOCUS_46440 3460 2672 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_46440 4278 3457 gene locus_tag LOCUS_46450 4278 3457 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808911.1 protein_id gnl|my_center|LOCUS_46450 5347 4271 gene locus_tag LOCUS_46460 5347 4271 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437017.1 protein_id gnl|my_center|LOCUS_46460 >Feature sequence0511 2543 891 gene locus_tag LOCUS_46470 2543 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 3241 2813 gene locus_tag LOCUS_46480 3241 2813 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813029.1 protein_id gnl|my_center|LOCUS_46480 >Feature sequence0512 42 1061 gene locus_tag LOCUS_46490 gene ilvC 42 1061 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142651.1 protein_id gnl|my_center|LOCUS_46490 1236 3143 gene locus_tag LOCUS_46500 1236 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 3152 3817 gene locus_tag LOCUS_46510 gene lptB 3152 3817 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855252.1 protein_id gnl|my_center|LOCUS_46510 3853 5061 gene locus_tag LOCUS_46520 3853 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 >Feature sequence0513 229 735 gene locus_tag LOCUS_46530 229 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 1777 773 gene locus_tag LOCUS_46540 1777 773 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989641.1 protein_id gnl|my_center|LOCUS_46540 2170 3363 gene locus_tag LOCUS_46550 2170 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 3502 5037 gene locus_tag LOCUS_46560 3502 5037 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816711.1 protein_id gnl|my_center|LOCUS_46560 >Feature sequence0514 169 2583 gene locus_tag LOCUS_46570 gene leuS 169 2583 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 protein_id gnl|my_center|LOCUS_46570 2712 3311 gene locus_tag LOCUS_46580 2712 3311 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681184.1 protein_id gnl|my_center|LOCUS_46580 3562 3996 gene locus_tag LOCUS_46590 3562 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 3981 5423 gene locus_tag LOCUS_46600 3981 5423 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679287.1 protein_id gnl|my_center|LOCUS_46600 >Feature sequence0515 741 1 gene locus_tag LOCUS_46610 741 1 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_46610 1629 769 gene locus_tag LOCUS_46620 1629 769 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776379.1 protein_id gnl|my_center|LOCUS_46620 2532 1639 gene locus_tag LOCUS_46630 2532 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 4009 2633 gene locus_tag LOCUS_46640 4009 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 5178 4111 gene locus_tag LOCUS_46650 5178 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 >Feature sequence0516 342 884 gene locus_tag LOCUS_46660 gene rplF 342 884 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_46660 901 1269 gene locus_tag LOCUS_46670 gene rplR 901 1269 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421141.1 protein_id gnl|my_center|LOCUS_46670 1288 1794 gene locus_tag LOCUS_46680 gene rpsE 1288 1794 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421138.1 protein_id gnl|my_center|LOCUS_46680 1807 1986 gene locus_tag LOCUS_46690 gene rpmD 1807 1986 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894509.1 protein_id gnl|my_center|LOCUS_46690 2002 2448 gene locus_tag LOCUS_46700 gene rplO 2002 2448 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_46700 2448 3722 gene locus_tag LOCUS_46710 gene secY 2448 3722 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_46710 3767 4417 gene locus_tag LOCUS_46720 3767 4417 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860634.1 protein_id gnl|my_center|LOCUS_46720 4417 5166 gene locus_tag LOCUS_46730 gene map 4417 5166 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_46730 5177 5446 gene locus_tag LOCUS_46740 5177 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 >Feature sequence0517 577 837 gene locus_tag LOCUS_46750 577 837 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868899.1 protein_id gnl|my_center|LOCUS_46750 830 1948 gene locus_tag LOCUS_46760 gene hydE 830 1948 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048412.1 protein_id gnl|my_center|LOCUS_46760 1930 3378 gene locus_tag LOCUS_46770 gene hydG 1930 3378 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203501.1 protein_id gnl|my_center|LOCUS_46770 3356 4567 gene locus_tag LOCUS_46780 gene hydF 3356 4567 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_46780 5182 4637 gene locus_tag LOCUS_46790 5182 4637 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964041.1 protein_id gnl|my_center|LOCUS_46790 >Feature sequence0518 1554 862 gene locus_tag LOCUS_46800 1554 862 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141952.1 protein_id gnl|my_center|LOCUS_46800 2135 1554 gene locus_tag LOCUS_46810 2135 1554 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368971.1 protein_id gnl|my_center|LOCUS_46810 3866 2145 gene locus_tag LOCUS_46820 3866 2145 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005399340.1 protein_id gnl|my_center|LOCUS_46820 <5468 3850 gene locus_tag LOCUS_46830 <5468 3850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005399341.1:ABC transporter ATP-binding protein >Feature sequence0519 832 125 gene locus_tag LOCUS_46840 832 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 1449 1057 gene locus_tag LOCUS_46850 1449 1057 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_46850 <5464 1848 gene locus_tag LOCUS_46860 <5464 1848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000753855.1:choline-binding protein PcpA >Feature sequence0520 238 2550 gene locus_tag LOCUS_46870 238 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 >Feature sequence0521 443 1078 gene locus_tag LOCUS_46880 443 1078 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193328953.1 protein_id gnl|my_center|LOCUS_46880 1224 2489 gene locus_tag LOCUS_46890 1224 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 2687 3322 gene locus_tag LOCUS_46900 2687 3322 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193328953.1 protein_id gnl|my_center|LOCUS_46900 3815 3375 gene locus_tag LOCUS_46910 3815 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809910.1 protein_id gnl|my_center|LOCUS_46910 4017 3802 gene locus_tag LOCUS_46920 4017 3802 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809912.1 protein_id gnl|my_center|LOCUS_46920 4281 5180 gene locus_tag LOCUS_46930 4281 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 >Feature sequence0522 1584 1 gene locus_tag LOCUS_46940 1584 1 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067352.1 protein_id gnl|my_center|LOCUS_46940 2370 1585 gene locus_tag LOCUS_46950 2370 1585 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062685931.1 protein_id gnl|my_center|LOCUS_46950 3284 2370 gene locus_tag LOCUS_46960 3284 2370 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106894843.1 protein_id gnl|my_center|LOCUS_46960 4915 3350 gene locus_tag LOCUS_46970 4915 3350 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015726.1 protein_id gnl|my_center|LOCUS_46970 >Feature sequence0523 435 5342 gene locus_tag LOCUS_46980 435 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 >Feature sequence0524 1970 360 gene locus_tag LOCUS_46990 1970 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 2340 1981 gene locus_tag LOCUS_47000 2340 1981 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_47000 4367 2727 gene locus_tag LOCUS_47010 4367 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 5090 4716 gene locus_tag LOCUS_47020 5090 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 >Feature sequence0525 1289 438 gene locus_tag LOCUS_47030 1289 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 2385 4265 gene locus_tag LOCUS_47040 gene mnmG 2385 4265 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898858.1 protein_id gnl|my_center|LOCUS_47040 >Feature sequence0526 915 532 gene locus_tag LOCUS_47050 915 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 1009 2034 gene locus_tag LOCUS_47060 1009 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673991.1 protein_id gnl|my_center|LOCUS_47060 2047 3072 gene locus_tag LOCUS_47070 2047 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673991.1 protein_id gnl|my_center|LOCUS_47070 3298 3119 gene locus_tag LOCUS_47080 3298 3119 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895603.1 protein_id gnl|my_center|LOCUS_47080 4772 3363 gene locus_tag LOCUS_47090 4772 3363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229353.1 protein_id gnl|my_center|LOCUS_47090 <5406 4760 gene locus_tag LOCUS_47100 <5406 4760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001141952.1:energy-coupling factor transporter transmembrane component T >Feature sequence0527 3566 2412 gene locus_tag LOCUS_47110 3566 2412 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765153.1 protein_id gnl|my_center|LOCUS_47110 3920 3780 gene locus_tag LOCUS_47120 3920 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 4102 4287 gene locus_tag LOCUS_47130 4102 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 4271 4900 gene locus_tag LOCUS_47140 4271 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47140 >Feature sequence0528 80 1756 gene locus_tag LOCUS_47150 80 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 2578 1823 gene locus_tag LOCUS_47160 2578 1823 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588546.1 protein_id gnl|my_center|LOCUS_47160 2982 4394 gene locus_tag LOCUS_47170 2982 4394 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388551.1 protein_id gnl|my_center|LOCUS_47170 >Feature sequence0529 426 809 gene locus_tag LOCUS_47180 426 809 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671440.1 protein_id gnl|my_center|LOCUS_47180 933 1556 gene locus_tag LOCUS_47190 933 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 1558 2781 gene locus_tag LOCUS_47200 1558 2781 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966655.1 protein_id gnl|my_center|LOCUS_47200 2771 3679 gene locus_tag LOCUS_47210 2771 3679 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966656.1 protein_id gnl|my_center|LOCUS_47210 3752 4963 gene locus_tag LOCUS_47220 3752 4963 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_47220 >Feature sequence0530 1226 57 gene locus_tag LOCUS_47230 gene cytX 1226 57 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225706.1 protein_id gnl|my_center|LOCUS_47230 2031 1219 gene locus_tag LOCUS_47240 gene thiD 2031 1219 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_47240 2802 2143 gene locus_tag LOCUS_47250 2802 2143 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_47250 3440 2802 gene locus_tag LOCUS_47260 gene thiE 3440 2802 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_47260 4248 3427 gene locus_tag LOCUS_47270 gene thiM 4248 3427 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_47270 4788 4270 gene locus_tag LOCUS_47280 gene thiW 4788 4270 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829480.1 protein_id gnl|my_center|LOCUS_47280 >Feature sequence0531 720 1520 gene locus_tag LOCUS_47290 gene cbiQ 720 1520 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812266.1 protein_id gnl|my_center|LOCUS_47290 1680 2516 gene locus_tag LOCUS_47300 1680 2516 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392733.1 protein_id gnl|my_center|LOCUS_47300 2556 3308 gene locus_tag LOCUS_47310 2556 3308 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812271.1 protein_id gnl|my_center|LOCUS_47310 3308 3622 gene locus_tag LOCUS_47320 3308 3622 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812269.1 protein_id gnl|my_center|LOCUS_47320 3843 5180 gene locus_tag LOCUS_47330 3843 5180 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_47330 >Feature sequence0532 3225 382 gene locus_tag LOCUS_47340 3225 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 3807 4184 gene locus_tag LOCUS_47350 3807 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 4412 4251 gene locus_tag LOCUS_47360 4412 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 5300 4677 gene locus_tag LOCUS_47370 5300 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 >Feature sequence0533 254 1615 gene locus_tag LOCUS_47380 254 1615 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861968.1 protein_id gnl|my_center|LOCUS_47380 1631 2458 gene locus_tag LOCUS_47390 1631 2458 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_47390 3679 2771 gene locus_tag LOCUS_47400 3679 2771 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747495.1 protein_id gnl|my_center|LOCUS_47400 4106 5122 gene locus_tag LOCUS_47410 4106 5122 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867187.1 protein_id gnl|my_center|LOCUS_47410 >Feature sequence0534 401 1363 gene locus_tag LOCUS_47420 401 1363 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964762.1 protein_id gnl|my_center|LOCUS_47420 1366 2697 gene locus_tag LOCUS_47430 1366 2697 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964763.1 protein_id gnl|my_center|LOCUS_47430 2690 3343 gene locus_tag LOCUS_47440 2690 3343 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263457.1 protein_id gnl|my_center|LOCUS_47440 3340 4656 gene locus_tag LOCUS_47450 3340 4656 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964765.1 protein_id gnl|my_center|LOCUS_47450 4653 5336 gene locus_tag LOCUS_47460 4653 5336 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830337.1 protein_id gnl|my_center|LOCUS_47460 >Feature sequence0535 <1 1722 gene locus_tag LOCUS_47470 <1 1722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081712308.1:glycogen/starch/alpha-glucan phosphorylase 2204 2782 gene locus_tag LOCUS_47480 gene scpB 2204 2782 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428258.1 protein_id gnl|my_center|LOCUS_47480 2769 4073 gene locus_tag LOCUS_47490 2769 4073 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454794.1 protein_id gnl|my_center|LOCUS_47490 4250 4666 gene locus_tag LOCUS_47500 4250 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_47500 4878 5168 gene locus_tag LOCUS_47510 gene rpsF 4878 5168 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420522.1 protein_id gnl|my_center|LOCUS_47510 >Feature sequence0536 2287 1520 gene locus_tag LOCUS_47520 2287 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 2935 2372 gene locus_tag LOCUS_47530 2935 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 3834 3028 gene locus_tag LOCUS_47540 3834 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 4005 3844 gene locus_tag LOCUS_47550 4005 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 5086 4010 gene locus_tag LOCUS_47560 5086 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 >Feature sequence0537 1351 311 gene locus_tag LOCUS_47570 1351 311 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272230.1 protein_id gnl|my_center|LOCUS_47570 3866 1467 gene locus_tag LOCUS_47580 3866 1467 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130514.1 protein_id gnl|my_center|LOCUS_47580 4650 3964 gene locus_tag LOCUS_47590 4650 3964 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272841.1 protein_id gnl|my_center|LOCUS_47590 4992 4663 gene locus_tag LOCUS_47600 4992 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 >Feature sequence0538 323 12 gene locus_tag LOCUS_47610 323 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 424 230 gene locus_tag LOCUS_47620 424 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 1787 804 gene locus_tag LOCUS_47630 1787 804 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_47630 2333 2016 gene locus_tag LOCUS_47640 2333 2016 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812269.1 protein_id gnl|my_center|LOCUS_47640 3085 2333 gene locus_tag LOCUS_47650 3085 2333 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812271.1 protein_id gnl|my_center|LOCUS_47650 3956 3123 gene locus_tag LOCUS_47660 3956 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 4793 3993 gene locus_tag LOCUS_47670 gene cbiQ 4793 3993 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812266.1 protein_id gnl|my_center|LOCUS_47670 >Feature sequence0539 3651 1972 gene locus_tag LOCUS_47680 3651 1972 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611323.1 protein_id gnl|my_center|LOCUS_47680 3816 3688 gene locus_tag LOCUS_47690 3816 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 4554 3889 gene locus_tag LOCUS_47700 4554 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 4866 4567 gene locus_tag LOCUS_47710 4866 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 >Feature sequence0540 324 920 gene locus_tag LOCUS_47720 324 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 2499 1039 gene locus_tag LOCUS_47730 2499 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 4173 2533 gene locus_tag LOCUS_47740 4173 2533 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129256806.1 protein_id gnl|my_center|LOCUS_47740 5044 4295 gene locus_tag LOCUS_47750 5044 4295 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130487.1 protein_id gnl|my_center|LOCUS_47750 >Feature sequence0541 <1 999 gene locus_tag LOCUS_47760 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000805139.1:LacI family DNA-binding transcriptional regulator 1089 2492 gene locus_tag LOCUS_47770 gene uxaC 1089 2492 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_47770 2704 2629 gene locus_tag LOCUS_t00300 2704 2629 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2807 2735 gene locus_tag LOCUS_t00310 2807 2735 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3950 2931 gene locus_tag LOCUS_47780 3950 2931 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_47780 4738 3947 gene locus_tag LOCUS_47790 4738 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 >Feature sequence0542 854 405 gene locus_tag LOCUS_47800 854 405 CDS product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745054.1 protein_id gnl|my_center|LOCUS_47800 1284 844 gene locus_tag LOCUS_47810 1284 844 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861965.1 protein_id gnl|my_center|LOCUS_47810 1710 2072 gene locus_tag LOCUS_47820 1710 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 2748 2161 gene locus_tag LOCUS_47830 2748 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681674.1 protein_id gnl|my_center|LOCUS_47830 3005 3700 gene locus_tag LOCUS_47840 3005 3700 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_47840 3730 4332 gene locus_tag LOCUS_47850 3730 4332 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016701.1 protein_id gnl|my_center|LOCUS_47850 4462 4896 gene locus_tag LOCUS_47860 4462 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 >Feature sequence0543 696 163 gene locus_tag LOCUS_47870 gene nusG 696 163 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_47870 902 705 gene locus_tag LOCUS_47880 902 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 1060 911 gene locus_tag LOCUS_47890 gene rpmG 1060 911 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_47890 1274 2362 gene locus_tag LOCUS_47900 1274 2362 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_47900 3535 2408 gene locus_tag LOCUS_47910 3535 2408 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869908.1 protein_id gnl|my_center|LOCUS_47910 4996 3665 gene locus_tag LOCUS_47920 4996 3665 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_47920 >Feature sequence0544 <1 583 gene locus_tag LOCUS_47930 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870274.1:restriction endonuclease subunit S 725 1978 gene locus_tag LOCUS_47940 725 1978 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107170.1 protein_id gnl|my_center|LOCUS_47940 2007 5186 gene locus_tag LOCUS_47950 2007 5186 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068838.1 protein_id gnl|my_center|LOCUS_47950 >Feature sequence0545 1828 635 gene locus_tag LOCUS_47960 1828 635 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_47960 2961 1834 gene locus_tag LOCUS_47970 2961 1834 CDS product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890534.1 protein_id gnl|my_center|LOCUS_47970 3211 3585 gene locus_tag LOCUS_47980 3211 3585 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_47980 3587 4453 gene locus_tag LOCUS_47990 3587 4453 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897173.1 protein_id gnl|my_center|LOCUS_47990 4450 5103 gene locus_tag LOCUS_48000 4450 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 >Feature sequence0546 2324 669 gene locus_tag LOCUS_48010 gene hcp 2324 669 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966037.1 protein_id gnl|my_center|LOCUS_48010 3231 2551 gene locus_tag LOCUS_48020 3231 2551 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665989.1 protein_id gnl|my_center|LOCUS_48020 <5256 3237 gene locus_tag LOCUS_48030 <5256 3237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812354.1:glutamine synthetase III >Feature sequence0547 >Feature sequence0548 1769 711 gene locus_tag LOCUS_48040 1769 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 3072 1780 gene locus_tag LOCUS_48050 3072 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 3705 3082 gene locus_tag LOCUS_48060 3705 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 5031 3718 gene locus_tag LOCUS_48070 5031 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 >Feature sequence0549 922 473 gene locus_tag LOCUS_48080 gene rplI 922 473 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_48080 2929 938 gene locus_tag LOCUS_48090 2929 938 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_48090 3855 2926 gene locus_tag LOCUS_48100 3855 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 <5240 4105 gene locus_tag LOCUS_48110 <5240 4105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009892490.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence0550 766 5181 gene locus_tag LOCUS_48120 gene essC 766 5181 CDS product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436727.1 protein_id gnl|my_center|LOCUS_48120 >Feature sequence0551 >Feature sequence0552 377 1135 gene locus_tag LOCUS_48130 gene sufC 377 1135 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224699.1 protein_id gnl|my_center|LOCUS_48130 1132 2541 gene locus_tag LOCUS_48140 gene sufB 1132 2541 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_48140 2541 3608 gene locus_tag LOCUS_48150 gene sufD 2541 3608 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 protein_id gnl|my_center|LOCUS_48150 3589 4806 gene locus_tag LOCUS_48160 3589 4806 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_48160 4799 5224 gene locus_tag LOCUS_48170 4799 5224 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_48170 >Feature sequence0553 1463 531 gene locus_tag LOCUS_48180 gene cysK 1463 531 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_48180 2056 1589 gene locus_tag LOCUS_48190 2056 1589 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262592.1 protein_id gnl|my_center|LOCUS_48190 2742 2086 gene locus_tag LOCUS_48200 2742 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 4922 2817 gene locus_tag LOCUS_48210 gene pnp 4922 2817 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_48210 >Feature sequence0554 3585 1726 gene locus_tag LOCUS_48220 3585 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016608.1 protein_id gnl|my_center|LOCUS_48220 5202 3715 gene locus_tag LOCUS_48230 gene galT 5202 3715 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_48230 >Feature sequence0555 49 1251 gene locus_tag LOCUS_48240 49 1251 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609547.1 protein_id gnl|my_center|LOCUS_48240 1270 1965 gene locus_tag LOCUS_48250 1270 1965 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922186.1 protein_id gnl|my_center|LOCUS_48250 1971 2756 gene locus_tag LOCUS_48260 1971 2756 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964562.1 protein_id gnl|my_center|LOCUS_48260 2765 3802 gene locus_tag LOCUS_48270 2765 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 3825 4727 gene locus_tag LOCUS_48280 3825 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 >Feature sequence0556 <5199 4406 gene locus_tag LOCUS_48290 <5199 4406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861462.1:flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase >Feature sequence0557 2536 884 gene locus_tag LOCUS_48300 2536 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 3749 3249 gene locus_tag LOCUS_48310 3749 3249 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392747.1 protein_id gnl|my_center|LOCUS_48310 5016 3847 gene locus_tag LOCUS_48320 5016 3847 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_48320 >Feature sequence0558 918 94 gene locus_tag LOCUS_48330 918 94 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986367.1 protein_id gnl|my_center|LOCUS_48330 1638 928 gene locus_tag LOCUS_48340 1638 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 2311 1664 gene locus_tag LOCUS_48350 2311 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 2453 2381 gene locus_tag LOCUS_t00320 2453 2381 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4213 2504 gene locus_tag LOCUS_48360 4213 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 5098 4217 gene locus_tag LOCUS_48370 5098 4217 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_48370 >Feature sequence0559 961 539 gene locus_tag LOCUS_48380 961 539 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476244.1 protein_id gnl|my_center|LOCUS_48380 1332 964 gene locus_tag LOCUS_48390 1332 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 2302 1334 gene locus_tag LOCUS_48400 gene pfkA 2302 1334 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_48400 4576 2921 gene locus_tag LOCUS_48410 4576 2921 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681065.1 protein_id gnl|my_center|LOCUS_48410 <5156 4578 gene locus_tag LOCUS_48420 <5156 4578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681067.1:iron ABC transporter permease >Feature sequence0560 <1 2243 gene locus_tag LOCUS_48430 <1 2243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775498.1:ATP-binding protein 2234 3430 gene locus_tag LOCUS_48440 2234 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 3443 3910 gene locus_tag LOCUS_48450 3443 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 3971 5095 gene locus_tag LOCUS_48460 3971 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 >Feature sequence0561 1064 198 gene locus_tag LOCUS_48470 1064 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 1610 1098 gene locus_tag LOCUS_48480 1610 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 2080 1697 gene locus_tag LOCUS_48490 2080 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 3194 2073 gene locus_tag LOCUS_48500 3194 2073 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_48500 3390 3196 gene locus_tag LOCUS_48510 3390 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 3686 4123 gene locus_tag LOCUS_48520 3686 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 4229 4819 gene locus_tag LOCUS_48530 4229 4819 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680409.1 protein_id gnl|my_center|LOCUS_48530 >Feature sequence0562 815 78 gene locus_tag LOCUS_48540 gene truA 815 78 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_48540 1627 827 gene locus_tag LOCUS_48550 1627 827 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_48550 2504 1620 gene locus_tag LOCUS_48560 2504 1620 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_48560 3377 2523 gene locus_tag LOCUS_48570 3377 2523 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_48570 3515 3440 gene locus_tag LOCUS_t00330 3515 3440 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3656 5011 gene locus_tag LOCUS_48580 3656 5011 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_48580 >Feature sequence0563 2861 1239 gene locus_tag LOCUS_48590 2861 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 4261 2876 gene locus_tag LOCUS_48600 4261 2876 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860945.1 protein_id gnl|my_center|LOCUS_48600 >Feature sequence0564 758 183 gene locus_tag LOCUS_48610 758 183 CDS product CDP-archaeol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964114.1 protein_id gnl|my_center|LOCUS_48610 1120 755 gene locus_tag LOCUS_48620 1120 755 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398824.1 protein_id gnl|my_center|LOCUS_48620 2203 1136 gene locus_tag LOCUS_48630 2203 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964120.1 protein_id gnl|my_center|LOCUS_48630 4334 2196 gene locus_tag LOCUS_48640 4334 2196 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964119.1 protein_id gnl|my_center|LOCUS_48640 <5139 4331 gene locus_tag LOCUS_48650 <5139 4331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986574.1:DegT/DnrJ/EryC1/StrS family aminotransferase >Feature sequence0565 1043 723 gene locus_tag LOCUS_48660 1043 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 1468 2889 gene locus_tag LOCUS_48670 1468 2889 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965627.1 protein_id gnl|my_center|LOCUS_48670 3042 3953 gene locus_tag LOCUS_48680 3042 3953 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816612.1 protein_id gnl|my_center|LOCUS_48680 3959 4774 gene locus_tag LOCUS_48690 3959 4774 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107914.1 protein_id gnl|my_center|LOCUS_48690 >Feature sequence0566 22 513 gene locus_tag LOCUS_48700 gene csm2 22 513 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917164.1 protein_id gnl|my_center|LOCUS_48700 526 1203 gene locus_tag LOCUS_48710 gene csm3 526 1203 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917166.1 protein_id gnl|my_center|LOCUS_48710 1205 2152 gene locus_tag LOCUS_48720 gene csm4 1205 2152 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414288.1 protein_id gnl|my_center|LOCUS_48720 2152 3297 gene locus_tag LOCUS_48730 gene csm5 2152 3297 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414285.1 protein_id gnl|my_center|LOCUS_48730 3322 4326 gene locus_tag LOCUS_48740 gene cas1 3322 4326 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414279.1 protein_id gnl|my_center|LOCUS_48740 4433 4741 gene locus_tag LOCUS_48750 gene cas2 4433 4741 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414276.1 protein_id gnl|my_center|LOCUS_48750 >Feature sequence0567 73 462 gene locus_tag LOCUS_48760 73 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 452 676 gene locus_tag LOCUS_48770 452 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 678 1766 gene locus_tag LOCUS_48780 gene essB 678 1766 CDS product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931192.1 protein_id gnl|my_center|LOCUS_48780 >Feature sequence0568 1475 1245 gene locus_tag LOCUS_48790 1475 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 1829 1557 gene locus_tag LOCUS_48800 1829 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 3175 2027 gene locus_tag LOCUS_48810 gene fucO 3175 2027 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013588.1 protein_id gnl|my_center|LOCUS_48810 3646 3215 gene locus_tag LOCUS_48820 3646 3215 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993892.1 protein_id gnl|my_center|LOCUS_48820 4774 3656 gene locus_tag LOCUS_48830 4774 3656 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_48830 >Feature sequence0569 120 659 gene locus_tag LOCUS_48840 gene lepB 120 659 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870097.1 protein_id gnl|my_center|LOCUS_48840 2085 721 gene locus_tag LOCUS_48850 2085 721 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_48850 2366 2094 gene locus_tag LOCUS_48860 2366 2094 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_48860 3181 2387 gene locus_tag LOCUS_48870 3181 2387 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_48870 3746 3186 gene locus_tag LOCUS_48880 gene coaE 3746 3186 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881297.1 protein_id gnl|my_center|LOCUS_48880 <5099 3746 gene locus_tag LOCUS_48890 <5099 3746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964413.1:DNA polymerase I >Feature sequence0570 1055 288 gene locus_tag LOCUS_48900 1055 288 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682019.1 protein_id gnl|my_center|LOCUS_48900 2113 1055 gene locus_tag LOCUS_48910 2113 1055 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669987.1 protein_id gnl|my_center|LOCUS_48910 3290 2217 gene locus_tag LOCUS_48920 3290 2217 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682022.1 protein_id gnl|my_center|LOCUS_48920 4369 3314 gene locus_tag LOCUS_48930 4369 3314 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682022.1 protein_id gnl|my_center|LOCUS_48930 >Feature sequence0571 20 406 gene locus_tag LOCUS_48940 20 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 484 639 gene locus_tag LOCUS_48950 484 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 581 1015 gene locus_tag LOCUS_48960 581 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 1309 2760 gene locus_tag LOCUS_48970 1309 2760 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_48970 2770 3498 gene locus_tag LOCUS_48980 2770 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 3510 3875 gene locus_tag LOCUS_48990 3510 3875 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_48990 3894 5045 gene locus_tag LOCUS_49000 3894 5045 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_49000 >Feature sequence0572 627 1361 gene locus_tag LOCUS_49010 627 1361 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016437.1 protein_id gnl|my_center|LOCUS_49010 2949 1477 gene locus_tag LOCUS_49020 2949 1477 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462215.1 protein_id gnl|my_center|LOCUS_49020 3686 2952 gene locus_tag LOCUS_49030 3686 2952 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815503.1 protein_id gnl|my_center|LOCUS_49030 4271 3687 gene locus_tag LOCUS_49040 4271 3687 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815501.1 protein_id gnl|my_center|LOCUS_49040 5052 4432 gene locus_tag LOCUS_49050 5052 4432 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681311.1 protein_id gnl|my_center|LOCUS_49050 >Feature sequence0573 >Feature sequence0574 <5080 301 gene locus_tag LOCUS_49060 <5080 301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479434.1:RHS repeat-associated core domain-containing protein >Feature sequence0575 2086 1577 gene locus_tag LOCUS_49070 2086 1577 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392747.1 protein_id gnl|my_center|LOCUS_49070 3374 2205 gene locus_tag LOCUS_49080 3374 2205 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_49080 <5079 3441 gene locus_tag LOCUS_49090 <5079 3441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963778.1:endopeptidase La >Feature sequence0576 <1 700 gene locus_tag LOCUS_49100 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436885.1:arginine--tRNA ligase 748 2553 gene locus_tag LOCUS_49110 gene lepA 748 2553 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416556.1 protein_id gnl|my_center|LOCUS_49110 2658 3347 gene locus_tag LOCUS_49120 2658 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048138.1 protein_id gnl|my_center|LOCUS_49120 3435 3578 gene locus_tag LOCUS_49130 3435 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 3559 3729 gene locus_tag LOCUS_49140 3559 3729 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888017.1 protein_id gnl|my_center|LOCUS_49140 3972 4844 gene locus_tag LOCUS_49150 3972 4844 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288847.1 protein_id gnl|my_center|LOCUS_49150 >Feature sequence0577 1315 23 gene locus_tag LOCUS_49160 1315 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 3038 1551 gene locus_tag LOCUS_49170 3038 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 4436 3978 gene locus_tag LOCUS_49180 4436 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 4542 4766 gene locus_tag LOCUS_49190 4542 4766 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016226.1 protein_id gnl|my_center|LOCUS_49190 >Feature sequence0578 135 761 gene locus_tag LOCUS_49200 gene rplD 135 761 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_49200 761 1045 gene locus_tag LOCUS_49210 gene rplW 761 1045 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_49210 1064 1891 gene locus_tag LOCUS_49220 gene rplB 1064 1891 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_49220 1913 2194 gene locus_tag LOCUS_49230 gene rpsS 1913 2194 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421166.1 protein_id gnl|my_center|LOCUS_49230 2232 2576 gene locus_tag LOCUS_49240 gene rplV 2232 2576 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887891.1 protein_id gnl|my_center|LOCUS_49240 2594 3397 gene locus_tag LOCUS_49250 gene rpsC 2594 3397 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421163.1 protein_id gnl|my_center|LOCUS_49250 3423 3857 gene locus_tag LOCUS_49260 gene rplP 3423 3857 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421160.1 protein_id gnl|my_center|LOCUS_49260 3847 4038 gene locus_tag LOCUS_49270 gene rpmC 3847 4038 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_49270 4058 4312 gene locus_tag LOCUS_49280 gene rpsQ 4058 4312 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421156.1 protein_id gnl|my_center|LOCUS_49280 4329 4697 gene locus_tag LOCUS_49290 gene rplN 4329 4697 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421155.1 protein_id gnl|my_center|LOCUS_49290 4712 5017 gene locus_tag LOCUS_49300 gene rplX 4712 5017 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427723.1 protein_id gnl|my_center|LOCUS_49300 >Feature sequence0579 780 67 gene locus_tag LOCUS_49310 780 67 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814197.1 protein_id gnl|my_center|LOCUS_49310 2071 824 gene locus_tag LOCUS_49320 2071 824 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065307.1 protein_id gnl|my_center|LOCUS_49320 2554 2180 gene locus_tag LOCUS_49330 2554 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 3734 2661 gene locus_tag LOCUS_49340 3734 2661 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379407.1 protein_id gnl|my_center|LOCUS_49340 4262 3801 gene locus_tag LOCUS_49350 4262 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 4720 4460 gene locus_tag LOCUS_49360 4720 4460 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113436.1 protein_id gnl|my_center|LOCUS_49360 4983 4720 gene locus_tag LOCUS_49370 4983 4720 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113434.1 protein_id gnl|my_center|LOCUS_49370 >Feature sequence0580 471 896 gene locus_tag LOCUS_49380 gene rplK 471 896 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_49380 915 1610 gene locus_tag LOCUS_49390 gene rplA 915 1610 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_49390 2123 2611 gene locus_tag LOCUS_49400 gene rplJ 2123 2611 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360185.1 protein_id gnl|my_center|LOCUS_49400 2702 3076 gene locus_tag LOCUS_49410 gene rplL 2702 3076 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357259.1 protein_id gnl|my_center|LOCUS_49410 3530 4966 gene locus_tag LOCUS_49420 gene pyk 3530 4966 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_49420 >Feature sequence0581 85 1749 gene locus_tag LOCUS_49430 85 1749 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902683.1 protein_id gnl|my_center|LOCUS_49430 2395 1709 gene locus_tag LOCUS_49440 2395 1709 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948158.1 protein_id gnl|my_center|LOCUS_49440 3464 2640 gene locus_tag LOCUS_49450 gene pstA 3464 2640 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356806.1 protein_id gnl|my_center|LOCUS_49450 4353 3484 gene locus_tag LOCUS_49460 gene pstC 4353 3484 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948157.1 protein_id gnl|my_center|LOCUS_49460 <5064 4366 gene locus_tag LOCUS_49470 <5064 4366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948156.1:phosphate ABC transporter substrate-binding protein >Feature sequence0582 177 2342 gene locus_tag LOCUS_49480 177 2342 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518812.1 protein_id gnl|my_center|LOCUS_49480 >Feature sequence0583 1287 13 gene locus_tag LOCUS_49490 1287 13 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442178.1 protein_id gnl|my_center|LOCUS_49490 1625 1296 gene locus_tag LOCUS_49500 gene azlD 1625 1296 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_49500 2320 1622 gene locus_tag LOCUS_49510 gene azlC 2320 1622 CDS product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969035.1 protein_id gnl|my_center|LOCUS_49510 3588 2377 gene locus_tag LOCUS_49520 3588 2377 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_49520 >Feature sequence0584 2949 2179 gene locus_tag LOCUS_49530 2949 2179 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948093.1 protein_id gnl|my_center|LOCUS_49530 4022 2946 gene locus_tag LOCUS_49540 4022 2946 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986194.1 protein_id gnl|my_center|LOCUS_49540 <5045 4077 gene locus_tag LOCUS_49550 <5045 4077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948657.1:ABC transporter substrate-binding protein >Feature sequence0585 <1 1124 gene locus_tag LOCUS_49560 <1 1124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003417090.1:trigger factor 1124 1921 gene locus_tag LOCUS_49570 1124 1921 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_49570 1944 2648 gene locus_tag LOCUS_49580 gene cysE 1944 2648 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459083.1 protein_id gnl|my_center|LOCUS_49580 2648 2977 gene locus_tag LOCUS_49590 2648 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 2955 3602 gene locus_tag LOCUS_49600 2955 3602 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_49600 3722 4303 gene locus_tag LOCUS_49610 3722 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 4339 4767 gene locus_tag LOCUS_49620 4339 4767 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902921.1 protein_id gnl|my_center|LOCUS_49620 >Feature sequence0586 1664 306 gene locus_tag LOCUS_49630 gene murD 1664 306 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_49630 2657 1686 gene locus_tag LOCUS_49640 gene mraY 2657 1686 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_49640 5003 2760 gene locus_tag LOCUS_49650 5003 2760 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949034.1 protein_id gnl|my_center|LOCUS_49650 >Feature sequence0587 1356 2444 gene locus_tag LOCUS_49660 gene mnmA 1356 2444 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066097.1 protein_id gnl|my_center|LOCUS_49660 2475 3230 gene locus_tag LOCUS_49670 2475 3230 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476314.1 protein_id gnl|my_center|LOCUS_49670 >Feature sequence0588 261 464 gene locus_tag LOCUS_49680 261 464 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191849.1 protein_id gnl|my_center|LOCUS_49680 1443 559 gene locus_tag LOCUS_49690 gene hslO 1443 559 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048141.1 protein_id gnl|my_center|LOCUS_49690 2196 1444 gene locus_tag LOCUS_49700 2196 1444 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105572.1 protein_id gnl|my_center|LOCUS_49700 2758 2255 gene locus_tag LOCUS_49710 2758 2255 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359469.1 protein_id gnl|my_center|LOCUS_49710 2999 3166 gene locus_tag LOCUS_49720 2999 3166 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963626.1 protein_id gnl|my_center|LOCUS_49720 4590 3259 gene locus_tag LOCUS_49730 gene dnaB 4590 3259 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_49730 >Feature sequence0589 1197 493 gene locus_tag LOCUS_49740 1197 493 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_49740 1968 1210 gene locus_tag LOCUS_49750 1968 1210 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017145.1 protein_id gnl|my_center|LOCUS_49750 2940 1972 gene locus_tag LOCUS_49760 2940 1972 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 protein_id gnl|my_center|LOCUS_49760 3828 2947 gene locus_tag LOCUS_49770 3828 2947 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_49770 <5028 3961 gene locus_tag LOCUS_49780 <5028 3961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902269.1:ABC transporter substrate-binding protein >Feature sequence0590 <1 4928 gene locus_tag LOCUS_49790 <1 4928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211477941.1:SpaA isopeptide-forming pilin-related protein >Feature sequence0591 1077 100 gene locus_tag LOCUS_49800 1077 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49800 2550 1201 gene locus_tag LOCUS_49810 gene mgtE 2550 1201 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_49810 3922 2567 gene locus_tag LOCUS_49820 gene mgtE 3922 2567 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_49820 <5020 4437 gene locus_tag LOCUS_49830 <5020 4437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016094.1:DUF421 domain-containing protein >Feature sequence0592 37 495 gene locus_tag LOCUS_49840 37 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 1525 497 gene locus_tag LOCUS_49850 1525 497 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582848.1 protein_id gnl|my_center|LOCUS_49850 2102 1500 gene locus_tag LOCUS_49860 2102 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 4008 2095 gene locus_tag LOCUS_49870 4008 2095 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_49870 >Feature sequence0593 <1 571 gene locus_tag LOCUS_49880 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861032.1:phage tail sheath family protein 595 1065 gene locus_tag LOCUS_49890 595 1065 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429851.1 protein_id gnl|my_center|LOCUS_49890 1068 1616 gene locus_tag LOCUS_49900 1068 1616 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429853.1 protein_id gnl|my_center|LOCUS_49900 1631 1795 gene locus_tag LOCUS_49910 1631 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081580231.1 protein_id gnl|my_center|LOCUS_49910 1801 4002 gene locus_tag LOCUS_49920 1801 4002 CDS product tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089746071.1 protein_id gnl|my_center|LOCUS_49920 4004 4651 gene locus_tag LOCUS_49930 4004 4651 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861037.1 protein_id gnl|my_center|LOCUS_49930 >Feature sequence0594 606 88 gene locus_tag LOCUS_49940 606 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 913 1602 gene locus_tag LOCUS_49950 913 1602 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964054.1 protein_id gnl|my_center|LOCUS_49950 1726 2787 gene locus_tag LOCUS_49960 1726 2787 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948657.1 protein_id gnl|my_center|LOCUS_49960 2842 3918 gene locus_tag LOCUS_49970 2842 3918 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986194.1 protein_id gnl|my_center|LOCUS_49970 3918 4685 gene locus_tag LOCUS_49980 3918 4685 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948655.1 protein_id gnl|my_center|LOCUS_49980 >Feature sequence0595 1708 362 gene locus_tag LOCUS_49990 gene rsxC 1708 362 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_49990 3947 2178 gene locus_tag LOCUS_50000 gene argS 3947 2178 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_50000 4602 4042 gene locus_tag LOCUS_50010 gene efp 4602 4042 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_50010 >Feature sequence0596 879 2111 gene locus_tag LOCUS_50020 879 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 2102 3373 gene locus_tag LOCUS_50030 2102 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 3378 4001 gene locus_tag LOCUS_50040 3378 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 4134 4430 gene locus_tag LOCUS_50050 4134 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50050 4449 4760 gene locus_tag LOCUS_50060 4449 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 >Feature sequence0597 1084 3960 gene locus_tag LOCUS_50070 1084 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 3950 4291 gene locus_tag LOCUS_50080 3950 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 4389 4715 gene locus_tag LOCUS_50090 4389 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 >Feature sequence0598 343 68 gene locus_tag LOCUS_50100 343 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50100 2579 384 gene locus_tag LOCUS_50110 2579 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 3453 2554 gene locus_tag LOCUS_50120 3453 2554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_50120 3830 3450 gene locus_tag LOCUS_50130 3830 3450 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_50130 4627 4280 gene locus_tag LOCUS_50140 4627 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 >Feature sequence0599 80 253 gene locus_tag LOCUS_50150 80 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 1142 2599 gene locus_tag LOCUS_50160 1142 2599 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661024.1 protein_id gnl|my_center|LOCUS_50160 2613 3464 gene locus_tag LOCUS_50170 gene speE 2613 3464 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_50170 3454 4302 gene locus_tag LOCUS_50180 gene speB 3454 4302 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_50180 >Feature sequence0600 176 298 gene locus_tag LOCUS_50190 176 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 270 977 gene locus_tag LOCUS_50200 270 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 990 2378 gene locus_tag LOCUS_50210 990 2378 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986917.1 protein_id gnl|my_center|LOCUS_50210 2542 3705 gene locus_tag LOCUS_50220 2542 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 3805 4497 gene locus_tag LOCUS_50230 gene cysE 3805 4497 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889486.1 protein_id gnl|my_center|LOCUS_50230 4511 4807 gene locus_tag LOCUS_50240 4511 4807 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414342.1 protein_id gnl|my_center|LOCUS_50240 >Feature sequence0601 426 2168 gene locus_tag LOCUS_50250 426 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50250 2169 3530 gene locus_tag LOCUS_50260 2169 3530 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459130.1 protein_id gnl|my_center|LOCUS_50260 3539 4240 gene locus_tag LOCUS_50270 3539 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 >Feature sequence0602 1812 1015 gene locus_tag LOCUS_50280 1812 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 4258 1802 gene locus_tag LOCUS_50290 4258 1802 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_50290 <4952 4270 gene locus_tag LOCUS_50300 <4952 4270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966319.1:isoleucine--tRNA ligase >Feature sequence0603 <1 584 gene locus_tag LOCUS_50310 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836418.1:NAD-dependent malic enzyme 677 1624 gene locus_tag LOCUS_50320 677 1624 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263595.1 protein_id gnl|my_center|LOCUS_50320 2842 1856 gene locus_tag LOCUS_50330 2842 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_50330 3569 2949 gene locus_tag LOCUS_50340 3569 2949 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895475.1 protein_id gnl|my_center|LOCUS_50340 4326 3628 gene locus_tag LOCUS_50350 4326 3628 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_50350 4604 4461 gene locus_tag LOCUS_50360 4604 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50360 >Feature sequence0604 1444 1977 gene locus_tag LOCUS_50370 1444 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 1989 3812 gene locus_tag LOCUS_50380 gene uvrC 1989 3812 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_50380 3930 4871 gene locus_tag LOCUS_50390 gene hprK 3930 4871 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_50390 >Feature sequence0605 2128 3000 gene locus_tag LOCUS_50400 2128 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 3072 4460 gene locus_tag LOCUS_50410 3072 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 4511 4762 gene locus_tag LOCUS_50420 4511 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 >Feature sequence0606 <1 1050 gene locus_tag LOCUS_50430 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482420.1:maltodextrin glucosidase 1074 2447 gene locus_tag LOCUS_50440 1074 2447 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233074.1 protein_id gnl|my_center|LOCUS_50440 2444 3424 gene locus_tag LOCUS_50450 2444 3424 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948854.1 protein_id gnl|my_center|LOCUS_50450 3421 3588 gene locus_tag LOCUS_50460 3421 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 3588 4454 gene locus_tag LOCUS_50470 3588 4454 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286075.1 protein_id gnl|my_center|LOCUS_50470 >Feature sequence0607 <1 1709 gene locus_tag LOCUS_50480 <1 1709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964657.1:transketolase 1744 3150 gene locus_tag LOCUS_50490 1744 3150 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_50490 3158 3832 gene locus_tag LOCUS_50500 3158 3832 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416528.1 protein_id gnl|my_center|LOCUS_50500 3844 4692 gene locus_tag LOCUS_50510 3844 4692 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_50510 >Feature sequence0608 <1 739 gene locus_tag LOCUS_50520 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966858.1:NAD(P)/FAD-dependent oxidoreductase 929 1411 gene locus_tag LOCUS_50530 929 1411 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948465.1 protein_id gnl|my_center|LOCUS_50530 1421 2377 gene locus_tag LOCUS_50540 1421 2377 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949075.1 protein_id gnl|my_center|LOCUS_50540 2551 4665 gene locus_tag LOCUS_50550 2551 4665 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_50550 >Feature sequence0609 1153 275 gene locus_tag LOCUS_50560 1153 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50560 2187 1150 gene locus_tag LOCUS_50570 2187 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 3342 2206 gene locus_tag LOCUS_50580 3342 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 3566 3429 gene locus_tag LOCUS_50590 3566 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50590 4581 3571 gene locus_tag LOCUS_50600 4581 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 4876 4634 gene locus_tag LOCUS_50610 4876 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 >Feature sequence0610 1527 1192 gene locus_tag LOCUS_50620 1527 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 2906 1527 gene locus_tag LOCUS_50630 gene argH 2906 1527 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_50630 <4901 2922 gene locus_tag LOCUS_50640 <4901 2922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106612643.1:YfhO family protein >Feature sequence0611 201 1310 gene locus_tag LOCUS_50650 201 1310 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067618.1 protein_id gnl|my_center|LOCUS_50650 1450 2985 gene locus_tag LOCUS_50660 1450 2985 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732280.1 protein_id gnl|my_center|LOCUS_50660 2960 4084 gene locus_tag LOCUS_50670 2960 4084 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074497.1 protein_id gnl|my_center|LOCUS_50670 >Feature sequence0612 621 151 gene locus_tag LOCUS_50680 621 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50680 805 1272 gene locus_tag LOCUS_50690 805 1272 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460328.1 protein_id gnl|my_center|LOCUS_50690 2003 2722 gene locus_tag LOCUS_50700 2003 2722 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948252.1 protein_id gnl|my_center|LOCUS_50700 4343 3162 gene locus_tag LOCUS_50710 4343 3162 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048235.1 protein_id gnl|my_center|LOCUS_50710 <4895 4354 gene locus_tag LOCUS_50720 <4895 4354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003427760.1:electron transfer flavoprotein subunit beta >Feature sequence0613 163 570 gene locus_tag LOCUS_50730 163 570 CDS product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461818.1 protein_id gnl|my_center|LOCUS_50730 680 988 gene locus_tag LOCUS_50740 gene rplU 680 988 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_50740 994 1311 gene locus_tag LOCUS_50750 994 1311 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476071.1 protein_id gnl|my_center|LOCUS_50750 1312 1602 gene locus_tag LOCUS_50760 gene rpmA 1312 1602 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_50760 1668 2945 gene locus_tag LOCUS_50770 gene obgE 1668 2945 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_50770 2957 3253 gene locus_tag LOCUS_50780 gene yhbY 2957 3253 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_50780 3257 3871 gene locus_tag LOCUS_50790 gene nadD 3257 3871 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943828.1 protein_id gnl|my_center|LOCUS_50790 3864 4454 gene locus_tag LOCUS_50800 gene yqeK 3864 4454 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399059.1 protein_id gnl|my_center|LOCUS_50800 4455 4793 gene locus_tag LOCUS_50810 4455 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 >Feature sequence0614 539 2380 gene locus_tag LOCUS_50820 gene typA 539 2380 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_50820 3113 2682 gene locus_tag LOCUS_50830 3113 2682 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_50830 4027 3107 gene locus_tag LOCUS_50840 gene pyrB 4027 3107 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_50840 >Feature sequence0615 744 559 gene locus_tag LOCUS_50850 744 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 1908 886 gene locus_tag LOCUS_50860 1908 886 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 protein_id gnl|my_center|LOCUS_50860 2243 1920 gene locus_tag LOCUS_50870 2243 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 3992 2358 gene locus_tag LOCUS_50880 3992 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 4565 4227 gene locus_tag LOCUS_50890 4565 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 >Feature sequence0616 166 1080 gene locus_tag LOCUS_50900 gene pyrB 166 1080 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_50900 1080 1514 gene locus_tag LOCUS_50910 1080 1514 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_50910 1582 2058 gene locus_tag LOCUS_50920 1582 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 2160 4727 gene locus_tag LOCUS_50930 2160 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50930 >Feature sequence0617 1621 890 gene locus_tag LOCUS_50940 gene fabG 1621 890 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_50940 2628 1687 gene locus_tag LOCUS_50950 gene fabD 2628 1687 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775318.1 protein_id gnl|my_center|LOCUS_50950 3656 2652 gene locus_tag LOCUS_50960 3656 2652 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048432.1 protein_id gnl|my_center|LOCUS_50960 4635 3685 gene locus_tag LOCUS_50970 4635 3685 CDS product DUF561 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722294.1 protein_id gnl|my_center|LOCUS_50970 >Feature sequence0618 1652 1212 gene locus_tag LOCUS_50980 1652 1212 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363747.1 protein_id gnl|my_center|LOCUS_50980 2433 1660 gene locus_tag LOCUS_50990 2433 1660 CDS product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113406.1 protein_id gnl|my_center|LOCUS_50990 4425 2458 gene locus_tag LOCUS_51000 gene uvrB 4425 2458 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891935.1 protein_id gnl|my_center|LOCUS_51000 >Feature sequence0619 262 798 gene locus_tag LOCUS_51010 262 798 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_51010 871 1011 gene locus_tag LOCUS_51020 871 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 1087 1917 gene locus_tag LOCUS_51030 1087 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 2089 3366 gene locus_tag LOCUS_51040 2089 3366 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_51040 3731 4618 gene locus_tag LOCUS_51050 3731 4618 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116510.1 protein_id gnl|my_center|LOCUS_51050 >Feature sequence0620 1608 1435 gene locus_tag LOCUS_51060 1608 1435 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_51060 1995 2198 gene locus_tag LOCUS_51070 1995 2198 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359346.1 protein_id gnl|my_center|LOCUS_51070 3100 2411 gene locus_tag LOCUS_51080 3100 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51080 3656 3778 gene locus_tag LOCUS_51090 3656 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 3865 4644 gene locus_tag LOCUS_51100 3865 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_51100 >Feature sequence0621 1239 847 gene locus_tag LOCUS_51110 1239 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 >Feature sequence0622 <1 1011 gene locus_tag LOCUS_51120 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434229.1:DNA topoisomerase (ATP-hydrolyzing) subunit B 1540 3978 gene locus_tag LOCUS_51130 gene gyrA 1540 3978 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_51130 >Feature sequence0623 1020 694 gene locus_tag LOCUS_51140 1020 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51140 1357 1229 gene locus_tag LOCUS_51150 1357 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51150 2091 1786 gene locus_tag LOCUS_51160 2091 1786 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991611.1 protein_id gnl|my_center|LOCUS_51160 3032 2664 gene locus_tag LOCUS_51170 3032 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51170 3433 3212 gene locus_tag LOCUS_51180 3433 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 3930 3430 gene locus_tag LOCUS_51190 3930 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51190 4481 4684 gene locus_tag LOCUS_51200 4481 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51200 >Feature sequence0624 <1 698 gene locus_tag LOCUS_51210 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966124.1:tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB 688 1128 gene locus_tag LOCUS_51220 gene rimI 688 1128 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_51220 1158 2033 gene locus_tag LOCUS_51230 1158 2033 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_51230 2014 3036 gene locus_tag LOCUS_51240 gene tsaD 2014 3036 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964219.1 protein_id gnl|my_center|LOCUS_51240 3066 3767 gene locus_tag LOCUS_51250 gene ispD 3066 3767 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048363.1 protein_id gnl|my_center|LOCUS_51250 3748 3873 gene locus_tag LOCUS_51260 3748 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 3870 4292 gene locus_tag LOCUS_51270 3870 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 4293 4652 gene locus_tag LOCUS_51280 4293 4652 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723189.1 protein_id gnl|my_center|LOCUS_51280 >Feature sequence0625 67 1161 gene locus_tag LOCUS_51290 67 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 1967 1206 gene locus_tag LOCUS_51300 1967 1206 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023916573.1 protein_id gnl|my_center|LOCUS_51300 2136 2297 gene locus_tag LOCUS_51310 2136 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 2445 2693 gene locus_tag LOCUS_51320 2445 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 3589 2732 gene locus_tag LOCUS_51330 3589 2732 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836414.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51330 3711 3592 gene locus_tag LOCUS_51340 3711 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 4508 3726 gene locus_tag LOCUS_51350 4508 3726 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_51350 >Feature sequence0626 61 2286 gene locus_tag LOCUS_51360 61 2286 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 protein_id gnl|my_center|LOCUS_51360 2490 3404 gene locus_tag LOCUS_51370 2490 3404 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281520.1 protein_id gnl|my_center|LOCUS_51370 3401 4351 gene locus_tag LOCUS_51380 3401 4351 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017180.1 protein_id gnl|my_center|LOCUS_51380 >Feature sequence0627 4423 155 gene locus_tag LOCUS_51390 4423 155 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484061.1 protein_id gnl|my_center|LOCUS_51390 >Feature sequence0628 53 523 gene locus_tag LOCUS_51400 53 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51400 520 969 gene locus_tag LOCUS_51410 520 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 972 1466 gene locus_tag LOCUS_51420 972 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 1485 1919 gene locus_tag LOCUS_51430 1485 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51430 1916 2476 gene locus_tag LOCUS_51440 1916 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 >Feature sequence0629 <1 606 gene locus_tag LOCUS_51450 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860935.1:anaerobic carbon-monoxide dehydrogenase catalytic subunit 2158 3366 gene locus_tag LOCUS_51460 2158 3366 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986697.1 protein_id gnl|my_center|LOCUS_51460 3389 4189 gene locus_tag LOCUS_51470 gene hadI 3389 4189 CDS product 2-hydroxyisocaproyl-CoA dehydratase activator HadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986690.1 protein_id gnl|my_center|LOCUS_51470 >Feature sequence0630 307 612 gene locus_tag LOCUS_51480 307 612 CDS product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461833.1 protein_id gnl|my_center|LOCUS_51480 602 1351 gene locus_tag LOCUS_51490 602 1351 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461832.1 protein_id gnl|my_center|LOCUS_51490 1348 2355 gene locus_tag LOCUS_51500 1348 2355 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461831.1 protein_id gnl|my_center|LOCUS_51500 2333 3091 gene locus_tag LOCUS_51510 2333 3091 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184185.1 protein_id gnl|my_center|LOCUS_51510 3970 3131 gene locus_tag LOCUS_51520 3970 3131 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814367.1 protein_id gnl|my_center|LOCUS_51520 >Feature sequence0631 986 432 gene locus_tag LOCUS_51530 986 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 2943 1249 gene locus_tag LOCUS_51540 2943 1249 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929046.1 protein_id gnl|my_center|LOCUS_51540 4797 3661 gene locus_tag LOCUS_51550 gene rlmD 4797 3661 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_51550 >Feature sequence0632 3149 1392 gene locus_tag LOCUS_51560 3149 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 4264 3128 gene locus_tag LOCUS_51570 4264 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51570 >Feature sequence0633 <1 2888 gene locus_tag LOCUS_51580 <1 2888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001143843.1:DEAD/DEAH box helicase family protein 3009 3947 gene locus_tag LOCUS_51590 3009 3947 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837604.1 protein_id gnl|my_center|LOCUS_51590 >Feature sequence0634 122 511 gene locus_tag LOCUS_51600 122 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51600 1194 1054 gene locus_tag LOCUS_51610 1194 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 1929 1198 gene locus_tag LOCUS_51620 1929 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 2771 4120 gene locus_tag LOCUS_51630 2771 4120 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_51630 >Feature sequence0635 422 1765 gene locus_tag LOCUS_51640 422 1765 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027699.1 protein_id gnl|my_center|LOCUS_51640 >Feature sequence0636 1674 361 gene locus_tag LOCUS_51650 1674 361 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_51650 1980 2876 gene locus_tag LOCUS_51660 1980 2876 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286852.1 protein_id gnl|my_center|LOCUS_51660 4774 2924 gene locus_tag LOCUS_51670 gene hcp 4774 2924 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966698.1 protein_id gnl|my_center|LOCUS_51670 >Feature sequence0637 102 866 gene locus_tag LOCUS_51680 102 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 885 1442 gene locus_tag LOCUS_51690 885 1442 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255938.1 protein_id gnl|my_center|LOCUS_51690 1496 2641 gene locus_tag LOCUS_51700 1496 2641 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816413.1 protein_id gnl|my_center|LOCUS_51700 2719 2943 gene locus_tag LOCUS_51710 2719 2943 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016226.1 protein_id gnl|my_center|LOCUS_51710 2940 3209 gene locus_tag LOCUS_51720 2940 3209 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016227.1 protein_id gnl|my_center|LOCUS_51720 3266 3643 gene locus_tag LOCUS_51730 3266 3643 CDS product YlxM family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460448.1 protein_id gnl|my_center|LOCUS_51730 >Feature sequence0638 1616 390 gene locus_tag LOCUS_51740 gene tyrS 1616 390 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_51740 1876 2904 gene locus_tag LOCUS_51750 1876 2904 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_51750 2904 3452 gene locus_tag LOCUS_51760 gene nrdG 2904 3452 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_51760 3433 4113 gene locus_tag LOCUS_51770 3433 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 >Feature sequence0639 1394 195 gene locus_tag LOCUS_51780 1394 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51780 4443 1402 gene locus_tag LOCUS_51790 4443 1402 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861545.1 protein_id gnl|my_center|LOCUS_51790 >Feature sequence0640 379 1290 gene locus_tag LOCUS_51800 gene trxB 379 1290 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_51800 1346 1891 gene locus_tag LOCUS_51810 1346 1891 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_51810 1972 2415 gene locus_tag LOCUS_51820 gene ohrR 1972 2415 CDS product organic hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245653.1 protein_id gnl|my_center|LOCUS_51820 2463 2987 gene locus_tag LOCUS_51830 2463 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 3073 4698 gene locus_tag LOCUS_51840 3073 4698 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109303.1 protein_id gnl|my_center|LOCUS_51840 >Feature sequence0641 <1 553 gene locus_tag LOCUS_51850 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000753855.1:choline-binding protein PcpA 848 1105 gene locus_tag LOCUS_51860 848 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 1134 2879 gene locus_tag LOCUS_51870 1134 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51870 3089 3214 gene locus_tag LOCUS_51880 3089 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 3237 3623 gene locus_tag LOCUS_51890 3237 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 4622 3720 gene locus_tag LOCUS_51900 4622 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 >Feature sequence0642 115 624 gene locus_tag LOCUS_51910 115 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 820 2574 gene locus_tag LOCUS_51920 820 2574 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005399341.1 protein_id gnl|my_center|LOCUS_51920 2558 4273 gene locus_tag LOCUS_51930 2558 4273 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005399340.1 protein_id gnl|my_center|LOCUS_51930 4542 4706 gene locus_tag LOCUS_51940 4542 4706 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895603.1 protein_id gnl|my_center|LOCUS_51940 >Feature sequence0643 407 550 gene locus_tag LOCUS_51950 407 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 522 950 gene locus_tag LOCUS_51960 522 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 2046 2558 gene locus_tag LOCUS_51970 gene trpP 2046 2558 CDS product tryptophan transporter TrpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233236.1 protein_id gnl|my_center|LOCUS_51970 3067 3504 gene locus_tag LOCUS_51980 3067 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51980 <4783 3575 gene locus_tag LOCUS_51990 <4783 3575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398851.1:diaminopimelate decarboxylase >Feature sequence0644 174 746 gene locus_tag LOCUS_52000 174 746 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577796.1 protein_id gnl|my_center|LOCUS_52000 990 2636 gene locus_tag LOCUS_52010 990 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 2676 4442 gene locus_tag LOCUS_52020 2676 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52020 >Feature sequence0645 1574 588 gene locus_tag LOCUS_52030 1574 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 2296 1598 gene locus_tag LOCUS_52040 2296 1598 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459569.1 protein_id gnl|my_center|LOCUS_52040 2506 3147 gene locus_tag LOCUS_52050 2506 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 >Feature sequence0646 2048 3109 gene locus_tag LOCUS_52060 gene ord 2048 3109 CDS product 2,4-diaminopentanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895461.1 protein_id gnl|my_center|LOCUS_52060 3265 3564 gene locus_tag LOCUS_52070 gene ortA 3265 3564 CDS product 2-amino-4-oxopentanoate thiolase subunit OrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860811.1 protein_id gnl|my_center|LOCUS_52070 >Feature sequence0647 1 465 gene locus_tag LOCUS_52080 1 465 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641270.1 protein_id gnl|my_center|LOCUS_52080 476 1573 gene locus_tag LOCUS_52090 476 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 1652 2599 gene locus_tag LOCUS_52100 1652 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52100 2733 3500 gene locus_tag LOCUS_52110 2733 3500 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963763.1 protein_id gnl|my_center|LOCUS_52110 3683 4252 gene locus_tag LOCUS_52120 3683 4252 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357101.1 protein_id gnl|my_center|LOCUS_52120 >Feature sequence0648 1263 595 gene locus_tag LOCUS_52130 1263 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52130 2487 1267 gene locus_tag LOCUS_52140 2487 1267 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475459.1 protein_id gnl|my_center|LOCUS_52140 3255 3986 gene locus_tag LOCUS_52150 gene sufC 3255 3986 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_52150 >Feature sequence0649 348 1550 gene locus_tag LOCUS_52160 gene coaBC 348 1550 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_52160 1578 3164 gene locus_tag LOCUS_52170 1578 3164 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_52170 3204 4574 gene locus_tag LOCUS_52180 3204 4574 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_52180 >Feature sequence0650 2853 1402 gene locus_tag LOCUS_52190 gene gltX 2853 1402 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_52190 3559 2882 gene locus_tag LOCUS_52200 3559 2882 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044679.1 protein_id gnl|my_center|LOCUS_52200 <4744 3587 gene locus_tag LOCUS_52210 <4744 3587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965567.1:aspartate--tRNA ligase >Feature sequence0651 <1 1729 gene locus_tag LOCUS_52220 <1 1729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009891588.1:selenium-dependent xanthine dehydrogenase 1882 4218 gene locus_tag LOCUS_52230 1882 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 >Feature sequence0652 1013 1381 gene locus_tag LOCUS_52240 1013 1381 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812106.1 protein_id gnl|my_center|LOCUS_52240 1585 2466 gene locus_tag LOCUS_52250 1585 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 3003 2539 gene locus_tag LOCUS_52260 gene moaC 3003 2539 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454438.1 protein_id gnl|my_center|LOCUS_52260 4047 3016 gene locus_tag LOCUS_52270 4047 3016 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_52270 <4725 4049 gene locus_tag LOCUS_52280 <4725 4049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009888685.1:molybdate ABC transporter permease subunit >Feature sequence0653 122 664 gene locus_tag LOCUS_52290 122 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52290 727 1404 gene locus_tag LOCUS_52300 727 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 1829 3202 gene locus_tag LOCUS_52310 1829 3202 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891344.1 protein_id gnl|my_center|LOCUS_52310 3429 3731 gene locus_tag LOCUS_52320 3429 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 3762 4586 gene locus_tag LOCUS_52330 3762 4586 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108784.1 protein_id gnl|my_center|LOCUS_52330 >Feature sequence0654 >Feature sequence0655 677 832 gene locus_tag LOCUS_52340 677 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 838 2277 gene locus_tag LOCUS_52350 gene proS 838 2277 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 protein_id gnl|my_center|LOCUS_52350 2330 3550 gene locus_tag LOCUS_52360 2330 3550 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_52360 4635 3685 gene locus_tag LOCUS_52370 4635 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52370 >Feature sequence0656 255 1730 gene locus_tag LOCUS_52380 255 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52380 1965 3422 gene locus_tag LOCUS_52390 1965 3422 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 protein_id gnl|my_center|LOCUS_52390 4579 3479 gene locus_tag LOCUS_52400 4579 3479 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141359.1 protein_id gnl|my_center|LOCUS_52400 >Feature sequence0657 1719 226 gene locus_tag LOCUS_52410 gene malQ 1719 226 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747291.1 protein_id gnl|my_center|LOCUS_52410 2684 1824 gene locus_tag LOCUS_52420 2684 1824 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_52420 3724 2684 gene locus_tag LOCUS_52430 3724 2684 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_52430 >Feature sequence0658 282 929 gene locus_tag LOCUS_52440 282 929 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949054.1 protein_id gnl|my_center|LOCUS_52440 934 1524 gene locus_tag LOCUS_52450 934 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 1527 3050 gene locus_tag LOCUS_52460 1527 3050 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949051.1 protein_id gnl|my_center|LOCUS_52460 3066 4118 gene locus_tag LOCUS_52470 3066 4118 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388243.1 protein_id gnl|my_center|LOCUS_52470 <4693 4128 gene locus_tag LOCUS_52480 <4693 4128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203365.1:VWA domain-containing protein >Feature sequence0659 3924 3784 gene locus_tag LOCUS_52490 3924 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 >Feature sequence0660 <1 980 gene locus_tag LOCUS_52500 <1 980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002988380.1:PBSX family phage terminase large subunit 992 2455 gene locus_tag LOCUS_52510 992 2455 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047637.1 protein_id gnl|my_center|LOCUS_52510 2452 4371 gene locus_tag LOCUS_52520 2452 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52520 4371 4556 gene locus_tag LOCUS_52530 4371 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 >Feature sequence0661 <1 1200 gene locus_tag LOCUS_52540 <1 1200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002485275.1:glucosaminidase domain-containing protein 1245 3005 gene locus_tag LOCUS_52550 1245 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 4606 3134 gene locus_tag LOCUS_52560 4606 3134 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_52560 >Feature sequence0662 1101 244 gene locus_tag LOCUS_52570 1101 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 1638 1102 gene locus_tag LOCUS_52580 1638 1102 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141164.1 protein_id gnl|my_center|LOCUS_52580 2951 1653 gene locus_tag LOCUS_52590 2951 1653 CDS product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869156.1 protein_id gnl|my_center|LOCUS_52590 3289 3208 gene locus_tag LOCUS_t00340 3289 3208 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3547 4137 gene locus_tag LOCUS_52600 3547 4137 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130597.1 protein_id gnl|my_center|LOCUS_52600 >Feature sequence0663 1738 566 gene locus_tag LOCUS_52610 gene cytX 1738 566 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225706.1 protein_id gnl|my_center|LOCUS_52610 2543 1731 gene locus_tag LOCUS_52620 gene thiD 2543 1731 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_52620 3196 2561 gene locus_tag LOCUS_52630 gene thiE 3196 2561 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436488.1 protein_id gnl|my_center|LOCUS_52630 3998 3183 gene locus_tag LOCUS_52640 gene thiM 3998 3183 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_52640 4334 4014 gene locus_tag LOCUS_52650 4334 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 >Feature sequence0664 42 752 gene locus_tag LOCUS_52660 42 752 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947920.1 protein_id gnl|my_center|LOCUS_52660 1384 962 gene locus_tag LOCUS_52670 1384 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 2384 1365 gene locus_tag LOCUS_52680 2384 1365 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836504.1 protein_id gnl|my_center|LOCUS_52680 3438 2386 gene locus_tag LOCUS_52690 3438 2386 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918104.1 protein_id gnl|my_center|LOCUS_52690 >Feature sequence0665 531 1571 gene locus_tag LOCUS_52700 531 1571 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_52700 1571 2431 gene locus_tag LOCUS_52710 1571 2431 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_52710 2444 3940 gene locus_tag LOCUS_52720 gene malQ 2444 3940 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_52720 >Feature sequence0666 22 411 gene locus_tag LOCUS_52730 22 411 CDS product DUF2513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385635.1 protein_id gnl|my_center|LOCUS_52730 541 374 gene locus_tag LOCUS_52740 541 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 1098 550 gene locus_tag LOCUS_52750 1098 550 CDS product phage repressor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922760.1 protein_id gnl|my_center|LOCUS_52750 1272 1475 gene locus_tag LOCUS_52760 1272 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 1589 1431 gene locus_tag LOCUS_52770 1589 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52770 1804 1604 gene locus_tag LOCUS_52780 1804 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 2029 2439 gene locus_tag LOCUS_52790 2029 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 2445 2885 gene locus_tag LOCUS_52800 2445 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52800 3283 3684 gene locus_tag LOCUS_52810 3283 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52810 3856 4278 gene locus_tag LOCUS_52820 3856 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52820 >Feature sequence0667 1514 453 gene locus_tag LOCUS_52830 1514 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 3067 1652 gene locus_tag LOCUS_52840 3067 1652 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110230.1 protein_id gnl|my_center|LOCUS_52840 3741 3064 gene locus_tag LOCUS_52850 3741 3064 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_52850 >Feature sequence0668 1627 746 gene locus_tag LOCUS_52860 1627 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52860 2883 1801 gene locus_tag LOCUS_52870 2883 1801 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444350.1 protein_id gnl|my_center|LOCUS_52870 4315 2885 gene locus_tag LOCUS_52880 4315 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52880 >Feature sequence0669 335 706 gene locus_tag LOCUS_52890 335 706 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_52890 699 1976 gene locus_tag LOCUS_52900 699 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 2195 2758 gene locus_tag LOCUS_52910 gene ahpC 2195 2758 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810052.1 protein_id gnl|my_center|LOCUS_52910 >Feature sequence0670 <1 1332 gene locus_tag LOCUS_52920 <1 1332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948922.1:ABC transporter ATP-binding protein 1369 2517 gene locus_tag LOCUS_52930 1369 2517 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701251.1 protein_id gnl|my_center|LOCUS_52930 3808 2642 gene locus_tag LOCUS_52940 3808 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 <4652 3871 gene locus_tag LOCUS_52950 <4652 3871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_147367330.1:ABC transporter ATP-binding protein >Feature sequence0671 704 180 gene locus_tag LOCUS_52960 gene hpt 704 180 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_52960 2046 697 gene locus_tag LOCUS_52970 gene tilS 2046 697 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434952.1 protein_id gnl|my_center|LOCUS_52970 2779 2459 gene locus_tag LOCUS_52980 2779 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52980 3140 2901 gene locus_tag LOCUS_52990 3140 2901 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_52990 3415 3140 gene locus_tag LOCUS_53000 3415 3140 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905402.1 protein_id gnl|my_center|LOCUS_53000 4630 3521 gene locus_tag LOCUS_53010 4630 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53010 >Feature sequence0672 82 2229 gene locus_tag LOCUS_53020 82 2229 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947999.1 protein_id gnl|my_center|LOCUS_53020 2238 2768 gene locus_tag LOCUS_53030 2238 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 2771 3211 gene locus_tag LOCUS_53040 gene tsaE 2771 3211 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_53040 3496 4194 gene locus_tag LOCUS_53050 gene tsaB 3496 4194 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048262.1 protein_id gnl|my_center|LOCUS_53050 4181 4639 gene locus_tag LOCUS_53060 gene rimI 4181 4639 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_53060 >Feature sequence0673 1405 410 gene locus_tag LOCUS_53070 1405 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 3476 1920 gene locus_tag LOCUS_53080 3476 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53080 3874 4014 gene locus_tag LOCUS_53090 3874 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 >Feature sequence0674 211 561 gene locus_tag LOCUS_53100 211 561 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422696.1 protein_id gnl|my_center|LOCUS_53100 595 1437 gene locus_tag LOCUS_53110 595 1437 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948948.1 protein_id gnl|my_center|LOCUS_53110 1459 2904 gene locus_tag LOCUS_53120 1459 2904 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183512.1 protein_id gnl|my_center|LOCUS_53120 2891 3817 gene locus_tag LOCUS_53130 gene murQ 2891 3817 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948949.1 protein_id gnl|my_center|LOCUS_53130 3950 4261 gene locus_tag LOCUS_53140 3950 4261 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898113.1 protein_id gnl|my_center|LOCUS_53140 >Feature sequence0675 2009 537 gene locus_tag LOCUS_53150 2009 537 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666927.1 protein_id gnl|my_center|LOCUS_53150 3260 2817 gene locus_tag LOCUS_53160 3260 2817 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430905.1 protein_id gnl|my_center|LOCUS_53160 3475 3299 gene locus_tag LOCUS_53170 3475 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 3868 4317 gene locus_tag LOCUS_53180 3868 4317 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703194.1 protein_id gnl|my_center|LOCUS_53180 >Feature sequence0676 1205 96 gene locus_tag LOCUS_53190 gene mglB 1205 96 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869062.1 protein_id gnl|my_center|LOCUS_53190 1566 2924 gene locus_tag LOCUS_53200 1566 2924 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_53200 3772 2978 gene locus_tag LOCUS_53210 3772 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53210 4602 3859 gene locus_tag LOCUS_53220 4602 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 >Feature sequence0677 868 338 gene locus_tag LOCUS_53230 868 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53230 2417 951 gene locus_tag LOCUS_53240 2417 951 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_53240 2961 2419 gene locus_tag LOCUS_53250 2961 2419 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918000.1 protein_id gnl|my_center|LOCUS_53250 3726 2983 gene locus_tag LOCUS_53260 gene yaaA 3726 2983 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476537.1 protein_id gnl|my_center|LOCUS_53260 4178 3723 gene locus_tag LOCUS_53270 gene bcp 4178 3723 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_53270 >Feature sequence0678 1892 588 gene locus_tag LOCUS_53280 gene nagZ 1892 588 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_53280 3999 1882 gene locus_tag LOCUS_53290 3999 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 >Feature sequence0679 1197 289 gene locus_tag LOCUS_53300 1197 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 2025 1258 gene locus_tag LOCUS_53310 2025 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53310 2502 2170 gene locus_tag LOCUS_53320 2502 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 3207 3004 gene locus_tag LOCUS_53330 3207 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 >Feature sequence0680 1919 1683 gene locus_tag LOCUS_53340 1919 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 3477 1993 gene locus_tag LOCUS_53350 3477 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 <4590 3545 gene locus_tag LOCUS_53360 <4590 3545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965653.1:phenylalanine--tRNA ligase subunit beta >Feature sequence0681 3580 53 gene locus_tag LOCUS_53370 gene nifJ 3580 53 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_53370 >Feature sequence0682 103 699 gene locus_tag LOCUS_53380 103 699 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681326.1 protein_id gnl|my_center|LOCUS_53380 719 3199 gene locus_tag LOCUS_53390 719 3199 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681327.1 protein_id gnl|my_center|LOCUS_53390 3201 4577 gene locus_tag LOCUS_53400 3201 4577 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681330.1 protein_id gnl|my_center|LOCUS_53400 >Feature sequence0683 129 1361 gene locus_tag LOCUS_53410 129 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53410 1361 2434 gene locus_tag LOCUS_53420 1361 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53420 2608 3621 gene locus_tag LOCUS_53430 2608 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53430 3762 4229 gene locus_tag LOCUS_53440 3762 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53440 >Feature sequence0684 817 476 gene locus_tag LOCUS_53450 817 476 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070606326.1 protein_id gnl|my_center|LOCUS_53450 1035 814 gene locus_tag LOCUS_53460 1035 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53460 2614 1055 gene locus_tag LOCUS_53470 2614 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036818.1 protein_id gnl|my_center|LOCUS_53470 3317 2589 gene locus_tag LOCUS_53480 3317 2589 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889773.1 protein_id gnl|my_center|LOCUS_53480 4044 3427 gene locus_tag LOCUS_53490 4044 3427 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205793.1 protein_id gnl|my_center|LOCUS_53490 >Feature sequence0685 2011 392 gene locus_tag LOCUS_53500 2011 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53500 3516 2035 gene locus_tag LOCUS_53510 3516 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53510 >Feature sequence0686 979 14 gene locus_tag LOCUS_53520 979 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 1061 2212 gene locus_tag LOCUS_53530 gene nifS 1061 2212 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_53530 3046 2393 gene locus_tag LOCUS_53540 3046 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53540 3908 3030 gene locus_tag LOCUS_53550 3908 3030 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897173.1 protein_id gnl|my_center|LOCUS_53550 4292 3915 gene locus_tag LOCUS_53560 4292 3915 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_53560 >Feature sequence0687 1466 387 gene locus_tag LOCUS_53570 1466 387 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837222.1 protein_id gnl|my_center|LOCUS_53570 2309 1509 gene locus_tag LOCUS_53580 2309 1509 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948093.1 protein_id gnl|my_center|LOCUS_53580 3359 2322 gene locus_tag LOCUS_53590 3359 2322 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837220.1 protein_id gnl|my_center|LOCUS_53590 3959 3717 gene locus_tag LOCUS_53600 3959 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53600 >Feature sequence0688 <1 1104 gene locus_tag LOCUS_53610 <1 1104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080270.1:branched-chain amino acid ABC transporter permease 1104 1952 gene locus_tag LOCUS_53620 1104 1952 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185981.1 protein_id gnl|my_center|LOCUS_53620 1945 2667 gene locus_tag LOCUS_53630 1945 2667 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869391.1 protein_id gnl|my_center|LOCUS_53630 2984 4414 gene locus_tag LOCUS_53640 2984 4414 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682416.1 protein_id gnl|my_center|LOCUS_53640 >Feature sequence0689 15 1127 gene locus_tag LOCUS_53650 15 1127 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_53650 1188 1712 gene locus_tag LOCUS_53660 1188 1712 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_53660 1874 2272 gene locus_tag LOCUS_53670 1874 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 2250 3689 gene locus_tag LOCUS_53680 2250 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53680 >Feature sequence0690 499 1761 gene locus_tag LOCUS_53690 gene pdeH 499 1761 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243525.1 protein_id gnl|my_center|LOCUS_53690 2188 2562 gene locus_tag LOCUS_53700 2188 2562 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816830.1 protein_id gnl|my_center|LOCUS_53700 3109 4410 gene locus_tag LOCUS_53710 gene ltrA 3109 4410 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 protein_id gnl|my_center|LOCUS_53710 >Feature sequence0691 431 2605 gene locus_tag LOCUS_53720 431 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53720 2729 3154 gene locus_tag LOCUS_53730 2729 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53730 3174 3602 gene locus_tag LOCUS_53740 3174 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53740 3721 4248 gene locus_tag LOCUS_53750 3721 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53750 >Feature sequence0692 1348 371 gene locus_tag LOCUS_53760 1348 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53760 3569 1368 gene locus_tag LOCUS_53770 3569 1368 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378512.1 protein_id gnl|my_center|LOCUS_53770 4526 3576 gene locus_tag LOCUS_53780 4526 3576 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_53780 >Feature sequence0693 2503 1424 gene locus_tag LOCUS_53790 2503 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 <4550 2490 gene locus_tag LOCUS_53800 <4550 2490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964119.1:phosphoenolpyruvate synthase >Feature sequence0694 70 843 gene locus_tag LOCUS_53810 70 843 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005008.1 protein_id gnl|my_center|LOCUS_53810 868 1719 gene locus_tag LOCUS_53820 868 1719 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056925.1 protein_id gnl|my_center|LOCUS_53820 1817 2308 gene locus_tag LOCUS_53830 1817 2308 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_53830 3068 2430 gene locus_tag LOCUS_53840 3068 2430 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087118335.1 protein_id gnl|my_center|LOCUS_53840 3521 3072 gene locus_tag LOCUS_53850 3521 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53850 4423 3671 gene locus_tag LOCUS_53860 4423 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 >Feature sequence0695 1238 297 gene locus_tag LOCUS_53870 1238 297 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880686.1 protein_id gnl|my_center|LOCUS_53870 2043 1369 gene locus_tag LOCUS_53880 2043 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 2930 2046 gene locus_tag LOCUS_53890 gene rsmI 2930 2046 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_53890 3657 2920 gene locus_tag LOCUS_53900 3657 2920 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_53900 4507 3659 gene locus_tag LOCUS_53910 4507 3659 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963624.1 protein_id gnl|my_center|LOCUS_53910 >Feature sequence0696 1263 508 gene locus_tag LOCUS_53920 gene kdgR 1263 508 CDS product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096122.1 protein_id gnl|my_center|LOCUS_53920 2811 1333 gene locus_tag LOCUS_53930 2811 1333 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_53930 3275 4282 gene locus_tag LOCUS_53940 3275 4282 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805139.1 protein_id gnl|my_center|LOCUS_53940 >Feature sequence0697 2273 27 gene locus_tag LOCUS_53950 gene cas10 2273 27 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900580.1 protein_id gnl|my_center|LOCUS_53950 3000 2266 gene locus_tag LOCUS_53960 gene cas6 3000 2266 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837017.1 protein_id gnl|my_center|LOCUS_53960 4390 3026 gene locus_tag LOCUS_53970 gene csm6 4390 3026 CDS product type III-A CRISPR-associated CARF protein Csm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899494.1 protein_id gnl|my_center|LOCUS_53970 >Feature sequence0698 27 1442 gene locus_tag LOCUS_53980 gene nhaC 27 1442 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696045.1 protein_id gnl|my_center|LOCUS_53980 1557 1952 gene locus_tag LOCUS_53990 1557 1952 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_53990 1952 2467 gene locus_tag LOCUS_54000 1952 2467 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432371.1 protein_id gnl|my_center|LOCUS_54000 2585 3805 gene locus_tag LOCUS_54010 2585 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54010 >Feature sequence0699 1211 225 gene locus_tag LOCUS_54020 1211 225 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_54020 3558 1447 gene locus_tag LOCUS_54030 3558 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54030 3971 3561 gene locus_tag LOCUS_54040 3971 3561 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_54040 >Feature sequence0700 60 992 gene locus_tag LOCUS_54050 60 992 CDS product MYG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973334.1 protein_id gnl|my_center|LOCUS_54050 3340 1226 gene locus_tag LOCUS_54060 3340 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54060 3728 3801 gene locus_tag LOCUS_t00350 3728 3801 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4010 4408 gene locus_tag LOCUS_54070 4010 4408 CDS product DUF3290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837296.1 protein_id gnl|my_center|LOCUS_54070 >Feature sequence0701 1123 878 gene locus_tag LOCUS_54080 1123 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 1475 2539 gene locus_tag LOCUS_54090 1475 2539 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964158.1 protein_id gnl|my_center|LOCUS_54090 2532 3374 gene locus_tag LOCUS_54100 2532 3374 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964157.1 protein_id gnl|my_center|LOCUS_54100 3368 4165 gene locus_tag LOCUS_54110 3368 4165 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_54110 >Feature sequence0702 <1 1513 gene locus_tag LOCUS_54120 <1 1513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964334.1:polysaccharide biosynthesis protein 1531 2733 gene locus_tag LOCUS_54130 1531 2733 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_54130 >Feature sequence0703 696 2225 gene locus_tag LOCUS_54140 gene rbsA 696 2225 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463701.1 protein_id gnl|my_center|LOCUS_54140 2228 3223 gene locus_tag LOCUS_54150 2228 3223 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315915.1 protein_id gnl|my_center|LOCUS_54150 3297 4343 gene locus_tag LOCUS_54160 3297 4343 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528455.1 protein_id gnl|my_center|LOCUS_54160 >Feature sequence0704 763 59 gene locus_tag LOCUS_54170 763 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54170 2023 779 gene locus_tag LOCUS_54180 2023 779 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_54180 2416 2189 gene locus_tag LOCUS_54190 2416 2189 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941305.1 protein_id gnl|my_center|LOCUS_54190 2671 2429 gene locus_tag LOCUS_54200 gene rpsP 2671 2429 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_54200 4124 2769 gene locus_tag LOCUS_54210 gene ffh 4124 2769 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_54210 >Feature sequence0705 297 566 gene locus_tag LOCUS_54220 297 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54220 624 2057 gene locus_tag LOCUS_54230 gene rlmD 624 2057 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021134739.1 protein_id gnl|my_center|LOCUS_54230 2054 2206 gene locus_tag LOCUS_54240 2054 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003042651.1 protein_id gnl|my_center|LOCUS_54240 2237 3220 gene locus_tag LOCUS_54250 2237 3220 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327241.1 protein_id gnl|my_center|LOCUS_54250 3207 4010 gene locus_tag LOCUS_54260 3207 4010 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259153.1 protein_id gnl|my_center|LOCUS_54260 >Feature sequence0706 3414 1669 gene locus_tag LOCUS_54270 3414 1669 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953783.1 protein_id gnl|my_center|LOCUS_54270 4209 3427 gene locus_tag LOCUS_54280 4209 3427 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965719.1 protein_id gnl|my_center|LOCUS_54280 >Feature sequence0707 3121 1364 gene locus_tag LOCUS_54290 3121 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54290 4236 3100 gene locus_tag LOCUS_54300 4236 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54300 >Feature sequence0708 219 2906 gene locus_tag LOCUS_54310 gene mgtA 219 2906 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047937.1 protein_id gnl|my_center|LOCUS_54310 3189 3353 gene locus_tag LOCUS_54320 3189 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54320 >Feature sequence0709 532 1536 gene locus_tag LOCUS_54330 gene cas1 532 1536 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414279.1 protein_id gnl|my_center|LOCUS_54330 1536 1832 gene locus_tag LOCUS_54340 1536 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 1868 3811 gene locus_tag LOCUS_54350 gene nrdD 1868 3811 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54350 3735 4025 gene locus_tag LOCUS_54360 3735 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54360 >Feature sequence0710 1648 1430 gene locus_tag LOCUS_54370 1648 1430 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_54370 1971 1753 gene locus_tag LOCUS_54380 1971 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54380 4131 2413 gene locus_tag LOCUS_54390 gene ggt 4131 2413 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254471.1 protein_id gnl|my_center|LOCUS_54390 >Feature sequence0711 <1 1732 gene locus_tag LOCUS_54400 <1 1732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459236.1:DUF3578 domain-containing protein 1707 4190 gene locus_tag LOCUS_54410 1707 4190 CDS product restriction endonuclease-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459237.1 protein_id gnl|my_center|LOCUS_54410 >Feature sequence0712 814 155 gene locus_tag LOCUS_54420 814 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 1642 1025 gene locus_tag LOCUS_54430 1642 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 3618 2152 gene locus_tag LOCUS_54440 3618 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54440 >Feature sequence0713 <1 1071 gene locus_tag LOCUS_54450 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679287.1:energy-coupling factor ABC transporter ATP-binding protein 1061 2851 gene locus_tag LOCUS_54460 1061 2851 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986746.1 protein_id gnl|my_center|LOCUS_54460 >Feature sequence0714 <1 1528 gene locus_tag LOCUS_54470 <1 1528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964334.1:polysaccharide biosynthesis protein 1546 2754 gene locus_tag LOCUS_54480 1546 2754 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_54480 >Feature sequence0715 67 1584 gene locus_tag LOCUS_54490 67 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 1999 2256 gene locus_tag LOCUS_54500 1999 2256 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113434.1 protein_id gnl|my_center|LOCUS_54500 2256 2519 gene locus_tag LOCUS_54510 2256 2519 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113436.1 protein_id gnl|my_center|LOCUS_54510 2680 3516 gene locus_tag LOCUS_54520 2680 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54520 >Feature sequence0716 <1 812 gene locus_tag LOCUS_54530 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000002071.1:pseudouridine-5'-phosphate glycosidase 1287 1072 gene locus_tag LOCUS_54540 1287 1072 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_54540 1580 1284 gene locus_tag LOCUS_54550 1580 1284 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_54550 3139 1946 gene locus_tag LOCUS_54560 gene tuf 3139 1946 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887863.1 protein_id gnl|my_center|LOCUS_54560 <4452 3272 gene locus_tag LOCUS_54570 <4452 3272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436178.1:elongation factor G >Feature sequence0717 365 132 gene locus_tag LOCUS_54580 365 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54580 510 325 gene locus_tag LOCUS_54590 510 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54590 1540 791 gene locus_tag LOCUS_54600 1540 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54600 2332 1784 gene locus_tag LOCUS_54610 2332 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54610 3969 2338 gene locus_tag LOCUS_54620 3969 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54620 >Feature sequence0718 <1 651 gene locus_tag LOCUS_54630 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002362247.1:YgeY family selenium metabolism-linked hydrolase 792 1988 gene locus_tag LOCUS_54640 gene ygeW 792 1988 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379712.1 protein_id gnl|my_center|LOCUS_54640 2126 3073 gene locus_tag LOCUS_54650 gene arcC 2126 3073 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680441.1 protein_id gnl|my_center|LOCUS_54650 3088 4419 gene locus_tag LOCUS_54660 3088 4419 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893433.1 protein_id gnl|my_center|LOCUS_54660 >Feature sequence0719 126 1112 gene locus_tag LOCUS_54670 126 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_54670 1130 2836 gene locus_tag LOCUS_54680 1130 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54680 2826 4235 gene locus_tag LOCUS_54690 2826 4235 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263064.1 protein_id gnl|my_center|LOCUS_54690 >Feature sequence0720 81 266 gene locus_tag LOCUS_54700 81 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54700 420 2144 gene locus_tag LOCUS_54710 420 2144 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775553.1 protein_id gnl|my_center|LOCUS_54710 2137 3840 gene locus_tag LOCUS_54720 2137 3840 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775554.1 protein_id gnl|my_center|LOCUS_54720 >Feature sequence0721 <1 3391 gene locus_tag LOCUS_54730 <1 3391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000682783.1:G5 domain-containing protein >Feature sequence0722 1873 404 gene locus_tag LOCUS_54740 1873 404 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986179.1 protein_id gnl|my_center|LOCUS_54740 2141 2788 gene locus_tag LOCUS_54750 2141 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 3536 2889 gene locus_tag LOCUS_54760 gene nth 3536 2889 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895383.1 protein_id gnl|my_center|LOCUS_54760 >Feature sequence0723 <1 2198 gene locus_tag LOCUS_54770 <1 2198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007789938.1:ATP-binding protein 2202 4334 gene locus_tag LOCUS_54780 2202 4334 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860789.1 protein_id gnl|my_center|LOCUS_54780 >Feature sequence0724 272 754 gene locus_tag LOCUS_54790 272 754 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_54790 751 1911 gene locus_tag LOCUS_54800 751 1911 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_54800 1908 2405 gene locus_tag LOCUS_54810 gene trmL 1908 2405 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 protein_id gnl|my_center|LOCUS_54810 3238 2459 gene locus_tag LOCUS_54820 3238 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 3353 3901 gene locus_tag LOCUS_54830 3353 3901 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180154.1 protein_id gnl|my_center|LOCUS_54830 >Feature sequence0725 278 610 gene locus_tag LOCUS_54840 278 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 1435 848 gene locus_tag LOCUS_54850 1435 848 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397458.1 protein_id gnl|my_center|LOCUS_54850 1974 3266 gene locus_tag LOCUS_54860 1974 3266 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924630.1 protein_id gnl|my_center|LOCUS_54860 3791 3357 gene locus_tag LOCUS_54870 3791 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 >Feature sequence0726 157 1038 gene locus_tag LOCUS_54880 157 1038 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_54880 1231 1899 gene locus_tag LOCUS_54890 1231 1899 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722217.1 protein_id gnl|my_center|LOCUS_54890 1910 2662 gene locus_tag LOCUS_54900 1910 2662 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_54900 2816 4111 gene locus_tag LOCUS_54910 2816 4111 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_54910 >Feature sequence0727 497 2749 gene locus_tag LOCUS_54920 497 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 2804 3943 gene locus_tag LOCUS_54930 2804 3943 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964720.1 protein_id gnl|my_center|LOCUS_54930 >Feature sequence0728 <1 653 gene locus_tag LOCUS_54940 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057033.1:molecular chaperone HtpG 833 3772 gene locus_tag LOCUS_54950 833 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54950 >Feature sequence0729 2116 11 gene locus_tag LOCUS_54960 gene pknB 2116 11 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986841.1 protein_id gnl|my_center|LOCUS_54960 2849 2121 gene locus_tag LOCUS_54970 2849 2121 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_54970 3906 2866 gene locus_tag LOCUS_54980 gene rlmN 3906 2866 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_54980 >Feature sequence0730 1897 74 gene locus_tag LOCUS_54990 1897 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54990 2497 2012 gene locus_tag LOCUS_55000 2497 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55000 <4394 2517 gene locus_tag LOCUS_55010 <4394 2517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000014672.1:rhs element protein RhsD >Feature sequence0731 1974 508 gene locus_tag LOCUS_55020 1974 508 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_55020 3765 2059 gene locus_tag LOCUS_55030 3765 2059 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860791.1 protein_id gnl|my_center|LOCUS_55030 <4392 3860 gene locus_tag LOCUS_55040 <4392 3860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860790.1:DUF4366 domain-containing protein >Feature sequence0732 712 359 gene locus_tag LOCUS_55050 712 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 3279 1063 gene locus_tag LOCUS_55060 3279 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 3520 3266 gene locus_tag LOCUS_55070 3520 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55070 3924 3727 gene locus_tag LOCUS_55080 3924 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55080 >Feature sequence0733 103 1041 gene locus_tag LOCUS_55090 103 1041 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545190.1 protein_id gnl|my_center|LOCUS_55090 1042 2187 gene locus_tag LOCUS_55100 gene glf 1042 2187 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875983.1 protein_id gnl|my_center|LOCUS_55100 2231 2956 gene locus_tag LOCUS_55110 2231 2956 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899987.1 protein_id gnl|my_center|LOCUS_55110 2960 3739 gene locus_tag LOCUS_55120 gene rfbF 2960 3739 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816687.1 protein_id gnl|my_center|LOCUS_55120 >Feature sequence0734 768 2276 gene locus_tag LOCUS_55130 768 2276 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357216.1 protein_id gnl|my_center|LOCUS_55130 >Feature sequence0735 879 319 gene locus_tag LOCUS_55140 879 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55140 2254 893 gene locus_tag LOCUS_55150 2254 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55150 3311 2322 gene locus_tag LOCUS_55160 3311 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55160 4133 3357 gene locus_tag LOCUS_55170 4133 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55170 >Feature sequence0736 1629 526 gene locus_tag LOCUS_55180 1629 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55180 2182 1703 gene locus_tag LOCUS_55190 2182 1703 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_55190 4198 2255 gene locus_tag LOCUS_55200 4198 2255 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897443.1 protein_id gnl|my_center|LOCUS_55200 >Feature sequence0737 1958 1116 gene locus_tag LOCUS_55210 1958 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55210 2595 1948 gene locus_tag LOCUS_55220 2595 1948 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_55220 3100 2693 gene locus_tag LOCUS_55230 3100 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55230 4041 3112 gene locus_tag LOCUS_55240 4041 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 >Feature sequence0738 2473 26 gene locus_tag LOCUS_55250 2473 26 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_55250 <4347 2485 gene locus_tag LOCUS_55260 <4347 2485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966319.1:isoleucine--tRNA ligase >Feature sequence0739 153 1487 gene locus_tag LOCUS_55270 153 1487 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225468.1 protein_id gnl|my_center|LOCUS_55270 1554 2459 gene locus_tag LOCUS_55280 1554 2459 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032532.1 protein_id gnl|my_center|LOCUS_55280 2468 3313 gene locus_tag LOCUS_55290 2468 3313 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383582.1 protein_id gnl|my_center|LOCUS_55290 3345 4328 gene locus_tag LOCUS_55300 3345 4328 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582922.1 protein_id gnl|my_center|LOCUS_55300 >Feature sequence0740 <1 942 gene locus_tag LOCUS_55310 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986984.1:LCP family protein 1695 1156 gene locus_tag LOCUS_55320 1695 1156 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 protein_id gnl|my_center|LOCUS_55320 3070 1775 gene locus_tag LOCUS_55330 gene eno 3070 1775 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948030.1 protein_id gnl|my_center|LOCUS_55330 3809 3099 gene locus_tag LOCUS_55340 3809 3099 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_55340 >Feature sequence0741 162 782 gene locus_tag LOCUS_55350 162 782 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681311.1 protein_id gnl|my_center|LOCUS_55350 881 1465 gene locus_tag LOCUS_55360 881 1465 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815501.1 protein_id gnl|my_center|LOCUS_55360 1467 2201 gene locus_tag LOCUS_55370 1467 2201 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815503.1 protein_id gnl|my_center|LOCUS_55370 2207 3670 gene locus_tag LOCUS_55380 2207 3670 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462215.1 protein_id gnl|my_center|LOCUS_55380 3708 3929 gene locus_tag LOCUS_55390 3708 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55390 >Feature sequence0742 178 1203 gene locus_tag LOCUS_55400 178 1203 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_55400 1207 3441 gene locus_tag LOCUS_55410 1207 3441 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_55410 3451 4185 gene locus_tag LOCUS_55420 3451 4185 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860641.1 protein_id gnl|my_center|LOCUS_55420 >Feature sequence0743 124 1227 gene locus_tag LOCUS_55430 124 1227 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262240.1 protein_id gnl|my_center|LOCUS_55430 1370 2629 gene locus_tag LOCUS_55440 1370 2629 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613276.1 protein_id gnl|my_center|LOCUS_55440 2641 3588 gene locus_tag LOCUS_55450 2641 3588 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_55450 >Feature sequence0744 17 796 gene locus_tag LOCUS_55460 17 796 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921670.1 protein_id gnl|my_center|LOCUS_55460 3185 963 gene locus_tag LOCUS_55470 3185 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55470 >Feature sequence0745 3960 3412 gene locus_tag LOCUS_55480 3960 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681674.1 protein_id gnl|my_center|LOCUS_55480 >Feature sequence0746 1426 521 gene locus_tag LOCUS_55490 1426 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 1876 1442 gene locus_tag LOCUS_55500 1876 1442 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357848.1 protein_id gnl|my_center|LOCUS_55500 2914 1940 gene locus_tag LOCUS_55510 2914 1940 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146584.1 protein_id gnl|my_center|LOCUS_55510 3871 2948 gene locus_tag LOCUS_55520 gene murB 3871 2948 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_55520 >Feature sequence0747 3081 4304 gene locus_tag LOCUS_55530 gene tyrS 3081 4304 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367412.1 protein_id gnl|my_center|LOCUS_55530 >Feature sequence0748 <1 576 gene locus_tag LOCUS_55540 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002296487.1:terminase large subunit 578 1834 gene locus_tag LOCUS_55550 578 1834 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523689.1 protein_id gnl|my_center|LOCUS_55550 1831 2487 gene locus_tag LOCUS_55560 1831 2487 CDS product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080656303.1 protein_id gnl|my_center|LOCUS_55560 2498 3634 gene locus_tag LOCUS_55570 2498 3634 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475652.1 protein_id gnl|my_center|LOCUS_55570 3679 3966 gene locus_tag LOCUS_55580 3679 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55580 >Feature sequence0749 <1 903 gene locus_tag LOCUS_55590 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009888871.1:LacI family transcriptional regulator CcpA 1659 940 gene locus_tag LOCUS_55600 1659 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626369.1 protein_id gnl|my_center|LOCUS_55600 2686 1721 gene locus_tag LOCUS_55610 2686 1721 CDS product DUF4300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837147.1 protein_id gnl|my_center|LOCUS_55610 2928 3797 gene locus_tag LOCUS_55620 2928 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 >Feature sequence0750 194 841 gene locus_tag LOCUS_55630 gene pcp 194 841 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866927.1 protein_id gnl|my_center|LOCUS_55630 1010 1354 gene locus_tag LOCUS_55640 1010 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55640 1381 1989 gene locus_tag LOCUS_55650 1381 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964077.1 protein_id gnl|my_center|LOCUS_55650 1991 2554 gene locus_tag LOCUS_55660 1991 2554 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964078.1 protein_id gnl|my_center|LOCUS_55660 2827 3201 gene locus_tag LOCUS_55670 2827 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193116.1 protein_id gnl|my_center|LOCUS_55670 3311 3706 gene locus_tag LOCUS_55680 3311 3706 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565456.1 protein_id gnl|my_center|LOCUS_55680 3755 4210 gene locus_tag LOCUS_55690 3755 4210 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770492.1 protein_id gnl|my_center|LOCUS_55690 >Feature sequence0751 94 1770 gene locus_tag LOCUS_55700 94 1770 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899360.1 protein_id gnl|my_center|LOCUS_55700 1812 2927 gene locus_tag LOCUS_55710 1812 2927 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861983.1 protein_id gnl|my_center|LOCUS_55710 2931 4139 gene locus_tag LOCUS_55720 2931 4139 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837690.1 protein_id gnl|my_center|LOCUS_55720 >Feature sequence0752 <1 770 gene locus_tag LOCUS_55730 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245314.1:ACP S-malonyltransferase 767 1513 gene locus_tag LOCUS_55740 gene fabG 767 1513 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_55740 1553 2788 gene locus_tag LOCUS_55750 gene fabF 1553 2788 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_55750 2793 3227 gene locus_tag LOCUS_55760 gene accB 2793 3227 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472869.1 protein_id gnl|my_center|LOCUS_55760 3233 3658 gene locus_tag LOCUS_55770 gene fabZ 3233 3658 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048424.1 protein_id gnl|my_center|LOCUS_55770 >Feature sequence0753 1008 634 gene locus_tag LOCUS_55780 1008 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55780 1049 1267 gene locus_tag LOCUS_55790 1049 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 2993 1638 gene locus_tag LOCUS_55800 2993 1638 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016035.1 protein_id gnl|my_center|LOCUS_55800 3996 3067 gene locus_tag LOCUS_55810 3996 3067 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754206.1 protein_id gnl|my_center|LOCUS_55810 >Feature sequence0754 89 949 gene locus_tag LOCUS_55820 89 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55820 969 1760 gene locus_tag LOCUS_55830 969 1760 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943967.1 protein_id gnl|my_center|LOCUS_55830 1766 2506 gene locus_tag LOCUS_55840 1766 2506 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459577.1 protein_id gnl|my_center|LOCUS_55840 2684 3871 gene locus_tag LOCUS_55850 gene metK 2684 3871 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_55850 >Feature sequence0755 <1 1806 gene locus_tag LOCUS_55860 <1 1806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861995.1:methionine--tRNA ligase 2403 3194 gene locus_tag LOCUS_55870 2403 3194 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_55870 3303 4190 gene locus_tag LOCUS_55880 3303 4190 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831939.1 protein_id gnl|my_center|LOCUS_55880 >Feature sequence0756 2680 1331 gene locus_tag LOCUS_55890 2680 1331 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_55890 3961 2684 gene locus_tag LOCUS_55900 3961 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55900 >Feature sequence0757 87 677 gene locus_tag LOCUS_55910 87 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55910 693 2960 gene locus_tag LOCUS_55920 693 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55920 2966 4132 gene locus_tag LOCUS_55930 2966 4132 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964720.1 protein_id gnl|my_center|LOCUS_55930 >Feature sequence0758 3328 1295 gene locus_tag LOCUS_55940 gene flhA 3328 1295 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_55940 <4262 3332 gene locus_tag LOCUS_55950 <4262 3332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003231949.1:flagellar biosynthesis protein FlhB >Feature sequence0759 1623 634 gene locus_tag LOCUS_55960 1623 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 2636 1635 gene locus_tag LOCUS_55970 2636 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55970 3040 2903 gene locus_tag LOCUS_55980 3040 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55980 3539 3042 gene locus_tag LOCUS_55990 3539 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55990 4116 3664 gene locus_tag LOCUS_56000 4116 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56000 >Feature sequence0760 972 586 gene locus_tag LOCUS_56010 972 586 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_56010 2451 1114 gene locus_tag LOCUS_56020 gene dnaB 2451 1114 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_56020 2900 2454 gene locus_tag LOCUS_56030 gene rplI 2900 2454 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966977.1 protein_id gnl|my_center|LOCUS_56030 <4254 2903 gene locus_tag LOCUS_56040 <4254 2903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003397329.1:DHH family phosphoesterase >Feature sequence0761 196 1527 gene locus_tag LOCUS_56050 196 1527 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_56050 1639 2967 gene locus_tag LOCUS_56060 1639 2967 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905313.1 protein_id gnl|my_center|LOCUS_56060 >Feature sequence0762 2354 1320 gene locus_tag LOCUS_56070 2354 1320 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966467.1 protein_id gnl|my_center|LOCUS_56070 2880 2347 gene locus_tag LOCUS_56080 2880 2347 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421255.1 protein_id gnl|my_center|LOCUS_56080 3389 3015 gene locus_tag LOCUS_56090 3389 3015 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963919.1 protein_id gnl|my_center|LOCUS_56090 >Feature sequence0763 932 3085 gene locus_tag LOCUS_56100 932 3085 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109314215.1 protein_id gnl|my_center|LOCUS_56100 3091 3780 gene locus_tag LOCUS_56110 3091 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56110 >Feature sequence0764 445 2241 gene locus_tag LOCUS_56120 gene walK 445 2241 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288851.1 protein_id gnl|my_center|LOCUS_56120 3110 2286 gene locus_tag LOCUS_56130 3110 2286 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402124.1 protein_id gnl|my_center|LOCUS_56130 3767 3126 gene locus_tag LOCUS_56140 3767 3126 CDS product DUF4125 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814656.1 protein_id gnl|my_center|LOCUS_56140 >Feature sequence0765 2034 1195 gene locus_tag LOCUS_56150 gene mscS 2034 1195 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_56150 2422 3141 gene locus_tag LOCUS_56160 2422 3141 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_56160 4032 3238 gene locus_tag LOCUS_56170 4032 3238 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407737.1 protein_id gnl|my_center|LOCUS_56170 >Feature sequence0766 644 291 gene locus_tag LOCUS_56180 644 291 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358362.1 protein_id gnl|my_center|LOCUS_56180 1606 656 gene locus_tag LOCUS_56190 gene cutD 1606 656 CDS product choline TMA-lyase-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986624.1 protein_id gnl|my_center|LOCUS_56190 2944 1676 gene locus_tag LOCUS_56200 2944 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56200 4221 2941 gene locus_tag LOCUS_56210 4221 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56210 >Feature sequence0767 21 308 gene locus_tag LOCUS_56220 21 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56220 317 718 gene locus_tag LOCUS_56230 317 718 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462228.1 protein_id gnl|my_center|LOCUS_56230 878 1771 gene locus_tag LOCUS_56240 gene rfbA 878 1771 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286449.1 protein_id gnl|my_center|LOCUS_56240 1793 2815 gene locus_tag LOCUS_56250 gene rfbB 1793 2815 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_56250 2815 3675 gene locus_tag LOCUS_56260 gene rfbD 2815 3675 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664653.1 protein_id gnl|my_center|LOCUS_56260 >Feature sequence0768 1093 1440 gene locus_tag LOCUS_56270 1093 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56270 <4238 1512 gene locus_tag LOCUS_56280 <4238 1512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009892173.1:carbamoyl-phosphate synthase large subunit >Feature sequence0769 <1 595 gene locus_tag LOCUS_56290 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966989.1:ParB/RepB/Spo0J family partition protein 607 1095 gene locus_tag LOCUS_56300 607 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56300 1744 1217 gene locus_tag LOCUS_56310 1744 1217 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966725.1 protein_id gnl|my_center|LOCUS_56310 1877 2761 gene locus_tag LOCUS_56320 1877 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56320 2947 3021 gene locus_tag LOCUS_t00360 2947 3021 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3498 3836 gene locus_tag LOCUS_56330 3498 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56330 >Feature sequence0770 <1 858 gene locus_tag LOCUS_56340 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082566.1:mannonate dehydratase 1328 1026 gene locus_tag LOCUS_56350 1328 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56350 1219 1680 gene locus_tag LOCUS_56360 1219 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56360 1878 3434 gene locus_tag LOCUS_56370 1878 3434 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681812.1 protein_id gnl|my_center|LOCUS_56370 >Feature sequence0771 307 1104 gene locus_tag LOCUS_56380 307 1104 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_56380 1136 1840 gene locus_tag LOCUS_56390 gene cysE 1136 1840 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459083.1 protein_id gnl|my_center|LOCUS_56390 1828 2175 gene locus_tag LOCUS_56400 1828 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56400 2153 2803 gene locus_tag LOCUS_56410 2153 2803 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_56410 2899 3480 gene locus_tag LOCUS_56420 2899 3480 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_56420 3529 3957 gene locus_tag LOCUS_56430 3529 3957 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902921.1 protein_id gnl|my_center|LOCUS_56430 >Feature sequence0772 1167 292 gene locus_tag LOCUS_56440 1167 292 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670316.1 protein_id gnl|my_center|LOCUS_56440 1449 2528 gene locus_tag LOCUS_56450 1449 2528 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945303.1 protein_id gnl|my_center|LOCUS_56450 2544 3434 gene locus_tag LOCUS_56460 2544 3434 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461074.1 protein_id gnl|my_center|LOCUS_56460 3427 4212 gene locus_tag LOCUS_56470 3427 4212 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808997.1 protein_id gnl|my_center|LOCUS_56470 >Feature sequence0773 369 1457 gene locus_tag LOCUS_56480 gene trpS 369 1457 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_56480 1460 1936 gene locus_tag LOCUS_56490 1460 1936 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_56490 1955 3319 gene locus_tag LOCUS_56500 1955 3319 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_56500 3519 4175 gene locus_tag LOCUS_56510 3519 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56510 >Feature sequence0774 395 1150 gene locus_tag LOCUS_56520 395 1150 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393254.1 protein_id gnl|my_center|LOCUS_56520 1137 3011 gene locus_tag LOCUS_56530 1137 3011 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861246.1 protein_id gnl|my_center|LOCUS_56530 4077 3232 gene locus_tag LOCUS_56540 4077 3232 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814367.1 protein_id gnl|my_center|LOCUS_56540 >Feature sequence0775 170 925 gene locus_tag LOCUS_56550 170 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56550 1124 2797 gene locus_tag LOCUS_56560 1124 2797 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_56560 2823 3662 gene locus_tag LOCUS_56570 2823 3662 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963960.1 protein_id gnl|my_center|LOCUS_56570 >Feature sequence0776 148 1128 gene locus_tag LOCUS_56580 gene hemB 148 1128 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016407.1 protein_id gnl|my_center|LOCUS_56580 1132 1971 gene locus_tag LOCUS_56590 1132 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 1961 2878 gene locus_tag LOCUS_56600 gene hemC 1961 2878 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930577.1 protein_id gnl|my_center|LOCUS_56600 >Feature sequence0777 430 1158 gene locus_tag LOCUS_56610 430 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56610 1338 1931 gene locus_tag LOCUS_56620 1338 1931 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989471.1 protein_id gnl|my_center|LOCUS_56620 1950 2948 gene locus_tag LOCUS_56630 1950 2948 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051408.1 protein_id gnl|my_center|LOCUS_56630 2941 3501 gene locus_tag LOCUS_56640 2941 3501 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_56640 3498 4055 gene locus_tag LOCUS_56650 3498 4055 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_56650 >Feature sequence0778 1684 491 gene locus_tag LOCUS_56660 gene ygeW 1684 491 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379712.1 protein_id gnl|my_center|LOCUS_56660 3176 1851 gene locus_tag LOCUS_56670 3176 1851 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362247.1 protein_id gnl|my_center|LOCUS_56670 <4190 3285 gene locus_tag LOCUS_56680 <4190 3285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861869.1:diaminopropionate ammonia-lyase >Feature sequence0779 2444 1116 gene locus_tag LOCUS_56690 gene xylA 2444 1116 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898127.1 protein_id gnl|my_center|LOCUS_56690 2766 3713 gene locus_tag LOCUS_56700 2766 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56700 >Feature sequence0780 1616 423 gene locus_tag LOCUS_56710 1616 423 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287699.1 protein_id gnl|my_center|LOCUS_56710 1764 1585 gene locus_tag LOCUS_56720 1764 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56720 2727 1807 gene locus_tag LOCUS_56730 2727 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56730 <4184 2720 gene locus_tag LOCUS_56740 <4184 2720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005170304.1:BsuBI/PstI family type II restriction endonuclease note possible pseudo, frameshifted >Feature sequence0781 764 886 gene locus_tag LOCUS_56750 764 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56750 2295 901 gene locus_tag LOCUS_56760 2295 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56760 4001 2415 gene locus_tag LOCUS_56770 4001 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56770 >Feature sequence0782 2 796 gene locus_tag LOCUS_56780 2 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56780 816 1481 gene locus_tag LOCUS_56790 gene cobI 816 1481 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626293.1 protein_id gnl|my_center|LOCUS_56790 1531 2262 gene locus_tag LOCUS_56800 gene cobJ 1531 2262 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016778.1 protein_id gnl|my_center|LOCUS_56800 >Feature sequence0783 <1 991 gene locus_tag LOCUS_56810 <1 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000489404.1:ABC transporter permease 1109 2407 gene locus_tag LOCUS_56820 1109 2407 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_56820 2408 3646 gene locus_tag LOCUS_56830 2408 3646 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_56830 >Feature sequence0784 1043 723 gene locus_tag LOCUS_56840 1043 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56840 1398 2819 gene locus_tag LOCUS_56850 1398 2819 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965627.1 protein_id gnl|my_center|LOCUS_56850 2850 3761 gene locus_tag LOCUS_56860 2850 3761 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816612.1 protein_id gnl|my_center|LOCUS_56860 >Feature sequence0785 397 230 gene locus_tag LOCUS_56870 397 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56870 1170 421 gene locus_tag LOCUS_56880 1170 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56880 1912 1181 gene locus_tag LOCUS_56890 1912 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56890 2531 1929 gene locus_tag LOCUS_56900 gene prfH 2531 1929 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788396.1 protein_id gnl|my_center|LOCUS_56900 3667 2528 gene locus_tag LOCUS_56910 3667 2528 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682062.1 protein_id gnl|my_center|LOCUS_56910 >Feature sequence0786 570 1157 gene locus_tag LOCUS_56920 570 1157 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948175.1 protein_id gnl|my_center|LOCUS_56920 1333 2097 gene locus_tag LOCUS_56930 1333 2097 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107264.1 protein_id gnl|my_center|LOCUS_56930 2147 2680 gene locus_tag LOCUS_56940 2147 2680 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020471.1 protein_id gnl|my_center|LOCUS_56940 2898 3743 gene locus_tag LOCUS_56950 2898 3743 CDS product DUF4300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837147.1 protein_id gnl|my_center|LOCUS_56950 >Feature sequence0787 <1 2369 gene locus_tag LOCUS_56960 <1 2369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965142.1:DNA mismatch repair protein MutS >Feature sequence0788 3509 165 gene locus_tag LOCUS_56970 3509 165 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263812.1 protein_id gnl|my_center|LOCUS_56970 4106 3525 gene locus_tag LOCUS_56980 4106 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56980 >Feature sequence0789 813 1538 gene locus_tag LOCUS_56990 813 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56990 1535 3046 gene locus_tag LOCUS_57000 1535 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57000 <4142 3106 gene locus_tag LOCUS_57010 <4142 3106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005809662.1:MATE family efflux transporter >Feature sequence0790 196 372 gene locus_tag LOCUS_57020 196 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57020 588 2630 gene locus_tag LOCUS_57030 588 2630 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045361.1 protein_id gnl|my_center|LOCUS_57030 2816 3763 gene locus_tag LOCUS_57040 2816 3763 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011578509.1 protein_id gnl|my_center|LOCUS_57040 >Feature sequence0791 1568 237 gene locus_tag LOCUS_57050 1568 237 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860793.1 protein_id gnl|my_center|LOCUS_57050 1924 1574 gene locus_tag LOCUS_57060 gene mobC 1924 1574 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426139.1 protein_id gnl|my_center|LOCUS_57060 2279 2845 gene locus_tag LOCUS_57070 2279 2845 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899842.1 protein_id gnl|my_center|LOCUS_57070 2891 3418 gene locus_tag LOCUS_57080 2891 3418 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_57080 3556 3903 gene locus_tag LOCUS_57090 3556 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57090 >Feature sequence0792 3093 1414 gene locus_tag LOCUS_57100 3093 1414 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775554.1 protein_id gnl|my_center|LOCUS_57100 <4134 3094 gene locus_tag LOCUS_57110 <4134 3094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775553.1:recombinase family protein >Feature sequence0793 303 431 gene locus_tag LOCUS_57120 303 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57120 583 2103 gene locus_tag LOCUS_57130 583 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354584.1 protein_id gnl|my_center|LOCUS_57130 2890 2354 gene locus_tag LOCUS_57140 2890 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57140 3061 3246 gene locus_tag LOCUS_57150 3061 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57150 3246 3572 gene locus_tag LOCUS_57160 3246 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57160 >Feature sequence0794 1966 218 gene locus_tag LOCUS_57170 gene dhaK 1966 218 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720705.1 protein_id gnl|my_center|LOCUS_57170 2530 1970 gene locus_tag LOCUS_57180 2530 1970 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993566.1 protein_id gnl|my_center|LOCUS_57180 3004 2534 gene locus_tag LOCUS_57190 3004 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57190 3424 3038 gene locus_tag LOCUS_57200 3424 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57200 <4127 3421 gene locus_tag LOCUS_57210 <4127 3421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389117.1:ABC transporter permease >Feature sequence0795 1463 18 gene locus_tag LOCUS_57220 1463 18 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948144.1 protein_id gnl|my_center|LOCUS_57220 3658 1898 gene locus_tag LOCUS_57230 3658 1898 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116641.1 protein_id gnl|my_center|LOCUS_57230 >Feature sequence0796 243 1379 gene locus_tag LOCUS_57240 243 1379 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733226.1 protein_id gnl|my_center|LOCUS_57240 >Feature sequence0797 1556 387 gene locus_tag LOCUS_57250 1556 387 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608374.1 protein_id gnl|my_center|LOCUS_57250 2780 1623 gene locus_tag LOCUS_57260 gene gguB 2780 1623 CDS product sugar ABC transporter permease GguB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311699.1 protein_id gnl|my_center|LOCUS_57260 <4121 2791 gene locus_tag LOCUS_57270 <4121 2791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533633.1:sugar ABC transporter ATP-binding protein >Feature sequence0798 579 1460 gene locus_tag LOCUS_57280 579 1460 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948342.1 protein_id gnl|my_center|LOCUS_57280 2841 2146 gene locus_tag LOCUS_57290 2841 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57290 4047 2857 gene locus_tag LOCUS_57300 4047 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57300 >Feature sequence0799 681 1 gene locus_tag LOCUS_57310 681 1 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704149.1 protein_id gnl|my_center|LOCUS_57310 1395 703 gene locus_tag LOCUS_57320 1395 703 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033073.1 protein_id gnl|my_center|LOCUS_57320 2051 1410 gene locus_tag LOCUS_57330 2051 1410 CDS product tyrosine-protein phosphatase CpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565383.1 protein_id gnl|my_center|LOCUS_57330 2447 3109 gene locus_tag LOCUS_57340 2447 3109 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901930.1 protein_id gnl|my_center|LOCUS_57340 3772 3152 gene locus_tag LOCUS_57350 3772 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57350 >Feature sequence0800 <4111 3428 gene locus_tag LOCUS_57360 <4111 3428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109063.1:restriction endonuclease subunit M >Feature sequence0801 296 1417 gene locus_tag LOCUS_57370 296 1417 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_57370 1427 1858 gene locus_tag LOCUS_57380 1427 1858 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993892.1 protein_id gnl|my_center|LOCUS_57380 1898 3046 gene locus_tag LOCUS_57390 gene fucO 1898 3046 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350150.1 protein_id gnl|my_center|LOCUS_57390 3218 3490 gene locus_tag LOCUS_57400 3218 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57400 3606 3890 gene locus_tag LOCUS_57410 3606 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57410 >Feature sequence0802 2629 965 gene locus_tag LOCUS_57420 gene leuA 2629 965 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_57420 4073 2718 gene locus_tag LOCUS_57430 gene glmM 4073 2718 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521461.1 protein_id gnl|my_center|LOCUS_57430 >Feature sequence0803 1240 65 gene locus_tag LOCUS_57440 1240 65 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266646.1 protein_id gnl|my_center|LOCUS_57440 3930 1258 gene locus_tag LOCUS_57450 3930 1258 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108345.1 protein_id gnl|my_center|LOCUS_57450 >Feature sequence0804 423 250 gene locus_tag LOCUS_57460 423 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57460 1925 666 gene locus_tag LOCUS_57470 1925 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57470 2131 1925 gene locus_tag LOCUS_57480 2131 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57480 >Feature sequence0805 973 308 gene locus_tag LOCUS_57490 973 308 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112597.1 protein_id gnl|my_center|LOCUS_57490 1973 948 gene locus_tag LOCUS_57500 1973 948 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 protein_id gnl|my_center|LOCUS_57500 3911 2508 gene locus_tag LOCUS_57510 gene pepV 3911 2508 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922267.1 protein_id gnl|my_center|LOCUS_57510 >Feature sequence0806 219 67 gene locus_tag LOCUS_57520 219 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57520 967 335 gene locus_tag LOCUS_57530 967 335 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763533.1 protein_id gnl|my_center|LOCUS_57530 1947 967 gene locus_tag LOCUS_57540 1947 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57540 2853 1951 gene locus_tag LOCUS_57550 2853 1951 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070651736.1 protein_id gnl|my_center|LOCUS_57550 3901 2963 gene locus_tag LOCUS_57560 3901 2963 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837604.1 protein_id gnl|my_center|LOCUS_57560 >Feature sequence0807 <1 538 gene locus_tag LOCUS_57570 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047906.1:flagellar protein export ATPase FliI 606 1049 gene locus_tag LOCUS_57580 606 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57580 1062 2447 gene locus_tag LOCUS_57590 1062 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57590 2425 3855 gene locus_tag LOCUS_57600 2425 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57600 >Feature sequence0808 1164 157 gene locus_tag LOCUS_57610 1164 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57610 <4094 1175 gene locus_tag LOCUS_57620 <4094 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203027.1:DUF6531 domain-containing protein >Feature sequence0809 797 108 gene locus_tag LOCUS_57630 797 108 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436797.1 protein_id gnl|my_center|LOCUS_57630 2806 896 gene locus_tag LOCUS_57640 2806 896 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_57640 3732 2866 gene locus_tag LOCUS_57650 3732 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57650 4012 4086 gene locus_tag LOCUS_t00370 4012 4086 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0810 <1 546 gene locus_tag LOCUS_57660 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048082.1:protein translocase subunit SecF 563 1711 gene locus_tag LOCUS_57670 gene tgt 563 1711 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_57670 1714 2025 gene locus_tag LOCUS_57680 gene yajC 1714 2025 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880797.1 protein_id gnl|my_center|LOCUS_57680 >Feature sequence0811 1435 155 gene locus_tag LOCUS_57690 1435 155 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_57690 1849 3816 gene locus_tag LOCUS_57700 gene uvrB 1849 3816 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891935.1 protein_id gnl|my_center|LOCUS_57700 >Feature sequence0812 463 915 gene locus_tag LOCUS_57710 463 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57710 1267 2475 gene locus_tag LOCUS_57720 1267 2475 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986697.1 protein_id gnl|my_center|LOCUS_57720 2498 3274 gene locus_tag LOCUS_57730 gene hadI 2498 3274 CDS product 2-hydroxyisocaproyl-CoA dehydratase activator HadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986690.1 protein_id gnl|my_center|LOCUS_57730 >Feature sequence0813 649 873 gene locus_tag LOCUS_57740 649 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57740 >Feature sequence0814 3 512 gene locus_tag LOCUS_57750 3 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57750 531 1781 gene locus_tag LOCUS_57760 531 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57760 1806 2171 gene locus_tag LOCUS_57770 1806 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57770 2491 3174 gene locus_tag LOCUS_57780 2491 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57780 >Feature sequence0815 42 776 gene locus_tag LOCUS_57790 42 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57790 752 988 gene locus_tag LOCUS_57800 752 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57800 985 2076 gene locus_tag LOCUS_57810 985 2076 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288210.1 protein_id gnl|my_center|LOCUS_57810 2092 3330 gene locus_tag LOCUS_57820 2092 3330 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000685095.1 protein_id gnl|my_center|LOCUS_57820 3435 3689 gene locus_tag LOCUS_57830 3435 3689 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113434.1 protein_id gnl|my_center|LOCUS_57830 3693 3956 gene locus_tag LOCUS_57840 3693 3956 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113436.1 protein_id gnl|my_center|LOCUS_57840 >Feature sequence0816 2212 1319 gene locus_tag LOCUS_57850 2212 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57850 4039 2456 gene locus_tag LOCUS_57860 4039 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57860 >Feature sequence0817 1279 524 gene locus_tag LOCUS_57870 1279 524 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969934.1 protein_id gnl|my_center|LOCUS_57870 2757 1279 gene locus_tag LOCUS_57880 2757 1279 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_57880 2912 3919 gene locus_tag LOCUS_57890 2912 3919 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805139.1 protein_id gnl|my_center|LOCUS_57890 >Feature sequence0818 1046 321 gene locus_tag LOCUS_57900 gene rsmG 1046 321 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_57900 2928 1039 gene locus_tag LOCUS_57910 gene mnmG 2928 1039 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966993.1 protein_id gnl|my_center|LOCUS_57910 4058 2961 gene locus_tag LOCUS_57920 gene mnmE 4058 2961 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359423.1 protein_id gnl|my_center|LOCUS_57920 >Feature sequence0819 2600 447 gene locus_tag LOCUS_57930 2600 447 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_57930 3786 2644 gene locus_tag LOCUS_57940 gene pheA 3786 2644 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_57940 >Feature sequence0820 572 294 gene locus_tag LOCUS_57950 572 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 1299 583 gene locus_tag LOCUS_57960 1299 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57960 1439 2269 gene locus_tag LOCUS_57970 1439 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57970 3519 2266 gene locus_tag LOCUS_57980 gene brnQ 3519 2266 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239244.1 protein_id gnl|my_center|LOCUS_57980 4031 3579 gene locus_tag LOCUS_57990 4031 3579 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_57990 >Feature sequence0821 410 970 gene locus_tag LOCUS_58000 410 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58000 967 1506 gene locus_tag LOCUS_58010 967 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58010 1519 3540 gene locus_tag LOCUS_58020 1519 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58020 >Feature sequence0822 1547 141 gene locus_tag LOCUS_58030 1547 141 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325301.1 protein_id gnl|my_center|LOCUS_58030 1846 1571 gene locus_tag LOCUS_58040 1846 1571 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_58040 2986 1865 gene locus_tag LOCUS_58050 2986 1865 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063838431.1 protein_id gnl|my_center|LOCUS_58050 3418 3732 gene locus_tag LOCUS_58060 3418 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58060 >Feature sequence0823 936 265 gene locus_tag LOCUS_58070 936 265 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 protein_id gnl|my_center|LOCUS_58070 1383 1850 gene locus_tag LOCUS_58080 gene tadA 1383 1850 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_58080 2590 1853 gene locus_tag LOCUS_58090 2590 1853 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369289.1 protein_id gnl|my_center|LOCUS_58090 <4058 2739 gene locus_tag LOCUS_58100 <4058 2739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861612.1:NFACT RNA binding domain-containing protein >Feature sequence0824 15 1544 gene locus_tag LOCUS_58110 15 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58110 1556 2392 gene locus_tag LOCUS_58120 1556 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58120 2405 3490 gene locus_tag LOCUS_58130 2405 3490 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_58130 >Feature sequence0825 1648 1998 gene locus_tag LOCUS_58140 1648 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58140 3333 2083 gene locus_tag LOCUS_58150 3333 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58150 >Feature sequence0826 <1 993 gene locus_tag LOCUS_58160 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048238.1:3-(aryl)acryloyl-CoA:(R)-3-(aryl)lactate CoA-transferase FldA 1077 2624 gene locus_tag LOCUS_58170 1077 2624 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048239.1 protein_id gnl|my_center|LOCUS_58170 2588 3736 gene locus_tag LOCUS_58180 gene acdA 2588 3736 CDS product 3-(aryl)acrylate reductase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357672.1 protein_id gnl|my_center|LOCUS_58180 >Feature sequence0827 1068 235 gene locus_tag LOCUS_58190 gene proB 1068 235 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_58190 2684 1071 gene locus_tag LOCUS_58200 2684 1071 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048336.1 protein_id gnl|my_center|LOCUS_58200 3906 2695 gene locus_tag LOCUS_58210 3906 2695 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048436.1 protein_id gnl|my_center|LOCUS_58210 >Feature sequence0828 774 1190 gene locus_tag LOCUS_58220 774 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58220 2840 1428 gene locus_tag LOCUS_58230 2840 1428 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296829.1 protein_id gnl|my_center|LOCUS_58230 <4046 2842 gene locus_tag LOCUS_58240 <4046 2842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545558.1:cofactor-independent phosphoglycerate mutase >Feature sequence0829 <1 632 gene locus_tag LOCUS_58250 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003427657.1:nicotinate phosphoribosyltransferase 1365 1943 gene locus_tag LOCUS_58260 1365 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58260 2127 2582 gene locus_tag LOCUS_58270 2127 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58270 >Feature sequence0830 1164 379 gene locus_tag LOCUS_58280 1164 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58280 2569 1139 gene locus_tag LOCUS_58290 2569 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58290 3218 3586 gene locus_tag LOCUS_58300 3218 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58300 >Feature sequence0831 1184 570 gene locus_tag LOCUS_58310 1184 570 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052445.1 protein_id gnl|my_center|LOCUS_58310 2864 1284 gene locus_tag LOCUS_58320 2864 1284 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58320 3160 2873 gene locus_tag LOCUS_58330 3160 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58330 3611 3336 gene locus_tag LOCUS_58340 3611 3336 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_58340 >Feature sequence0832 579 322 gene locus_tag LOCUS_58350 579 322 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113434.1 protein_id gnl|my_center|LOCUS_58350 >Feature sequence0833 2344 1154 gene locus_tag LOCUS_58360 2344 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58360 2688 2981 gene locus_tag LOCUS_58370 2688 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58370 3007 3387 gene locus_tag LOCUS_58380 3007 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58380 >Feature sequence0834 1802 564 gene locus_tag LOCUS_58390 1802 564 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_58390 2451 1804 gene locus_tag LOCUS_58400 2451 1804 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438166.1 protein_id gnl|my_center|LOCUS_58400 2836 2435 gene locus_tag LOCUS_58410 2836 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58410 <4014 2840 gene locus_tag LOCUS_58420 <4014 2840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964990.1:ribonuclease J >Feature sequence0835 1050 13 gene locus_tag LOCUS_58430 1050 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58430 1990 1055 gene locus_tag LOCUS_58440 1990 1055 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454768.1 protein_id gnl|my_center|LOCUS_58440 2124 2399 gene locus_tag LOCUS_58450 2124 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58450 3947 2451 gene locus_tag LOCUS_58460 gene glpK 3947 2451 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_58460 >Feature sequence0836 3166 2657 gene locus_tag LOCUS_58470 3166 2657 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775404.1 protein_id gnl|my_center|LOCUS_58470 <4007 3169 gene locus_tag LOCUS_58480 <4007 3169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775403.1:glycoside hydrolase family 3 C-terminal domain-containing protein >Feature sequence0837 469 194 gene locus_tag LOCUS_58490 469 194 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392154.1 protein_id gnl|my_center|LOCUS_58490 1041 1295 gene locus_tag LOCUS_58500 1041 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58500 1520 1690 gene locus_tag LOCUS_58510 1520 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58510 1702 1932 gene locus_tag LOCUS_58520 1702 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 1980 2198 gene locus_tag LOCUS_58530 1980 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58530 2476 2330 gene locus_tag LOCUS_58540 2476 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58540 3036 3953 gene locus_tag LOCUS_58550 3036 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58550 >Feature sequence0838 466 2685 gene locus_tag LOCUS_58560 466 2685 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109016.1 protein_id gnl|my_center|LOCUS_58560 2694 3869 gene locus_tag LOCUS_58570 2694 3869 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467385.1 protein_id gnl|my_center|LOCUS_58570 >Feature sequence0839 576 400 gene locus_tag LOCUS_58580 576 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58580 1939 746 gene locus_tag LOCUS_58590 1939 746 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_58590 3006 2008 gene locus_tag LOCUS_58600 gene pta 3006 2008 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_58600 >Feature sequence0840 >Feature sequence0841 1975 1466 gene locus_tag LOCUS_58610 1975 1466 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_58610 3132 2044 gene locus_tag LOCUS_58620 3132 2044 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_58620 3971 3129 gene locus_tag LOCUS_58630 3971 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58630 >Feature sequence0842 <1 920 gene locus_tag LOCUS_58640 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010819485.1:phage terminase large subunit 928 2265 gene locus_tag LOCUS_58650 928 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58650 2269 3906 gene locus_tag LOCUS_58660 2269 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58660 >Feature sequence0843 364 936 gene locus_tag LOCUS_58670 364 936 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_58670 1062 2360 gene locus_tag LOCUS_58680 1062 2360 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_58680 2589 3911 gene locus_tag LOCUS_58690 2589 3911 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964048.1 protein_id gnl|my_center|LOCUS_58690 >Feature sequence0844 1698 769 gene locus_tag LOCUS_58700 1698 769 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_58700 3835 1919 gene locus_tag LOCUS_58710 3835 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58710 >Feature sequence0845 1118 741 gene locus_tag LOCUS_58720 1118 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58720 1576 1127 gene locus_tag LOCUS_58730 1576 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58730 2442 1573 gene locus_tag LOCUS_58740 2442 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58740 >Feature sequence0846 627 340 gene locus_tag LOCUS_58750 627 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_58750 753 1238 gene locus_tag LOCUS_58760 753 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_58760 1254 2261 gene locus_tag LOCUS_58770 1254 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_58770 2968 2330 gene locus_tag LOCUS_58780 gene trmB 2968 2330 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239385.1 protein_id gnl|my_center|LOCUS_58780 >Feature sequence0847 2 1741 gene locus_tag LOCUS_58790 gene dnaG 2 1741 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_58790 1748 2446 gene locus_tag LOCUS_58800 1748 2446 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006551.1 protein_id gnl|my_center|LOCUS_58800 2433 3221 gene locus_tag LOCUS_58810 2433 3221 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_58810 3618 3954 gene locus_tag LOCUS_tm00020 3618 3954 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0848 150 1115 gene locus_tag LOCUS_58820 150 1115 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_58820 1196 2062 gene locus_tag LOCUS_58830 1196 2062 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_58830 2087 3028 gene locus_tag LOCUS_58840 gene pfkA 2087 3028 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440192.1 protein_id gnl|my_center|LOCUS_58840 3047 3826 gene locus_tag LOCUS_58850 3047 3826 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_58850 >Feature sequence0849 29 310 gene locus_tag LOCUS_58860 29 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58860 1393 338 gene locus_tag LOCUS_58870 1393 338 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_58870 1618 2916 gene locus_tag LOCUS_58880 gene eno 1618 2916 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964032.1 protein_id gnl|my_center|LOCUS_58880 >Feature sequence0850 430 1923 gene locus_tag LOCUS_58890 430 1923 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_58890 1907 2572 gene locus_tag LOCUS_58900 1907 2572 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272632.1 protein_id gnl|my_center|LOCUS_58900 3299 2760 gene locus_tag LOCUS_58910 3299 2760 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241398.1 protein_id gnl|my_center|LOCUS_58910 3642 3310 gene locus_tag LOCUS_58920 3642 3310 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355771.1 protein_id gnl|my_center|LOCUS_58920 >Feature sequence0851 2427 1000 gene locus_tag LOCUS_58930 2427 1000 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202144.1 protein_id gnl|my_center|LOCUS_58930 3407 2427 gene locus_tag LOCUS_58940 3407 2427 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003836797.1 protein_id gnl|my_center|LOCUS_58940 >Feature sequence0852 594 1091 gene locus_tag LOCUS_58950 594 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58950 1099 1617 gene locus_tag LOCUS_58960 gene cobO 1099 1617 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948638.1 protein_id gnl|my_center|LOCUS_58960 1690 2232 gene locus_tag LOCUS_58970 1690 2232 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966303.1 protein_id gnl|my_center|LOCUS_58970 2248 2847 gene locus_tag LOCUS_58980 gene yedF 2248 2847 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892314.1 protein_id gnl|my_center|LOCUS_58980 2850 3089 gene locus_tag LOCUS_58990 2850 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58990 3173 3355 gene locus_tag LOCUS_59000 3173 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59000 >Feature sequence0853 2488 1763 gene locus_tag LOCUS_59010 2488 1763 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109727.1 protein_id gnl|my_center|LOCUS_59010 3938 2499 gene locus_tag LOCUS_59020 3938 2499 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_59020 >Feature sequence0854 <1 592 gene locus_tag LOCUS_59030 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459550.1:BMP family ABC transporter substrate-binding protein 742 2031 gene locus_tag LOCUS_59040 742 2031 CDS product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367092.1 protein_id gnl|my_center|LOCUS_59040 2034 2375 gene locus_tag LOCUS_59050 2034 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59050 2394 3149 gene locus_tag LOCUS_59060 2394 3149 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_59060 >Feature sequence0855 708 4 gene locus_tag LOCUS_59070 708 4 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986593.1 protein_id gnl|my_center|LOCUS_59070 2215 698 gene locus_tag LOCUS_59080 2215 698 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681159.1 protein_id gnl|my_center|LOCUS_59080 3927 2218 gene locus_tag LOCUS_59090 3927 2218 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681161.1 protein_id gnl|my_center|LOCUS_59090 >Feature sequence0856 1541 546 gene locus_tag LOCUS_59100 gene msrAB 1541 546 CDS product bifunctional peptide-methionine (S)-S-oxide reductase MsrA/peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995985.1 protein_id gnl|my_center|LOCUS_59100 1853 2470 gene locus_tag LOCUS_59110 1853 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59110 2509 3198 gene locus_tag LOCUS_59120 2509 3198 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_59120 3295 3915 gene locus_tag LOCUS_59130 3295 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59130 >Feature sequence0857 246 1715 gene locus_tag LOCUS_59140 gene guaB 246 1715 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965988.1 protein_id gnl|my_center|LOCUS_59140 1719 2735 gene locus_tag LOCUS_59150 1719 2735 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897671.1 protein_id gnl|my_center|LOCUS_59150 3584 3015 gene locus_tag LOCUS_59160 3584 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59160 >Feature sequence0858 1449 61 gene locus_tag LOCUS_59170 1449 61 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_59170 1587 2495 gene locus_tag LOCUS_59180 1587 2495 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272197.1 protein_id gnl|my_center|LOCUS_59180 2876 3352 gene locus_tag LOCUS_59190 2876 3352 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_59190 3791 3507 gene locus_tag LOCUS_59200 3791 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59200 >Feature sequence0859 541 876 gene locus_tag LOCUS_59210 541 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59210 877 1635 gene locus_tag LOCUS_59220 877 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59220 1628 2173 gene locus_tag LOCUS_59230 1628 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59230 2199 2846 gene locus_tag LOCUS_59240 2199 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205180329.1 protein_id gnl|my_center|LOCUS_59240 >Feature sequence0860 2771 1878 gene locus_tag LOCUS_59250 2771 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59250 2978 2775 gene locus_tag LOCUS_59260 2978 2775 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885335.1 protein_id gnl|my_center|LOCUS_59260 3314 3439 gene locus_tag LOCUS_59270 3314 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59270 >Feature sequence0861 197 1030 gene locus_tag LOCUS_59280 gene mreC 197 1030 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775464.1 protein_id gnl|my_center|LOCUS_59280 1027 1539 gene locus_tag LOCUS_59290 1027 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59290 >Feature sequence0862 1931 1626 gene locus_tag LOCUS_59300 1931 1626 CDS product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439520.1 protein_id gnl|my_center|LOCUS_59300 2202 1918 gene locus_tag LOCUS_59310 2202 1918 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419469.1 protein_id gnl|my_center|LOCUS_59310 3340 2180 gene locus_tag LOCUS_59320 gene nusA 3340 2180 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_59320 3823 3359 gene locus_tag LOCUS_59330 3823 3359 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_59330 >Feature sequence0863 948 1451 gene locus_tag LOCUS_59340 948 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59340 1965 1498 gene locus_tag LOCUS_59350 gene tadA 1965 1498 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_59350 2137 2832 gene locus_tag LOCUS_59360 2137 2832 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_59360 >Feature sequence0864 28 1431 gene locus_tag LOCUS_59370 28 1431 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_59370 1433 2758 gene locus_tag LOCUS_59380 gene der 1433 2758 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_59380 2759 3391 gene locus_tag LOCUS_59390 gene plsY 2759 3391 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_59390 >Feature sequence0865 2241 415 gene locus_tag LOCUS_59400 2241 415 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986619.1 protein_id gnl|my_center|LOCUS_59400 3006 2260 gene locus_tag LOCUS_59410 3006 2260 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986620.1 protein_id gnl|my_center|LOCUS_59410 3703 3047 gene locus_tag LOCUS_59420 3703 3047 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986621.1 protein_id gnl|my_center|LOCUS_59420 >Feature sequence0866 127 1410 gene locus_tag LOCUS_59430 gene clpX 127 1410 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_59430 1461 3755 gene locus_tag LOCUS_59440 gene lon 1461 3755 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435613.1 protein_id gnl|my_center|LOCUS_59440 >Feature sequence0867 450 635 gene locus_tag LOCUS_59450 450 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59450 680 919 gene locus_tag LOCUS_59460 680 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59460 1016 1441 gene locus_tag LOCUS_59470 1016 1441 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902513.1 protein_id gnl|my_center|LOCUS_59470 3086 1806 gene locus_tag LOCUS_59480 3086 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014528.1 protein_id gnl|my_center|LOCUS_59480 3515 3135 gene locus_tag LOCUS_59490 3515 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59490 >Feature sequence0868 1540 245 gene locus_tag LOCUS_59500 1540 245 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898268.1 protein_id gnl|my_center|LOCUS_59500 2073 1537 gene locus_tag LOCUS_59510 2073 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59510 3189 2131 gene locus_tag LOCUS_59520 3189 2131 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566022.1 protein_id gnl|my_center|LOCUS_59520 <3916 3316 gene locus_tag LOCUS_59530 <3916 3316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002917245.1:response regulator >Feature sequence0869 404 1087 gene locus_tag LOCUS_59540 404 1087 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948485.1 protein_id gnl|my_center|LOCUS_59540 1234 2151 gene locus_tag LOCUS_59550 1234 2151 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948486.1 protein_id gnl|my_center|LOCUS_59550 2144 2887 gene locus_tag LOCUS_59560 2144 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59560 2940 3185 gene locus_tag LOCUS_59570 2940 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59570 3255 3866 gene locus_tag LOCUS_59580 3255 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59580 >Feature sequence0870 <1 595 gene locus_tag LOCUS_59590 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436251.1:DNA polymerase III subunit alpha 857 2593 gene locus_tag LOCUS_59600 857 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59600 2610 3887 gene locus_tag LOCUS_59610 2610 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59610 >Feature sequence0871 2850 259 gene locus_tag LOCUS_59620 gene clpB 2850 259 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948176.1 protein_id gnl|my_center|LOCUS_59620 >Feature sequence0872 2693 1074 gene locus_tag LOCUS_59630 2693 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59630 >Feature sequence0873 90 530 gene locus_tag LOCUS_59640 90 530 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460328.1 protein_id gnl|my_center|LOCUS_59640 1305 2024 gene locus_tag LOCUS_59650 1305 2024 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965914.1 protein_id gnl|my_center|LOCUS_59650 2538 2059 gene locus_tag LOCUS_59660 2538 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59660 3615 2683 gene locus_tag LOCUS_59670 3615 2683 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948398.1 protein_id gnl|my_center|LOCUS_59670 3859 3710 gene locus_tag LOCUS_59680 3859 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59680 >Feature sequence0874 256 678 gene locus_tag LOCUS_59690 gene arsD 256 678 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272722.1 protein_id gnl|my_center|LOCUS_59690 692 2422 gene locus_tag LOCUS_59700 gene arsA 692 2422 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272721.1 protein_id gnl|my_center|LOCUS_59700 2514 3554 gene locus_tag LOCUS_59710 gene arsB 2514 3554 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462028.1 protein_id gnl|my_center|LOCUS_59710 >Feature sequence0875 1001 507 gene locus_tag LOCUS_59720 1001 507 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_59720 1375 1232 gene locus_tag LOCUS_59730 1375 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59730 2496 1450 gene locus_tag LOCUS_59740 2496 1450 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947984.1 protein_id gnl|my_center|LOCUS_59740 3506 2499 gene locus_tag LOCUS_59750 gene asnA 3506 2499 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641196.1 protein_id gnl|my_center|LOCUS_59750 >Feature sequence0876 1660 2934 gene locus_tag LOCUS_59760 1660 2934 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082942.1 protein_id gnl|my_center|LOCUS_59760 >Feature sequence0877 970 173 gene locus_tag LOCUS_59770 970 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59770 1096 3843 gene locus_tag LOCUS_59780 1096 3843 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106612643.1 protein_id gnl|my_center|LOCUS_59780 >Feature sequence0878 2538 3395 gene locus_tag LOCUS_59790 2538 3395 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288251.1 protein_id gnl|my_center|LOCUS_59790 >Feature sequence0879 1 606 gene locus_tag LOCUS_59800 1 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59800 738 1337 gene locus_tag LOCUS_59810 738 1337 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681326.1 protein_id gnl|my_center|LOCUS_59810 1394 3853 gene locus_tag LOCUS_59820 1394 3853 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681327.1 protein_id gnl|my_center|LOCUS_59820 >Feature sequence0880 1015 470 gene locus_tag LOCUS_59830 1015 470 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_59830 1767 1015 gene locus_tag LOCUS_59840 1767 1015 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_59840 2817 1771 gene locus_tag LOCUS_59850 2817 1771 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_59850 3457 2936 gene locus_tag LOCUS_59860 3457 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59860 >Feature sequence0881 481 915 gene locus_tag LOCUS_59870 481 915 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261909.1 protein_id gnl|my_center|LOCUS_59870 905 2128 gene locus_tag LOCUS_59880 905 2128 CDS product acyl-CoA thioesterase/bile acid-CoA:amino acid N-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261908.1 protein_id gnl|my_center|LOCUS_59880 2316 2780 gene locus_tag LOCUS_59890 2316 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59890 2874 3656 gene locus_tag LOCUS_59900 2874 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59900 >Feature sequence0882 385 687 gene locus_tag LOCUS_59910 385 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59910 1409 720 gene locus_tag LOCUS_59920 1409 720 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_59920 2451 1420 gene locus_tag LOCUS_59930 2451 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59930 3635 2451 gene locus_tag LOCUS_59940 gene metK 3635 2451 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933820.1 protein_id gnl|my_center|LOCUS_59940 >Feature sequence0883 2632 1451 gene locus_tag LOCUS_59950 2632 1451 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430617.1 protein_id gnl|my_center|LOCUS_59950 3851 2649 gene locus_tag LOCUS_59960 3851 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59960 >Feature sequence0884 267 3467 gene locus_tag LOCUS_59970 267 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59970 >Feature sequence0885 1254 676 gene locus_tag LOCUS_59980 1254 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59980 2557 1283 gene locus_tag LOCUS_59990 2557 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59990 3776 2607 gene locus_tag LOCUS_60000 3776 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60000 >Feature sequence0886 309 43 gene locus_tag LOCUS_60010 gene rpsO 309 43 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419491.1 protein_id gnl|my_center|LOCUS_60010 1568 720 gene locus_tag LOCUS_60020 1568 720 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890830.1 protein_id gnl|my_center|LOCUS_60020 3710 1674 gene locus_tag LOCUS_60030 gene htpG 3710 1674 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_60030 >Feature sequence0887 52 1044 gene locus_tag LOCUS_60040 52 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60040 1072 1737 gene locus_tag LOCUS_60050 1072 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60050 1818 3821 gene locus_tag LOCUS_60060 1818 3821 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_60060 >Feature sequence0888 74 580 gene locus_tag LOCUS_60070 74 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60070 593 1765 gene locus_tag LOCUS_60080 593 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60080 1762 3444 gene locus_tag LOCUS_60090 1762 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60090 >Feature sequence0889 1976 378 gene locus_tag LOCUS_60100 1976 378 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_60100 3079 2018 gene locus_tag LOCUS_60110 3079 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60110 3779 3054 gene locus_tag LOCUS_60120 3779 3054 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964567.1 protein_id gnl|my_center|LOCUS_60120 >Feature sequence0890 2586 640 gene locus_tag LOCUS_60130 2586 640 CDS product PTS beta-glucoside transporter subunit IIBCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027722.1 protein_id gnl|my_center|LOCUS_60130 3027 2758 gene locus_tag LOCUS_60140 gene rpsR 3027 2758 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_60140 3499 3047 gene locus_tag LOCUS_60150 3499 3047 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902513.1 protein_id gnl|my_center|LOCUS_60150 3822 3535 gene locus_tag LOCUS_60160 gene rpsF 3822 3535 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_60160 >Feature sequence0891 <1 1172 gene locus_tag LOCUS_60170 <1 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404923.1:D-alanine--D-alanine ligase family protein 1172 1795 gene locus_tag LOCUS_60180 1172 1795 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435254.1 protein_id gnl|my_center|LOCUS_60180 >Feature sequence0892 <1 560 gene locus_tag LOCUS_60190 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438208.1:radical SAM protein 536 1699 gene locus_tag LOCUS_60200 536 1699 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435857.1 protein_id gnl|my_center|LOCUS_60200 2213 3742 gene locus_tag LOCUS_60210 gene guaA 2213 3742 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679432.1 protein_id gnl|my_center|LOCUS_60210 >Feature sequence0893 1121 384 gene locus_tag LOCUS_60220 gene truA 1121 384 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_60220 1932 1126 gene locus_tag LOCUS_60230 1932 1126 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_60230 2800 1925 gene locus_tag LOCUS_60240 2800 1925 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_60240 3674 2820 gene locus_tag LOCUS_60250 3674 2820 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_60250 3840 3765 gene locus_tag LOCUS_t00380 3840 3765 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0894 418 110 gene locus_tag LOCUS_60260 418 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60260 804 622 gene locus_tag LOCUS_60270 804 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704439.1 protein_id gnl|my_center|LOCUS_60270 2425 1304 gene locus_tag LOCUS_60280 2425 1304 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966180.1 protein_id gnl|my_center|LOCUS_60280 3116 2451 gene locus_tag LOCUS_60290 3116 2451 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963960.1 protein_id gnl|my_center|LOCUS_60290 <3852 3150 gene locus_tag LOCUS_60300 <3852 3150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009903819.1:biotin--[acetyl-CoA-carboxylase] ligase >Feature sequence0895 475 344 gene locus_tag LOCUS_60310 475 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60310 1535 492 gene locus_tag LOCUS_60320 1535 492 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368732.1 protein_id gnl|my_center|LOCUS_60320 2452 1538 gene locus_tag LOCUS_60330 2452 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60330 3227 2442 gene locus_tag LOCUS_60340 3227 2442 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_60340 3443 3246 gene locus_tag LOCUS_60350 3443 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60350 >Feature sequence0896 36 1001 gene locus_tag LOCUS_60360 36 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60360 994 1293 gene locus_tag LOCUS_60370 994 1293 CDS product DUF2577 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047654.1 protein_id gnl|my_center|LOCUS_60370 1298 1693 gene locus_tag LOCUS_60380 1298 1693 CDS product DUF2634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861039.1 protein_id gnl|my_center|LOCUS_60380 1693 2760 gene locus_tag LOCUS_60390 1693 2760 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861040.1 protein_id gnl|my_center|LOCUS_60390 2753 3298 gene locus_tag LOCUS_60400 2753 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60400 3306 3680 gene locus_tag LOCUS_60410 3306 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60410 >Feature sequence0897 3406 1661 gene locus_tag LOCUS_60420 3406 1661 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_60420 3576 3493 gene locus_tag LOCUS_t00390 3576 3493 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0898 172 1662 gene locus_tag LOCUS_60430 172 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60430 1681 3300 gene locus_tag LOCUS_60440 1681 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60440 3396 3518 gene locus_tag LOCUS_60450 3396 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60450 >Feature sequence0899 848 1117 gene locus_tag LOCUS_60460 848 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60460 1143 1868 gene locus_tag LOCUS_60470 1143 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60470 3480 2020 gene locus_tag LOCUS_60480 3480 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60480 >Feature sequence0900 1789 59 gene locus_tag LOCUS_60490 1789 59 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_60490 3507 1786 gene locus_tag LOCUS_60500 3507 1786 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_60500 3783 3544 gene locus_tag LOCUS_60510 3783 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60510 >Feature sequence0901 <1 1543 gene locus_tag LOCUS_60520 <1 1543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869269.1:V-type ATP synthase subunit A 1555 2958 gene locus_tag LOCUS_60530 1555 2958 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869712.1 protein_id gnl|my_center|LOCUS_60530 2971 3585 gene locus_tag LOCUS_60540 2971 3585 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_60540 >Feature sequence0902 182 1303 gene locus_tag LOCUS_60550 182 1303 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289189.1 protein_id gnl|my_center|LOCUS_60550 1393 2100 gene locus_tag LOCUS_60560 1393 2100 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949128.1 protein_id gnl|my_center|LOCUS_60560 2285 3121 gene locus_tag LOCUS_60570 2285 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60570 >Feature sequence0903 2202 1360 gene locus_tag LOCUS_60580 2202 1360 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030302.1 protein_id gnl|my_center|LOCUS_60580 2788 2195 gene locus_tag LOCUS_60590 2788 2195 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037239.1 protein_id gnl|my_center|LOCUS_60590 3713 2880 gene locus_tag LOCUS_60600 3713 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60600 >Feature sequence0904 245 81 gene locus_tag LOCUS_60610 245 81 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895603.1 protein_id gnl|my_center|LOCUS_60610 2229 514 gene locus_tag LOCUS_60620 2229 514 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005399340.1 protein_id gnl|my_center|LOCUS_60620 <3831 2213 gene locus_tag LOCUS_60630 <3831 2213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005399341.1:ABC transporter ATP-binding protein >Feature sequence0905 2649 529 gene locus_tag LOCUS_60640 gene fusA 2649 529 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436178.1 protein_id gnl|my_center|LOCUS_60640 3135 2665 gene locus_tag LOCUS_60650 gene rpsG 3135 2665 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357613.1 protein_id gnl|my_center|LOCUS_60650 3710 3291 gene locus_tag LOCUS_60660 gene rpsL 3710 3291 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_60660 >Feature sequence0906 1699 593 gene locus_tag LOCUS_60670 gene cas7e 1699 593 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 protein_id gnl|my_center|LOCUS_60670 2267 1689 gene locus_tag LOCUS_60680 gene casB 2267 1689 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003586648.1 protein_id gnl|my_center|LOCUS_60680 <3829 2277 gene locus_tag LOCUS_60690 <3829 2277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009994024.1:type I-E CRISPR-associated protein Cse1/CasA >Feature sequence0907 2068 1472 gene locus_tag LOCUS_60700 2068 1472 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681326.1 protein_id gnl|my_center|LOCUS_60700 2321 3439 gene locus_tag LOCUS_60710 2321 3439 CDS product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890534.1 protein_id gnl|my_center|LOCUS_60710 >Feature sequence0908 368 793 gene locus_tag LOCUS_60720 gene fabZ 368 793 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447678.1 protein_id gnl|my_center|LOCUS_60720 898 1383 gene locus_tag LOCUS_60730 898 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60730 1787 2497 gene locus_tag LOCUS_60740 1787 2497 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964614.1 protein_id gnl|my_center|LOCUS_60740 2484 3275 gene locus_tag LOCUS_60750 2484 3275 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_60750 >Feature sequence0909 >Feature sequence0910 44 1450 gene locus_tag LOCUS_60760 44 1450 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_60760 1535 2605 gene locus_tag LOCUS_60770 1535 2605 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356948.1 protein_id gnl|my_center|LOCUS_60770 2562 3242 gene locus_tag LOCUS_60780 2562 3242 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293786.1 protein_id gnl|my_center|LOCUS_60780 >Feature sequence0911 3176 537 gene locus_tag LOCUS_60790 3176 537 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880372.1 protein_id gnl|my_center|LOCUS_60790 >Feature sequence0912 1117 170 gene locus_tag LOCUS_60800 1117 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60800 1387 2706 gene locus_tag LOCUS_60810 gene xylA 1387 2706 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898127.1 protein_id gnl|my_center|LOCUS_60810 >Feature sequence0913 454 1491 gene locus_tag LOCUS_60820 gene asrA 454 1491 CDS product anaerobic sulfite reductase subunit AsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964821.1 protein_id gnl|my_center|LOCUS_60820 1481 2272 gene locus_tag LOCUS_60830 gene asrB 1481 2272 CDS product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964822.1 protein_id gnl|my_center|LOCUS_60830 2284 3261 gene locus_tag LOCUS_60840 gene asrC 2284 3261 CDS product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964823.1 protein_id gnl|my_center|LOCUS_60840 >Feature sequence0914 1668 913 gene locus_tag LOCUS_60850 1668 913 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724134.1 protein_id gnl|my_center|LOCUS_60850 2325 1675 gene locus_tag LOCUS_60860 2325 1675 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383057.1 protein_id gnl|my_center|LOCUS_60860 3326 2481 gene locus_tag LOCUS_60870 3326 2481 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_60870 >Feature sequence0915 39 1052 gene locus_tag LOCUS_60880 39 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60880 1052 1948 gene locus_tag LOCUS_60890 1052 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60890 2275 3297 gene locus_tag LOCUS_60900 2275 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60900 3331 3720 gene locus_tag LOCUS_60910 3331 3720 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_60910 >Feature sequence0916 1232 123 gene locus_tag LOCUS_60920 1232 123 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461029.1 protein_id gnl|my_center|LOCUS_60920 3122 1608 gene locus_tag LOCUS_60930 3122 1608 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775555.1 protein_id gnl|my_center|LOCUS_60930 >Feature sequence0917 586 392 gene locus_tag LOCUS_60940 586 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60940 689 1138 gene locus_tag LOCUS_60950 689 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60950 <3801 1192 gene locus_tag LOCUS_60960 <3801 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016607.1:TIR domain-containing protein >Feature sequence0918 <1 1098 gene locus_tag LOCUS_60970 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048254.1:insulinase family protein 1110 2006 gene locus_tag LOCUS_60980 gene era 1110 2006 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_60980 2008 2652 gene locus_tag LOCUS_60990 2008 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60990 >Feature sequence0919 295 603 gene locus_tag LOCUS_61000 295 603 CDS product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461833.1 protein_id gnl|my_center|LOCUS_61000 719 1357 gene locus_tag LOCUS_61010 719 1357 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461832.1 protein_id gnl|my_center|LOCUS_61010 1341 2345 gene locus_tag LOCUS_61020 1341 2345 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461831.1 protein_id gnl|my_center|LOCUS_61020 2326 3102 gene locus_tag LOCUS_61030 2326 3102 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184185.1 protein_id gnl|my_center|LOCUS_61030 >Feature sequence0920 2101 941 gene locus_tag LOCUS_61040 gene dnaJ 2101 941 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_61040 <3790 2227 gene locus_tag LOCUS_61050 <3790 2227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003430934.1:molecular chaperone DnaK >Feature sequence0921 1084 371 gene locus_tag LOCUS_61060 gene rsmG 1084 371 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_61060 1848 1084 gene locus_tag LOCUS_61070 1848 1084 CDS product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898686.1 protein_id gnl|my_center|LOCUS_61070 2063 2965 gene locus_tag LOCUS_61080 gene sppA 2063 2965 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229337.1 protein_id gnl|my_center|LOCUS_61080 >Feature sequence0922 1177 458 gene locus_tag LOCUS_61090 1177 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61090 2669 1254 gene locus_tag LOCUS_61100 2669 1254 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986504.1 protein_id gnl|my_center|LOCUS_61100 3327 2653 gene locus_tag LOCUS_61110 3327 2653 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986505.1 protein_id gnl|my_center|LOCUS_61110 >Feature sequence0923 171 830 gene locus_tag LOCUS_61120 171 830 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384085.1 protein_id gnl|my_center|LOCUS_61120 811 1482 gene locus_tag LOCUS_61130 811 1482 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154147.1 protein_id gnl|my_center|LOCUS_61130 1502 2275 gene locus_tag LOCUS_61140 1502 2275 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005008.1 protein_id gnl|my_center|LOCUS_61140 2345 3214 gene locus_tag LOCUS_61150 2345 3214 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056925.1 protein_id gnl|my_center|LOCUS_61150 >Feature sequence0924 <1 1020 gene locus_tag LOCUS_61160 <1 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009039964.1:Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain 1025 1819 gene locus_tag LOCUS_61170 1025 1819 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475869.1 protein_id gnl|my_center|LOCUS_61170 1825 2715 gene locus_tag LOCUS_61180 1825 2715 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905213.1 protein_id gnl|my_center|LOCUS_61180 >Feature sequence0925 1672 506 gene locus_tag LOCUS_61190 1672 506 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_61190 3135 1759 gene locus_tag LOCUS_61200 3135 1759 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948690.1 protein_id gnl|my_center|LOCUS_61200 <3771 3151 gene locus_tag LOCUS_61210 <3771 3151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002383735.1:MetQ/NlpA family ABC transporter substrate-binding protein >Feature sequence0926 939 16 gene locus_tag LOCUS_61220 gene ttdA 939 16 CDS product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045349.1 protein_id gnl|my_center|LOCUS_61220 2230 962 gene locus_tag LOCUS_61230 2230 962 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433394.1 protein_id gnl|my_center|LOCUS_61230 2431 3324 gene locus_tag LOCUS_61240 2431 3324 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227377.1 protein_id gnl|my_center|LOCUS_61240 >Feature sequence0927 175 1269 gene locus_tag LOCUS_61250 175 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61250 1273 2514 gene locus_tag LOCUS_61260 1273 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61260 2530 3471 gene locus_tag LOCUS_61270 2530 3471 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_61270 >Feature sequence0928 2014 500 gene locus_tag LOCUS_61280 2014 500 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_61280 3136 2069 gene locus_tag LOCUS_61290 gene galE 3136 2069 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_61290 <3761 3247 gene locus_tag LOCUS_61300 <3761 3247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788311.1:phosphoribosylaminoimidazolecarboxamide formyltransferase >Feature sequence0929 468 887 gene locus_tag LOCUS_61310 468 887 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_61310 931 1548 gene locus_tag LOCUS_61320 931 1548 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006874833.1 protein_id gnl|my_center|LOCUS_61320 1550 2035 gene locus_tag LOCUS_61330 1550 2035 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359122.1 protein_id gnl|my_center|LOCUS_61330 2032 2364 gene locus_tag LOCUS_61340 2032 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61340 2370 3113 gene locus_tag LOCUS_61350 gene whiG 2370 3113 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_61350 3157 3492 gene locus_tag LOCUS_61360 3157 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61360 >Feature sequence0930 14 1093 gene locus_tag LOCUS_61370 gene serC 14 1093 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_61370 1103 2269 gene locus_tag LOCUS_61380 1103 2269 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_61380 2262 3488 gene locus_tag LOCUS_61390 2262 3488 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462038.1 protein_id gnl|my_center|LOCUS_61390 >Feature sequence0931 1264 329 gene locus_tag LOCUS_61400 1264 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61400 1876 1301 gene locus_tag LOCUS_61410 1876 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61410 2389 2168 gene locus_tag LOCUS_61420 2389 2168 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809979.1 protein_id gnl|my_center|LOCUS_61420 3328 2486 gene locus_tag LOCUS_61430 3328 2486 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811883.1 protein_id gnl|my_center|LOCUS_61430 >Feature sequence0932 1905 1177 gene locus_tag LOCUS_61440 gene hadI 1905 1177 CDS product 2-hydroxyisocaproyl-CoA dehydratase activator HadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986690.1 protein_id gnl|my_center|LOCUS_61440 3193 1985 gene locus_tag LOCUS_61450 3193 1985 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986697.1 protein_id gnl|my_center|LOCUS_61450 >Feature sequence0933 1430 339 gene locus_tag LOCUS_61460 1430 339 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964155.1 protein_id gnl|my_center|LOCUS_61460 2250 1459 gene locus_tag LOCUS_61470 2250 1459 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_61470 3068 2247 gene locus_tag LOCUS_61480 3068 2247 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808911.1 protein_id gnl|my_center|LOCUS_61480 <3754 3061 gene locus_tag LOCUS_61490 <3754 3061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272316.1:ABC transporter ATP-binding protein >Feature sequence0934 2331 451 gene locus_tag LOCUS_61500 2331 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61500 3711 2692 gene locus_tag LOCUS_61510 gene ilvC 3711 2692 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_61510 >Feature sequence0935 1 1386 gene locus_tag LOCUS_61520 1 1386 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_61520 1471 2541 gene locus_tag LOCUS_61530 1471 2541 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356948.1 protein_id gnl|my_center|LOCUS_61530 2498 3178 gene locus_tag LOCUS_61540 2498 3178 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293786.1 protein_id gnl|my_center|LOCUS_61540 >Feature sequence0936 >Feature sequence0937 2325 343 gene locus_tag LOCUS_61550 2325 343 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887791.1 protein_id gnl|my_center|LOCUS_61550 >Feature sequence0938 516 1736 gene locus_tag LOCUS_61560 gene mtnK 516 1736 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033250.1 protein_id gnl|my_center|LOCUS_61560 1737 2828 gene locus_tag LOCUS_61570 gene mtnA 1737 2828 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392493.1 protein_id gnl|my_center|LOCUS_61570 >Feature sequence0939 396 1070 gene locus_tag LOCUS_61580 396 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61580 1143 1601 gene locus_tag LOCUS_61590 1143 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61590 1737 3308 gene locus_tag LOCUS_61600 1737 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61600 >Feature sequence0940 1693 71 gene locus_tag LOCUS_61610 1693 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61610 3093 1708 gene locus_tag LOCUS_61620 3093 1708 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860945.1 protein_id gnl|my_center|LOCUS_61620 >Feature sequence0941 377 2233 gene locus_tag LOCUS_61630 gene dnaK 377 2233 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_61630 2254 3405 gene locus_tag LOCUS_61640 gene dnaJ 2254 3405 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048002.1 protein_id gnl|my_center|LOCUS_61640 >Feature sequence0942 771 442 gene locus_tag LOCUS_61650 771 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61650 3693 778 gene locus_tag LOCUS_61660 3693 778 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106612643.1 protein_id gnl|my_center|LOCUS_61660 >Feature sequence0943 610 335 gene locus_tag LOCUS_61670 610 335 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_61670 842 1651 gene locus_tag LOCUS_61680 842 1651 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774239.1 protein_id gnl|my_center|LOCUS_61680 1927 1715 gene locus_tag LOCUS_61690 1927 1715 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381076.1 protein_id gnl|my_center|LOCUS_61690 2620 1988 gene locus_tag LOCUS_61700 2620 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61700 <3730 2607 gene locus_tag LOCUS_61710 <3730 2607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015770.1:AAA family ATPase >Feature sequence0944 <1 1125 gene locus_tag LOCUS_61720 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003359423.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE 1156 3039 gene locus_tag LOCUS_61730 gene mnmG 1156 3039 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_61730 >Feature sequence0945 659 111 gene locus_tag LOCUS_61740 659 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61740 1814 660 gene locus_tag LOCUS_61750 1814 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61750 2581 2117 gene locus_tag LOCUS_61760 2581 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61760 >Feature sequence0946 1972 524 gene locus_tag LOCUS_61770 gene proS 1972 524 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895182.1 protein_id gnl|my_center|LOCUS_61770 <3722 2053 gene locus_tag LOCUS_61780 <3722 2053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_092281764.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence0947 <1 1778 gene locus_tag LOCUS_61790 <1 1778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966001.1:ABC-F family ATP-binding cassette domain-containing protein 1780 1992 gene locus_tag LOCUS_61800 1780 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61800 2146 2739 gene locus_tag LOCUS_61810 2146 2739 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775601.1 protein_id gnl|my_center|LOCUS_61810 2732 3565 gene locus_tag LOCUS_61820 2732 3565 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030302.1 protein_id gnl|my_center|LOCUS_61820 >Feature sequence0948 <1 1344 gene locus_tag LOCUS_61830 <1 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861371.1:relaxase/mobilization nuclease domain-containing protein 1936 1418 gene locus_tag LOCUS_61840 1936 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61840 3079 2099 gene locus_tag LOCUS_61850 3079 2099 CDS product single-strand DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861368.1 protein_id gnl|my_center|LOCUS_61850 >Feature sequence0949 <1 813 gene locus_tag LOCUS_61860 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681327.1:PEP/pyruvate-binding domain-containing protein 815 2146 gene locus_tag LOCUS_61870 815 2146 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681330.1 protein_id gnl|my_center|LOCUS_61870 2252 2926 gene locus_tag LOCUS_61880 2252 2926 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238594.1 protein_id gnl|my_center|LOCUS_61880 >Feature sequence0950 2940 898 gene locus_tag LOCUS_61890 2940 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61890 >Feature sequence0951 677 6 gene locus_tag LOCUS_61900 677 6 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154147.1 protein_id gnl|my_center|LOCUS_61900 1317 658 gene locus_tag LOCUS_61910 1317 658 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384085.1 protein_id gnl|my_center|LOCUS_61910 2374 1541 gene locus_tag LOCUS_61920 2374 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61920 3010 2492 gene locus_tag LOCUS_61930 3010 2492 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454674.1 protein_id gnl|my_center|LOCUS_61930 3494 3051 gene locus_tag LOCUS_61940 gene ohrR 3494 3051 CDS product organic hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245653.1 protein_id gnl|my_center|LOCUS_61940 >Feature sequence0952 396 1508 gene locus_tag LOCUS_61950 396 1508 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426064.1 protein_id gnl|my_center|LOCUS_61950 1589 2101 gene locus_tag LOCUS_61960 gene tpx 1589 2101 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024529.1 protein_id gnl|my_center|LOCUS_61960 2912 2337 gene locus_tag LOCUS_61970 2912 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61970 >Feature sequence0953 <1 998 gene locus_tag LOCUS_61980 <1 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047859.1:DNA-processing protein DprA 1014 3098 gene locus_tag LOCUS_61990 gene topA 1014 3098 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047858.1 protein_id gnl|my_center|LOCUS_61990 3461 3607 gene locus_tag LOCUS_62000 3461 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62000 >Feature sequence0954 1647 1997 gene locus_tag LOCUS_62010 1647 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62010 3343 2093 gene locus_tag LOCUS_62020 3343 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62020 >Feature sequence0955 <1 584 gene locus_tag LOCUS_62030 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986412.1:NADH-quinone oxidoreductase subunit NuoF 594 2330 gene locus_tag LOCUS_62040 594 2330 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986411.1 protein_id gnl|my_center|LOCUS_62040 >Feature sequence0956 >Feature sequence0957 398 2401 gene locus_tag LOCUS_62050 398 2401 CDS product GGDEF and EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963950.1 protein_id gnl|my_center|LOCUS_62050 2820 2455 gene locus_tag LOCUS_62060 gene rplL 2820 2455 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421186.1 protein_id gnl|my_center|LOCUS_62060 3395 2883 gene locus_tag LOCUS_62070 gene rplJ 3395 2883 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_62070 >Feature sequence0958 <1 1025 gene locus_tag LOCUS_62080 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003358530.1:TrkH family potassium uptake protein 1180 2274 gene locus_tag LOCUS_62090 gene vioA 1180 2274 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998544.1 protein_id gnl|my_center|LOCUS_62090 3317 2952 gene locus_tag LOCUS_62100 3317 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62100 >Feature sequence0959 692 2509 gene locus_tag LOCUS_62110 692 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62110 3693 2548 gene locus_tag LOCUS_62120 3693 2548 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_62120 >Feature sequence0960 <1 580 gene locus_tag LOCUS_62130 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902660.1:sodium ion-translocating decarboxylase subunit beta 871 1821 gene locus_tag LOCUS_62140 gene gctA 871 1821 CDS product glutaconate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902658.1 protein_id gnl|my_center|LOCUS_62140 1835 2632 gene locus_tag LOCUS_62150 gene gctB 1835 2632 CDS product glutaconate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902656.1 protein_id gnl|my_center|LOCUS_62150 >Feature sequence0961 403 549 gene locus_tag LOCUS_62160 403 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62160 3170 546 gene locus_tag LOCUS_62170 3170 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62170 3546 3172 gene locus_tag LOCUS_62180 3546 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62180 >Feature sequence0962 696 1808 gene locus_tag LOCUS_62190 gene ugpC 696 1808 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_62190 1959 2813 gene locus_tag LOCUS_62200 1959 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62200 2806 3294 gene locus_tag LOCUS_62210 2806 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62210 >Feature sequence0963 1111 107 gene locus_tag LOCUS_62220 gene aroF 1111 107 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358658.1 protein_id gnl|my_center|LOCUS_62220 1253 1128 gene locus_tag LOCUS_62230 1253 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62230 1347 1225 gene locus_tag LOCUS_62240 1347 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62240 2714 1344 gene locus_tag LOCUS_62250 2714 1344 CDS product salicylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143153455.1 protein_id gnl|my_center|LOCUS_62250 3295 2933 gene locus_tag LOCUS_62260 3295 2933 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964778.1 protein_id gnl|my_center|LOCUS_62260 3423 3298 gene locus_tag LOCUS_62270 3423 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62270 >Feature sequence0964 <1 1410 gene locus_tag LOCUS_62280 <1 1410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393521.1:xylulokinase 1421 1876 gene locus_tag LOCUS_62290 gene bcp 1421 1876 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_62290 1873 2616 gene locus_tag LOCUS_62300 gene yaaA 1873 2616 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476537.1 protein_id gnl|my_center|LOCUS_62300 2627 3175 gene locus_tag LOCUS_62310 2627 3175 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918000.1 protein_id gnl|my_center|LOCUS_62310 3249 3383 gene locus_tag LOCUS_62320 3249 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62320 >Feature sequence0965 738 1631 gene locus_tag LOCUS_62330 738 1631 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803743.1 protein_id gnl|my_center|LOCUS_62330 1793 2542 gene locus_tag LOCUS_62340 1793 2542 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525205.1 protein_id gnl|my_center|LOCUS_62340 >Feature sequence0966 1291 1956 gene locus_tag LOCUS_62350 gene sdaAB 1291 1956 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356598.1 protein_id gnl|my_center|LOCUS_62350 2039 2920 gene locus_tag LOCUS_62360 gene sdaAA 2039 2920 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356262.1 protein_id gnl|my_center|LOCUS_62360 2996 3202 gene locus_tag LOCUS_62370 2996 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62370 >Feature sequence0967 >Feature sequence0968 563 147 gene locus_tag LOCUS_62380 563 147 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_62380 1479 607 gene locus_tag LOCUS_62390 1479 607 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964831.1 protein_id gnl|my_center|LOCUS_62390 2197 1760 gene locus_tag LOCUS_62400 2197 1760 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993892.1 protein_id gnl|my_center|LOCUS_62400 3405 2287 gene locus_tag LOCUS_62410 3405 2287 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_62410 >Feature sequence0969 182 646 gene locus_tag LOCUS_62420 182 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62420 1890 688 gene locus_tag LOCUS_62430 1890 688 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_62430 2885 1899 gene locus_tag LOCUS_62440 2885 1899 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566022.1 protein_id gnl|my_center|LOCUS_62440 3349 2882 gene locus_tag LOCUS_62450 3349 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62450 >Feature sequence0970 2831 1692 gene locus_tag LOCUS_62460 2831 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62460 >Feature sequence0971 570 7 gene locus_tag LOCUS_62470 570 7 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002910979.1 protein_id gnl|my_center|LOCUS_62470 772 2643 gene locus_tag LOCUS_62480 772 2643 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_62480 3531 3016 gene locus_tag LOCUS_62490 3531 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62490 >Feature sequence0972 1777 938 gene locus_tag LOCUS_62500 1777 938 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_62500 2499 1834 gene locus_tag LOCUS_62510 2499 1834 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_62510 <3658 2571 gene locus_tag LOCUS_62520 <3658 2571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002439680.1:oligoendopeptidase F >Feature sequence0973 533 141 gene locus_tag LOCUS_62530 533 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62530 1019 543 gene locus_tag LOCUS_62540 1019 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62540 1511 1032 gene locus_tag LOCUS_62550 1511 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62550 3623 1521 gene locus_tag LOCUS_62560 3623 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62560 >Feature sequence0974 1719 706 gene locus_tag LOCUS_62570 1719 706 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262593.1 protein_id gnl|my_center|LOCUS_62570 3292 1712 gene locus_tag LOCUS_62580 3292 1712 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146974.1 protein_id gnl|my_center|LOCUS_62580 >Feature sequence0975 2622 1339 gene locus_tag LOCUS_62590 2622 1339 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836619.1 protein_id gnl|my_center|LOCUS_62590 3245 2640 gene locus_tag LOCUS_62600 3245 2640 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836620.1 protein_id gnl|my_center|LOCUS_62600 3545 3372 gene locus_tag LOCUS_62610 3545 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62610 >Feature sequence0976 899 99 gene locus_tag LOCUS_62620 899 99 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027122.1 protein_id gnl|my_center|LOCUS_62620 1745 909 gene locus_tag LOCUS_62630 1745 909 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_62630 2083 1751 gene locus_tag LOCUS_62640 2083 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62640 3225 2086 gene locus_tag LOCUS_62650 3225 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62650 3641 3423 gene locus_tag LOCUS_62660 3641 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62660 >Feature sequence0977 <1 581 gene locus_tag LOCUS_62670 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012099547.1:YjjI family glycine radical enzyme 581 1423 gene locus_tag LOCUS_62680 581 1423 CDS product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099548.1 protein_id gnl|my_center|LOCUS_62680 1465 2982 gene locus_tag LOCUS_62690 1465 2982 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289202.1 protein_id gnl|my_center|LOCUS_62690 >Feature sequence0978 1499 210 gene locus_tag LOCUS_62700 gene dsdA 1499 210 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658347.1 protein_id gnl|my_center|LOCUS_62700 3443 1656 gene locus_tag LOCUS_62710 3443 1656 CDS product aminopeptidase P family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986733.1 protein_id gnl|my_center|LOCUS_62710 >Feature sequence0979 84 1271 gene locus_tag LOCUS_62720 84 1271 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459580.1 protein_id gnl|my_center|LOCUS_62720 1479 3149 gene locus_tag LOCUS_62730 1479 3149 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_62730 >Feature sequence0980 2401 1700 gene locus_tag LOCUS_62740 2401 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62740 3030 2401 gene locus_tag LOCUS_62750 gene nth 3030 2401 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895383.1 protein_id gnl|my_center|LOCUS_62750 3521 3027 gene locus_tag LOCUS_62760 3521 3027 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_62760 >Feature sequence0981 1535 318 gene locus_tag LOCUS_62770 1535 318 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903248.1 protein_id gnl|my_center|LOCUS_62770 3541 1601 gene locus_tag LOCUS_62780 3541 1601 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903247.1 protein_id gnl|my_center|LOCUS_62780 >Feature sequence0982 232 1476 gene locus_tag LOCUS_62790 232 1476 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188697727.1 protein_id gnl|my_center|LOCUS_62790 1473 2447 gene locus_tag LOCUS_62800 1473 2447 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173518221.1 protein_id gnl|my_center|LOCUS_62800 2435 3475 gene locus_tag LOCUS_62810 2435 3475 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003321939.1 protein_id gnl|my_center|LOCUS_62810 >Feature sequence0983 1540 245 gene locus_tag LOCUS_62820 1540 245 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898268.1 protein_id gnl|my_center|LOCUS_62820 2073 1537 gene locus_tag LOCUS_62830 2073 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62830 3189 2131 gene locus_tag LOCUS_62840 3189 2131 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566022.1 protein_id gnl|my_center|LOCUS_62840 >Feature sequence0984 1145 132 gene locus_tag LOCUS_62850 1145 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62850 1349 1158 gene locus_tag LOCUS_62860 1349 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62860 1443 1285 gene locus_tag LOCUS_62870 1443 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62870 2234 1788 gene locus_tag LOCUS_62880 2234 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62880 2714 2265 gene locus_tag LOCUS_62890 2714 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62890 3354 2698 gene locus_tag LOCUS_62900 3354 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62900 >Feature sequence0985 44 976 gene locus_tag LOCUS_62910 gene cysK 44 976 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_62910 1152 2843 gene locus_tag LOCUS_62920 1152 2843 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_62920 >Feature sequence0986 3142 125 gene locus_tag LOCUS_62930 3142 125 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228826.1 protein_id gnl|my_center|LOCUS_62930 >Feature sequence0987 152 1171 gene locus_tag LOCUS_62940 152 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62940 1674 2906 gene locus_tag LOCUS_62950 1674 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62950 >Feature sequence0988 >Feature sequence0989 2201 1335 gene locus_tag LOCUS_62960 gene glyQ 2201 1335 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416656.1 protein_id gnl|my_center|LOCUS_62960 3063 2284 gene locus_tag LOCUS_62970 3063 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62970 >Feature sequence0990 <1 784 gene locus_tag LOCUS_62980 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775385.1:iron chelate uptake ABC transporter family permease subunit 781 2550 gene locus_tag LOCUS_62990 781 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62990 2574 3383 gene locus_tag LOCUS_63000 2574 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63000 >Feature sequence0991 477 1259 gene locus_tag LOCUS_63010 477 1259 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130487.1 protein_id gnl|my_center|LOCUS_63010 1369 2652 gene locus_tag LOCUS_63020 1369 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63020 >Feature sequence0992 2766 946 gene locus_tag LOCUS_63030 gene typA 2766 946 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_63030 3431 2874 gene locus_tag LOCUS_63040 3431 2874 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987052.1 protein_id gnl|my_center|LOCUS_63040 >Feature sequence0993 370 1491 gene locus_tag LOCUS_63050 370 1491 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068741.1 protein_id gnl|my_center|LOCUS_63050 2352 1822 gene locus_tag LOCUS_63060 2352 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63060 3044 2568 gene locus_tag LOCUS_63070 3044 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63070 3476 3108 gene locus_tag LOCUS_63080 3476 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63080 >Feature sequence0994 <1 1325 gene locus_tag LOCUS_63090 <1 1325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002387142.1:putative selenate reductase subunit YgfK 1405 2796 gene locus_tag LOCUS_63100 gene hydA 1405 2796 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891590.1 protein_id gnl|my_center|LOCUS_63100 >Feature sequence0995 5 379 gene locus_tag LOCUS_63110 5 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63110 3051 442 gene locus_tag LOCUS_63120 3051 442 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860848.1 protein_id gnl|my_center|LOCUS_63120 >Feature sequence0996 85 843 gene locus_tag LOCUS_63130 85 843 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067850802.1 protein_id gnl|my_center|LOCUS_63130 864 1355 gene locus_tag LOCUS_63140 864 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63140 1521 2627 gene locus_tag LOCUS_63150 1521 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63150 >Feature sequence0997 420 103 gene locus_tag LOCUS_63160 gene rpsJ 420 103 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_63160 1595 762 gene locus_tag LOCUS_63170 1595 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63170 2391 1630 gene locus_tag LOCUS_63180 2391 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63180 2996 2406 gene locus_tag LOCUS_63190 gene lepB 2996 2406 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583882.1 protein_id gnl|my_center|LOCUS_63190 <3596 2996 gene locus_tag LOCUS_63200 <3596 2996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434910.1:class I SAM-dependent methyltransferase >Feature sequence0998 <1 820 gene locus_tag LOCUS_63210 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965154.1:NAD(P)/FAD-dependent oxidoreductase 813 1490 gene locus_tag LOCUS_63220 gene cmk 813 1490 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 protein_id gnl|my_center|LOCUS_63220 1477 2331 gene locus_tag LOCUS_63230 1477 2331 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439450.1 protein_id gnl|my_center|LOCUS_63230 2312 3448 gene locus_tag LOCUS_63240 gene rpsA 2312 3448 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986222.1 protein_id gnl|my_center|LOCUS_63240 3513 3587 gene locus_tag LOCUS_t00400 3513 3587 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0999 <1 737 gene locus_tag LOCUS_63250 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272522.1:flavocytochrome c 932 1324 gene locus_tag LOCUS_63260 932 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63260 1428 2372 gene locus_tag LOCUS_63270 gene msrB 1428 2372 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901472.1 protein_id gnl|my_center|LOCUS_63270 >Feature sequence1000 248 93 gene locus_tag LOCUS_63280 248 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63280 1512 349 gene locus_tag LOCUS_63290 1512 349 CDS product DUF4236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506893.1 protein_id gnl|my_center|LOCUS_63290 2271 1594 gene locus_tag LOCUS_63300 2271 1594 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294560.1 protein_id gnl|my_center|LOCUS_63300 <3584 2281 gene locus_tag LOCUS_63310 <3584 2281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929927.1:alpha-L-fucosidase >Feature sequence1001 <1 2770 gene locus_tag LOCUS_63320 <1 2770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113036.1:GLUG motif-containing protein 2897 3547 gene locus_tag LOCUS_63330 2897 3547 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170003.1 protein_id gnl|my_center|LOCUS_63330 >Feature sequence1002 2704 1913 gene locus_tag LOCUS_63340 2704 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63340 3540 2740 gene locus_tag LOCUS_63350 gene codY 3540 2740 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220850.1 protein_id gnl|my_center|LOCUS_63350 >Feature sequence1003 1559 213 gene locus_tag LOCUS_63360 1559 213 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113788.1 protein_id gnl|my_center|LOCUS_63360 3046 1733 gene locus_tag LOCUS_63370 3046 1733 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399406.1 protein_id gnl|my_center|LOCUS_63370 >Feature sequence1004 788 201 gene locus_tag LOCUS_63380 gene yihA 788 201 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905788.1 protein_id gnl|my_center|LOCUS_63380 3139 806 gene locus_tag LOCUS_63390 gene lon 3139 806 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460911.1 protein_id gnl|my_center|LOCUS_63390 >Feature sequence1005 1861 134 gene locus_tag LOCUS_63400 1861 134 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_63400 3033 1984 gene locus_tag LOCUS_63410 3033 1984 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528455.1 protein_id gnl|my_center|LOCUS_63410 >Feature sequence1006 1399 932 gene locus_tag LOCUS_63420 1399 932 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460509.1 protein_id gnl|my_center|LOCUS_63420 2007 1519 gene locus_tag LOCUS_63430 gene coaD 2007 1519 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388467.1 protein_id gnl|my_center|LOCUS_63430 2599 2051 gene locus_tag LOCUS_63440 gene rsmD 2599 2051 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_63440 <3565 2787 gene locus_tag LOCUS_63450 <3565 2787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002667252.1:aminopeptidase >Feature sequence1007 1570 503 gene locus_tag LOCUS_63460 1570 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63460 3072 1570 gene locus_tag LOCUS_63470 3072 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63470 >Feature sequence1008 3201 2014 gene locus_tag LOCUS_63480 3201 2014 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948693.1 protein_id gnl|my_center|LOCUS_63480 >Feature sequence1009 <1 911 gene locus_tag LOCUS_63490 <1 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015262274.1:IS21 family transposase 918 1694 gene locus_tag LOCUS_63500 gene istB 918 1694 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_63500 1968 2087 gene locus_tag LOCUS_63510 1968 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63510 2946 2455 gene locus_tag LOCUS_63520 2946 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63520 >Feature sequence1010 48 2351 gene locus_tag LOCUS_63530 48 2351 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109016.1 protein_id gnl|my_center|LOCUS_63530 >Feature sequence1011 854 159 gene locus_tag LOCUS_63540 gene rplA 854 159 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_63540 1367 942 gene locus_tag LOCUS_63550 gene rplK 1367 942 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_63550 1911 1381 gene locus_tag LOCUS_63560 gene nusG 1911 1381 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966426.1 protein_id gnl|my_center|LOCUS_63560 2141 1932 gene locus_tag LOCUS_63570 2141 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63570 2316 2167 gene locus_tag LOCUS_63580 gene rpmG 2316 2167 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_63580 3306 2425 gene locus_tag LOCUS_63590 3306 2425 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_63590 >Feature sequence1012 <1 507 gene locus_tag LOCUS_63600 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814549.1:N-acetylmuramoyl-L-alanine amidase 678 1610 gene locus_tag LOCUS_63610 678 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63610 >Feature sequence1013 3523 2588 gene locus_tag LOCUS_63620 gene trxB 3523 2588 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948886.1 protein_id gnl|my_center|LOCUS_63620 >Feature sequence1014 2036 1698 gene locus_tag LOCUS_63630 2036 1698 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047981.1 protein_id gnl|my_center|LOCUS_63630 2986 2474 gene locus_tag LOCUS_63640 2986 2474 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409241.1 protein_id gnl|my_center|LOCUS_63640 >Feature sequence1015 2607 1060 gene locus_tag LOCUS_63650 2607 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63650 2918 2727 gene locus_tag LOCUS_63660 2918 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63660 >Feature sequence1016 88 342 gene locus_tag LOCUS_63670 88 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63670 399 587 gene locus_tag LOCUS_63680 399 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63680 556 807 gene locus_tag LOCUS_63690 556 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63690 992 753 gene locus_tag LOCUS_63700 992 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63700 1108 1404 gene locus_tag LOCUS_63710 1108 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63710 1424 1981 gene locus_tag LOCUS_63720 1424 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63720 1983 2255 gene locus_tag LOCUS_63730 1983 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63730 2260 2523 gene locus_tag LOCUS_63740 2260 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63740 2546 2749 gene locus_tag LOCUS_63750 2546 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63750 2746 3129 gene locus_tag LOCUS_63760 2746 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63760 3105 3392 gene locus_tag LOCUS_63770 3105 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63770 >Feature sequence1017 532 885 gene locus_tag LOCUS_63780 532 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63780 1142 2029 gene locus_tag LOCUS_63790 1142 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63790 >Feature sequence1018 606 88 gene locus_tag LOCUS_63800 606 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63800 2461 638 gene locus_tag LOCUS_63810 2461 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63810 >Feature sequence1019 639 199 gene locus_tag LOCUS_63820 639 199 CDS product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047635.1 protein_id gnl|my_center|LOCUS_63820 1375 851 gene locus_tag LOCUS_63830 1375 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63830 1857 1375 gene locus_tag LOCUS_63840 1857 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63840 2602 1835 gene locus_tag LOCUS_63850 2602 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63850 3229 2606 gene locus_tag LOCUS_63860 3229 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63860 3496 3236 gene locus_tag LOCUS_63870 3496 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63870 >Feature sequence1020 <1 623 gene locus_tag LOCUS_63880 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027699.1:SWIM zinc finger domain-containing protein >Feature sequence1021 3346 8 gene locus_tag LOCUS_63890 gene mfd 3346 8 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425912.1 protein_id gnl|my_center|LOCUS_63890 3537 3355 gene locus_tag LOCUS_63900 3537 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63900 >Feature sequence1022 1205 2152 gene locus_tag LOCUS_63910 1205 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63910 2149 3210 gene locus_tag LOCUS_63920 2149 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63920 >Feature sequence1023 <1 689 gene locus_tag LOCUS_63930 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016778.1:precorrin-3B C(17)-methyltransferase 682 1440 gene locus_tag LOCUS_63940 gene cobK 682 1440 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915112.1 protein_id gnl|my_center|LOCUS_63940 1449 2693 gene locus_tag LOCUS_63950 1449 2693 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943626.1 protein_id gnl|my_center|LOCUS_63950 2710 3381 gene locus_tag LOCUS_63960 2710 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63960 >Feature sequence1024 1215 709 gene locus_tag LOCUS_63970 1215 709 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641270.1 protein_id gnl|my_center|LOCUS_63970 1610 1215 gene locus_tag LOCUS_63980 1610 1215 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_63980 1911 2348 gene locus_tag LOCUS_63990 gene rpiB 1911 2348 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_63990 <3530 2457 gene locus_tag LOCUS_64000 <3530 2457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_111696045.1:Na+/H+ antiporter NhaC >Feature sequence1025 187 318 gene locus_tag LOCUS_64010 187 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64010 572 3136 gene locus_tag LOCUS_64020 gene mgtA 572 3136 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402038.1 protein_id gnl|my_center|LOCUS_64020 >Feature sequence1026 >Feature sequence1027 808 2256 gene locus_tag LOCUS_64030 808 2256 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015882.1 protein_id gnl|my_center|LOCUS_64030 2269 3429 gene locus_tag LOCUS_64040 2269 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64040 >Feature sequence1028 2172 1753 gene locus_tag LOCUS_64050 2172 1753 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276952.1 protein_id gnl|my_center|LOCUS_64050 2628 2810 gene locus_tag LOCUS_64060 2628 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64060 2830 3291 gene locus_tag LOCUS_64070 2830 3291 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081017.1 protein_id gnl|my_center|LOCUS_64070 >Feature sequence1029 766 338 gene locus_tag LOCUS_64080 766 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64080 1707 997 gene locus_tag LOCUS_64090 gene yycF 1707 997 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658889.1 protein_id gnl|my_center|LOCUS_64090 <3522 1840 gene locus_tag LOCUS_64100 <3522 1840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545591.1:1,4-alpha-glucan branching protein GlgB >Feature sequence1030 2620 2111 gene locus_tag LOCUS_64110 2620 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64110 3451 2621 gene locus_tag LOCUS_64120 gene mreC 3451 2621 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945174.1 protein_id gnl|my_center|LOCUS_64120 >Feature sequence1031 47 454 gene locus_tag LOCUS_64130 47 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64130 463 1497 gene locus_tag LOCUS_64140 gene sufD 463 1497 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 protein_id gnl|my_center|LOCUS_64140 1512 2756 gene locus_tag LOCUS_64150 1512 2756 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_64150 2743 3195 gene locus_tag LOCUS_64160 2743 3195 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_64160 >Feature sequence1032 <1 575 gene locus_tag LOCUS_64170 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949041.1:RluA family pseudouridine synthase 740 1366 gene locus_tag LOCUS_64180 740 1366 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_64180 1363 2457 gene locus_tag LOCUS_64190 1363 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64190 >Feature sequence1033 480 133 gene locus_tag LOCUS_64200 gene rsfS 480 133 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416416.1 protein_id gnl|my_center|LOCUS_64200 1913 612 gene locus_tag LOCUS_64210 1913 612 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048020.1 protein_id gnl|my_center|LOCUS_64210 3096 1927 gene locus_tag LOCUS_64220 3096 1927 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679466.1 protein_id gnl|my_center|LOCUS_64220 >Feature sequence1034 1624 197 gene locus_tag LOCUS_64230 1624 197 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048336.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_64230 1850 1617 gene locus_tag LOCUS_64240 1850 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_64240 3075 1861 gene locus_tag LOCUS_64250 3075 1861 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966853.1 protein_id gnl|my_center|LOCUS_64250 >Feature sequence1035 29 1504 gene locus_tag LOCUS_64260 29 1504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_64260 1555 1908 gene locus_tag LOCUS_64270 1555 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64270 >Feature sequence1036 1043 534 gene locus_tag LOCUS_64280 1043 534 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434936.1 protein_id gnl|my_center|LOCUS_64280 2931 1291 gene locus_tag LOCUS_64290 2931 1291 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454872.1 protein_id gnl|my_center|LOCUS_64290 3304 2948 gene locus_tag LOCUS_64300 3304 2948 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395974.1 protein_id gnl|my_center|LOCUS_64300 >Feature sequence1037 <1 921 gene locus_tag LOCUS_64310 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965410.1:NFACT RNA binding domain-containing protein 1964 969 gene locus_tag LOCUS_64320 1964 969 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_64320 2599 1961 gene locus_tag LOCUS_64330 gene plsY 2599 1961 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_64330 3501 2599 gene locus_tag LOCUS_64340 3501 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64340 >Feature sequence1038 350 1648 gene locus_tag LOCUS_64350 350 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64350 2134 2757 gene locus_tag LOCUS_64360 2134 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64360 >Feature sequence1039 1170 2549 gene locus_tag LOCUS_64370 1170 2549 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956705.1 protein_id gnl|my_center|LOCUS_64370 >Feature sequence1040 1261 56 gene locus_tag LOCUS_64380 1261 56 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864195.1 protein_id gnl|my_center|LOCUS_64380 2123 1263 gene locus_tag LOCUS_64390 gene argB 2123 1263 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864194.1 protein_id gnl|my_center|LOCUS_64390 3475 2249 gene locus_tag LOCUS_64400 gene argJ 3475 2249 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965687.1 protein_id gnl|my_center|LOCUS_64400 >Feature sequence1041 2331 1426 gene locus_tag LOCUS_64410 2331 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64410 2923 2372 gene locus_tag LOCUS_64420 2923 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64420 <3508 2927 gene locus_tag LOCUS_64430 <3508 2927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860791.1:DNA topoisomerase 3 >Feature sequence1042 <1 2685 gene locus_tag LOCUS_64440 <1 2685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193484061.1:2-hydroxyacyl-CoA dehydratase 2790 2972 gene locus_tag LOCUS_64450 2790 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64450 3452 3018 gene locus_tag LOCUS_64460 3452 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64460 >Feature sequence1043 592 864 gene locus_tag LOCUS_64470 592 864 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_64470 932 1141 gene locus_tag LOCUS_64480 932 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64480 >Feature sequence1044 716 51 gene locus_tag LOCUS_64490 716 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64490 1847 855 gene locus_tag LOCUS_64500 1847 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_64500 2502 1882 gene locus_tag LOCUS_64510 2502 1882 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895475.1 protein_id gnl|my_center|LOCUS_64510 3290 2466 gene locus_tag LOCUS_64520 3290 2466 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_64520 >Feature sequence1045 701 2602 gene locus_tag LOCUS_64530 701 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64530 >Feature sequence1046 1667 21 gene locus_tag LOCUS_64540 1667 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64540 2373 1681 gene locus_tag LOCUS_64550 2373 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64550 3476 2373 gene locus_tag LOCUS_64560 3476 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64560 >Feature sequence1047 2010 262 gene locus_tag LOCUS_64570 2010 262 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986745.1 protein_id gnl|my_center|LOCUS_64570 <3498 2003 gene locus_tag LOCUS_64580 <3498 2003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462213.1:ABC transporter ATP-binding protein >Feature sequence1048 1720 167 gene locus_tag LOCUS_64590 1720 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64590 3009 1768 gene locus_tag LOCUS_64600 3009 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64600 3452 3048 gene locus_tag LOCUS_64610 3452 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64610 >Feature sequence1049 1270 626 gene locus_tag LOCUS_64620 gene deoC 1270 626 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439345.1 protein_id gnl|my_center|LOCUS_64620 2059 1370 gene locus_tag LOCUS_64630 gene radC 2059 1370 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816793.1 protein_id gnl|my_center|LOCUS_64630 2661 2071 gene locus_tag LOCUS_64640 2661 2071 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226290.1 protein_id gnl|my_center|LOCUS_64640 <3496 2714 gene locus_tag LOCUS_64650 <3496 2714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003433836.1:radical SAM protein >Feature sequence1050 955 524 gene locus_tag LOCUS_64660 955 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64660 1271 957 gene locus_tag LOCUS_64670 1271 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64670 2403 1594 gene locus_tag LOCUS_64680 2403 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64680 <3495 2657 gene locus_tag LOCUS_64690 <3495 2657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002904591.1:zinc-binding alcohol dehydrogenase family protein >Feature sequence1051 1216 518 gene locus_tag LOCUS_64700 1216 518 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672626.1 protein_id gnl|my_center|LOCUS_64700 2451 1231 gene locus_tag LOCUS_64710 2451 1231 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681571.1 protein_id gnl|my_center|LOCUS_64710 >Feature sequence1052 <1 975 gene locus_tag LOCUS_64720 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262240.1:AI-2E family transporter 1122 2381 gene locus_tag LOCUS_64730 1122 2381 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641660.1 protein_id gnl|my_center|LOCUS_64730 2393 3340 gene locus_tag LOCUS_64740 2393 3340 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_64740 >Feature sequence1053 95 280 gene locus_tag LOCUS_64750 95 280 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_64750 303 704 gene locus_tag LOCUS_64760 gene rpsH 303 704 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 protein_id gnl|my_center|LOCUS_64760 761 1303 gene locus_tag LOCUS_64770 gene rplF 761 1303 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_64770 1322 1690 gene locus_tag LOCUS_64780 gene rplR 1322 1690 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_64780 1708 2214 gene locus_tag LOCUS_64790 gene rpsE 1708 2214 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 protein_id gnl|my_center|LOCUS_64790 2261 2443 gene locus_tag LOCUS_64800 gene rpmD 2261 2443 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002432330.1 protein_id gnl|my_center|LOCUS_64800 2463 2903 gene locus_tag LOCUS_64810 gene rplO 2463 2903 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966393.1 protein_id gnl|my_center|LOCUS_64810 >Feature sequence1054 1910 963 gene locus_tag LOCUS_64820 1910 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64820 3324 1897 gene locus_tag LOCUS_64830 3324 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64830 >Feature sequence1055 290 484 gene locus_tag LOCUS_64840 290 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64840 558 806 gene locus_tag LOCUS_64850 558 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64850 818 3004 gene locus_tag LOCUS_64860 818 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64860 >Feature sequence1056 2514 436 gene locus_tag LOCUS_64870 2514 436 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808998.1 protein_id gnl|my_center|LOCUS_64870 2737 2519 gene locus_tag LOCUS_64880 2737 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64880 >Feature sequence1057 1459 692 gene locus_tag LOCUS_64890 1459 692 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861999.1 protein_id gnl|my_center|LOCUS_64890 2982 1504 gene locus_tag LOCUS_64900 gene gltX 2982 1504 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435581.1 protein_id gnl|my_center|LOCUS_64900 3468 2986 gene locus_tag LOCUS_64910 3468 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64910 >Feature sequence1058 1476 604 gene locus_tag LOCUS_64920 gene cdaA 1476 604 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_64920 2438 1473 gene locus_tag LOCUS_64930 2438 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64930 2847 2440 gene locus_tag LOCUS_64940 2847 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64940 >Feature sequence1059 1026 277 gene locus_tag LOCUS_64950 gene tpiA 1026 277 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_64950 2263 1049 gene locus_tag LOCUS_64960 2263 1049 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_64960 3454 2423 gene locus_tag LOCUS_64970 gene gap 3454 2423 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_64970 >Feature sequence1060 1186 950 gene locus_tag LOCUS_64980 gene acpP 1186 950 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_64980 2183 1242 gene locus_tag LOCUS_64990 2183 1242 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_64990 3229 2303 gene locus_tag LOCUS_65000 3229 2303 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836550.1 protein_id gnl|my_center|LOCUS_65000 >Feature sequence1061 1318 2676 gene locus_tag LOCUS_65010 1318 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65010 2681 3454 gene locus_tag LOCUS_65020 gene rfbF 2681 3454 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 protein_id gnl|my_center|LOCUS_65020 >Feature sequence1062 2130 1075 gene locus_tag LOCUS_65030 gene sufD 2130 1075 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 protein_id gnl|my_center|LOCUS_65030 <3466 2130 gene locus_tag LOCUS_65040 <3466 2130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966563.1:Fe-S cluster assembly protein SufB >Feature sequence1063 390 3431 gene locus_tag LOCUS_65050 390 3431 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861545.1 protein_id gnl|my_center|LOCUS_65050 >Feature sequence1064 1541 915 gene locus_tag LOCUS_65060 1541 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65060 <3464 1735 gene locus_tag LOCUS_65070 <3464 1735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948677.1:DNA helicase RecQ >Feature sequence1065 3350 438 gene locus_tag LOCUS_65080 3350 438 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114402.1 protein_id gnl|my_center|LOCUS_65080 3459 3340 gene locus_tag LOCUS_65090 3459 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65090 >Feature sequence1066 430 1365 gene locus_tag LOCUS_65100 430 1365 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287891.1 protein_id gnl|my_center|LOCUS_65100 1368 2330 gene locus_tag LOCUS_65110 gene opp2B 1368 2330 CDS product oligopeptide ABC transporter permease Opp2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354943.1 protein_id gnl|my_center|LOCUS_65110 2341 3279 gene locus_tag LOCUS_65120 2341 3279 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287893.1 protein_id gnl|my_center|LOCUS_65120 >Feature sequence1067 663 1619 gene locus_tag LOCUS_65130 663 1619 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122904.1 protein_id gnl|my_center|LOCUS_65130 <3451 2254 gene locus_tag LOCUS_65140 <3451 2254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584102.1:dihydroxy-acid dehydratase >Feature sequence1068 933 2123 gene locus_tag LOCUS_65150 933 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65150 2224 3192 gene locus_tag LOCUS_65160 2224 3192 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727629.1 protein_id gnl|my_center|LOCUS_65160 >Feature sequence1069 1473 190 gene locus_tag LOCUS_65170 1473 190 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258138.1 protein_id gnl|my_center|LOCUS_65170 >Feature sequence1070 258 689 gene locus_tag LOCUS_65180 258 689 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902921.1 protein_id gnl|my_center|LOCUS_65180 1569 1084 gene locus_tag LOCUS_65190 1569 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65190 3412 1748 gene locus_tag LOCUS_65200 3412 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65200 >Feature sequence1071 748 1053 gene locus_tag LOCUS_65210 748 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65210 1064 1273 gene locus_tag LOCUS_65220 1064 1273 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860795.1 protein_id gnl|my_center|LOCUS_65220 1868 2899 gene locus_tag LOCUS_65230 gene hrcA 1868 2899 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454754.1 protein_id gnl|my_center|LOCUS_65230 >Feature sequence1072 2381 1137 gene locus_tag LOCUS_65240 2381 1137 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_65240 3170 2415 gene locus_tag LOCUS_65250 3170 2415 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242850.1 protein_id gnl|my_center|LOCUS_65250 >Feature sequence1073 633 1982 gene locus_tag LOCUS_65260 633 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65260 >Feature sequence1074 2137 698 gene locus_tag LOCUS_65270 gene araA 2137 698 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082981.1 protein_id gnl|my_center|LOCUS_65270 3298 2456 gene locus_tag LOCUS_65280 3298 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65280 >Feature sequence1075 1255 80 gene locus_tag LOCUS_65290 1255 80 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942937.1 protein_id gnl|my_center|LOCUS_65290 3310 1259 gene locus_tag LOCUS_65300 3310 1259 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942936.1 protein_id gnl|my_center|LOCUS_65300 >Feature sequence1076 916 77 gene locus_tag LOCUS_65310 916 77 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775600.1 protein_id gnl|my_center|LOCUS_65310 1501 917 gene locus_tag LOCUS_65320 1501 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802421.1 protein_id gnl|my_center|LOCUS_65320 3261 1810 gene locus_tag LOCUS_65330 gene rlmD 3261 1810 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021134739.1 protein_id gnl|my_center|LOCUS_65330 >Feature sequence1077 >Feature sequence1078 23 535 gene locus_tag LOCUS_65340 gene purE 23 535 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_65340 567 1592 gene locus_tag LOCUS_65350 gene purM 567 1592 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_65350 1586 2194 gene locus_tag LOCUS_65360 gene purN 1586 2194 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_65360 >Feature sequence1079 <1 818 gene locus_tag LOCUS_65370 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001247465.1:SMC family ATPase 1891 986 gene locus_tag LOCUS_65380 1891 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65380 2609 2139 gene locus_tag LOCUS_65390 2609 2139 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461289.1 protein_id gnl|my_center|LOCUS_65390 3385 2681 gene locus_tag LOCUS_65400 3385 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65400 >Feature sequence1080 87 2075 gene locus_tag LOCUS_65410 87 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65410 >Feature sequence1081 1359 646 gene locus_tag LOCUS_65420 1359 646 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_65420 2552 1377 gene locus_tag LOCUS_65430 2552 1377 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_65430 <3429 2563 gene locus_tag LOCUS_65440 <3429 2563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014519082.1:ATP-binding protein >Feature sequence1082 939 391 gene locus_tag LOCUS_65450 939 391 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_65450 >Feature sequence1083 2195 1440 gene locus_tag LOCUS_65460 2195 1440 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900828.1 protein_id gnl|my_center|LOCUS_65460 2975 2211 gene locus_tag LOCUS_65470 2975 2211 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067850802.1 protein_id gnl|my_center|LOCUS_65470 3416 3147 gene locus_tag LOCUS_65480 3416 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65480 >Feature sequence1084 1357 362 gene locus_tag LOCUS_65490 gene ilvC 1357 362 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_65490 1963 1451 gene locus_tag LOCUS_65500 gene ilvN 1963 1451 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496411.1 protein_id gnl|my_center|LOCUS_65500 <3415 2161 gene locus_tag LOCUS_65510 <3415 2161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436643.1:biosynthetic-type acetolactate synthase large subunit >Feature sequence1085 <1 791 gene locus_tag LOCUS_65520 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003384675.1:phosphatidate cytidylyltransferase 796 1935 gene locus_tag LOCUS_65530 796 1935 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_65530 1932 2963 gene locus_tag LOCUS_65540 gene rseP 1932 2963 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_65540 >Feature sequence1086 3246 1843 gene locus_tag LOCUS_65550 gene selA 3246 1843 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048015.1 protein_id gnl|my_center|LOCUS_65550 3378 3286 gene locus_tag LOCUS_t00410 3378 3286 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1087 <1 1029 gene locus_tag LOCUS_65560 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002363934.1:PTS sugar transporter subunit IIC 1057 2160 gene locus_tag LOCUS_65570 1057 2160 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861793.1 protein_id gnl|my_center|LOCUS_65570 2160 3029 gene locus_tag LOCUS_65580 2160 3029 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439905.1 protein_id gnl|my_center|LOCUS_65580 >Feature sequence1088 171 1454 gene locus_tag LOCUS_65590 171 1454 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837602.1 protein_id gnl|my_center|LOCUS_65590 >Feature sequence1089 19 1134 gene locus_tag LOCUS_65600 19 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65600 1214 1735 gene locus_tag LOCUS_65610 1214 1735 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_65610 1713 2399 gene locus_tag LOCUS_65620 1713 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65620 2510 3397 gene locus_tag LOCUS_65630 gene ispE 2510 3397 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947969.1 protein_id gnl|my_center|LOCUS_65630 >Feature sequence1090 1198 245 gene locus_tag LOCUS_65640 1198 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65640 2423 1137 gene locus_tag LOCUS_65650 2423 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65650 3299 2763 gene locus_tag LOCUS_65660 3299 2763 CDS product DUF3841 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459262.1 protein_id gnl|my_center|LOCUS_65660 >Feature sequence1091 1809 625 gene locus_tag LOCUS_65670 1809 625 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_65670 2925 1822 gene locus_tag LOCUS_65680 2925 1822 CDS product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890534.1 protein_id gnl|my_center|LOCUS_65680 >Feature sequence1092 <1 1285 gene locus_tag LOCUS_65690 <1 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963335.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence1093 2071 2352 gene locus_tag LOCUS_65700 2071 2352 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905402.1 protein_id gnl|my_center|LOCUS_65700 2352 2591 gene locus_tag LOCUS_65710 2352 2591 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_65710 >Feature sequence1094 82 1815 gene locus_tag LOCUS_65720 gene ade 82 1815 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476052.1 protein_id gnl|my_center|LOCUS_65720 1916 3298 gene locus_tag LOCUS_65730 1916 3298 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_65730 >Feature sequence1095 487 2481 gene locus_tag LOCUS_65740 487 2481 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_65740 2481 2927 gene locus_tag LOCUS_65750 gene rplI 2481 2927 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_65750 >Feature sequence1096 1635 850 gene locus_tag LOCUS_65760 1635 850 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947941.1 protein_id gnl|my_center|LOCUS_65760 2339 1668 gene locus_tag LOCUS_65770 2339 1668 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_65770 <3393 2408 gene locus_tag LOCUS_65780 <3393 2408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966273.1:methionine--tRNA ligase >Feature sequence1097 539 1072 gene locus_tag LOCUS_65790 539 1072 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199111.1 protein_id gnl|my_center|LOCUS_65790 1099 1965 gene locus_tag LOCUS_65800 1099 1965 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 protein_id gnl|my_center|LOCUS_65800 2121 2960 gene locus_tag LOCUS_65810 2121 2960 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531924.1 protein_id gnl|my_center|LOCUS_65810 >Feature sequence1098 1201 137 gene locus_tag LOCUS_65820 1201 137 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_65820 3007 2480 gene locus_tag LOCUS_65830 3007 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65830 3144 3338 gene locus_tag LOCUS_65840 3144 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65840 >Feature sequence1099 1416 193 gene locus_tag LOCUS_65850 1416 193 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072584.1 protein_id gnl|my_center|LOCUS_65850 <3387 1409 gene locus_tag LOCUS_65860 <3387 1409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068835.1:type I restriction-modification system subunit M >Feature sequence1100 121 861 gene locus_tag LOCUS_65870 121 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65870 942 2069 gene locus_tag LOCUS_65880 942 2069 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869908.1 protein_id gnl|my_center|LOCUS_65880 3207 2119 gene locus_tag LOCUS_65890 3207 2119 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_65890 >Feature sequence1101 1282 494 gene locus_tag LOCUS_65900 1282 494 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870068.1 protein_id gnl|my_center|LOCUS_65900 1605 1402 gene locus_tag LOCUS_65910 1605 1402 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081092.1 protein_id gnl|my_center|LOCUS_65910 1839 2663 gene locus_tag LOCUS_65920 1839 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65920 3220 2750 gene locus_tag LOCUS_65930 3220 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65930 >Feature sequence1102 185 1045 gene locus_tag LOCUS_65940 185 1045 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_65940 2951 1107 gene locus_tag LOCUS_65950 2951 1107 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_65950 3183 2965 gene locus_tag LOCUS_65960 3183 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_65960 >Feature sequence1103 <1 858 gene locus_tag LOCUS_65970 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775387.1:zinc ABC transporter substrate-binding protein 1032 1742 gene locus_tag LOCUS_65980 1032 1742 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678718.1 protein_id gnl|my_center|LOCUS_65980 1746 2633 gene locus_tag LOCUS_65990 1746 2633 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775385.1 protein_id gnl|my_center|LOCUS_65990 >Feature sequence1104 1559 2209 gene locus_tag LOCUS_66000 1559 2209 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904004.1 protein_id gnl|my_center|LOCUS_66000 2361 3143 gene locus_tag LOCUS_66010 2361 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66010 3127 3273 gene locus_tag LOCUS_66020 3127 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66020 >Feature sequence1105 470 108 gene locus_tag LOCUS_66030 470 108 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417647.1 protein_id gnl|my_center|LOCUS_66030 1438 554 gene locus_tag LOCUS_66040 1438 554 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357090.1 protein_id gnl|my_center|LOCUS_66040 2407 1457 gene locus_tag LOCUS_66050 2407 1457 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427052.1 protein_id gnl|my_center|LOCUS_66050 <3376 2370 gene locus_tag LOCUS_66060 <3376 2370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966459.1:ABC transporter ATP-binding protein >Feature sequence1106 2184 1006 gene locus_tag LOCUS_66070 2184 1006 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948998.1 protein_id gnl|my_center|LOCUS_66070 3336 2197 gene locus_tag LOCUS_66080 3336 2197 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963712.1 protein_id gnl|my_center|LOCUS_66080 >Feature sequence1107 1768 1166 gene locus_tag LOCUS_66090 1768 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66090 2928 1765 gene locus_tag LOCUS_66100 gene recA 2928 1765 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245789.1 protein_id gnl|my_center|LOCUS_66100 >Feature sequence1108 344 1780 gene locus_tag LOCUS_66110 344 1780 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993891.1 protein_id gnl|my_center|LOCUS_66110 >Feature sequence1109 1794 757 gene locus_tag LOCUS_66120 1794 757 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_66120 3271 1919 gene locus_tag LOCUS_66130 3271 1919 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015138.1 protein_id gnl|my_center|LOCUS_66130 >Feature sequence1110 51 1043 gene locus_tag LOCUS_66140 51 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66140 1202 2047 gene locus_tag LOCUS_66150 gene mreC 1202 2047 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438051.1 protein_id gnl|my_center|LOCUS_66150 2052 2528 gene locus_tag LOCUS_66160 2052 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66160 >Feature sequence1111 647 384 gene locus_tag LOCUS_66170 647 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66170 1053 628 gene locus_tag LOCUS_66180 1053 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66180 2704 1130 gene locus_tag LOCUS_66190 2704 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66190 3284 2880 gene locus_tag LOCUS_66200 3284 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66200 >Feature sequence1112 1326 730 gene locus_tag LOCUS_66210 gene purN 1326 730 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_66210 2362 1337 gene locus_tag LOCUS_66220 gene purM 2362 1337 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_66220 2935 2426 gene locus_tag LOCUS_66230 gene purE 2935 2426 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_66230 >Feature sequence1113 1414 392 gene locus_tag LOCUS_66240 1414 392 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902186.1 protein_id gnl|my_center|LOCUS_66240 2590 1433 gene locus_tag LOCUS_66250 gene hemW 2590 1433 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454756.1 protein_id gnl|my_center|LOCUS_66250 <3357 2597 gene locus_tag LOCUS_66260 <3357 2597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003416556.1:translation elongation factor 4 >Feature sequence1114 1466 912 gene locus_tag LOCUS_66270 gene yfcE 1466 912 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966036.1 protein_id gnl|my_center|LOCUS_66270 2072 1485 gene locus_tag LOCUS_66280 2072 1485 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947081.1 protein_id gnl|my_center|LOCUS_66280 3084 2116 gene locus_tag LOCUS_66290 gene holA 3084 2116 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282563.1 protein_id gnl|my_center|LOCUS_66290 >Feature sequence1115 292 990 gene locus_tag LOCUS_66300 292 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66300 1003 2397 gene locus_tag LOCUS_66310 1003 2397 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 protein_id gnl|my_center|LOCUS_66310 >Feature sequence1116 317 2059 gene locus_tag LOCUS_66320 317 2059 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995243.1 protein_id gnl|my_center|LOCUS_66320 >Feature sequence1117 102 1997 gene locus_tag LOCUS_66330 102 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66330 2021 2350 gene locus_tag LOCUS_66340 2021 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66340 2377 2544 gene locus_tag LOCUS_66350 2377 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66350 >Feature sequence1118 380 514 gene locus_tag LOCUS_66360 380 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66360 2577 889 gene locus_tag LOCUS_66370 gene cydC 2577 889 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667625.1 protein_id gnl|my_center|LOCUS_66370 <3352 2577 gene locus_tag LOCUS_66380 <3352 2577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006995243.1:ABC transporter ATP-binding protein/permease >Feature sequence1119 2 1036 gene locus_tag LOCUS_66390 2 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66390 1344 1586 gene locus_tag LOCUS_66400 1344 1586 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115145.1 protein_id gnl|my_center|LOCUS_66400 1583 1705 gene locus_tag LOCUS_66410 1583 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66410 2342 1842 gene locus_tag LOCUS_66420 2342 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66420 2426 2962 gene locus_tag LOCUS_66430 2426 2962 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262419.1 protein_id gnl|my_center|LOCUS_66430 >Feature sequence1120 2182 14 gene locus_tag LOCUS_66440 gene nrdD 2182 14 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095357.1 protein_id gnl|my_center|LOCUS_66440 >Feature sequence1121 <1 3009 gene locus_tag LOCUS_66450 <1 3009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000753855.1:choline-binding protein PcpA >Feature sequence1122 1409 387 gene locus_tag LOCUS_66460 1409 387 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902186.1 protein_id gnl|my_center|LOCUS_66460 2579 1422 gene locus_tag LOCUS_66470 gene hemW 2579 1422 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454756.1 protein_id gnl|my_center|LOCUS_66470 <3342 2582 gene locus_tag LOCUS_66480 <3342 2582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003416556.1:translation elongation factor 4 >Feature sequence1123 1364 552 gene locus_tag LOCUS_66490 1364 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66490 2587 1355 gene locus_tag LOCUS_66500 2587 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66500 3339 2605 gene locus_tag LOCUS_66510 3339 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66510 >Feature sequence1124 2144 855 gene locus_tag LOCUS_66520 2144 855 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_66520 2802 2149 gene locus_tag LOCUS_66530 2802 2149 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986882.1 protein_id gnl|my_center|LOCUS_66530 3218 2799 gene locus_tag LOCUS_66540 3218 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66540 >Feature sequence1125 <1 988 gene locus_tag LOCUS_66550 <1 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048077.1:coproporphyrinogen III oxidase 985 2265 gene locus_tag LOCUS_66560 gene hisS 985 2265 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422928.1 protein_id gnl|my_center|LOCUS_66560 2285 2818 gene locus_tag LOCUS_66570 2285 2818 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_66570 >Feature sequence1126 <1 566 gene locus_tag LOCUS_66580 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002370092.1:ATP-dependent DNA helicase RecG 597 2144 gene locus_tag LOCUS_66590 597 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66590 2161 2715 gene locus_tag LOCUS_66600 gene rsmD 2161 2715 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_66600 2732 3328 gene locus_tag LOCUS_66610 2732 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66610 >Feature sequence1127 3186 1204 gene locus_tag LOCUS_66620 3186 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_66620 >Feature sequence1128 99 347 gene locus_tag LOCUS_66630 99 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66630 545 1003 gene locus_tag LOCUS_66640 545 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665895.1 protein_id gnl|my_center|LOCUS_66640 1058 1261 gene locus_tag LOCUS_66650 1058 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681636.1 protein_id gnl|my_center|LOCUS_66650 1336 1905 gene locus_tag LOCUS_66660 1336 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676860.1 protein_id gnl|my_center|LOCUS_66660 2048 2764 gene locus_tag LOCUS_66670 2048 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66670 2852 3184 gene locus_tag LOCUS_66680 2852 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033414.1 protein_id gnl|my_center|LOCUS_66680 >Feature sequence1129 <1 1262 gene locus_tag LOCUS_66690 <1 1262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071542382.1:trypsin-like peptidase domain-containing protein 1544 1617 gene locus_tag LOCUS_t00420 1544 1617 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1799 2830 gene locus_tag LOCUS_66700 1799 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673991.1 protein_id gnl|my_center|LOCUS_66700 >Feature sequence1130 1681 323 gene locus_tag LOCUS_66710 1681 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66710 3323 2979 gene locus_tag LOCUS_66720 3323 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66720 >Feature sequence1131 1692 559 gene locus_tag LOCUS_66730 1692 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66730 2178 1975 gene locus_tag LOCUS_66740 2178 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66740 2938 2204 gene locus_tag LOCUS_66750 2938 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66750 3137 3066 gene locus_tag LOCUS_t00430 3137 3066 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3260 3188 gene locus_tag LOCUS_t00440 3260 3188 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1132 134 358 gene locus_tag LOCUS_66760 134 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66760 516 1364 gene locus_tag LOCUS_66770 516 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66770 1429 1683 gene locus_tag LOCUS_66780 1429 1683 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587616.1 protein_id gnl|my_center|LOCUS_66780 1684 1980 gene locus_tag LOCUS_66790 1684 1980 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_66790 2082 3176 gene locus_tag LOCUS_66800 2082 3176 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703952.1 protein_id gnl|my_center|LOCUS_66800 >Feature sequence1133 <1 612 gene locus_tag LOCUS_66810 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000088780.1:saccharopine dehydrogenase family protein 614 1765 gene locus_tag LOCUS_66820 gene nspC 614 1765 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764364.1 protein_id gnl|my_center|LOCUS_66820 2786 2061 gene locus_tag LOCUS_66830 2786 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66830 >Feature sequence1134 1347 304 gene locus_tag LOCUS_66840 1347 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66840 2683 2042 gene locus_tag LOCUS_66850 2683 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66850 >Feature sequence1135 333 118 gene locus_tag LOCUS_66860 333 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_66860 585 346 gene locus_tag LOCUS_66870 585 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399633.1 protein_id gnl|my_center|LOCUS_66870 1234 686 gene locus_tag LOCUS_66880 1234 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_66880 1448 1254 gene locus_tag LOCUS_66890 1448 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66890 2106 1531 gene locus_tag LOCUS_66900 2106 1531 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_66900 3161 2100 gene locus_tag LOCUS_66910 3161 2100 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978063.1 protein_id gnl|my_center|LOCUS_66910 >Feature sequence1136 <1 536 gene locus_tag LOCUS_66920 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048307.1:UDP-N-acetylmuramate dehydrogenase 536 1411 gene locus_tag LOCUS_66930 gene rapZ 536 1411 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416961.1 protein_id gnl|my_center|LOCUS_66930 1411 2364 gene locus_tag LOCUS_66940 gene whiA 1411 2364 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_66940 2401 2655 gene locus_tag LOCUS_66950 2401 2655 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_66950 >Feature sequence1137 988 446 gene locus_tag LOCUS_66960 988 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66960 1783 3102 gene locus_tag LOCUS_66970 1783 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66970 >Feature sequence1138 1984 914 gene locus_tag LOCUS_66980 1984 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66980 >Feature sequence1139 1375 377 gene locus_tag LOCUS_66990 gene fliM 1375 377 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183958.1 protein_id gnl|my_center|LOCUS_66990 1834 1394 gene locus_tag LOCUS_67000 1834 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67000 2833 2081 gene locus_tag LOCUS_67010 2833 2081 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870067.1 protein_id gnl|my_center|LOCUS_67010 >Feature sequence1140 2649 1945 gene locus_tag LOCUS_67020 2649 1945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286289.1 protein_id gnl|my_center|LOCUS_67020 3278 2667 gene locus_tag LOCUS_67030 3278 2667 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056290.1 protein_id gnl|my_center|LOCUS_67030 >Feature sequence1141 288 2165 gene locus_tag LOCUS_67040 288 2165 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_67040 >Feature sequence1142 >Feature sequence1143 620 330 gene locus_tag LOCUS_67050 620 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67050 972 622 gene locus_tag LOCUS_67060 972 622 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461083.1 protein_id gnl|my_center|LOCUS_67060 2298 1039 gene locus_tag LOCUS_67070 2298 1039 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461202.1 protein_id gnl|my_center|LOCUS_67070 2969 2295 gene locus_tag LOCUS_67080 2969 2295 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461203.1 protein_id gnl|my_center|LOCUS_67080 >Feature sequence1144 1913 549 gene locus_tag LOCUS_67090 gene mgtE 1913 549 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_67090 2431 2015 gene locus_tag LOCUS_67100 2431 2015 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774977.1 protein_id gnl|my_center|LOCUS_67100 <3301 2487 gene locus_tag LOCUS_67110 <3301 2487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964657.1:transketolase >Feature sequence1145 571 17 gene locus_tag LOCUS_67120 gene frr 571 17 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_67120 1320 622 gene locus_tag LOCUS_67130 gene pyrH 1320 622 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430597.1 protein_id gnl|my_center|LOCUS_67130 2026 1412 gene locus_tag LOCUS_67140 2026 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67140 2534 2067 gene locus_tag LOCUS_67150 2534 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67150 <3300 2777 gene locus_tag LOCUS_67160 <3300 2777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966138.1:ATP-dependent RecD-like DNA helicase >Feature sequence1146 1106 171 gene locus_tag LOCUS_67170 1106 171 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897998.1 protein_id gnl|my_center|LOCUS_67170 1519 2079 gene locus_tag LOCUS_67180 1519 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67180 2633 2983 gene locus_tag LOCUS_67190 2633 2983 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963892.1 protein_id gnl|my_center|LOCUS_67190 >Feature sequence1147 1892 603 gene locus_tag LOCUS_67200 1892 603 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356901.1 protein_id gnl|my_center|LOCUS_67200 2714 1902 gene locus_tag LOCUS_67210 2714 1902 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289081.1 protein_id gnl|my_center|LOCUS_67210 3294 2743 gene locus_tag LOCUS_67220 gene rfbC 3294 2743 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_67220 >Feature sequence1148 >Feature sequence1149 692 1699 gene locus_tag LOCUS_67230 692 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67230 2261 3145 gene locus_tag LOCUS_67240 2261 3145 CDS product DUF4846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903242.1 protein_id gnl|my_center|LOCUS_67240 >Feature sequence1150 175 3108 gene locus_tag LOCUS_67250 175 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67250 >Feature sequence1151 816 199 gene locus_tag LOCUS_67260 816 199 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_67260 2025 823 gene locus_tag LOCUS_67270 gene rpoD 2025 823 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_67270 3062 2100 gene locus_tag LOCUS_67280 3062 2100 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_67280 >Feature sequence1152 <1 1167 gene locus_tag LOCUS_67290 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016965.1:CRISPR-associated helicase/endonuclease Cas3 1164 1661 gene locus_tag LOCUS_67300 gene cas4 1164 1661 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016964.1 protein_id gnl|my_center|LOCUS_67300 1676 2668 gene locus_tag LOCUS_67310 gene cas1b 1676 2668 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896423.1 protein_id gnl|my_center|LOCUS_67310 2671 2946 gene locus_tag LOCUS_67320 gene cas2 2671 2946 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903132.1 protein_id gnl|my_center|LOCUS_67320 >Feature sequence1153 <1 651 gene locus_tag LOCUS_67330 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986728.1:biotin synthase BioB 1366 776 gene locus_tag LOCUS_67340 1366 776 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545477.1 protein_id gnl|my_center|LOCUS_67340 1637 1921 gene locus_tag LOCUS_67350 1637 1921 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420907.1 protein_id gnl|my_center|LOCUS_67350 >Feature sequence1154 31 927 gene locus_tag LOCUS_67360 31 927 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_67360 1764 1003 gene locus_tag LOCUS_67370 1764 1003 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016780.1 protein_id gnl|my_center|LOCUS_67370 3146 1764 gene locus_tag LOCUS_67380 3146 1764 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016781.1 protein_id gnl|my_center|LOCUS_67380 >Feature sequence1155 1208 456 gene locus_tag LOCUS_67390 1208 456 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873069.1 protein_id gnl|my_center|LOCUS_67390 1769 1266 gene locus_tag LOCUS_67400 1769 1266 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434936.1 protein_id gnl|my_center|LOCUS_67400 2014 2181 gene locus_tag LOCUS_67410 2014 2181 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963626.1 protein_id gnl|my_center|LOCUS_67410 <3278 2286 gene locus_tag LOCUS_67420 <3278 2286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003420541.1:replicative DNA helicase >Feature sequence1156 1534 497 gene locus_tag LOCUS_67430 1534 497 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986692.1 protein_id gnl|my_center|LOCUS_67430 2335 1547 gene locus_tag LOCUS_67440 gene etfB 2335 1547 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986693.1 protein_id gnl|my_center|LOCUS_67440 <3277 2384 gene locus_tag LOCUS_67450 <3277 2384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986694.1:putative isocaproyl-CoA dehydrogenase AcdB >Feature sequence1157 3161 1503 gene locus_tag LOCUS_67460 3161 1503 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812007.1 protein_id gnl|my_center|LOCUS_67460 >Feature sequence1158 107 328 gene locus_tag LOCUS_67470 107 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67470 329 607 gene locus_tag LOCUS_67480 329 607 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016227.1 protein_id gnl|my_center|LOCUS_67480 760 688 gene locus_tag LOCUS_t00450 760 688 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 849 924 gene locus_tag LOCUS_t00460 849 924 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1081 2106 gene locus_tag LOCUS_67490 gene gap 1081 2106 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_67490 >Feature sequence1159 <1 1736 gene locus_tag LOCUS_67500 <1 1736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986883.1:translational GTPase TypA >Feature sequence1160 1640 342 gene locus_tag LOCUS_67510 1640 342 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_67510 2302 1766 gene locus_tag LOCUS_67520 gene rplQ 2302 1766 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357477.1 protein_id gnl|my_center|LOCUS_67520 <3269 2371 gene locus_tag LOCUS_67530 <3269 2371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357472.1:DNA-directed RNA polymerase subunit alpha >Feature sequence1161 1567 713 gene locus_tag LOCUS_67540 1567 713 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948298.1 protein_id gnl|my_center|LOCUS_67540 2525 1557 gene locus_tag LOCUS_67550 gene potA 2525 1557 CDS product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720321.1 protein_id gnl|my_center|LOCUS_67550 2678 2986 gene locus_tag LOCUS_67560 2678 2986 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357450.1 protein_id gnl|my_center|LOCUS_67560 >Feature sequence1162 82 1200 gene locus_tag LOCUS_67570 82 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67570 1280 2527 gene locus_tag LOCUS_67580 1280 2527 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_67580 2589 3113 gene locus_tag LOCUS_67590 2589 3113 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_67590 >Feature sequence1163 2065 953 gene locus_tag LOCUS_67600 2065 953 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263739.1 protein_id gnl|my_center|LOCUS_67600 >Feature sequence1164 1551 565 gene locus_tag LOCUS_67610 1551 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67610 <3268 1730 gene locus_tag LOCUS_67620 <3268 1730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986783.1:ribonuclease Y >Feature sequence1165 914 372 gene locus_tag LOCUS_67630 914 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67630 1667 1002 gene locus_tag LOCUS_67640 1667 1002 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 protein_id gnl|my_center|LOCUS_67640 2852 1668 gene locus_tag LOCUS_67650 2852 1668 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_67650 >Feature sequence1166 1467 103 gene locus_tag LOCUS_67660 1467 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67660 1809 2723 gene locus_tag LOCUS_67670 gene pyrB 1809 2723 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_67670 2723 3157 gene locus_tag LOCUS_67680 2723 3157 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_67680 >Feature sequence1167 2066 849 gene locus_tag LOCUS_67690 2066 849 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_67690 3231 2281 gene locus_tag LOCUS_67700 3231 2281 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949084.1 protein_id gnl|my_center|LOCUS_67700 >Feature sequence1168 2326 2072 gene locus_tag LOCUS_67710 2326 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67710 2744 2319 gene locus_tag LOCUS_67720 gene ruvX 2744 2319 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021214669.1 protein_id gnl|my_center|LOCUS_67720 3143 2880 gene locus_tag LOCUS_67730 3143 2880 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385813.1 protein_id gnl|my_center|LOCUS_67730 >Feature sequence1169 1974 1009 gene locus_tag LOCUS_67740 1974 1009 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_67740 3116 1995 gene locus_tag LOCUS_67750 gene recA 3116 1995 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428218.1 protein_id gnl|my_center|LOCUS_67750 >Feature sequence1170 34 765 gene locus_tag LOCUS_67760 34 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67760 731 3046 gene locus_tag LOCUS_67770 731 3046 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861362.1 protein_id gnl|my_center|LOCUS_67770 >Feature sequence1171 <1 767 gene locus_tag LOCUS_67780 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681327.1:PEP/pyruvate-binding domain-containing protein 769 2109 gene locus_tag LOCUS_67790 769 2109 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681330.1 protein_id gnl|my_center|LOCUS_67790 2230 2427 gene locus_tag LOCUS_67800 2230 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67800 >Feature sequence1172 441 1298 gene locus_tag LOCUS_67810 441 1298 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435320.1 protein_id gnl|my_center|LOCUS_67810 1308 2153 gene locus_tag LOCUS_67820 1308 2153 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108784.1 protein_id gnl|my_center|LOCUS_67820 2906 2190 gene locus_tag LOCUS_67830 2906 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67830 >Feature sequence1173 >Feature sequence1174 2515 932 gene locus_tag LOCUS_67840 2515 932 CDS product TerB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546145.1 protein_id gnl|my_center|LOCUS_67840 3192 2530 gene locus_tag LOCUS_67850 3192 2530 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766910.1 protein_id gnl|my_center|LOCUS_67850 >Feature sequence1175 1 204 gene locus_tag LOCUS_67860 1 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67860 242 445 gene locus_tag LOCUS_67870 242 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67870 473 1573 gene locus_tag LOCUS_67880 473 1573 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681411.1 protein_id gnl|my_center|LOCUS_67880 1585 3189 gene locus_tag LOCUS_67890 1585 3189 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681397.1 protein_id gnl|my_center|LOCUS_67890 >Feature sequence1176 1788 1072 gene locus_tag LOCUS_67900 1788 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67900 1945 2649 gene locus_tag LOCUS_67910 1945 2649 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460542.1 protein_id gnl|my_center|LOCUS_67910 >Feature sequence1177 2351 1557 gene locus_tag LOCUS_67920 gene cheR 2351 1557 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230589.1 protein_id gnl|my_center|LOCUS_67920 <3248 2705 gene locus_tag LOCUS_67930 <3248 2705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674490.1:30S ribosomal protein S1 >Feature sequence1178 769 236 gene locus_tag LOCUS_67940 769 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67940 3038 771 gene locus_tag LOCUS_67950 3038 771 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479745.1 protein_id gnl|my_center|LOCUS_67950 >Feature sequence1179 1291 83 gene locus_tag LOCUS_67960 1291 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67960 1548 3125 gene locus_tag LOCUS_67970 1548 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67970 >Feature sequence1180 6 203 gene locus_tag LOCUS_67980 6 203 CDS product transposon-encoded TnpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680022.1 protein_id gnl|my_center|LOCUS_67980 276 596 gene locus_tag LOCUS_67990 276 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67990 838 2298 gene locus_tag LOCUS_68000 838 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68000 2467 3150 gene locus_tag LOCUS_68010 2467 3150 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668469.1 protein_id gnl|my_center|LOCUS_68010 >Feature sequence1181 2646 1021 gene locus_tag LOCUS_68020 2646 1021 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836418.1 protein_id gnl|my_center|LOCUS_68020 >Feature sequence1182 214 411 gene locus_tag LOCUS_68030 214 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68030 1736 549 gene locus_tag LOCUS_68040 gene mobV 1736 549 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122833.1 protein_id gnl|my_center|LOCUS_68040 2450 1857 gene locus_tag LOCUS_68050 2450 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68050 2705 2466 gene locus_tag LOCUS_68060 2705 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68060 3068 2874 gene locus_tag LOCUS_68070 3068 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68070 >Feature sequence1183 434 96 gene locus_tag LOCUS_68080 gene rsfS 434 96 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416416.1 protein_id gnl|my_center|LOCUS_68080 1028 435 gene locus_tag LOCUS_68090 gene yqeK 1028 435 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078244.1 protein_id gnl|my_center|LOCUS_68090 1629 1021 gene locus_tag LOCUS_68100 gene nadD 1629 1021 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943828.1 protein_id gnl|my_center|LOCUS_68100 1927 1631 gene locus_tag LOCUS_68110 gene yhbY 1927 1631 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_68110 3216 1939 gene locus_tag LOCUS_68120 gene obgE 3216 1939 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_68120 >Feature sequence1184 85 492 gene locus_tag LOCUS_68130 85 492 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_68130 508 909 gene locus_tag LOCUS_68140 508 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68140 1455 2006 gene locus_tag LOCUS_68150 1455 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68150 2050 2691 gene locus_tag LOCUS_68160 2050 2691 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_68160 2810 3067 gene locus_tag LOCUS_68170 2810 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68170 >Feature sequence1185 155 544 gene locus_tag LOCUS_68180 155 544 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_68180 555 1373 gene locus_tag LOCUS_68190 555 1373 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_68190 1384 2418 gene locus_tag LOCUS_68200 gene kdd 1384 2418 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_68200 >Feature sequence1186 883 1164 gene locus_tag LOCUS_68210 883 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68210 3079 1223 gene locus_tag LOCUS_68220 3079 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68220 >Feature sequence1187 <1 696 gene locus_tag LOCUS_68230 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207749.1:DUF853 family protein 705 2042 gene locus_tag LOCUS_68240 705 2042 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_68240 2057 2713 gene locus_tag LOCUS_68250 2057 2713 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_68250 >Feature sequence1188 <1 724 gene locus_tag LOCUS_68260 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582961.1:ATP-grasp domain-containing protein 739 1929 gene locus_tag LOCUS_68270 739 1929 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704930.1 protein_id gnl|my_center|LOCUS_68270 1926 2723 gene locus_tag LOCUS_68280 1926 2723 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083199050.1 protein_id gnl|my_center|LOCUS_68280 >Feature sequence1189 <1 1061 gene locus_tag LOCUS_68290 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272760.1:sensor histidine kinase 1048 2016 gene locus_tag LOCUS_68300 1048 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68300 2032 3051 gene locus_tag LOCUS_68310 gene mglB 2032 3051 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903112.1 protein_id gnl|my_center|LOCUS_68310 >Feature sequence1190 1680 1132 gene locus_tag LOCUS_68320 1680 1132 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986429.1 protein_id gnl|my_center|LOCUS_68320 2376 1801 gene locus_tag LOCUS_68330 2376 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68330 <3234 2425 gene locus_tag LOCUS_68340 <3234 2425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002439552.1:recombinase RecA >Feature sequence1191 460 161 gene locus_tag LOCUS_68350 460 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68350 636 791 gene locus_tag LOCUS_68360 636 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68360 1518 901 gene locus_tag LOCUS_68370 1518 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68370 2137 1511 gene locus_tag LOCUS_68380 2137 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68380 2951 2124 gene locus_tag LOCUS_68390 2951 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68390 >Feature sequence1192 1052 135 gene locus_tag LOCUS_68400 1052 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68400 1543 1100 gene locus_tag LOCUS_68410 1543 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68410 1995 1597 gene locus_tag LOCUS_68420 1995 1597 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680115.1 protein_id gnl|my_center|LOCUS_68420 2252 2052 gene locus_tag LOCUS_68430 2252 2052 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674407.1 protein_id gnl|my_center|LOCUS_68430 2570 2340 gene locus_tag LOCUS_68440 2570 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68440 2845 2567 gene locus_tag LOCUS_68450 2845 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68450 >Feature sequence1193 457 146 gene locus_tag LOCUS_68460 457 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68460 608 826 gene locus_tag LOCUS_68470 608 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68470 895 1812 gene locus_tag LOCUS_68480 895 1812 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_68480 1919 2914 gene locus_tag LOCUS_68490 1919 2914 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812002.1 protein_id gnl|my_center|LOCUS_68490 >Feature sequence1194 22 1080 gene locus_tag LOCUS_68500 22 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68500 1138 2379 gene locus_tag LOCUS_68510 1138 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68510 >Feature sequence1195 2311 203 gene locus_tag LOCUS_68520 2311 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68520 <3228 2367 gene locus_tag LOCUS_68530 <3228 2367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804172.1:helicase >Feature sequence1196 1730 2287 gene locus_tag LOCUS_68540 gene efp 1730 2287 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_68540 2371 3024 gene locus_tag LOCUS_68550 2371 3024 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582846.1 protein_id gnl|my_center|LOCUS_68550 >Feature sequence1197 91 969 gene locus_tag LOCUS_68560 91 969 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_68560 986 1606 gene locus_tag LOCUS_68570 gene gmk 986 1606 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_68570 1619 1864 gene locus_tag LOCUS_68580 1619 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68580 1986 2528 gene locus_tag LOCUS_68590 gene pgsA 1986 2528 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362543.1 protein_id gnl|my_center|LOCUS_68590 >Feature sequence1198 1323 436 gene locus_tag LOCUS_68600 gene murB 1323 436 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_68600 2292 1348 gene locus_tag LOCUS_68610 gene hprK 2292 1348 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_68610 <3221 2313 gene locus_tag LOCUS_68620 <3221 2313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986302.1:SNF2 helicase associated domain-containing protein >Feature sequence1199 >Feature sequence1200 578 66 gene locus_tag LOCUS_68630 578 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68630 2141 672 gene locus_tag LOCUS_68640 2141 672 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_68640 2686 2144 gene locus_tag LOCUS_68650 2686 2144 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918000.1 protein_id gnl|my_center|LOCUS_68650 3172 2702 gene locus_tag LOCUS_68660 3172 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68660 >Feature sequence1201 <1 698 gene locus_tag LOCUS_68670 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815859.1:response regulator 673 1578 gene locus_tag LOCUS_68680 673 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68680 >Feature sequence1202 1981 593 gene locus_tag LOCUS_68690 1981 593 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_68690 2900 2040 gene locus_tag LOCUS_68700 gene ylqF 2900 2040 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861161.1 protein_id gnl|my_center|LOCUS_68700 >Feature sequence1203 1915 818 gene locus_tag LOCUS_68710 1915 818 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476426.1 protein_id gnl|my_center|LOCUS_68710 2477 1887 gene locus_tag LOCUS_68720 2477 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68720 <3210 2478 gene locus_tag LOCUS_68730 <3210 2478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005483418.1:glycosyltransferase >Feature sequence1204 57 2174 gene locus_tag LOCUS_68740 57 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68740 2346 2636 gene locus_tag LOCUS_68750 2346 2636 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918591.1 protein_id gnl|my_center|LOCUS_68750 3027 3155 gene locus_tag LOCUS_68760 3027 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68760 >Feature sequence1205 1603 1046 gene locus_tag LOCUS_68770 1603 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68770 2368 1946 gene locus_tag LOCUS_68780 2368 1946 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_68780 3200 2361 gene locus_tag LOCUS_68790 3200 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68790 >Feature sequence1206 276 575 gene locus_tag LOCUS_68800 276 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68800 568 1704 gene locus_tag LOCUS_68810 568 1704 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272381.1 protein_id gnl|my_center|LOCUS_68810 1697 2248 gene locus_tag LOCUS_68820 1697 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68820 2253 3032 gene locus_tag LOCUS_68830 2253 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68830 >Feature sequence1207 <1 895 gene locus_tag LOCUS_68840 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966024.1:exonuclease SbcCD subunit D 1561 2379 gene locus_tag LOCUS_68850 1561 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68850 <3197 2567 gene locus_tag LOCUS_68860 <3197 2567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005904352.1:FprA family A-type flavoprotein >Feature sequence1208 402 1847 gene locus_tag LOCUS_68870 402 1847 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296810.1 protein_id gnl|my_center|LOCUS_68870 1860 3161 gene locus_tag LOCUS_68880 1860 3161 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976583.1 protein_id gnl|my_center|LOCUS_68880 >Feature sequence1209 290 1624 gene locus_tag LOCUS_68890 290 1624 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676360.1 protein_id gnl|my_center|LOCUS_68890 1747 2703 gene locus_tag LOCUS_68900 1747 2703 CDS product DUF4300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860938.1 protein_id gnl|my_center|LOCUS_68900 >Feature sequence1210 496 137 gene locus_tag LOCUS_68910 496 137 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119153.1 protein_id gnl|my_center|LOCUS_68910 2792 957 gene locus_tag LOCUS_68920 gene ftsH 2792 957 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_68920 >Feature sequence1211 933 460 gene locus_tag LOCUS_68930 933 460 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962372.1 protein_id gnl|my_center|LOCUS_68930 1153 1662 gene locus_tag LOCUS_68940 1153 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68940 1771 3057 gene locus_tag LOCUS_68950 gene tig 1771 3057 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_68950 >Feature sequence1212 <1 1334 gene locus_tag LOCUS_68960 <1 1334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009993891.1:alpha-L-fucosidase >Feature sequence1213 1597 776 gene locus_tag LOCUS_68970 1597 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68970 2612 1590 gene locus_tag LOCUS_68980 gene fliG 2612 1590 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 protein_id gnl|my_center|LOCUS_68980 >Feature sequence1214 1826 1173 gene locus_tag LOCUS_68990 1826 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68990 2513 1830 gene locus_tag LOCUS_69000 2513 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69000 >Feature sequence1215 687 550 gene locus_tag LOCUS_69010 687 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69010 1246 674 gene locus_tag LOCUS_69020 1246 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69020 2121 1243 gene locus_tag LOCUS_69030 2121 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69030 3160 2459 gene locus_tag LOCUS_69040 3160 2459 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001796827.1 protein_id gnl|my_center|LOCUS_69040 >Feature sequence1216 1196 477 gene locus_tag LOCUS_69050 1196 477 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948252.1 protein_id gnl|my_center|LOCUS_69050 2269 2538 gene locus_tag LOCUS_69060 2269 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69060 3037 2573 gene locus_tag LOCUS_69070 3037 2573 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460328.1 protein_id gnl|my_center|LOCUS_69070 >Feature sequence1217 13 1686 gene locus_tag LOCUS_69080 13 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69080 1697 2476 gene locus_tag LOCUS_69090 1697 2476 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_69090 >Feature sequence1218 1286 2188 gene locus_tag LOCUS_69100 1286 2188 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047707.1 protein_id gnl|my_center|LOCUS_69100 2249 2911 gene locus_tag LOCUS_69110 2249 2911 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358158.1 protein_id gnl|my_center|LOCUS_69110 >Feature sequence1219 1 381 gene locus_tag LOCUS_69120 1 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69120 393 812 gene locus_tag LOCUS_69130 393 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69130 809 1258 gene locus_tag LOCUS_69140 809 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69140 1261 1749 gene locus_tag LOCUS_69150 1261 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69150 1765 2199 gene locus_tag LOCUS_69160 1765 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69160 2199 2762 gene locus_tag LOCUS_69170 2199 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69170 >Feature sequence1220 <1 778 gene locus_tag LOCUS_69180 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808153.1:diaminopimelate dehydrogenase 2224 1403 gene locus_tag LOCUS_69190 2224 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69190 <3178 2221 gene locus_tag LOCUS_69200 <3178 2221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001023185.1:GGDEF domain-containing protein >Feature sequence1221 38 499 gene locus_tag LOCUS_69210 38 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69210 1921 647 gene locus_tag LOCUS_69220 gene sstT 1921 647 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811470.1 protein_id gnl|my_center|LOCUS_69220 2550 3089 gene locus_tag LOCUS_69230 2550 3089 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_69230 >Feature sequence1222 822 526 gene locus_tag LOCUS_69240 822 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69240 1299 928 gene locus_tag LOCUS_69250 1299 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69250 >Feature sequence1223 <1 2075 gene locus_tag LOCUS_69260 <1 2075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009891588.1:selenium-dependent xanthine dehydrogenase 2090 2521 gene locus_tag LOCUS_69270 gene dutA 2090 2521 CDS product dUTP diphosphatase DutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245820.1 protein_id gnl|my_center|LOCUS_69270 >Feature sequence1224 2020 911 gene locus_tag LOCUS_69280 gene mglB 2020 911 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869062.1 protein_id gnl|my_center|LOCUS_69280 >Feature sequence1225 1501 353 gene locus_tag LOCUS_69290 1501 353 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989388.1 protein_id gnl|my_center|LOCUS_69290 2743 1553 gene locus_tag LOCUS_69300 2743 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69300 2823 2969 gene locus_tag LOCUS_69310 2823 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69310 >Feature sequence1226 109 182 gene locus_tag LOCUS_t00470 109 182 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 200 285 gene locus_tag LOCUS_t00480 200 285 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 763 1101 gene locus_tag LOCUS_69320 763 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69320 1112 2089 gene locus_tag LOCUS_69330 gene dusB 1112 2089 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_69330 2441 2923 gene locus_tag LOCUS_69340 gene greA 2441 2923 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_69340 >Feature sequence1227 369 557 gene locus_tag LOCUS_69350 369 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69350 761 2551 gene locus_tag LOCUS_69360 761 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69360 >Feature sequence1228 97 519 gene locus_tag LOCUS_69370 97 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69370 688 2334 gene locus_tag LOCUS_69380 688 2334 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129256806.1 protein_id gnl|my_center|LOCUS_69380 2386 3012 gene locus_tag LOCUS_69390 2386 3012 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948953.1 protein_id gnl|my_center|LOCUS_69390 >Feature sequence1229 264 1550 gene locus_tag LOCUS_69400 gene tig 264 1550 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965929.1 protein_id gnl|my_center|LOCUS_69400 1565 2146 gene locus_tag LOCUS_69410 gene clpP 1565 2146 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_69410 >Feature sequence1230 175 432 gene locus_tag LOCUS_69420 175 432 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_69420 425 1420 gene locus_tag LOCUS_69430 gene hydE 425 1420 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868900.1 protein_id gnl|my_center|LOCUS_69430 1430 2848 gene locus_tag LOCUS_69440 gene hydG 1430 2848 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_69440 >Feature sequence1231 1212 91 gene locus_tag LOCUS_69450 1212 91 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902588.1 protein_id gnl|my_center|LOCUS_69450 2220 1348 gene locus_tag LOCUS_69460 2220 1348 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902589.1 protein_id gnl|my_center|LOCUS_69460 2543 2217 gene locus_tag LOCUS_69470 2543 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69470 >Feature sequence1232 <1 1550 gene locus_tag LOCUS_69480 <1 1550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393742.1:dihydroxy-acid dehydratase >Feature sequence1233 1532 474 gene locus_tag LOCUS_69490 gene ispG 1532 474 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861462.1 protein_id gnl|my_center|LOCUS_69490 2591 1557 gene locus_tag LOCUS_69500 gene rseP 2591 1557 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430605.1 protein_id gnl|my_center|LOCUS_69500 <3147 2588 gene locus_tag LOCUS_69510 <3147 2588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989733.1:1-deoxy-D-xylulose-5-phosphate reductoisomerase >Feature sequence1234 >Feature sequence1235 1533 1796 gene locus_tag LOCUS_69520 1533 1796 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545507.1 protein_id gnl|my_center|LOCUS_69520 1806 2156 gene locus_tag LOCUS_69530 1806 2156 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438259.1 protein_id gnl|my_center|LOCUS_69530 2393 2857 gene locus_tag LOCUS_69540 2393 2857 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419428.1 protein_id gnl|my_center|LOCUS_69540 >Feature sequence1236 1239 2252 gene locus_tag LOCUS_69550 gene aroF 1239 2252 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_69550 >Feature sequence1237 565 804 gene locus_tag LOCUS_69560 565 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69560 1315 1521 gene locus_tag LOCUS_69570 1315 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69570 >Feature sequence1238 68 541 gene locus_tag LOCUS_69580 68 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69580 684 1703 gene locus_tag LOCUS_69590 gene pheS 684 1703 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436795.1 protein_id gnl|my_center|LOCUS_69590 >Feature sequence1239 39 1811 gene locus_tag LOCUS_69600 39 1811 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963614.1 protein_id gnl|my_center|LOCUS_69600 3003 1870 gene locus_tag LOCUS_69610 gene nifS 3003 1870 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066396.1 protein_id gnl|my_center|LOCUS_69610 >Feature sequence1240 <3138 85 gene locus_tag LOCUS_69620 <3138 85 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966420.1:DNA-directed RNA polymerase subunit beta' >Feature sequence1241 <1 1242 gene locus_tag LOCUS_69630 <1 1242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704357.1:hydratase 1254 3128 gene locus_tag LOCUS_69640 gene ftsH 1254 3128 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048280.1 protein_id gnl|my_center|LOCUS_69640 >Feature sequence1242 221 1921 gene locus_tag LOCUS_69650 221 1921 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902683.1 protein_id gnl|my_center|LOCUS_69650 1918 3009 gene locus_tag LOCUS_69660 1918 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69660 >Feature sequence1243 <3136 2501 gene locus_tag LOCUS_69670 <3136 2501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000753855.1:choline-binding protein PcpA >Feature sequence1244 1470 589 gene locus_tag LOCUS_69680 1470 589 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_69680 3000 1825 gene locus_tag LOCUS_69690 gene hemA 3000 1825 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546522.1 protein_id gnl|my_center|LOCUS_69690 >Feature sequence1245 667 2034 gene locus_tag LOCUS_69700 667 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69700 2046 2747 gene locus_tag LOCUS_69710 2046 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69710 >Feature sequence1246 <1 647 gene locus_tag LOCUS_69720 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903010.1:SDR family oxidoreductase 846 2507 gene locus_tag LOCUS_69730 846 2507 CDS product glycerophosphoryl diester phosphodiesterase membrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922150.1 protein_id gnl|my_center|LOCUS_69730 >Feature sequence1247 1744 836 gene locus_tag LOCUS_69740 1744 836 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582871.1 protein_id gnl|my_center|LOCUS_69740 <3127 2018 gene locus_tag LOCUS_69750 <3127 2018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007539804.1:extracellular solute-binding protein >Feature sequence1248 97 1251 gene locus_tag LOCUS_69760 97 1251 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_69760 1278 2060 gene locus_tag LOCUS_69770 1278 2060 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888867.1 protein_id gnl|my_center|LOCUS_69770 2074 3126 gene locus_tag LOCUS_69780 2074 3126 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 protein_id gnl|my_center|LOCUS_69780 >Feature sequence1249 2140 83 gene locus_tag LOCUS_69790 2140 83 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893754.1 protein_id gnl|my_center|LOCUS_69790 2423 2142 gene locus_tag LOCUS_69800 2423 2142 CDS product DUF6110 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893755.1 protein_id gnl|my_center|LOCUS_69800 2716 2646 gene locus_tag LOCUS_t00490 2716 2646 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1250 <1 1093 gene locus_tag LOCUS_69810 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921811.1:FCT-2 pilus major pilin FctA/T1 1097 1834 gene locus_tag LOCUS_69820 gene srtC1 1097 1834 CDS product FCT-2 pilus polymerization class B sortase SrtC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921812.1 protein_id gnl|my_center|LOCUS_69820 1836 2657 gene locus_tag LOCUS_69830 1836 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69830 3122 2694 gene locus_tag LOCUS_69840 3122 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69840 >Feature sequence1251 305 1501 gene locus_tag LOCUS_69850 305 1501 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_69850 2095 1562 gene locus_tag LOCUS_69860 gene lepB 2095 1562 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425127.1 protein_id gnl|my_center|LOCUS_69860 3101 2163 gene locus_tag LOCUS_69870 3101 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69870 >Feature sequence1252 38 1396 gene locus_tag LOCUS_69880 38 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69880 1545 2996 gene locus_tag LOCUS_69890 1545 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69890 >Feature sequence1253 1489 152 gene locus_tag LOCUS_69900 gene rsmB 1489 152 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_69900 2186 1482 gene locus_tag LOCUS_69910 2186 1482 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383773.1 protein_id gnl|my_center|LOCUS_69910 <3120 2191 gene locus_tag LOCUS_69920 <3120 2191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546616.1:methionyl-tRNA formyltransferase >Feature sequence1254 956 2065 gene locus_tag LOCUS_69930 gene ribD 956 2065 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905672.1 protein_id gnl|my_center|LOCUS_69930 2065 2709 gene locus_tag LOCUS_69940 gene ribE 2065 2709 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493840.1 protein_id gnl|my_center|LOCUS_69940 >Feature sequence1255 <1 710 gene locus_tag LOCUS_69950 <1 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003429268.1:DHH family phosphoesterase 726 1172 gene locus_tag LOCUS_69960 gene rplI 726 1172 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048442.1 protein_id gnl|my_center|LOCUS_69960 1174 2514 gene locus_tag LOCUS_69970 gene dnaB 1174 2514 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_69970 2524 2982 gene locus_tag LOCUS_69980 2524 2982 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130996.1 protein_id gnl|my_center|LOCUS_69980 >Feature sequence1256 109 855 gene locus_tag LOCUS_69990 gene larB 109 855 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_69990 876 2471 gene locus_tag LOCUS_70000 876 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70000 >Feature sequence1257 1776 811 gene locus_tag LOCUS_70010 1776 811 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002906717.1 protein_id gnl|my_center|LOCUS_70010 2629 1754 gene locus_tag LOCUS_70020 2629 1754 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964117.1 protein_id gnl|my_center|LOCUS_70020 >Feature sequence1258 1376 336 gene locus_tag LOCUS_70030 gene argC 1376 336 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851634.1 protein_id gnl|my_center|LOCUS_70030 2452 1601 gene locus_tag LOCUS_70040 2452 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70040 >Feature sequence1259 <1 1041 gene locus_tag LOCUS_70050 <1 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001160526.1:class II fumarate hydratase 1056 2426 gene locus_tag LOCUS_70060 1056 2426 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_70060 3065 2472 gene locus_tag LOCUS_70070 3065 2472 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_70070 >Feature sequence1260 <3106 2126 gene locus_tag LOCUS_70080 <3106 2126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943186.1:DNA-processing protein DprA >Feature sequence1261 188 1885 gene locus_tag LOCUS_70090 188 1885 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902683.1 protein_id gnl|my_center|LOCUS_70090 1882 2973 gene locus_tag LOCUS_70100 1882 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70100 >Feature sequence1262 42 626 gene locus_tag LOCUS_70110 gene yqeK 42 626 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_70110 626 982 gene locus_tag LOCUS_70120 gene rsfS 626 982 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_70120 1854 1240 gene locus_tag LOCUS_70130 gene lexA 1854 1240 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 protein_id gnl|my_center|LOCUS_70130 2050 2403 gene locus_tag LOCUS_70140 2050 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70140 <3098 2504 gene locus_tag LOCUS_70150 <3098 2504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811557.1:tyrosine-type recombinase/integrase >Feature sequence1263 1147 788 gene locus_tag LOCUS_70160 1147 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70160 2367 1726 gene locus_tag LOCUS_70170 gene cmk 2367 1726 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015703.1 protein_id gnl|my_center|LOCUS_70170 >Feature sequence1264 3 386 gene locus_tag LOCUS_70180 3 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70180 408 1484 gene locus_tag LOCUS_70190 408 1484 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437017.1 protein_id gnl|my_center|LOCUS_70190 1477 2298 gene locus_tag LOCUS_70200 1477 2298 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808911.1 protein_id gnl|my_center|LOCUS_70200 2295 3083 gene locus_tag LOCUS_70210 2295 3083 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_70210 >Feature sequence1265 1959 64 gene locus_tag LOCUS_70220 1959 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70220 2247 1975 gene locus_tag LOCUS_70230 2247 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70230 2732 2274 gene locus_tag LOCUS_70240 2732 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70240 >Feature sequence1266 1520 177 gene locus_tag LOCUS_70250 1520 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70250 3050 1539 gene locus_tag LOCUS_70260 3050 1539 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_70260 >Feature sequence1267 2922 136 gene locus_tag LOCUS_70270 2922 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70270 >Feature sequence1268 30 275 gene locus_tag LOCUS_70280 30 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70280 584 1336 gene locus_tag LOCUS_70290 584 1336 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130487.1 protein_id gnl|my_center|LOCUS_70290 1576 1731 gene locus_tag LOCUS_70300 1576 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70300 1865 2353 gene locus_tag LOCUS_70310 1865 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_70310 >Feature sequence1269 1591 221 gene locus_tag LOCUS_70320 1591 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70320 3077 1593 gene locus_tag LOCUS_70330 3077 1593 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047636.1 protein_id gnl|my_center|LOCUS_70330 >Feature sequence1270 <1 1854 gene locus_tag LOCUS_70340 <1 1854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002391620.1:glycoside hydrolase family 3 N-terminal domain-containing protein >Feature sequence1271 184 2070 gene locus_tag LOCUS_70350 184 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70350 >Feature sequence1272 >Feature sequence1273 95 322 gene locus_tag LOCUS_70360 95 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70360 411 1199 gene locus_tag LOCUS_70370 411 1199 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861405.1 protein_id gnl|my_center|LOCUS_70370 1239 1745 gene locus_tag LOCUS_70380 1239 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70380 >Feature sequence1274 1283 2914 gene locus_tag LOCUS_70390 1283 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70390 >Feature sequence1275 103 1011 gene locus_tag LOCUS_70400 103 1011 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_70400 1050 2669 gene locus_tag LOCUS_70410 1050 2669 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 protein_id gnl|my_center|LOCUS_70410 >Feature sequence1276 2209 548 gene locus_tag LOCUS_70420 2209 548 CDS product glycerophosphoryl diester phosphodiesterase membrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922150.1 protein_id gnl|my_center|LOCUS_70420 <3065 2419 gene locus_tag LOCUS_70430 <3065 2419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903010.1:SDR family oxidoreductase >Feature sequence1277 2076 343 gene locus_tag LOCUS_70440 gene ade 2076 343 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476052.1 protein_id gnl|my_center|LOCUS_70440 2597 2106 gene locus_tag LOCUS_70450 2597 2106 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393456.1 protein_id gnl|my_center|LOCUS_70450 >Feature sequence1278 9 1136 gene locus_tag LOCUS_70460 9 1136 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_70460 >Feature sequence1279 1662 892 gene locus_tag LOCUS_70470 1662 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70470 2633 1659 gene locus_tag LOCUS_70480 gene hemB 2633 1659 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963427.1 protein_id gnl|my_center|LOCUS_70480 >Feature sequence1280 307 1743 gene locus_tag LOCUS_70490 307 1743 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_70490 >Feature sequence1281 <1 696 gene locus_tag LOCUS_70500 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963725.1:Ig-like domain-containing protein 805 1728 gene locus_tag LOCUS_70510 805 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70510 1856 2014 gene locus_tag LOCUS_70520 1856 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70520 >Feature sequence1282 985 1779 gene locus_tag LOCUS_70530 985 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70530 1937 2434 gene locus_tag LOCUS_70540 gene ilvN 1937 2434 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_70540 >Feature sequence1283 2739 1021 gene locus_tag LOCUS_70550 2739 1021 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170127867.1 protein_id gnl|my_center|LOCUS_70550 >Feature sequence1284 540 848 gene locus_tag LOCUS_70560 540 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70560 862 1026 gene locus_tag LOCUS_70570 862 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70570 1028 1471 gene locus_tag LOCUS_70580 1028 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70580 1541 1837 gene locus_tag LOCUS_70590 1541 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70590 1849 2802 gene locus_tag LOCUS_70600 1849 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70600 >Feature sequence1285 918 1805 gene locus_tag LOCUS_70610 918 1805 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286852.1 protein_id gnl|my_center|LOCUS_70610 2993 2046 gene locus_tag LOCUS_70620 2993 2046 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016646.1 protein_id gnl|my_center|LOCUS_70620 >Feature sequence1286 391 101 gene locus_tag LOCUS_70630 gene eutM 391 101 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358305.1 protein_id gnl|my_center|LOCUS_70630 2261 474 gene locus_tag LOCUS_70640 2261 474 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986619.1 protein_id gnl|my_center|LOCUS_70640 3018 2278 gene locus_tag LOCUS_70650 3018 2278 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986620.1 protein_id gnl|my_center|LOCUS_70650 >Feature sequence1287 119 841 gene locus_tag LOCUS_70660 119 841 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 protein_id gnl|my_center|LOCUS_70660 844 2109 gene locus_tag LOCUS_70670 844 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70670 2747 2890 gene locus_tag LOCUS_70680 2747 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70680 >Feature sequence1288 >Feature sequence1289 <1 1950 gene locus_tag LOCUS_70690 <1 1950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000753855.1:choline-binding protein PcpA 2033 3043 gene locus_tag LOCUS_70700 gene ansA 2033 3043 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_70700 >Feature sequence1290 2317 797 gene locus_tag LOCUS_70710 gene garD 2317 797 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246362.1 protein_id gnl|my_center|LOCUS_70710 2758 2336 gene locus_tag LOCUS_70720 2758 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70720 >Feature sequence1291 1859 666 gene locus_tag LOCUS_70730 1859 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70730 3029 1872 gene locus_tag LOCUS_70740 3029 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70740 >Feature sequence1292 >Feature sequence1293 71 577 gene locus_tag LOCUS_70750 71 577 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_70750 596 1783 gene locus_tag LOCUS_70760 gene nusA 596 1783 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_70760 1761 2045 gene locus_tag LOCUS_70770 1761 2045 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419469.1 protein_id gnl|my_center|LOCUS_70770 2032 2337 gene locus_tag LOCUS_70780 2032 2337 CDS product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020853.1 protein_id gnl|my_center|LOCUS_70780 >Feature sequence1294 718 1029 gene locus_tag LOCUS_70790 718 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70790 1022 1546 gene locus_tag LOCUS_70800 1022 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70800 1752 2204 gene locus_tag LOCUS_70810 1752 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70810 2231 2770 gene locus_tag LOCUS_70820 2231 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70820 >Feature sequence1295 271 708 gene locus_tag LOCUS_70830 271 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70830 686 901 gene locus_tag LOCUS_70840 686 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70840 1452 1730 gene locus_tag LOCUS_70850 1452 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70850 1821 1994 gene locus_tag LOCUS_70860 1821 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70860 >Feature sequence1296 128 1093 gene locus_tag LOCUS_70870 128 1093 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_70870 1083 2156 gene locus_tag LOCUS_70880 1083 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70880 2326 2487 gene locus_tag LOCUS_70890 2326 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70890 >Feature sequence1297 1819 1085 gene locus_tag LOCUS_70900 1819 1085 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890711.1 protein_id gnl|my_center|LOCUS_70900 1980 2843 gene locus_tag LOCUS_70910 gene fba 1980 2843 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_70910 >Feature sequence1298 319 2280 gene locus_tag LOCUS_70920 319 2280 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948262.1 protein_id gnl|my_center|LOCUS_70920 >Feature sequence1299 1068 217 gene locus_tag LOCUS_70930 1068 217 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114402.1 protein_id gnl|my_center|LOCUS_70930 1975 1055 gene locus_tag LOCUS_70940 1975 1055 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_70940 <3032 2060 gene locus_tag LOCUS_70950 <3032 2060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003722711.1:sugar ABC transporter substrate-binding protein >Feature sequence1300 1022 1795 gene locus_tag LOCUS_70960 gene sigI 1022 1795 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181792.1 protein_id gnl|my_center|LOCUS_70960 >Feature sequence1301 1006 767 gene locus_tag LOCUS_70970 1006 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70970 1308 1478 gene locus_tag LOCUS_70980 1308 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70980 1492 1677 gene locus_tag LOCUS_70990 1492 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70990 1735 1872 gene locus_tag LOCUS_71000 1735 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71000 <3026 2020 gene locus_tag LOCUS_71010 <3026 2020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048315.1:alanine racemase >Feature sequence1302 1743 2921 gene locus_tag LOCUS_71020 1743 2921 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467385.1 protein_id gnl|my_center|LOCUS_71020 >Feature sequence1303 2542 278 gene locus_tag LOCUS_71030 2542 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71030 >Feature sequence1304 981 349 gene locus_tag LOCUS_71040 981 349 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263645.1 protein_id gnl|my_center|LOCUS_71040 2438 1089 gene locus_tag LOCUS_71050 gene mgtE 2438 1089 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_71050 <3020 2468 gene locus_tag LOCUS_71060 <3020 2468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002297086.1:polyribonucleotide nucleotidyltransferase >Feature sequence1305 >Feature sequence1306 540 1811 gene locus_tag LOCUS_71070 540 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71070 1994 2608 gene locus_tag LOCUS_71080 1994 2608 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287847.1 protein_id gnl|my_center|LOCUS_71080 >Feature sequence1307 509 1189 gene locus_tag LOCUS_71090 509 1189 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_71090 1201 2088 gene locus_tag LOCUS_71100 gene dapA 1201 2088 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_71100 2098 2850 gene locus_tag LOCUS_71110 gene dapB 2098 2850 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965675.1 protein_id gnl|my_center|LOCUS_71110 >Feature sequence1308 1096 149 gene locus_tag LOCUS_71120 1096 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71120 1738 2247 gene locus_tag LOCUS_71130 1738 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71130 2253 2885 gene locus_tag LOCUS_71140 2253 2885 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220818393.1 protein_id gnl|my_center|LOCUS_71140 >Feature sequence1309 1536 1805 gene locus_tag LOCUS_71150 1536 1805 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 protein_id gnl|my_center|LOCUS_71150 >Feature sequence1310 1232 147 gene locus_tag LOCUS_71160 1232 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71160 1819 1223 gene locus_tag LOCUS_71170 1819 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71170 2652 1969 gene locus_tag LOCUS_71180 2652 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71180 >Feature sequence1311 1880 741 gene locus_tag LOCUS_71190 gene pheA 1880 741 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_71190 2617 1880 gene locus_tag LOCUS_71200 2617 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71200 >Feature sequence1312 89 568 gene locus_tag LOCUS_71210 89 568 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067975.1 protein_id gnl|my_center|LOCUS_71210 1522 620 gene locus_tag LOCUS_71220 1522 620 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681428.1 protein_id gnl|my_center|LOCUS_71220 1719 1791 gene locus_tag LOCUS_t00500 1719 1791 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1313 430 2112 gene locus_tag LOCUS_71230 430 2112 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775554.1 protein_id gnl|my_center|LOCUS_71230 >Feature sequence1314 84 869 gene locus_tag LOCUS_71240 gene codY 84 869 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362579.1 protein_id gnl|my_center|LOCUS_71240 982 1299 gene locus_tag LOCUS_71250 982 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71250 1333 1785 gene locus_tag LOCUS_71260 1333 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665895.1 protein_id gnl|my_center|LOCUS_71260 1802 2128 gene locus_tag LOCUS_71270 1802 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033414.1 protein_id gnl|my_center|LOCUS_71270 >Feature sequence1315 413 1579 gene locus_tag LOCUS_71280 gene cytX 413 1579 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100888.1 protein_id gnl|my_center|LOCUS_71280 >Feature sequence1316 506 321 gene locus_tag LOCUS_71290 gene rpmB 506 321 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775872.1 protein_id gnl|my_center|LOCUS_71290 753 2744 gene locus_tag LOCUS_71300 gene tkt 753 2744 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964657.1 protein_id gnl|my_center|LOCUS_71300 >Feature sequence1317 <1 2889 gene locus_tag LOCUS_71310 <1 2889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986794.1:PolC-type DNA polymerase III >Feature sequence1318 253 50 gene locus_tag LOCUS_71320 253 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71320 810 253 gene locus_tag LOCUS_71330 gene frr 810 253 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430598.1 protein_id gnl|my_center|LOCUS_71330 1546 845 gene locus_tag LOCUS_71340 gene pyrH 1546 845 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430597.1 protein_id gnl|my_center|LOCUS_71340 2802 2029 gene locus_tag LOCUS_71350 2802 2029 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680889.1 protein_id gnl|my_center|LOCUS_71350 >Feature sequence1319 <2995 618 gene locus_tag LOCUS_71360 <2995 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861158.1:chromosome segregation protein SMC >Feature sequence1320 75 812 gene locus_tag LOCUS_71370 75 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71370 799 1653 gene locus_tag LOCUS_71380 799 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_71380 1664 2008 gene locus_tag LOCUS_71390 1664 2008 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_71390 2008 2604 gene locus_tag LOCUS_71400 gene recR 2008 2604 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_71400 >Feature sequence1321 381 1196 gene locus_tag LOCUS_71410 381 1196 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417310.1 protein_id gnl|my_center|LOCUS_71410 1203 2609 gene locus_tag LOCUS_71420 1203 2609 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_71420 >Feature sequence1322 801 1424 gene locus_tag LOCUS_71430 801 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71430 1546 1845 gene locus_tag LOCUS_71440 1546 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71440 1878 2189 gene locus_tag LOCUS_71450 1878 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71450 >Feature sequence1323 <1 593 gene locus_tag LOCUS_71460 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009895627.1:LytTR family DNA-binding domain-containing protein 590 1870 gene locus_tag LOCUS_71470 590 1870 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860860.1 protein_id gnl|my_center|LOCUS_71470 2154 2564 gene locus_tag LOCUS_71480 2154 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71480 >Feature sequence1324 45 719 gene locus_tag LOCUS_71490 45 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71490 1027 794 gene locus_tag LOCUS_71500 1027 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71500 1136 2512 gene locus_tag LOCUS_71510 gene mtaB 1136 2512 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964598.1 protein_id gnl|my_center|LOCUS_71510 >Feature sequence1325 179 1441 gene locus_tag LOCUS_71520 179 1441 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_71520 1446 2075 gene locus_tag LOCUS_71530 1446 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71530 >Feature sequence1326 203 1984 gene locus_tag LOCUS_71540 gene fucI 203 1984 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_71540 2003 2656 gene locus_tag LOCUS_71550 2003 2656 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286139.1 protein_id gnl|my_center|LOCUS_71550 >Feature sequence1327 <1 580 gene locus_tag LOCUS_71560 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003388628.1:YicC family protein 588 1220 gene locus_tag LOCUS_71570 gene gmk 588 1220 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_71570 1221 1466 gene locus_tag LOCUS_71580 1221 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71580 1539 2861 gene locus_tag LOCUS_71590 gene rimO 1539 2861 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_71590 >Feature sequence1328 948 229 gene locus_tag LOCUS_71600 948 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71600 >Feature sequence1329 <1 2902 gene locus_tag LOCUS_71610 <1 2902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_181146406.1:N-acetylmuramoyl-L-alanine amidase family protein >Feature sequence1330 600 223 gene locus_tag LOCUS_71620 600 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71620 865 611 gene locus_tag LOCUS_71630 865 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71630 1445 867 gene locus_tag LOCUS_71640 1445 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71640 <2966 1546 gene locus_tag LOCUS_71650 <2966 1546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000688713.1:glycoside hydrolase family 31 protein >Feature sequence1331 418 1485 gene locus_tag LOCUS_71660 418 1485 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074497.1 protein_id gnl|my_center|LOCUS_71660 1485 2420 gene locus_tag LOCUS_71670 1485 2420 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008856.1 protein_id gnl|my_center|LOCUS_71670 >Feature sequence1332 2798 1290 gene locus_tag LOCUS_71680 2798 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71680 >Feature sequence1333 853 335 gene locus_tag LOCUS_71690 gene hpt 853 335 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 protein_id gnl|my_center|LOCUS_71690 1821 1114 gene locus_tag LOCUS_71700 1821 1114 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287139.1 protein_id gnl|my_center|LOCUS_71700 2253 1987 gene locus_tag LOCUS_71710 2253 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71710 2689 2234 gene locus_tag LOCUS_71720 2689 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71720 >Feature sequence1334 1706 1578 gene locus_tag LOCUS_71730 1706 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71730 2074 1847 gene locus_tag LOCUS_71740 2074 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71740 >Feature sequence1335 1851 763 gene locus_tag LOCUS_71750 gene csaB 1851 763 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391759.1 protein_id gnl|my_center|LOCUS_71750 <2958 1844 gene locus_tag LOCUS_71760 <2958 1844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017871314.1:DUF5693 family protein >Feature sequence1336 488 1489 gene locus_tag LOCUS_71770 488 1489 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031094.1 protein_id gnl|my_center|LOCUS_71770 1767 2525 gene locus_tag LOCUS_71780 1767 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71780 >Feature sequence1337 76 2175 gene locus_tag LOCUS_71790 76 2175 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_71790 >Feature sequence1338 2036 342 gene locus_tag LOCUS_71800 2036 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71800 <2953 2046 gene locus_tag LOCUS_71810 <2953 2046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001035315.1:pneumococcal surface protein A >Feature sequence1339 256 2391 gene locus_tag LOCUS_71820 gene cooS 256 2391 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768251.1 protein_id gnl|my_center|LOCUS_71820 >Feature sequence1340 994 614 gene locus_tag LOCUS_71830 994 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71830 1643 1020 gene locus_tag LOCUS_71840 1643 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71840 2196 1657 gene locus_tag LOCUS_71850 2196 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71850 2583 2260 gene locus_tag LOCUS_71860 2583 2260 CDS product DUF1310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209550990.1 protein_id gnl|my_center|LOCUS_71860 2826 2659 gene locus_tag LOCUS_71870 2826 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71870 >Feature sequence1341 2251 794 gene locus_tag LOCUS_71880 gene guaB 2251 794 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048242.1 protein_id gnl|my_center|LOCUS_71880 <2950 2354 gene locus_tag LOCUS_71890 <2950 2354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436062.1:phosphoribosylamine--glycine ligase >Feature sequence1342 1525 950 gene locus_tag LOCUS_71900 gene rsxA 1525 950 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_71900 2207 1608 gene locus_tag LOCUS_71910 2207 1608 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_71910 2774 2217 gene locus_tag LOCUS_71920 2774 2217 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902280.1 protein_id gnl|my_center|LOCUS_71920 2949 2764 gene locus_tag LOCUS_71930 2949 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71930 >Feature sequence1343 933 1358 gene locus_tag LOCUS_71940 933 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71940 1378 1806 gene locus_tag LOCUS_71950 1378 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71950 1970 2497 gene locus_tag LOCUS_71960 1970 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71960 >Feature sequence1344 1994 270 gene locus_tag LOCUS_71970 1994 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71970 <2947 2009 gene locus_tag LOCUS_71980 <2947 2009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966833.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence1345 1892 714 gene locus_tag LOCUS_71990 1892 714 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_71990 2925 1948 gene locus_tag LOCUS_72000 2925 1948 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048435.1 protein_id gnl|my_center|LOCUS_72000 >Feature sequence1346 628 203 gene locus_tag LOCUS_72010 628 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72010 2842 632 gene locus_tag LOCUS_72020 2842 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72020 >Feature sequence1347 1584 799 gene locus_tag LOCUS_72030 1584 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72030 1942 1685 gene locus_tag LOCUS_72040 1942 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72040 2889 1978 gene locus_tag LOCUS_72050 2889 1978 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894028.1 protein_id gnl|my_center|LOCUS_72050 >Feature sequence1348 <1 814 gene locus_tag LOCUS_72060 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869417.1:flagellar hook-associated protein FlgK 849 2705 gene locus_tag LOCUS_72070 gene flgK 849 2705 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965510.1 protein_id gnl|my_center|LOCUS_72070 >Feature sequence1349 249 1529 gene locus_tag LOCUS_72080 249 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72080 >Feature sequence1350 1986 247 gene locus_tag LOCUS_72090 gene dnaG 1986 247 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_72090 <2941 1997 gene locus_tag LOCUS_72100 <2941 1997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583673.1:deoxyguanosinetriphosphate triphosphohydrolase >Feature sequence1351 1014 2939 gene locus_tag LOCUS_72110 gene ilvB 1014 2939 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_72110 >Feature sequence1352 219 2459 gene locus_tag LOCUS_72120 gene pflB 219 2459 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_72120 >Feature sequence1353 418 1749 gene locus_tag LOCUS_72130 418 1749 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964763.1 protein_id gnl|my_center|LOCUS_72130 1742 2395 gene locus_tag LOCUS_72140 1742 2395 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263457.1 protein_id gnl|my_center|LOCUS_72140 >Feature sequence1354 186 1097 gene locus_tag LOCUS_72150 186 1097 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_72150 1090 2106 gene locus_tag LOCUS_72160 gene tsaD 1090 2106 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_72160 2108 2815 gene locus_tag LOCUS_72170 gene ispD 2108 2815 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048363.1 protein_id gnl|my_center|LOCUS_72170 >Feature sequence1355 <1 604 gene locus_tag LOCUS_72180 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814361.1:TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein 951 1364 gene locus_tag LOCUS_72190 951 1364 CDS product DUF4418 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679162.1 protein_id gnl|my_center|LOCUS_72190 1383 2051 gene locus_tag LOCUS_72200 1383 2051 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956980.1 protein_id gnl|my_center|LOCUS_72200 >Feature sequence1356 2550 1012 gene locus_tag LOCUS_72210 gene murJ 2550 1012 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966328.1 protein_id gnl|my_center|LOCUS_72210 >Feature sequence1357 2769 337 gene locus_tag LOCUS_72220 2769 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72220 >Feature sequence1358 1366 152 gene locus_tag LOCUS_72230 1366 152 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291561.1 protein_id gnl|my_center|LOCUS_72230 1698 1468 gene locus_tag LOCUS_72240 1698 1468 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905235.1 protein_id gnl|my_center|LOCUS_72240 2549 2220 gene locus_tag LOCUS_72250 2549 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72250 >Feature sequence1359 851 306 gene locus_tag LOCUS_72260 851 306 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_72260 1603 851 gene locus_tag LOCUS_72270 1603 851 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_72270 2659 1607 gene locus_tag LOCUS_72280 2659 1607 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_72280 >Feature sequence1360 2784 1609 gene locus_tag LOCUS_72290 gene cls 2784 1609 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966588.1 protein_id gnl|my_center|LOCUS_72290 >Feature sequence1361 1416 643 gene locus_tag LOCUS_72300 gene phnC 1416 643 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548759.1 protein_id gnl|my_center|LOCUS_72300 2395 1418 gene locus_tag LOCUS_72310 2395 1418 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169047059.1 protein_id gnl|my_center|LOCUS_72310 >Feature sequence1362 346 576 gene locus_tag LOCUS_72320 346 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72320 569 1378 gene locus_tag LOCUS_72330 569 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72330 >Feature sequence1363 <1 602 gene locus_tag LOCUS_72340 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015777117.1:DUF4091 domain-containing protein 604 1752 gene locus_tag LOCUS_72350 604 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72350 >Feature sequence1364 675 1886 gene locus_tag LOCUS_72360 675 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72360 1954 2646 gene locus_tag LOCUS_72370 gene cysE 1954 2646 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459083.1 protein_id gnl|my_center|LOCUS_72370 >Feature sequence1365 1768 932 gene locus_tag LOCUS_72380 1768 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72380 2438 1788 gene locus_tag LOCUS_72390 2438 1788 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245470.1 protein_id gnl|my_center|LOCUS_72390 2905 2444 gene locus_tag LOCUS_72400 2905 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72400 >Feature sequence1366 7 678 gene locus_tag LOCUS_72410 7 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72410 810 1844 gene locus_tag LOCUS_72420 810 1844 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368732.1 protein_id gnl|my_center|LOCUS_72420 1929 2780 gene locus_tag LOCUS_72430 1929 2780 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860782.1 protein_id gnl|my_center|LOCUS_72430 >Feature sequence1367 183 1370 gene locus_tag LOCUS_72440 gene deoB 183 1370 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046067.1 protein_id gnl|my_center|LOCUS_72440 1381 2202 gene locus_tag LOCUS_72450 1381 2202 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986426.1 protein_id gnl|my_center|LOCUS_72450 2643 2843 gene locus_tag LOCUS_72460 2643 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72460 >Feature sequence1368 <1 1198 gene locus_tag LOCUS_72470 <1 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476101.1:aminotransferase class V-fold PLP-dependent enzyme 1503 1742 gene locus_tag LOCUS_72480 1503 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72480 >Feature sequence1369 176 490 gene locus_tag LOCUS_72490 176 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72490 2400 1024 gene locus_tag LOCUS_72500 2400 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531676.1 protein_id gnl|my_center|LOCUS_72500 >Feature sequence1370 142 1377 gene locus_tag LOCUS_72510 142 1377 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966819.1 protein_id gnl|my_center|LOCUS_72510 1521 1910 gene locus_tag LOCUS_72520 1521 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72520 1922 2332 gene locus_tag LOCUS_72530 1922 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_72530 2363 2521 gene locus_tag LOCUS_72540 2363 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_72540 >Feature sequence1371 13 708 gene locus_tag LOCUS_72550 13 708 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_72550 698 1477 gene locus_tag LOCUS_72560 698 1477 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292113.1 protein_id gnl|my_center|LOCUS_72560 1999 1571 gene locus_tag LOCUS_72570 1999 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722815.1 protein_id gnl|my_center|LOCUS_72570 >Feature sequence1372 1077 523 gene locus_tag LOCUS_72580 gene yfcE 1077 523 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966036.1 protein_id gnl|my_center|LOCUS_72580 1683 1096 gene locus_tag LOCUS_72590 1683 1096 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947081.1 protein_id gnl|my_center|LOCUS_72590 2695 1727 gene locus_tag LOCUS_72600 gene holA 2695 1727 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282563.1 protein_id gnl|my_center|LOCUS_72600 >Feature sequence1373 801 1241 gene locus_tag LOCUS_72610 801 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72610 >Feature sequence1374 >Feature sequence1375 1174 161 gene locus_tag LOCUS_72620 1174 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72620 2289 1192 gene locus_tag LOCUS_72630 2289 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72630 >Feature sequence1376 828 1247 gene locus_tag LOCUS_72640 828 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948562.1 protein_id gnl|my_center|LOCUS_72640 2855 1323 gene locus_tag LOCUS_72650 2855 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72650 >Feature sequence1377 1003 218 gene locus_tag LOCUS_72660 1003 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72660 2532 2699 gene locus_tag LOCUS_72670 2532 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_72670 >Feature sequence1378 1266 1667 gene locus_tag LOCUS_72680 1266 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72680 1673 2155 gene locus_tag LOCUS_72690 1673 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72690 >Feature sequence1379 <2880 2097 gene locus_tag LOCUS_72700 <2880 2097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289130.1:carbohydrate ABC transporter permease >Feature sequence1380 <1 807 gene locus_tag LOCUS_72710 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815292.1:DNA-binding transcriptional regulator CytR 2098 959 gene locus_tag LOCUS_72720 2098 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72720 >Feature sequence1381 738 2705 gene locus_tag LOCUS_72730 738 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72730 >Feature sequence1382 2554 1115 gene locus_tag LOCUS_72740 2554 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72740 >Feature sequence1383 381 1313 gene locus_tag LOCUS_72750 381 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72750 1433 1708 gene locus_tag LOCUS_72760 gene flgM 1433 1708 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451387.1 protein_id gnl|my_center|LOCUS_72760 1689 2213 gene locus_tag LOCUS_72770 1689 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72770 >Feature sequence1384 <2877 118 gene locus_tag LOCUS_72780 <2877 118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000753855.1:choline-binding protein PcpA >Feature sequence1385 1450 116 gene locus_tag LOCUS_72790 gene gdhA 1450 116 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_72790 1700 2359 gene locus_tag LOCUS_72800 1700 2359 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813444.1 protein_id gnl|my_center|LOCUS_72800 >Feature sequence1386 25 1335 gene locus_tag LOCUS_72810 25 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72810 1346 2044 gene locus_tag LOCUS_72820 1346 2044 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294560.1 protein_id gnl|my_center|LOCUS_72820 2049 2627 gene locus_tag LOCUS_72830 2049 2627 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_72830 >Feature sequence1387 15 1649 gene locus_tag LOCUS_72840 15 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72840 1689 2834 gene locus_tag LOCUS_72850 1689 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72850 >Feature sequence1388 419 81 gene locus_tag LOCUS_72860 gene rsfS 419 81 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_72860 1013 420 gene locus_tag LOCUS_72870 gene yqeK 1013 420 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078477.1 protein_id gnl|my_center|LOCUS_72870 1614 1006 gene locus_tag LOCUS_72880 gene nadD 1614 1006 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841927.1 protein_id gnl|my_center|LOCUS_72880 1912 1616 gene locus_tag LOCUS_72890 gene yhbY 1912 1616 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_72890 <2874 1924 gene locus_tag LOCUS_72900 <2874 1924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964572.1:GTPase ObgE >Feature sequence1389 1345 101 gene locus_tag LOCUS_72910 gene dinB 1345 101 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989855.1 protein_id gnl|my_center|LOCUS_72910 2811 1351 gene locus_tag LOCUS_72920 2811 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72920 >Feature sequence1390 307 2307 gene locus_tag LOCUS_72930 307 2307 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_72930 2331 2753 gene locus_tag LOCUS_72940 2331 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72940 >Feature sequence1391 >Feature sequence1392 798 1532 gene locus_tag LOCUS_72950 798 1532 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_72950 1543 1728 gene locus_tag LOCUS_72960 1543 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72960 2488 2802 gene locus_tag LOCUS_72970 2488 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72970 >Feature sequence1393 109 744 gene locus_tag LOCUS_72980 109 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72980 698 1750 gene locus_tag LOCUS_72990 gene dnaN 698 1750 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_72990 1765 2148 gene locus_tag LOCUS_73000 1765 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73000 2150 2302 gene locus_tag LOCUS_73010 2150 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73010 2325 2843 gene locus_tag LOCUS_73020 2325 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73020 >Feature sequence1394 1363 143 gene locus_tag LOCUS_73030 1363 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73030 2482 1889 gene locus_tag LOCUS_73040 2482 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73040 >Feature sequence1395 387 1697 gene locus_tag LOCUS_73050 387 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73050 1707 2384 gene locus_tag LOCUS_73060 gene cutC 1707 2384 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356490.1 protein_id gnl|my_center|LOCUS_73060 >Feature sequence1396 1733 270 gene locus_tag LOCUS_73070 1733 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73070 1936 2286 gene locus_tag LOCUS_73080 1936 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73080 2724 2290 gene locus_tag LOCUS_73090 gene dutA 2724 2290 CDS product dUTP diphosphatase DutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245820.1 protein_id gnl|my_center|LOCUS_73090 >Feature sequence1397 781 218 gene locus_tag LOCUS_73100 gene lepB 781 218 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870097.1 protein_id gnl|my_center|LOCUS_73100 >Feature sequence1398 <1 1415 gene locus_tag LOCUS_73110 <1 1415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056768.1:diguanylate cyclase 1435 2019 gene locus_tag LOCUS_73120 1435 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73120 2040 2735 gene locus_tag LOCUS_73130 2040 2735 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_73130 >Feature sequence1399 1214 273 gene locus_tag LOCUS_73140 1214 273 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 protein_id gnl|my_center|LOCUS_73140 2479 1271 gene locus_tag LOCUS_73150 gene ftsY 2479 1271 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861159.1 protein_id gnl|my_center|LOCUS_73150 >Feature sequence1400 430 1638 gene locus_tag LOCUS_73160 430 1638 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_73160 1754 2353 gene locus_tag LOCUS_73170 1754 2353 CDS product DMP19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016782.1 protein_id gnl|my_center|LOCUS_73170 >Feature sequence1401 >Feature sequence1402 2038 752 gene locus_tag LOCUS_73180 2038 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73180 2614 2282 gene locus_tag LOCUS_73190 gene rnpA 2614 2282 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_73190 2822 2688 gene locus_tag LOCUS_73200 gene rpmH 2822 2688 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831901.1 protein_id gnl|my_center|LOCUS_73200 >Feature sequence1403 1472 501 gene locus_tag LOCUS_73210 1472 501 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_73210 2058 1465 gene locus_tag LOCUS_73220 2058 1465 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963621.1 protein_id gnl|my_center|LOCUS_73220 <2862 2064 gene locus_tag LOCUS_73230 <2862 2064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861997.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence1404 881 1705 gene locus_tag LOCUS_73240 881 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73240 >Feature sequence1405 29 694 gene locus_tag LOCUS_73250 29 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462299.1 protein_id gnl|my_center|LOCUS_73250 679 1518 gene locus_tag LOCUS_73260 gene eutJ 679 1518 CDS product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986622.1 protein_id gnl|my_center|LOCUS_73260 1538 1843 gene locus_tag LOCUS_73270 1538 1843 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815265.1 protein_id gnl|my_center|LOCUS_73270 1837 2106 gene locus_tag LOCUS_73280 1837 2106 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361873.1 protein_id gnl|my_center|LOCUS_73280 >Feature sequence1406 529 1959 gene locus_tag LOCUS_73290 529 1959 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903800.1 protein_id gnl|my_center|LOCUS_73290 >Feature sequence1407 <1 2610 gene locus_tag LOCUS_73300 <1 2610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016607.1:TIR domain-containing protein >Feature sequence1408 >Feature sequence1409 376 2307 gene locus_tag LOCUS_73310 376 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73310 >Feature sequence1410 387 704 gene locus_tag LOCUS_73320 gene rpsJ 387 704 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357250.1 protein_id gnl|my_center|LOCUS_73320 782 1459 gene locus_tag LOCUS_73330 gene rplC 782 1459 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966412.1 protein_id gnl|my_center|LOCUS_73330 1482 2102 gene locus_tag LOCUS_73340 gene rplD 1482 2102 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_73340 2102 2401 gene locus_tag LOCUS_73350 gene rplW 2102 2401 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_73350 >Feature sequence1411 2818 974 gene locus_tag LOCUS_73360 2818 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73360 >Feature sequence1412 407 1771 gene locus_tag LOCUS_73370 407 1771 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061331.1 protein_id gnl|my_center|LOCUS_73370 >Feature sequence1413 <1 2336 gene locus_tag LOCUS_73380 <1 2336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000416815.1:DUF2974 domain-containing protein 2515 2333 gene locus_tag LOCUS_73390 2515 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73390 >Feature sequence1414 638 1417 gene locus_tag LOCUS_73400 638 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73400 1410 2264 gene locus_tag LOCUS_73410 1410 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73410 >Feature sequence1415 810 1811 gene locus_tag LOCUS_73420 810 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73420 1821 2195 gene locus_tag LOCUS_73430 1821 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73430 2496 2660 gene locus_tag LOCUS_73440 2496 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73440 >Feature sequence1416 2500 1406 gene locus_tag LOCUS_73450 2500 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73450 >Feature sequence1417 22 492 gene locus_tag LOCUS_73460 gene rpsG 22 492 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357613.1 protein_id gnl|my_center|LOCUS_73460 507 2624 gene locus_tag LOCUS_73470 gene fusA 507 2624 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436178.1 protein_id gnl|my_center|LOCUS_73470 >Feature sequence1418 334 1725 gene locus_tag LOCUS_73480 gene hydA 334 1725 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891590.1 protein_id gnl|my_center|LOCUS_73480 >Feature sequence1419 107 886 gene locus_tag LOCUS_73490 107 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73490 896 1924 gene locus_tag LOCUS_73500 896 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73500 1935 2639 gene locus_tag LOCUS_73510 1935 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73510 >Feature sequence1420 102 968 gene locus_tag LOCUS_73520 102 968 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948181.1 protein_id gnl|my_center|LOCUS_73520 1248 2534 gene locus_tag LOCUS_73530 1248 2534 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016781.1 protein_id gnl|my_center|LOCUS_73530 >Feature sequence1421 <1 660 gene locus_tag LOCUS_73540 <1 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583089.1:cysteine desulfurase NifS 823 1839 gene locus_tag LOCUS_73550 823 1839 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 protein_id gnl|my_center|LOCUS_73550 >Feature sequence1422 395 1531 gene locus_tag LOCUS_73560 gene nagA 395 1531 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775571.1 protein_id gnl|my_center|LOCUS_73560 1624 2373 gene locus_tag LOCUS_73570 1624 2373 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437811.1 protein_id gnl|my_center|LOCUS_73570 2395 2616 gene locus_tag LOCUS_73580 2395 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73580 >Feature sequence1423 211 1152 gene locus_tag LOCUS_73590 gene hprK 211 1152 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_73590 1217 2152 gene locus_tag LOCUS_73600 1217 2152 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_73600 >Feature sequence1424 508 1992 gene locus_tag LOCUS_73610 508 1992 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_73610 2081 2437 gene locus_tag LOCUS_73620 2081 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73620 >Feature sequence1425 2026 839 gene locus_tag LOCUS_73630 2026 839 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948371.1 protein_id gnl|my_center|LOCUS_73630 2709 2308 gene locus_tag LOCUS_73640 2709 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73640 >Feature sequence1426 1960 1385 gene locus_tag LOCUS_73650 1960 1385 CDS product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922738.1 protein_id gnl|my_center|LOCUS_73650 >Feature sequence1427 302 994 gene locus_tag LOCUS_73660 302 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73660 1006 1647 gene locus_tag LOCUS_73670 1006 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73670 1744 1941 gene locus_tag LOCUS_73680 1744 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73680 >Feature sequence1428 1886 474 gene locus_tag LOCUS_73690 1886 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73690 <2818 1876 gene locus_tag LOCUS_73700 <2818 1876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016728782.1:CCA tRNA nucleotidyltransferase >Feature sequence1429 341 1303 gene locus_tag LOCUS_73710 341 1303 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964762.1 protein_id gnl|my_center|LOCUS_73710 1305 2636 gene locus_tag LOCUS_73720 1305 2636 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964763.1 protein_id gnl|my_center|LOCUS_73720 >Feature sequence1430 2691 283 gene locus_tag LOCUS_73730 2691 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224695.1 protein_id gnl|my_center|LOCUS_73730 >Feature sequence1431 1788 1294 gene locus_tag LOCUS_73740 gene ybeY 1788 1294 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964605.1 protein_id gnl|my_center|LOCUS_73740 <2812 1845 gene locus_tag LOCUS_73750 <2812 1845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861553.1:PhoH family protein >Feature sequence1432 687 91 gene locus_tag LOCUS_73760 gene recR 687 91 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_73760 1035 691 gene locus_tag LOCUS_73770 1035 691 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_73770 2630 1047 gene locus_tag LOCUS_73780 gene dnaX 2630 1047 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421622.1 protein_id gnl|my_center|LOCUS_73780 >Feature sequence1433 1855 17 gene locus_tag LOCUS_73790 1855 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73790 2680 1865 gene locus_tag LOCUS_73800 2680 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73800 >Feature sequence1434 46 555 gene locus_tag LOCUS_73810 gene lspA 46 555 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364048.1 protein_id gnl|my_center|LOCUS_73810 558 1463 gene locus_tag LOCUS_73820 558 1463 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_73820 1491 2123 gene locus_tag LOCUS_73830 1491 2123 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_73830 >Feature sequence1435 424 2049 gene locus_tag LOCUS_73840 424 2049 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434813.1 protein_id gnl|my_center|LOCUS_73840 >Feature sequence1436 638 1090 gene locus_tag LOCUS_73850 638 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73850 1100 1504 gene locus_tag LOCUS_73860 1100 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73860 1485 2705 gene locus_tag LOCUS_73870 1485 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73870 >Feature sequence1437 18 1010 gene locus_tag LOCUS_73880 18 1010 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_73880 1049 1543 gene locus_tag LOCUS_73890 gene ybeY 1049 1543 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047996.1 protein_id gnl|my_center|LOCUS_73890 >Feature sequence1438 1715 2515 gene locus_tag LOCUS_73900 gene thiD 1715 2515 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948480.1 protein_id gnl|my_center|LOCUS_73900 >Feature sequence1439 <1 821 gene locus_tag LOCUS_73910 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775387.1:zinc ABC transporter substrate-binding protein 1430 2143 gene locus_tag LOCUS_73920 1430 2143 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678718.1 protein_id gnl|my_center|LOCUS_73920 >Feature sequence1440 1103 9 gene locus_tag LOCUS_73930 gene araR 1103 9 CDS product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 protein_id gnl|my_center|LOCUS_73930 2691 1096 gene locus_tag LOCUS_73940 2691 1096 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_73940 >Feature sequence1441 348 1268 gene locus_tag LOCUS_73950 348 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73950 1368 1673 gene locus_tag LOCUS_73960 1368 1673 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357450.1 protein_id gnl|my_center|LOCUS_73960 >Feature sequence1442 >Feature sequence1443 1774 1025 gene locus_tag LOCUS_73970 gene trmD 1774 1025 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384686.1 protein_id gnl|my_center|LOCUS_73970 2286 1777 gene locus_tag LOCUS_73980 gene rimM 2286 1777 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_73980 2591 2364 gene locus_tag LOCUS_73990 2591 2364 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941305.1 protein_id gnl|my_center|LOCUS_73990 >Feature sequence1444 244 1191 gene locus_tag LOCUS_74000 244 1191 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_74000 1220 1441 gene locus_tag LOCUS_74010 1220 1441 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809979.1 protein_id gnl|my_center|LOCUS_74010 2790 1456 gene locus_tag LOCUS_74020 2790 1456 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678766.1 protein_id gnl|my_center|LOCUS_74020 >Feature sequence1445 432 151 gene locus_tag LOCUS_74030 432 151 CDS product CD1845 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860780.1 protein_id gnl|my_center|LOCUS_74030 698 429 gene locus_tag LOCUS_74040 698 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74040 1818 679 gene locus_tag LOCUS_74050 1818 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74050 2702 1815 gene locus_tag LOCUS_74060 2702 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74060 >Feature sequence1446 36 1394 gene locus_tag LOCUS_74070 36 1394 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972116.1 protein_id gnl|my_center|LOCUS_74070 1492 2382 gene locus_tag LOCUS_74080 1492 2382 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803743.1 protein_id gnl|my_center|LOCUS_74080 >Feature sequence1447 587 312 gene locus_tag LOCUS_74090 587 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74090 2094 733 gene locus_tag LOCUS_74100 2094 733 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_74100 >Feature sequence1448 2087 687 gene locus_tag LOCUS_74110 2087 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329694.1 protein_id gnl|my_center|LOCUS_74110 >Feature sequence1449 >Feature sequence1450 399 809 gene locus_tag LOCUS_74120 399 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74120 864 2228 gene locus_tag LOCUS_74130 gene radA 864 2228 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_74130 2253 2720 gene locus_tag LOCUS_74140 gene ybaK 2253 2720 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_74140 >Feature sequence1451 1521 1 gene locus_tag LOCUS_74150 1521 1 CDS product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262245.1 protein_id gnl|my_center|LOCUS_74150 2255 1518 gene locus_tag LOCUS_74160 2255 1518 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262244.1 protein_id gnl|my_center|LOCUS_74160 2751 2302 gene locus_tag LOCUS_74170 2751 2302 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651443.1 protein_id gnl|my_center|LOCUS_74170 >Feature sequence1452 410 589 gene locus_tag LOCUS_74180 410 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74180 618 1400 gene locus_tag LOCUS_74190 618 1400 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 protein_id gnl|my_center|LOCUS_74190 1393 2271 gene locus_tag LOCUS_74200 1393 2271 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355975.1 protein_id gnl|my_center|LOCUS_74200 >Feature sequence1453 335 979 gene locus_tag LOCUS_74210 335 979 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_74210 1148 1777 gene locus_tag LOCUS_74220 1148 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74220 >Feature sequence1454 <1 905 gene locus_tag LOCUS_74230 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083710.1:acyl CoA:acetate/3-ketoacid CoA transferase 929 2329 gene locus_tag LOCUS_74240 929 2329 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819390.1 protein_id gnl|my_center|LOCUS_74240 >Feature sequence1455 <1 1010 gene locus_tag LOCUS_74250 <1 1010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966142.1:rod shape-determining protein >Feature sequence1456 40 1047 gene locus_tag LOCUS_74260 40 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74260 1044 1523 gene locus_tag LOCUS_74270 1044 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74270 >Feature sequence1457 1033 257 gene locus_tag LOCUS_74280 1033 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74280 1359 2153 gene locus_tag LOCUS_74290 gene yqeB 1359 2153 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047954.1 protein_id gnl|my_center|LOCUS_74290 >Feature sequence1458 1617 406 gene locus_tag LOCUS_74300 1617 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74300 2742 1645 gene locus_tag LOCUS_74310 gene mnmA 2742 1645 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_74310 >Feature sequence1459 861 1253 gene locus_tag LOCUS_74320 861 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74320 1332 1925 gene locus_tag LOCUS_74330 1332 1925 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048294.1 protein_id gnl|my_center|LOCUS_74330 1918 2148 gene locus_tag LOCUS_74340 1918 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74340 >Feature sequence1460 <1 757 gene locus_tag LOCUS_74350 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032916282.1:histidine ammonia-lyase 1421 1164 gene locus_tag LOCUS_74360 1421 1164 CDS product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291476.1 protein_id gnl|my_center|LOCUS_74360 1846 2598 gene locus_tag LOCUS_74370 1846 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74370 >Feature sequence1461 1037 600 gene locus_tag LOCUS_74380 1037 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74380 1439 1765 gene locus_tag LOCUS_74390 1439 1765 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963892.1 protein_id gnl|my_center|LOCUS_74390 1767 2354 gene locus_tag LOCUS_74400 1767 2354 CDS product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963893.1 protein_id gnl|my_center|LOCUS_74400 >Feature sequence1462 1201 581 gene locus_tag LOCUS_74410 1201 581 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679289.1 protein_id gnl|my_center|LOCUS_74410 <2774 1835 gene locus_tag LOCUS_74420 <2774 1835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898714.1:transcription termination factor Rho >Feature sequence1463 555 151 gene locus_tag LOCUS_74430 555 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74430 1912 620 gene locus_tag LOCUS_74440 1912 620 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_74440 >Feature sequence1464 58 2700 gene locus_tag LOCUS_74450 58 2700 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_74450 >Feature sequence1465 1377 292 gene locus_tag LOCUS_74460 gene leuB 1377 292 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880105.1 protein_id gnl|my_center|LOCUS_74460 <2770 1809 gene locus_tag LOCUS_74470 <2770 1809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454735.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB >Feature sequence1466 1150 539 gene locus_tag LOCUS_74480 1150 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74480 1866 1411 gene locus_tag LOCUS_74490 1866 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74490 2662 1994 gene locus_tag LOCUS_74500 2662 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74500 >Feature sequence1467 1498 1568 gene locus_tag LOCUS_t00510 1498 1568 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1665 2339 gene locus_tag LOCUS_74510 1665 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74510 >Feature sequence1468 588 1535 gene locus_tag LOCUS_74520 588 1535 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861474.1 protein_id gnl|my_center|LOCUS_74520 <2765 1585 gene locus_tag LOCUS_74530 <2765 1585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016728782.1:CCA tRNA nucleotidyltransferase >Feature sequence1469 1663 59 gene locus_tag LOCUS_74540 1663 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74540 1893 1699 gene locus_tag LOCUS_74550 1893 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74550 2676 1921 gene locus_tag LOCUS_74560 2676 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74560 >Feature sequence1470 191 27 gene locus_tag LOCUS_74570 191 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74570 497 294 gene locus_tag LOCUS_74580 497 294 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861845.1 protein_id gnl|my_center|LOCUS_74580 916 500 gene locus_tag LOCUS_74590 916 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74590 2516 1032 gene locus_tag LOCUS_74600 2516 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74600 >Feature sequence1471 76 1569 gene locus_tag LOCUS_74610 gene cobA 76 1569 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898657.1 protein_id gnl|my_center|LOCUS_74610 >Feature sequence1472 <2761 2049 gene locus_tag LOCUS_74620 <2761 2049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861472.1:VanW family protein >Feature sequence1473 <1 1753 gene locus_tag LOCUS_74630 <1 1753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898459.1:Na/Pi cotransporter family protein 2087 1830 gene locus_tag LOCUS_74640 2087 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74640 >Feature sequence1474 1083 325 gene locus_tag LOCUS_74650 1083 325 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588546.1 protein_id gnl|my_center|LOCUS_74650 >Feature sequence1475 <1 1022 gene locus_tag LOCUS_74660 <1 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259581.1:GHMP kinase 1044 1685 gene locus_tag LOCUS_74670 1044 1685 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_74670 1689 1829 gene locus_tag LOCUS_74680 1689 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74680 >Feature sequence1476 15 965 gene locus_tag LOCUS_74690 15 965 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_74690 >Feature sequence1477 652 1401 gene locus_tag LOCUS_74700 gene rpsB 652 1401 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424537.1 protein_id gnl|my_center|LOCUS_74700 1742 2680 gene locus_tag LOCUS_74710 gene tsf 1742 2680 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_74710 >Feature sequence1478 <2754 332 gene locus_tag LOCUS_74720 <2754 332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964962.1:phosphoribosylformylglycinamidine synthase >Feature sequence1479 1720 1016 gene locus_tag LOCUS_74730 1720 1016 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_74730 2698 2126 gene locus_tag LOCUS_74740 2698 2126 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956720.1 protein_id gnl|my_center|LOCUS_74740 >Feature sequence1480 <1 1292 gene locus_tag LOCUS_74750 <1 1292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003358861.1:WG repeat-containing protein 1479 1610 gene locus_tag LOCUS_74760 1479 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74760 1688 2404 gene locus_tag LOCUS_74770 1688 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74770 2538 2732 gene locus_tag LOCUS_74780 2538 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74780 >Feature sequence1481 348 1163 gene locus_tag LOCUS_74790 gene rsmI 348 1163 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_74790 1313 2068 gene locus_tag LOCUS_74800 1313 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74800 >Feature sequence1482 33 821 gene locus_tag LOCUS_74810 33 821 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_74810 >Feature sequence1483 368 736 gene locus_tag LOCUS_74820 gene rpsM 368 736 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421125.1 protein_id gnl|my_center|LOCUS_74820 762 1163 gene locus_tag LOCUS_74830 gene rpsK 762 1163 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_74830 1209 2150 gene locus_tag LOCUS_74840 1209 2150 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427733.1 protein_id gnl|my_center|LOCUS_74840 2179 2520 gene locus_tag LOCUS_74850 gene rplQ 2179 2520 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421117.1 protein_id gnl|my_center|LOCUS_74850 >Feature sequence1484 2710 1427 gene locus_tag LOCUS_74860 gene clpX 2710 1427 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_74860 >Feature sequence1485 <2739 1312 gene locus_tag LOCUS_74870 <2739 1312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860946.1:ATP-dependent helicase >Feature sequence1486 1094 78 gene locus_tag LOCUS_74880 1094 78 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392149.1 protein_id gnl|my_center|LOCUS_74880 2144 1602 gene locus_tag LOCUS_74890 2144 1602 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861803.1 protein_id gnl|my_center|LOCUS_74890 2653 2141 gene locus_tag LOCUS_74900 2653 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869496.1 protein_id gnl|my_center|LOCUS_74900 >Feature sequence1487 209 1291 gene locus_tag LOCUS_74910 gene serC 209 1291 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_74910 1301 2464 gene locus_tag LOCUS_74920 1301 2464 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_74920 2496 2630 gene locus_tag LOCUS_74930 2496 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74930 >Feature sequence1488 >Feature sequence1489 758 159 gene locus_tag LOCUS_74940 758 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74940 2722 758 gene locus_tag LOCUS_74950 2722 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74950 >Feature sequence1490 <1 789 gene locus_tag LOCUS_74960 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861551.1:glycine--tRNA ligase subunit beta 1413 862 gene locus_tag LOCUS_74970 1413 862 CDS product DUF4342 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964609.1 protein_id gnl|my_center|LOCUS_74970 2170 1391 gene locus_tag LOCUS_74980 gene recO 2170 1391 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518908.1 protein_id gnl|my_center|LOCUS_74980 2690 2187 gene locus_tag LOCUS_74990 2690 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74990 >Feature sequence1491 111 1694 gene locus_tag LOCUS_75000 111 1694 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582720.1 protein_id gnl|my_center|LOCUS_75000 >Feature sequence1492 399 2471 gene locus_tag LOCUS_75010 gene pnp 399 2471 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_75010 >Feature sequence1493 <1 1293 gene locus_tag LOCUS_75020 <1 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965974.1:alpha-amylase family glycosyl hydrolase 1637 1383 gene locus_tag LOCUS_75030 1637 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75030 >Feature sequence1494 2683 1001 gene locus_tag LOCUS_75040 gene oppA 2683 1001 CDS product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232957.1 protein_id gnl|my_center|LOCUS_75040 >Feature sequence1495 2511 1915 gene locus_tag LOCUS_75050 2511 1915 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681326.1 protein_id gnl|my_center|LOCUS_75050 >Feature sequence1496 475 1149 gene locus_tag LOCUS_75060 475 1149 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_75060 1168 2424 gene locus_tag LOCUS_75070 1168 2424 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814514.1 protein_id gnl|my_center|LOCUS_75070 >Feature sequence1497 2285 1767 gene locus_tag LOCUS_75080 2285 1767 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432371.1 protein_id gnl|my_center|LOCUS_75080 >Feature sequence1498 2038 74 gene locus_tag LOCUS_75090 2038 74 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903241.1 protein_id gnl|my_center|LOCUS_75090 >Feature sequence1499 1126 2073 gene locus_tag LOCUS_75100 1126 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75100 >Feature sequence1500 2707 1916 gene locus_tag LOCUS_75110 2707 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75110 >Feature sequence1501 411 833 gene locus_tag LOCUS_75120 411 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_75120 782 994 gene locus_tag LOCUS_75130 782 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_75130 987 1820 gene locus_tag LOCUS_75140 987 1820 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775600.1 protein_id gnl|my_center|LOCUS_75140 1852 1977 gene locus_tag LOCUS_75150 1852 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75150 2166 2363 gene locus_tag LOCUS_75160 2166 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75160 2377 2568 gene locus_tag LOCUS_75170 2377 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75170 >Feature sequence1502 894 1469 gene locus_tag LOCUS_75180 894 1469 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963621.1 protein_id gnl|my_center|LOCUS_75180 1479 2465 gene locus_tag LOCUS_75190 1479 2465 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_75190 >Feature sequence1503 >Feature sequence1504 494 1510 gene locus_tag LOCUS_75200 gene fliG 494 1510 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 protein_id gnl|my_center|LOCUS_75200 1503 2324 gene locus_tag LOCUS_75210 1503 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75210 >Feature sequence1505 412 756 gene locus_tag LOCUS_75220 412 756 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_75220 1280 840 gene locus_tag LOCUS_75230 1280 840 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041894.1 protein_id gnl|my_center|LOCUS_75230 <2716 1438 gene locus_tag LOCUS_75240 <2716 1438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016921.1:S9 family peptidase >Feature sequence1506 993 79 gene locus_tag LOCUS_75250 993 79 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085299.1 protein_id gnl|my_center|LOCUS_75250 2163 1078 gene locus_tag LOCUS_75260 2163 1078 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379407.1 protein_id gnl|my_center|LOCUS_75260 >Feature sequence1507 44 679 gene locus_tag LOCUS_75270 44 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75270 691 1620 gene locus_tag LOCUS_75280 691 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75280 1623 1928 gene locus_tag LOCUS_75290 1623 1928 CDS product phage head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047643.1 protein_id gnl|my_center|LOCUS_75290 1928 2050 gene locus_tag LOCUS_75300 1928 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75300 2040 2393 gene locus_tag LOCUS_75310 2040 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75310 2393 2683 gene locus_tag LOCUS_75320 2393 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75320 >Feature sequence1508 1544 114 gene locus_tag LOCUS_75330 1544 114 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680081.1 protein_id gnl|my_center|LOCUS_75330 2433 1687 gene locus_tag LOCUS_75340 2433 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75340 >Feature sequence1509 628 1071 gene locus_tag LOCUS_75350 628 1071 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229083.1 protein_id gnl|my_center|LOCUS_75350 1318 2709 gene locus_tag LOCUS_75360 1318 2709 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681107.1 protein_id gnl|my_center|LOCUS_75360 >Feature sequence1510 819 1217 gene locus_tag LOCUS_75370 819 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75370 1259 2152 gene locus_tag LOCUS_75380 1259 2152 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_75380 >Feature sequence1511 1934 825 gene locus_tag LOCUS_75390 1934 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75390 2709 1954 gene locus_tag LOCUS_75400 2709 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75400 >Feature sequence1512 2370 418 gene locus_tag LOCUS_75410 gene ligA 2370 418 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545963.1 protein_id gnl|my_center|LOCUS_75410 >Feature sequence1513 2036 759 gene locus_tag LOCUS_75420 2036 759 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_75420 <2710 2029 gene locus_tag LOCUS_75430 <2710 2029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986379.1:tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA >Feature sequence1514 428 1270 gene locus_tag LOCUS_75440 428 1270 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641097.1 protein_id gnl|my_center|LOCUS_75440 1401 1622 gene locus_tag LOCUS_75450 1401 1622 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809979.1 protein_id gnl|my_center|LOCUS_75450 2002 2577 gene locus_tag LOCUS_75460 2002 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75460 >Feature sequence1515 2240 2695 gene locus_tag LOCUS_75470 2240 2695 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770492.1 protein_id gnl|my_center|LOCUS_75470 >Feature sequence1516 1198 296 gene locus_tag LOCUS_75480 1198 296 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_75480 1328 2497 gene locus_tag LOCUS_75490 1328 2497 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 protein_id gnl|my_center|LOCUS_75490 >Feature sequence1517 991 191 gene locus_tag LOCUS_75500 991 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75500 1517 996 gene locus_tag LOCUS_75510 1517 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75510 >Feature sequence1518 201 1535 gene locus_tag LOCUS_75520 201 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75520 2375 1659 gene locus_tag LOCUS_75530 2375 1659 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902265.1 protein_id gnl|my_center|LOCUS_75530 >Feature sequence1519 <1 1112 gene locus_tag LOCUS_75540 <1 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015881.1:D-lysine 5,6-aminomutase subunit alpha 1105 1896 gene locus_tag LOCUS_75550 1105 1896 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_75550 1907 2431 gene locus_tag LOCUS_75560 gene cobO 1907 2431 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081762.1 protein_id gnl|my_center|LOCUS_75560 >Feature sequence1520 <1 1974 gene locus_tag LOCUS_75570 <1 1974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947996.1:preprotein translocase subunit SecA >Feature sequence1521 107 625 gene locus_tag LOCUS_75580 107 625 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_75580 603 1244 gene locus_tag LOCUS_75590 603 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75590 1374 2252 gene locus_tag LOCUS_75600 gene ispE 1374 2252 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894070.1 protein_id gnl|my_center|LOCUS_75600 >Feature sequence1522 <2700 489 gene locus_tag LOCUS_75610 <2700 489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009889064.1:alanine--tRNA ligase >Feature sequence1523 2009 1035 gene locus_tag LOCUS_75620 2009 1035 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 protein_id gnl|my_center|LOCUS_75620 <2700 2009 gene locus_tag LOCUS_75630 <2700 2009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582800.1:sugar ABC transporter ATP-binding protein >Feature sequence1524 728 1906 gene locus_tag LOCUS_75640 gene msrAB 728 1906 CDS product bifunctional peptide-methionine (S)-S-oxide reductase MsrA/peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995985.1 protein_id gnl|my_center|LOCUS_75640 >Feature sequence1525 407 1345 gene locus_tag LOCUS_75650 407 1345 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192701.1 protein_id gnl|my_center|LOCUS_75650 >Feature sequence1526 1260 886 gene locus_tag LOCUS_75660 1260 886 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061260.1 protein_id gnl|my_center|LOCUS_75660 2319 1261 gene locus_tag LOCUS_75670 2319 1261 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 protein_id gnl|my_center|LOCUS_75670 2695 2465 gene locus_tag LOCUS_75680 2695 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75680 >Feature sequence1527 >Feature sequence1528 7 249 gene locus_tag LOCUS_75690 7 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75690 242 544 gene locus_tag LOCUS_75700 242 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75700 1265 576 gene locus_tag LOCUS_75710 1265 576 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_75710 2307 1276 gene locus_tag LOCUS_75720 2307 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75720 >Feature sequence1529 499 1299 gene locus_tag LOCUS_75730 499 1299 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674694.1 protein_id gnl|my_center|LOCUS_75730 1299 1796 gene locus_tag LOCUS_75740 1299 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75740 >Feature sequence1530 >Feature sequence1531 758 2326 gene locus_tag LOCUS_75750 758 2326 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015726.1 protein_id gnl|my_center|LOCUS_75750 >Feature sequence1532 2268 1396 gene locus_tag LOCUS_75760 2268 1396 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286008.1 protein_id gnl|my_center|LOCUS_75760 >Feature sequence1533 <1 1621 gene locus_tag LOCUS_75770 <1 1621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963336.1:DNA gyrase subunit A 1704 2294 gene locus_tag LOCUS_75780 1704 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75780 >Feature sequence1534 1212 190 gene locus_tag LOCUS_75790 1212 190 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_75790 2014 1214 gene locus_tag LOCUS_75800 2014 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75800 2547 2314 gene locus_tag LOCUS_75810 2547 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75810 >Feature sequence1535 184 1083 gene locus_tag LOCUS_75820 184 1083 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682287.1 protein_id gnl|my_center|LOCUS_75820 1192 2172 gene locus_tag LOCUS_75830 1192 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75830 >Feature sequence1536 2402 1686 gene locus_tag LOCUS_75840 2402 1686 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681676.1 protein_id gnl|my_center|LOCUS_75840 2610 2491 gene locus_tag LOCUS_75850 2610 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75850 >Feature sequence1537 >Feature sequence1538 2335 815 gene locus_tag LOCUS_75860 gene mglA 2335 815 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903113.1 protein_id gnl|my_center|LOCUS_75860 >Feature sequence1539 1720 398 gene locus_tag LOCUS_75870 1720 398 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582440.1 protein_id gnl|my_center|LOCUS_75870 >Feature sequence1540 1833 1189 gene locus_tag LOCUS_75880 1833 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75880 >Feature sequence1541 116 1132 gene locus_tag LOCUS_75890 gene trpD 116 1132 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_75890 1125 1928 gene locus_tag LOCUS_75900 gene trpC 1125 1928 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_75900 1915 2526 gene locus_tag LOCUS_75910 1915 2526 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_75910 >Feature sequence1542 2591 51 gene locus_tag LOCUS_75920 2591 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75920 >Feature sequence1543 156 2399 gene locus_tag LOCUS_75930 gene glgB 156 2399 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_75930 >Feature sequence1544 529 1890 gene locus_tag LOCUS_75940 529 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75940 1900 2670 gene locus_tag LOCUS_75950 1900 2670 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048159.1 protein_id gnl|my_center|LOCUS_75950 >Feature sequence1545 524 177 gene locus_tag LOCUS_75960 524 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75960 2053 569 gene locus_tag LOCUS_75970 2053 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75970 >Feature sequence1546 67 1125 gene locus_tag LOCUS_75980 gene rfbG 67 1125 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_75980 1149 2489 gene locus_tag LOCUS_75990 gene rfbH 1149 2489 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_75990 >Feature sequence1547 1 150 gene locus_tag LOCUS_76000 1 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76000 292 1476 gene locus_tag LOCUS_76010 292 1476 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681571.1 protein_id gnl|my_center|LOCUS_76010 1765 2454 gene locus_tag LOCUS_76020 1765 2454 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672626.1 protein_id gnl|my_center|LOCUS_76020 >Feature sequence1548 <1 939 gene locus_tag LOCUS_76030 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010874921.1:NAD(P)-dependent alcohol dehydrogenase 941 1897 gene locus_tag LOCUS_76040 941 1897 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016646.1 protein_id gnl|my_center|LOCUS_76040 >Feature sequence1549 2565 865 gene locus_tag LOCUS_76050 2565 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76050 >Feature sequence1550 8 2131 gene locus_tag LOCUS_76060 8 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76060 >Feature sequence1551 184 537 gene locus_tag LOCUS_76070 184 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76070 >Feature sequence1552 1298 309 gene locus_tag LOCUS_76080 1298 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76080 2056 1331 gene locus_tag LOCUS_76090 2056 1331 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_76090 2510 2094 gene locus_tag LOCUS_76100 2510 2094 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047705.1 protein_id gnl|my_center|LOCUS_76100 >Feature sequence1553 1305 1718 gene locus_tag LOCUS_76110 1305 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76110 1720 2166 gene locus_tag LOCUS_76120 1720 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76120 >Feature sequence1554 392 664 gene locus_tag LOCUS_76130 392 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76130 661 1428 gene locus_tag LOCUS_76140 661 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76140 >Feature sequence1555 1055 279 gene locus_tag LOCUS_76150 1055 279 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409686.1 protein_id gnl|my_center|LOCUS_76150 1440 2483 gene locus_tag LOCUS_76160 1440 2483 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966934.1 protein_id gnl|my_center|LOCUS_76160 >Feature sequence1556 724 897 gene locus_tag LOCUS_76170 724 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76170 872 2200 gene locus_tag LOCUS_76180 872 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76180 >Feature sequence1557 1265 441 gene locus_tag LOCUS_76190 1265 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76190 2074 1283 gene locus_tag LOCUS_76200 2074 1283 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_76200 <2659 2064 gene locus_tag LOCUS_76210 <2659 2064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861141.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence1558 101 1036 gene locus_tag LOCUS_76220 101 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76220 1046 1666 gene locus_tag LOCUS_76230 1046 1666 CDS product DUF4125 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903383.1 protein_id gnl|my_center|LOCUS_76230 1701 2531 gene locus_tag LOCUS_76240 1701 2531 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402124.1 protein_id gnl|my_center|LOCUS_76240 >Feature sequence1559 >Feature sequence1560 >Feature sequence1561 1198 284 gene locus_tag LOCUS_76250 1198 284 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966220.1 protein_id gnl|my_center|LOCUS_76250 1974 1285 gene locus_tag LOCUS_76260 1974 1285 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862963.1 protein_id gnl|my_center|LOCUS_76260 <2658 2124 gene locus_tag LOCUS_76270 <2658 2124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013094954.1:3-dehydro-L-gulonate 2-dehydrogenase >Feature sequence1562 155 673 gene locus_tag LOCUS_76280 gene rpsE 155 673 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003328273.1 protein_id gnl|my_center|LOCUS_76280 690 872 gene locus_tag LOCUS_76290 gene rpmD 690 872 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057241.1 protein_id gnl|my_center|LOCUS_76290 893 1330 gene locus_tag LOCUS_76300 gene rplO 893 1330 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766074.1 protein_id gnl|my_center|LOCUS_76300 1332 2654 gene locus_tag LOCUS_76310 gene secY 1332 2654 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869909.1 protein_id gnl|my_center|LOCUS_76310 >Feature sequence1563 112 552 gene locus_tag LOCUS_76320 gene rplO 112 552 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_76320 552 1868 gene locus_tag LOCUS_76330 gene secY 552 1868 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_76330 1945 2586 gene locus_tag LOCUS_76340 1945 2586 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_76340 >Feature sequence1564 598 747 gene locus_tag LOCUS_76350 598 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76350 820 2298 gene locus_tag LOCUS_76360 820 2298 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113321.1 protein_id gnl|my_center|LOCUS_76360 >Feature sequence1565 <1 1176 gene locus_tag LOCUS_76370 <1 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966563.1:Fe-S cluster assembly protein SufB 1176 2231 gene locus_tag LOCUS_76380 gene sufD 1176 2231 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 protein_id gnl|my_center|LOCUS_76380 >Feature sequence1566 1470 316 gene locus_tag LOCUS_76390 1470 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76390 2587 1481 gene locus_tag LOCUS_76400 gene hadC 2587 1481 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_76400 >Feature sequence1567 1125 625 gene locus_tag LOCUS_76410 gene def 1125 625 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388617.1 protein_id gnl|my_center|LOCUS_76410 <2652 1137 gene locus_tag LOCUS_76420 <2652 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047882.1:primosomal protein N' >Feature sequence1568 1890 358 gene locus_tag LOCUS_76430 1890 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76430 2584 2075 gene locus_tag LOCUS_76440 2584 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76440 >Feature sequence1569 >Feature sequence1570 1681 344 gene locus_tag LOCUS_76450 1681 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76450 1823 1683 gene locus_tag LOCUS_76460 1823 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76460 <2648 1820 gene locus_tag LOCUS_76470 <2648 1820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583125.1:folylpolyglutamate synthase/dihydrofolate synthase family protein >Feature sequence1571 14 385 gene locus_tag LOCUS_76480 14 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76480 401 871 gene locus_tag LOCUS_76490 401 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76490 864 1688 gene locus_tag LOCUS_76500 864 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76500 >Feature sequence1572 621 154 gene locus_tag LOCUS_76510 gene ybaK 621 154 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_76510 2072 708 gene locus_tag LOCUS_76520 gene radA 2072 708 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_76520 2536 2126 gene locus_tag LOCUS_76530 2536 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76530 >Feature sequence1573 385 1383 gene locus_tag LOCUS_76540 385 1383 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356149.1 protein_id gnl|my_center|LOCUS_76540 1460 2236 gene locus_tag LOCUS_76550 gene flgF 1460 2236 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671871.1 protein_id gnl|my_center|LOCUS_76550 >Feature sequence1574 1193 276 gene locus_tag LOCUS_76560 1193 276 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_76560 >Feature sequence1575 1185 2144 gene locus_tag LOCUS_76570 1185 2144 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861279.1 protein_id gnl|my_center|LOCUS_76570 >Feature sequence1576 829 62 gene locus_tag LOCUS_76580 829 62 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_76580 1328 858 gene locus_tag LOCUS_76590 1328 858 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_76590 2342 1455 gene locus_tag LOCUS_76600 2342 1455 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_76600 >Feature sequence1577 592 1452 gene locus_tag LOCUS_76610 592 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76610 >Feature sequence1578 364 1977 gene locus_tag LOCUS_76620 gene ptsP 364 1977 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048342.1 protein_id gnl|my_center|LOCUS_76620 1989 2252 gene locus_tag LOCUS_76630 1989 2252 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719221.1 protein_id gnl|my_center|LOCUS_76630 >Feature sequence1579 1403 621 gene locus_tag LOCUS_76640 1403 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76640 2349 1576 gene locus_tag LOCUS_76650 2349 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76650 >Feature sequence1580 818 1177 gene locus_tag LOCUS_76660 818 1177 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_76660 >Feature sequence1581 <1 685 gene locus_tag LOCUS_76670 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965094.1:translation elongation factor Ts 765 989 gene locus_tag LOCUS_76680 765 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76680 991 1716 gene locus_tag LOCUS_76690 991 1716 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_76690 >Feature sequence1582 97 1899 gene locus_tag LOCUS_76700 97 1899 CDS product IS1182-like element IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284571.1 protein_id gnl|my_center|LOCUS_76700 1937 2089 gene locus_tag LOCUS_76710 1937 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76710 2280 2531 gene locus_tag LOCUS_76720 2280 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76720 >Feature sequence1583 765 286 gene locus_tag LOCUS_76730 765 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_76730 2624 747 gene locus_tag LOCUS_76740 2624 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_76740 >Feature sequence1584 139 2433 gene locus_tag LOCUS_76750 gene xdhA 139 2433 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_76750 >Feature sequence1585 <2626 836 gene locus_tag LOCUS_76760 <2626 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034165920.1:DEAD/DEAH box helicase >Feature sequence1586 <1 2544 gene locus_tag LOCUS_76770 <1 2544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436266.1:excinuclease ABC subunit UvrA >Feature sequence1587 1155 679 gene locus_tag LOCUS_76780 gene agaV 1155 679 CDS product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387360.1 protein_id gnl|my_center|LOCUS_76780 1369 2580 gene locus_tag LOCUS_76790 1369 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76790 >Feature sequence1588 860 66 gene locus_tag LOCUS_76800 860 66 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438780.1 protein_id gnl|my_center|LOCUS_76800 2407 869 gene locus_tag LOCUS_76810 2407 869 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861882.1 protein_id gnl|my_center|LOCUS_76810 2604 2473 gene locus_tag LOCUS_76820 2604 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76820 >Feature sequence1589 1707 757 gene locus_tag LOCUS_76830 1707 757 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_76830 <2618 1670 gene locus_tag LOCUS_76840 <2618 1670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081442.1:ABC transporter ATP-binding protein >Feature sequence1590 1264 824 gene locus_tag LOCUS_76850 1264 824 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362455.1 protein_id gnl|my_center|LOCUS_76850 <2618 1345 gene locus_tag LOCUS_76860 <2618 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795565.1:amidophosphoribosyltransferase >Feature sequence1591 168 548 gene locus_tag LOCUS_76870 168 548 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_76870 545 1444 gene locus_tag LOCUS_76880 545 1444 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_76880 >Feature sequence1592 141 2402 gene locus_tag LOCUS_76890 gene glgP 141 2402 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950158.1 protein_id gnl|my_center|LOCUS_76890 >Feature sequence1593 <1 1549 gene locus_tag LOCUS_76900 <1 1549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836931.1:sensor histidine kinase >Feature sequence1594 <1 1313 gene locus_tag LOCUS_76910 <1 1313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102097.1:phytoene desaturase family protein 1310 2287 gene locus_tag LOCUS_76920 1310 2287 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_76920 >Feature sequence1595 326 1219 gene locus_tag LOCUS_76930 326 1219 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456718.1 protein_id gnl|my_center|LOCUS_76930 1340 2098 gene locus_tag LOCUS_76940 1340 2098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681851.1 protein_id gnl|my_center|LOCUS_76940 >Feature sequence1596 1005 76 gene locus_tag LOCUS_76950 gene metA 1005 76 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_76950 2581 1007 gene locus_tag LOCUS_76960 gene ligA 2581 1007 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_76960 >Feature sequence1597 882 46 gene locus_tag LOCUS_76970 882 46 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989345.1 protein_id gnl|my_center|LOCUS_76970 1089 2540 gene locus_tag LOCUS_76980 1089 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76980 >Feature sequence1598 1810 2151 gene locus_tag LOCUS_76990 gene rplS 1810 2151 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419350.1 protein_id gnl|my_center|LOCUS_76990 >Feature sequence1599 2251 362 gene locus_tag LOCUS_77000 2251 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77000 2436 2251 gene locus_tag LOCUS_77010 2436 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77010 >Feature sequence1600 2054 426 gene locus_tag LOCUS_77020 2054 426 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_77020 >Feature sequence1601 <2609 1790 gene locus_tag LOCUS_77030 <2609 1790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081416.1:TIGR01212 family radical SAM protein >Feature sequence1602 14 2596 gene locus_tag LOCUS_77040 gene clpB 14 2596 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365367.1 protein_id gnl|my_center|LOCUS_77040 >Feature sequence1603 <1 866 gene locus_tag LOCUS_77050 <1 866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015660.1:ArsA family ATPase 1774 1073 gene locus_tag LOCUS_77060 1774 1073 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015968.1 protein_id gnl|my_center|LOCUS_77060 2499 1771 gene locus_tag LOCUS_77070 2499 1771 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861304.1 protein_id gnl|my_center|LOCUS_77070 >Feature sequence1604 >Feature sequence1605 1184 81 gene locus_tag LOCUS_77080 1184 81 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310837.1 protein_id gnl|my_center|LOCUS_77080 2009 1530 gene locus_tag LOCUS_77090 gene coaD 2009 1530 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_77090 2304 2221 gene locus_tag LOCUS_t00520 2304 2221 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2423 2338 gene locus_tag LOCUS_t00530 2423 2338 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1606 >Feature sequence1607 1794 1363 gene locus_tag LOCUS_77100 1794 1363 CDS product DUF1934 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966177.1 protein_id gnl|my_center|LOCUS_77100 <2604 1794 gene locus_tag LOCUS_77110 <2604 1794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009894070.1:4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase >Feature sequence1608 25 258 gene locus_tag LOCUS_77120 25 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77120 504 2198 gene locus_tag LOCUS_77130 504 2198 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428989.1 protein_id gnl|my_center|LOCUS_77130 2209 2580 gene locus_tag LOCUS_77140 2209 2580 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462292.1 protein_id gnl|my_center|LOCUS_77140 >Feature sequence1609 2413 848 gene locus_tag LOCUS_77150 2413 848 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870275.1 protein_id gnl|my_center|LOCUS_77150 >Feature sequence1610 2565 1777 gene locus_tag LOCUS_77160 2565 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77160 >Feature sequence1611 <1 2054 gene locus_tag LOCUS_77170 <1 2054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674947.1:RNA degradosome polyphosphate kinase <2601 2101 gene locus_tag LOCUS_77180 <2601 2101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938673.1:ketol-acid reductoisomerase >Feature sequence1612 319 1218 gene locus_tag LOCUS_77190 gene era 319 1218 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_77190 1229 1900 gene locus_tag LOCUS_77200 1229 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77200 1939 2514 gene locus_tag LOCUS_77210 1939 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77210 >Feature sequence1613 1116 94 gene locus_tag LOCUS_77220 1116 94 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_77220 >Feature sequence1614 2593 1037 gene locus_tag LOCUS_77230 2593 1037 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679279.1 protein_id gnl|my_center|LOCUS_77230 >Feature sequence1615 >Feature sequence1616 1481 2053 gene locus_tag LOCUS_77240 1481 2053 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943862.1 protein_id gnl|my_center|LOCUS_77240 <2595 2093 gene locus_tag LOCUS_77250 <2595 2093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042680609.1:DUF438 domain-containing protein >Feature sequence1617 884 534 gene locus_tag LOCUS_77260 884 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77260 1497 853 gene locus_tag LOCUS_77270 1497 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77270 1973 1611 gene locus_tag LOCUS_77280 1973 1611 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417647.1 protein_id gnl|my_center|LOCUS_77280 >Feature sequence1618 333 1094 gene locus_tag LOCUS_77290 333 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77290 1474 1121 gene locus_tag LOCUS_77300 1474 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77300 1602 1949 gene locus_tag LOCUS_77310 1602 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77310 1998 2582 gene locus_tag LOCUS_77320 1998 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77320 >Feature sequence1619 394 1320 gene locus_tag LOCUS_77330 gene tsf 394 1320 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_77330 1388 2110 gene locus_tag LOCUS_77340 1388 2110 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906063.1 protein_id gnl|my_center|LOCUS_77340 2334 2591 gene locus_tag LOCUS_77350 2334 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77350 >Feature sequence1620 203 1030 gene locus_tag LOCUS_77360 203 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77360 1055 2536 gene locus_tag LOCUS_77370 gene thrC 1055 2536 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_77370 >Feature sequence1621 471 1559 gene locus_tag LOCUS_77380 471 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77380 1636 2265 gene locus_tag LOCUS_77390 1636 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77390 >Feature sequence1622 <1 580 gene locus_tag LOCUS_77400 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003439456.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence1623 726 502 gene locus_tag LOCUS_77410 726 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77410 1387 812 gene locus_tag LOCUS_77420 1387 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77420 >Feature sequence1624 772 65 gene locus_tag LOCUS_77430 772 65 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_77430 1427 873 gene locus_tag LOCUS_77440 gene frr 1427 873 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_77440 2164 1466 gene locus_tag LOCUS_77450 gene pyrH 2164 1466 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430597.1 protein_id gnl|my_center|LOCUS_77450 >Feature sequence1625 523 215 gene locus_tag LOCUS_77460 gene fliQ 523 215 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392308.1 protein_id gnl|my_center|LOCUS_77460 1389 538 gene locus_tag LOCUS_77470 1389 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77470 1764 1405 gene locus_tag LOCUS_77480 1764 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77480 <2584 1803 gene locus_tag LOCUS_77490 <2584 1803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392326.1:flagellar motor switch phosphatase FliY >Feature sequence1626 769 359 gene locus_tag LOCUS_77500 769 359 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064953.1 protein_id gnl|my_center|LOCUS_77500 >Feature sequence1627 986 2092 gene locus_tag LOCUS_77510 986 2092 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_77510 >Feature sequence1628 87 1457 gene locus_tag LOCUS_77520 87 1457 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430790.1 protein_id gnl|my_center|LOCUS_77520 1423 2289 gene locus_tag LOCUS_77530 gene nadC 1423 2289 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360683.1 protein_id gnl|my_center|LOCUS_77530 >Feature sequence1629 <1 953 gene locus_tag LOCUS_77540 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963681.1:glycoside hydrolase family 88 protein 946 2526 gene locus_tag LOCUS_77550 946 2526 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963677.1 protein_id gnl|my_center|LOCUS_77550 >Feature sequence1630 2279 180 gene locus_tag LOCUS_77560 gene fusA 2279 180 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_77560 >Feature sequence1631 561 1832 gene locus_tag LOCUS_77570 561 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77570 >Feature sequence1632 953 42 gene locus_tag LOCUS_77580 953 42 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403172.1 protein_id gnl|my_center|LOCUS_77580 2263 977 gene locus_tag LOCUS_77590 2263 977 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861628.1 protein_id gnl|my_center|LOCUS_77590 >Feature sequence1633 1754 1026 gene locus_tag LOCUS_77600 1754 1026 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889773.1 protein_id gnl|my_center|LOCUS_77600 2452 1835 gene locus_tag LOCUS_77610 2452 1835 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205793.1 protein_id gnl|my_center|LOCUS_77610 >Feature sequence1634 1042 1410 gene locus_tag LOCUS_77620 1042 1410 CDS product EXLDI protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262962.1 protein_id gnl|my_center|LOCUS_77620 1826 2536 gene locus_tag LOCUS_77630 1826 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77630 >Feature sequence1635 1464 919 gene locus_tag LOCUS_77640 1464 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77640 >Feature sequence1636 1848 1 gene locus_tag LOCUS_77650 gene uvrC 1848 1 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436264.1 protein_id gnl|my_center|LOCUS_77650 2430 1849 gene locus_tag LOCUS_77660 2430 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77660 >Feature sequence1637 1849 776 gene locus_tag LOCUS_77670 gene prfA 1849 776 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_77670 2324 1917 gene locus_tag LOCUS_77680 2324 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77680 >Feature sequence1638 1956 124 gene locus_tag LOCUS_77690 1956 124 CDS product reverse transcriptase/maturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680466.1 protein_id gnl|my_center|LOCUS_77690 >Feature sequence1639 <1 805 gene locus_tag LOCUS_77700 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459235.1:RecQ family ATP-dependent DNA helicase 972 1739 gene locus_tag LOCUS_77710 972 1739 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963654.1 protein_id gnl|my_center|LOCUS_77710 2001 2405 gene locus_tag LOCUS_77720 2001 2405 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470207.1 protein_id gnl|my_center|LOCUS_77720 >Feature sequence1640 679 374 gene locus_tag LOCUS_77730 gene rplX 679 374 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919138.1 protein_id gnl|my_center|LOCUS_77730 1060 692 gene locus_tag LOCUS_77740 gene rplN 1060 692 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323021.1 protein_id gnl|my_center|LOCUS_77740 1355 1098 gene locus_tag LOCUS_77750 gene rpsQ 1355 1098 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_77750 1592 1392 gene locus_tag LOCUS_77760 gene rpmC 1592 1392 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722500.1 protein_id gnl|my_center|LOCUS_77760 2020 1592 gene locus_tag LOCUS_77770 gene rplP 2020 1592 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_77770 <2566 2020 gene locus_tag LOCUS_77780 <2566 2020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393931.1:30S ribosomal protein S3 >Feature sequence1641 <1 935 gene locus_tag LOCUS_77790 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868672.1:chemotaxis response regulator protein-glutamate methylesterase >Feature sequence1642 <1 1829 gene locus_tag LOCUS_77800 <1 1829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966549.1:Ig-like domain-containing protein >Feature sequence1643 323 36 gene locus_tag LOCUS_77810 323 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77810 936 715 gene locus_tag LOCUS_77820 936 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77820 1690 1115 gene locus_tag LOCUS_77830 1690 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77830 2036 1692 gene locus_tag LOCUS_77840 2036 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77840 2376 2029 gene locus_tag LOCUS_77850 2376 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77850 >Feature sequence1644 <1 2542 gene locus_tag LOCUS_77860 <1 2542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680864.1:heavy metal translocating P-type ATPase >Feature sequence1645 >Feature sequence1646 <1 834 gene locus_tag LOCUS_77870 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035380749.1:bifunctional acetaldehyde-CoA/alcohol dehydrogenase 835 1554 gene locus_tag LOCUS_77880 gene trpA 835 1554 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788291.1 protein_id gnl|my_center|LOCUS_77880 1622 2353 gene locus_tag LOCUS_77890 gene gamR 1622 2353 CDS product transcriptional regulator GamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234841.1 protein_id gnl|my_center|LOCUS_77890 >Feature sequence1647 <1 786 gene locus_tag LOCUS_77900 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000499553.1:FtsX-like permease family protein 954 2012 gene locus_tag LOCUS_77910 954 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77910 >Feature sequence1648 15 1124 gene locus_tag LOCUS_77920 15 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77920 1230 1505 gene locus_tag LOCUS_77930 1230 1505 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905402.1 protein_id gnl|my_center|LOCUS_77930 1505 1744 gene locus_tag LOCUS_77940 1505 1744 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_77940 2018 2338 gene locus_tag LOCUS_77950 2018 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77950 >Feature sequence1649 1048 320 gene locus_tag LOCUS_77960 1048 320 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972957.1 protein_id gnl|my_center|LOCUS_77960 2115 1048 gene locus_tag LOCUS_77970 2115 1048 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 protein_id gnl|my_center|LOCUS_77970 >Feature sequence1650 >Feature sequence1651 <1 802 gene locus_tag LOCUS_77980 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870462.1:response regulator 805 2163 gene locus_tag LOCUS_77990 805 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77990 >Feature sequence1652 148 1170 gene locus_tag LOCUS_78000 148 1170 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902186.1 protein_id gnl|my_center|LOCUS_78000 1208 2308 gene locus_tag LOCUS_78010 1208 2308 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986574.1 protein_id gnl|my_center|LOCUS_78010 >Feature sequence1653 1006 2262 gene locus_tag LOCUS_78020 gene leuC 1006 2262 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_78020 >Feature sequence1654 <2550 458 gene locus_tag LOCUS_78030 <2550 458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009893200.1:calcium-translocating P-type ATPase, PMCA-type >Feature sequence1655 <1 872 gene locus_tag LOCUS_78040 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047961.1:NCS2 family permease 888 2165 gene locus_tag LOCUS_78050 888 2165 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896806.1 protein_id gnl|my_center|LOCUS_78050 >Feature sequence1656 165 1085 gene locus_tag LOCUS_78060 165 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78060 1185 1481 gene locus_tag LOCUS_78070 1185 1481 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357450.1 protein_id gnl|my_center|LOCUS_78070 >Feature sequence1657 94 1053 gene locus_tag LOCUS_78080 94 1053 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860960.1 protein_id gnl|my_center|LOCUS_78080 1231 2367 gene locus_tag LOCUS_78090 1231 2367 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437554.1 protein_id gnl|my_center|LOCUS_78090 >Feature sequence1658 50 2233 gene locus_tag LOCUS_78100 gene pcrA 50 2233 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457083.1 protein_id gnl|my_center|LOCUS_78100 2273 2545 gene locus_tag LOCUS_78110 2273 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78110 >Feature sequence1659 1710 403 gene locus_tag LOCUS_78120 gene brnQ 1710 403 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669699.1 protein_id gnl|my_center|LOCUS_78120 1937 1782 gene locus_tag LOCUS_78130 1937 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78130 >Feature sequence1660 1976 315 gene locus_tag LOCUS_78140 1976 315 CDS product bacteriocin-associated integral membrane family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930898.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_78140 >Feature sequence1661 2522 2163 gene locus_tag LOCUS_78150 2522 2163 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_78150 >Feature sequence1662 1006 254 gene locus_tag LOCUS_78160 1006 254 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812271.1 protein_id gnl|my_center|LOCUS_78160 1884 1051 gene locus_tag LOCUS_78170 1884 1051 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392733.1 protein_id gnl|my_center|LOCUS_78170 >Feature sequence1663 545 1561 gene locus_tag LOCUS_78180 gene tsaD 545 1561 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_78180 1562 2245 gene locus_tag LOCUS_78190 1562 2245 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674392.1 protein_id gnl|my_center|LOCUS_78190 >Feature sequence1664 480 1964 gene locus_tag LOCUS_78200 480 1964 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860721.1 protein_id gnl|my_center|LOCUS_78200 >Feature sequence1665 >Feature sequence1666 >Feature sequence1667 2240 927 gene locus_tag LOCUS_78210 2240 927 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_78210 >Feature sequence1668 1033 185 gene locus_tag LOCUS_78220 1033 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78220 2309 1056 gene locus_tag LOCUS_78230 2309 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78230 >Feature sequence1669 106 471 gene locus_tag LOCUS_78240 106 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78240 446 1897 gene locus_tag LOCUS_78250 446 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78250 >Feature sequence1670 <1 1114 gene locus_tag LOCUS_78260 <1 1114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808364.1:DUF2974 domain-containing protein 1296 1538 gene locus_tag LOCUS_78270 1296 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78270 >Feature sequence1671 2046 1186 gene locus_tag LOCUS_78280 2046 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78280 >Feature sequence1672 <1 1240 gene locus_tag LOCUS_78290 <1 1240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861090.1:M20 family metallopeptidase 1411 2166 gene locus_tag LOCUS_78300 1411 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78300 2385 2461 gene locus_tag LOCUS_t00540 2385 2461 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1673 1637 96 gene locus_tag LOCUS_78310 1637 96 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461096.1 protein_id gnl|my_center|LOCUS_78310 2129 1728 gene locus_tag LOCUS_78320 gene tnpB 2129 1728 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748777.1 protein_id gnl|my_center|LOCUS_78320 2437 2078 gene locus_tag LOCUS_78330 2437 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78330 >Feature sequence1674 804 1679 gene locus_tag LOCUS_78340 804 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78340 1749 2378 gene locus_tag LOCUS_78350 gene upp 1749 2378 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_78350 >Feature sequence1675 1600 956 gene locus_tag LOCUS_78360 1600 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78360 <2531 2024 gene locus_tag LOCUS_78370 <2531 2024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011837017.1:CRISPR-associated endoribonuclease Cas6 >Feature sequence1676 1254 733 gene locus_tag LOCUS_78380 gene nrdG 1254 733 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905258.1 protein_id gnl|my_center|LOCUS_78380 <2528 1341 gene locus_tag LOCUS_78390 <2528 1341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905257.1:anaerobic ribonucleoside-triphosphate reductase >Feature sequence1677 1954 467 gene locus_tag LOCUS_78400 1954 467 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994262.1 protein_id gnl|my_center|LOCUS_78400 >Feature sequence1678 >Feature sequence1679 492 767 gene locus_tag LOCUS_78410 492 767 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_78410 >Feature sequence1680 2274 1546 gene locus_tag LOCUS_78420 2274 1546 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_78420 >Feature sequence1681 2055 61 gene locus_tag LOCUS_78430 2055 61 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_78430 >Feature sequence1682 1744 356 gene locus_tag LOCUS_78440 1744 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78440 >Feature sequence1683 1592 528 gene locus_tag LOCUS_78450 1592 528 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229940.1 protein_id gnl|my_center|LOCUS_78450 2016 1585 gene locus_tag LOCUS_78460 2016 1585 CDS product DUF2634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438449.1 protein_id gnl|my_center|LOCUS_78460 2456 2019 gene locus_tag LOCUS_78470 2456 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78470 >Feature sequence1684 1064 1942 gene locus_tag LOCUS_78480 1064 1942 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339520.1 protein_id gnl|my_center|LOCUS_78480 >Feature sequence1685 31 1089 gene locus_tag LOCUS_78490 31 1089 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763402.1 protein_id gnl|my_center|LOCUS_78490 1073 2161 gene locus_tag LOCUS_78500 1073 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78500 >Feature sequence1686 70 1071 gene locus_tag LOCUS_78510 70 1071 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356351.1 protein_id gnl|my_center|LOCUS_78510 1096 2493 gene locus_tag LOCUS_78520 1096 2493 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730345.1 protein_id gnl|my_center|LOCUS_78520 >Feature sequence1687 >Feature sequence1688 72 1385 gene locus_tag LOCUS_78530 72 1385 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_78530 >Feature sequence1689 1041 70 gene locus_tag LOCUS_78540 1041 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78540 2477 1227 gene locus_tag LOCUS_78550 gene rny 2477 1227 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_78550 >Feature sequence1690 1338 892 gene locus_tag LOCUS_78560 1338 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78560 1649 1320 gene locus_tag LOCUS_78570 1649 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78570 2084 1662 gene locus_tag LOCUS_78580 2084 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78580 2495 2091 gene locus_tag LOCUS_78590 2495 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78590 >Feature sequence1691 97 906 gene locus_tag LOCUS_78600 97 906 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251908.1 protein_id gnl|my_center|LOCUS_78600 910 1395 gene locus_tag LOCUS_78610 910 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78610 1392 1721 gene locus_tag LOCUS_78620 1392 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78620 1793 2113 gene locus_tag LOCUS_78630 1793 2113 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681704.1 protein_id gnl|my_center|LOCUS_78630 >Feature sequence1692 839 120 gene locus_tag LOCUS_78640 839 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78640 >Feature sequence1693 1254 676 gene locus_tag LOCUS_78650 1254 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78650 >Feature sequence1694 1622 480 gene locus_tag LOCUS_78660 1622 480 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921836.1 protein_id gnl|my_center|LOCUS_78660 <2509 1750 gene locus_tag LOCUS_78670 <2509 1750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029491155.1:APC family permease >Feature sequence1695 <1 1330 gene locus_tag LOCUS_78680 <1 1330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000986372.1:flagellar hook protein FlgE 1897 2106 gene locus_tag LOCUS_78690 1897 2106 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081092.1 protein_id gnl|my_center|LOCUS_78690 >Feature sequence1696 >Feature sequence1697 496 1155 gene locus_tag LOCUS_78700 496 1155 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861982.1 protein_id gnl|my_center|LOCUS_78700 >Feature sequence1698 2081 258 gene locus_tag LOCUS_78710 2081 258 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164733.1 protein_id gnl|my_center|LOCUS_78710 >Feature sequence1699 <1 1456 gene locus_tag LOCUS_78720 <1 1456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006995243.1:ABC transporter ATP-binding protein/permease >Feature sequence1700 171 1172 gene locus_tag LOCUS_78730 gene pta 171 1172 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_78730 1195 2397 gene locus_tag LOCUS_78740 gene ackA 1195 2397 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_78740 >Feature sequence1701 <1 2360 gene locus_tag LOCUS_78750 <1 2360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193484061.1:2-hydroxyacyl-CoA dehydratase >Feature sequence1702 739 1362 gene locus_tag LOCUS_78760 739 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78760 1346 2158 gene locus_tag LOCUS_78770 1346 2158 CDS product PD-(D/E)XK nuclease-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025480718.1 protein_id gnl|my_center|LOCUS_78770 >Feature sequence1703 <2501 610 gene locus_tag LOCUS_78780 <2501 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546145.1:TerB N-terminal domain-containing protein >Feature sequence1704 968 1705 gene locus_tag LOCUS_78790 968 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78790 2499 1993 gene locus_tag LOCUS_78800 2499 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78800 >Feature sequence1705 <1 1076 gene locus_tag LOCUS_78810 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791971.1:phosphoenolpyruvate carboxykinase (ATP) 2226 1156 gene locus_tag LOCUS_78820 2226 1156 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 protein_id gnl|my_center|LOCUS_78820 >Feature sequence1706 >Feature sequence1707 407 622 gene locus_tag LOCUS_78830 407 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78830 >Feature sequence1708 1 813 gene locus_tag LOCUS_78840 1 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78840 1297 863 gene locus_tag LOCUS_78850 1297 863 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_78850 2211 1297 gene locus_tag LOCUS_78860 gene pyrB 2211 1297 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_78860 >Feature sequence1709 2440 227 gene locus_tag LOCUS_78870 gene ppdK 2440 227 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_78870 >Feature sequence1710 488 18 gene locus_tag LOCUS_78880 488 18 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 protein_id gnl|my_center|LOCUS_78880 1961 516 gene locus_tag LOCUS_78890 gene glgA 1961 516 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_78890 <2488 1985 gene locus_tag LOCUS_78900 <2488 1985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003660689.1:DNA repair protein RecN >Feature sequence1711 980 216 gene locus_tag LOCUS_78910 980 216 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016780.1 protein_id gnl|my_center|LOCUS_78910 2389 980 gene locus_tag LOCUS_78920 2389 980 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016781.1 protein_id gnl|my_center|LOCUS_78920 >Feature sequence1712 1094 585 gene locus_tag LOCUS_78930 1094 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78930 1210 1617 gene locus_tag LOCUS_78940 1210 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78940 1640 2314 gene locus_tag LOCUS_78950 1640 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78950 >Feature sequence1713 1764 646 gene locus_tag LOCUS_78960 1764 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78960 <2485 1876 gene locus_tag LOCUS_78970 <2485 1876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003420729.1:rod shape-determining protein >Feature sequence1714 1727 267 gene locus_tag LOCUS_78980 1727 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78980 2317 1724 gene locus_tag LOCUS_78990 2317 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78990 >Feature sequence1715 1822 1532 gene locus_tag LOCUS_79000 1822 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79000 2251 1952 gene locus_tag LOCUS_79010 2251 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79010 >Feature sequence1716 1449 379 gene locus_tag LOCUS_79020 1449 379 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_79020 1652 1461 gene locus_tag LOCUS_79030 1652 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79030 1814 2416 gene locus_tag LOCUS_79040 1814 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79040 >Feature sequence1717 999 67 gene locus_tag LOCUS_79050 999 67 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454768.1 protein_id gnl|my_center|LOCUS_79050 <2479 1196 gene locus_tag LOCUS_79060 <2479 1196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965634.1:phospho-sugar mutase >Feature sequence1718 661 867 gene locus_tag LOCUS_79070 661 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79070 2245 860 gene locus_tag LOCUS_79080 2245 860 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_79080 >Feature sequence1719 1738 20 gene locus_tag LOCUS_79090 1738 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79090 2156 1989 gene locus_tag LOCUS_79100 2156 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79100 >Feature sequence1720 1939 32 gene locus_tag LOCUS_79110 gene pknB 1939 32 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986841.1 protein_id gnl|my_center|LOCUS_79110 <2474 1955 gene locus_tag LOCUS_79120 <2474 1955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003416261.1:Stp1/IreP family PP2C-type Ser/Thr phosphatase >Feature sequence1721 108 374 gene locus_tag LOCUS_79130 gene rpsT 108 374 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273615.1 protein_id gnl|my_center|LOCUS_79130 1094 441 gene locus_tag LOCUS_79140 gene trmB 1094 441 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_79140 <2474 1187 gene locus_tag LOCUS_79150 <2474 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965728.1:trypsin-like peptidase domain-containing protein >Feature sequence1722 <1 1349 gene locus_tag LOCUS_79160 <1 1349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002485041.1:CDP-glycerol--poly(glycerophosphate) glycerophosphotransferase 1359 2069 gene locus_tag LOCUS_79170 1359 2069 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721503.1 protein_id gnl|my_center|LOCUS_79170 >Feature sequence1723 346 2319 gene locus_tag LOCUS_79180 gene recQ 346 2319 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965975.1 protein_id gnl|my_center|LOCUS_79180 >Feature sequence1724 <1 673 gene locus_tag LOCUS_79190 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009896901.1:EFR1 family ferrodoxin <2467 1100 gene locus_tag LOCUS_79200 <2467 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042338787.1:cell wall-binding repeat-containing protein >Feature sequence1725 <1 869 gene locus_tag LOCUS_79210 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003386373.1:cell division protein FtsZ 1682 915 gene locus_tag LOCUS_79220 1682 915 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_79220 >Feature sequence1726 179 436 gene locus_tag LOCUS_79230 179 436 CDS product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016883.1 protein_id gnl|my_center|LOCUS_79230 1018 1959 gene locus_tag LOCUS_79240 gene trxB 1018 1959 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948886.1 protein_id gnl|my_center|LOCUS_79240 >Feature sequence1727 >Feature sequence1728 1040 30 gene locus_tag LOCUS_79250 1040 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79250 1457 1053 gene locus_tag LOCUS_79260 1457 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79260 >Feature sequence1729 70 672 gene locus_tag LOCUS_79270 70 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79270 675 1961 gene locus_tag LOCUS_79280 675 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79280 >Feature sequence1730 1770 244 gene locus_tag LOCUS_79290 1770 244 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_79290 2388 2083 gene locus_tag LOCUS_79300 2388 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79300 >Feature sequence1731 51 2396 gene locus_tag LOCUS_79310 51 2396 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 protein_id gnl|my_center|LOCUS_79310 >Feature sequence1732 1932 1729 gene locus_tag LOCUS_79320 1932 1729 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016140.1 protein_id gnl|my_center|LOCUS_79320 >Feature sequence1733 <2444 1856 gene locus_tag LOCUS_79330 <2444 1856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963695.1:ABC transporter ATP-binding protein >Feature sequence1734 <1 1192 gene locus_tag LOCUS_79340 <1 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438167.1:U32 family peptidase >Feature sequence1735 481 1626 gene locus_tag LOCUS_79350 481 1626 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399632.1 protein_id gnl|my_center|LOCUS_79350 >Feature sequence1736 2010 334 gene locus_tag LOCUS_79360 2010 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79360 >Feature sequence1737 169 873 gene locus_tag LOCUS_79370 169 873 CDS product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986262.1 protein_id gnl|my_center|LOCUS_79370 863 1621 gene locus_tag LOCUS_79380 863 1621 CDS product lantibiotic immunity ABC transporter MutE/EpiE family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888312.1 protein_id gnl|my_center|LOCUS_79380 1614 2345 gene locus_tag LOCUS_79390 1614 2345 CDS product lantibiotic immunity ABC transporter MutG family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861184.1 protein_id gnl|my_center|LOCUS_79390 >Feature sequence1738 <1 852 gene locus_tag LOCUS_79400 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_136798312.1:glycosyltransferase >Feature sequence1739 236 1729 gene locus_tag LOCUS_79410 gene malQ 236 1729 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747291.1 protein_id gnl|my_center|LOCUS_79410 1823 2083 gene locus_tag LOCUS_79420 1823 2083 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681231.1 protein_id gnl|my_center|LOCUS_79420 2093 2251 gene locus_tag LOCUS_79430 2093 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79430 >Feature sequence1740 441 118 gene locus_tag LOCUS_79440 441 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79440 1525 737 gene locus_tag LOCUS_79450 1525 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369000.1 protein_id gnl|my_center|LOCUS_79450 <2425 1587 gene locus_tag LOCUS_79460 <2425 1587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002359867.1:glycoside hydrolase family 88 protein >Feature sequence1741 1891 1682 gene locus_tag LOCUS_79470 1891 1682 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359683.1 protein_id gnl|my_center|LOCUS_79470 2376 1903 gene locus_tag LOCUS_79480 2376 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79480 >Feature sequence1742 <1 831 gene locus_tag LOCUS_79490 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861616.1:HlyD family efflux transporter periplasmic adaptor subunit 853 1551 gene locus_tag LOCUS_79500 853 1551 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_79500 1572 2072 gene locus_tag LOCUS_79510 gene sepF 1572 2072 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416162.1 protein_id gnl|my_center|LOCUS_79510 2060 2344 gene locus_tag LOCUS_79520 2060 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79520 >Feature sequence1743 3 275 gene locus_tag LOCUS_79530 3 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79530 275 928 gene locus_tag LOCUS_79540 gene rpe 275 928 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354925.1 protein_id gnl|my_center|LOCUS_79540 983 1633 gene locus_tag LOCUS_79550 983 1633 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454892.1 protein_id gnl|my_center|LOCUS_79550 1761 2393 gene locus_tag LOCUS_79560 1761 2393 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437747.1 protein_id gnl|my_center|LOCUS_79560 >Feature sequence1744 1566 865 gene locus_tag LOCUS_79570 1566 865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722723.1 protein_id gnl|my_center|LOCUS_79570 <2415 1573 gene locus_tag LOCUS_79580 <2415 1573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963641.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence1745 90 653 gene locus_tag LOCUS_79590 90 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79590 800 1726 gene locus_tag LOCUS_79600 800 1726 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_79600 >Feature sequence1746 842 483 gene locus_tag LOCUS_79610 842 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79610 2140 842 gene locus_tag LOCUS_79620 2140 842 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068364.1 protein_id gnl|my_center|LOCUS_79620 >Feature sequence1747 1206 187 gene locus_tag LOCUS_79630 1206 187 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_79630 2045 1203 gene locus_tag LOCUS_79640 2045 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79640 >Feature sequence1748 485 1399 gene locus_tag LOCUS_79650 485 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79650 1889 1605 gene locus_tag LOCUS_79660 1889 1605 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903810.1 protein_id gnl|my_center|LOCUS_79660 2323 1892 gene locus_tag LOCUS_79670 2323 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79670 >Feature sequence1749 1294 413 gene locus_tag LOCUS_79680 1294 413 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679293.1 protein_id gnl|my_center|LOCUS_79680 2364 1309 gene locus_tag LOCUS_79690 2364 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79690 >Feature sequence1750 2126 1248 gene locus_tag LOCUS_79700 2126 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79700 >Feature sequence1751 2307 1633 gene locus_tag LOCUS_79710 2307 1633 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_79710 >Feature sequence1752 21 1964 gene locus_tag LOCUS_79720 21 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79720 >Feature sequence1753 1132 767 gene locus_tag LOCUS_79730 1132 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79730 1703 1170 gene locus_tag LOCUS_79740 gene recU 1703 1170 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460152.1 protein_id gnl|my_center|LOCUS_79740 <2409 1675 gene locus_tag LOCUS_79750 <2409 1675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949019.1:RluA family pseudouridine synthase >Feature sequence1754 >Feature sequence1755 40 489 gene locus_tag LOCUS_79760 40 489 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697334.1 protein_id gnl|my_center|LOCUS_79760 492 926 gene locus_tag LOCUS_79770 gene rpiB 492 926 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_79770 1425 907 gene locus_tag LOCUS_79780 1425 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79780 >Feature sequence1756 2047 266 gene locus_tag LOCUS_79790 2047 266 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_79790 >Feature sequence1757 >Feature sequence1758 1922 921 gene locus_tag LOCUS_79800 1922 921 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422061.1 protein_id gnl|my_center|LOCUS_79800 >Feature sequence1759 2335 1403 gene locus_tag LOCUS_79810 gene cysK 2335 1403 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_79810 >Feature sequence1760 250 2205 gene locus_tag LOCUS_79820 250 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79820 >Feature sequence1761 1033 413 gene locus_tag LOCUS_79830 1033 413 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727834.1 protein_id gnl|my_center|LOCUS_79830 2197 1205 gene locus_tag LOCUS_79840 2197 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79840 >Feature sequence1762 2336 1347 gene locus_tag LOCUS_79850 2336 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79850 >Feature sequence1763 1234 713 gene locus_tag LOCUS_79860 1234 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79860 2250 1231 gene locus_tag LOCUS_79870 2250 1231 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963366.1 protein_id gnl|my_center|LOCUS_79870 >Feature sequence1764 1347 760 gene locus_tag LOCUS_79880 gene clpP 1347 760 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965928.1 protein_id gnl|my_center|LOCUS_79880 <2399 1526 gene locus_tag LOCUS_79890 <2399 1526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003417090.1:trigger factor >Feature sequence1765 783 1430 gene locus_tag LOCUS_79900 783 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79900 >Feature sequence1766 1257 2246 gene locus_tag LOCUS_79910 1257 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79910 >Feature sequence1767 1445 480 gene locus_tag LOCUS_79920 1445 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79920 1628 1458 gene locus_tag LOCUS_79930 1628 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79930 1808 2164 gene locus_tag LOCUS_79940 1808 2164 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_79940 >Feature sequence1768 1875 106 gene locus_tag LOCUS_79950 1875 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79950 2077 2167 gene locus_tag LOCUS_t00550 2077 2167 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1769 2344 14 gene locus_tag LOCUS_79960 2344 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79960 >Feature sequence1770 <1 756 gene locus_tag LOCUS_79970 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029494599.1:TatD family hydrolase 769 1140 gene locus_tag LOCUS_79980 gene acpS 769 1140 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861979.1 protein_id gnl|my_center|LOCUS_79980 >Feature sequence1771 424 185 gene locus_tag LOCUS_79990 424 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_79990 804 424 gene locus_tag LOCUS_80000 gene mobC 804 424 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426139.1 protein_id gnl|my_center|LOCUS_80000 2035 1073 gene locus_tag LOCUS_80010 2035 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80010 >Feature sequence1772 201 641 gene locus_tag LOCUS_80020 201 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80020 631 1080 gene locus_tag LOCUS_80030 631 1080 CDS product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793164.1 protein_id gnl|my_center|LOCUS_80030 1208 1558 gene locus_tag LOCUS_80040 gene rplS 1208 1558 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_80040 2211 1603 gene locus_tag LOCUS_80050 gene lexA 2211 1603 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208755.1 protein_id gnl|my_center|LOCUS_80050 >Feature sequence1773 393 1334 gene locus_tag LOCUS_80060 393 1334 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_80060 >Feature sequence1774 <1 866 gene locus_tag LOCUS_80070 <1 866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000080564.1:DEAD/DEAH box helicase 863 1507 gene locus_tag LOCUS_80080 863 1507 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_80080 1504 2043 gene locus_tag LOCUS_80090 1504 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80090 >Feature sequence1775 1783 1190 gene locus_tag LOCUS_80100 1783 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80100 2330 1773 gene locus_tag LOCUS_80110 2330 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80110 >Feature sequence1776 736 1140 gene locus_tag LOCUS_80120 736 1140 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836423.1 protein_id gnl|my_center|LOCUS_80120 1133 1717 gene locus_tag LOCUS_80130 1133 1717 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836424.1 protein_id gnl|my_center|LOCUS_80130 >Feature sequence1777 <1 1235 gene locus_tag LOCUS_80140 <1 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103421.1:type I restriction endonuclease subunit R >Feature sequence1778 223 579 gene locus_tag LOCUS_80150 223 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80150 607 1377 gene locus_tag LOCUS_80160 607 1377 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681611.1 protein_id gnl|my_center|LOCUS_80160 1423 1632 gene locus_tag LOCUS_80170 1423 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80170 1726 2196 gene locus_tag LOCUS_80180 1726 2196 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817484.1 protein_id gnl|my_center|LOCUS_80180 >Feature sequence1779 >Feature sequence1780 2 649 gene locus_tag LOCUS_80190 2 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80190 659 1840 gene locus_tag LOCUS_80200 gene hydF 659 1840 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_80200 >Feature sequence1781 773 1345 gene locus_tag LOCUS_80210 773 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80210 1342 1488 gene locus_tag LOCUS_80220 1342 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80220 >Feature sequence1782 1143 286 gene locus_tag LOCUS_80230 1143 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80230 1454 1140 gene locus_tag LOCUS_80240 1454 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80240 2126 1464 gene locus_tag LOCUS_80250 2126 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80250 >Feature sequence1783 1832 690 gene locus_tag LOCUS_80260 gene acdA 1832 690 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_80260 >Feature sequence1784 >Feature sequence1785 751 134 gene locus_tag LOCUS_80270 gene nadD 751 134 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964574.1 protein_id gnl|my_center|LOCUS_80270 1059 754 gene locus_tag LOCUS_80280 gene yhbY 1059 754 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830956.1 protein_id gnl|my_center|LOCUS_80280 2353 1082 gene locus_tag LOCUS_80290 gene obgE 2353 1082 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_80290 >Feature sequence1786 1185 2174 gene locus_tag LOCUS_80300 1185 2174 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889546.1 protein_id gnl|my_center|LOCUS_80300 >Feature sequence1787 >Feature sequence1788 44 349 gene locus_tag LOCUS_80310 44 349 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994780.1 protein_id gnl|my_center|LOCUS_80310 1304 561 gene locus_tag LOCUS_80320 1304 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80320 <2363 1785 gene locus_tag LOCUS_80330 <2363 1785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011475861.1:YjjG family noncanonical pyrimidine nucleotidase >Feature sequence1789 575 1174 gene locus_tag LOCUS_80340 575 1174 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166986.1 protein_id gnl|my_center|LOCUS_80340 1177 2178 gene locus_tag LOCUS_80350 1177 2178 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448020.1 protein_id gnl|my_center|LOCUS_80350 >Feature sequence1790 <2356 1176 gene locus_tag LOCUS_80360 <2356 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037863.1:AAA family ATPase >Feature sequence1791 1932 1255 gene locus_tag LOCUS_80370 1932 1255 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_80370 2325 2032 gene locus_tag LOCUS_80380 2325 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80380 >Feature sequence1792 522 1817 gene locus_tag LOCUS_80390 522 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80390 >Feature sequence1793 1735 197 gene locus_tag LOCUS_80400 1735 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80400 >Feature sequence1794 67 543 gene locus_tag LOCUS_80410 gene infC 67 543 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860916.1 protein_id gnl|my_center|LOCUS_80410 595 792 gene locus_tag LOCUS_80420 gene rpmI 595 792 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429729.1 protein_id gnl|my_center|LOCUS_80420 811 1170 gene locus_tag LOCUS_80430 gene rplT 811 1170 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429730.1 protein_id gnl|my_center|LOCUS_80430 >Feature sequence1795 1378 2337 gene locus_tag LOCUS_80440 1378 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80440 >Feature sequence1796 >Feature sequence1797 557 108 gene locus_tag LOCUS_80450 gene rpiB 557 108 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721856.1 protein_id gnl|my_center|LOCUS_80450 1415 573 gene locus_tag LOCUS_80460 gene rsmI 1415 573 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947928.1 protein_id gnl|my_center|LOCUS_80460 2151 1405 gene locus_tag LOCUS_80470 2151 1405 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947927.1 protein_id gnl|my_center|LOCUS_80470 >Feature sequence1798 <1 661 gene locus_tag LOCUS_80480 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003229499.1:L-arabinose isomerase >Feature sequence1799 635 123 gene locus_tag LOCUS_80490 635 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80490 1445 1008 gene locus_tag LOCUS_80500 1445 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80500 2088 1447 gene locus_tag LOCUS_80510 2088 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80510 >Feature sequence1800 >Feature sequence1801 806 2176 gene locus_tag LOCUS_80520 806 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80520 >Feature sequence1802 1306 875 gene locus_tag LOCUS_80530 1306 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80530 1927 1307 gene locus_tag LOCUS_80540 1927 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80540 >Feature sequence1803 982 65 gene locus_tag LOCUS_80550 gene rbsC 982 65 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419501.1 protein_id gnl|my_center|LOCUS_80550 <2323 991 gene locus_tag LOCUS_80560 <2323 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582800.1:sugar ABC transporter ATP-binding protein >Feature sequence1804 <1 933 gene locus_tag LOCUS_80570 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003242960.1:flagellar hook-associated protein 2 960 1340 gene locus_tag LOCUS_80580 gene fliS 960 1340 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243747.1 protein_id gnl|my_center|LOCUS_80580 1337 1801 gene locus_tag LOCUS_80590 1337 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80590 1810 1995 gene locus_tag LOCUS_80600 1810 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80600 >Feature sequence1805 <1 1725 gene locus_tag LOCUS_80610 <1 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459675.1:ABC transporter ATP-binding protein >Feature sequence1806 415 1194 gene locus_tag LOCUS_80620 415 1194 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015659.1 protein_id gnl|my_center|LOCUS_80620 1214 2191 gene locus_tag LOCUS_80630 1214 2191 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015658.1 protein_id gnl|my_center|LOCUS_80630 >Feature sequence1807 >Feature sequence1808 461 685 gene locus_tag LOCUS_80640 461 685 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016226.1 protein_id gnl|my_center|LOCUS_80640 682 951 gene locus_tag LOCUS_80650 682 951 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016227.1 protein_id gnl|my_center|LOCUS_80650 1010 1387 gene locus_tag LOCUS_80660 1010 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80660 >Feature sequence1809 2076 1318 gene locus_tag LOCUS_80670 2076 1318 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963364.1 protein_id gnl|my_center|LOCUS_80670 >Feature sequence1810 >Feature sequence1811 >Feature sequence1812 714 118 gene locus_tag LOCUS_80680 714 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80680 1561 833 gene locus_tag LOCUS_80690 1561 833 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989966.1 protein_id gnl|my_center|LOCUS_80690 2077 1748 gene locus_tag LOCUS_80700 2077 1748 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460590.1 protein_id gnl|my_center|LOCUS_80700 >Feature sequence1813 398 162 gene locus_tag LOCUS_80710 398 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80710 1663 497 gene locus_tag LOCUS_80720 1663 497 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_80720 >Feature sequence1814 172 1053 gene locus_tag LOCUS_80730 172 1053 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427637.1 protein_id gnl|my_center|LOCUS_80730 1056 1802 gene locus_tag LOCUS_80740 1056 1802 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_80740 >Feature sequence1815 <1 970 gene locus_tag LOCUS_80750 <1 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002356948.1:methionine ABC transporter ATP-binding protein 963 1643 gene locus_tag LOCUS_80760 963 1643 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293786.1 protein_id gnl|my_center|LOCUS_80760 >Feature sequence1816 119 259 gene locus_tag LOCUS_80770 119 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80770 2014 302 gene locus_tag LOCUS_80780 2014 302 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_80780 >Feature sequence1817 <1 930 gene locus_tag LOCUS_80790 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972116.1:extracellular solute-binding protein 1026 1916 gene locus_tag LOCUS_80800 1026 1916 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_80800 >Feature sequence1818 1690 149 gene locus_tag LOCUS_80810 1690 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80810 <2298 1690 gene locus_tag LOCUS_80820 <2298 1690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357557.1:ATP-dependent Clp endopeptidase proteolytic subunit ClpP >Feature sequence1819 <2297 10 gene locus_tag LOCUS_80830 <2297 10 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000725079.1:N-acetylmuramoyl-L-alanine amidase family protein >Feature sequence1820 2111 1419 gene locus_tag LOCUS_80840 2111 1419 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434748.1 protein_id gnl|my_center|LOCUS_80840 >Feature sequence1821 1205 27 gene locus_tag LOCUS_80850 gene xseA 1205 27 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_80850 1661 1224 gene locus_tag LOCUS_80860 gene nusB 1661 1224 CDS product N utilization substance protein NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830247.1 protein_id gnl|my_center|LOCUS_80860 >Feature sequence1822 >Feature sequence1823 476 691 gene locus_tag LOCUS_80870 476 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80870 714 932 gene locus_tag LOCUS_80880 714 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80880 1035 1388 gene locus_tag LOCUS_80890 1035 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80890 2259 1471 gene locus_tag LOCUS_80900 2259 1471 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_80900 >Feature sequence1824 405 1775 gene locus_tag LOCUS_80910 405 1775 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_80910 1923 2207 gene locus_tag LOCUS_80920 gene groES 1923 2207 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965991.1 protein_id gnl|my_center|LOCUS_80920 >Feature sequence1825 <1 1047 gene locus_tag LOCUS_80930 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015979.1:glycine betaine ABC transporter substrate-binding protein 1040 1768 gene locus_tag LOCUS_80940 1040 1768 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008798583.1 protein_id gnl|my_center|LOCUS_80940 >Feature sequence1826 >Feature sequence1827 2226 943 gene locus_tag LOCUS_80950 2226 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80950 >Feature sequence1828 <1 704 gene locus_tag LOCUS_80960 <1 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977908.1:sugar ABC transporter substrate-binding protein 769 1665 gene locus_tag LOCUS_80970 769 1665 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080851.1 protein_id gnl|my_center|LOCUS_80970 >Feature sequence1829 218 1090 gene locus_tag LOCUS_80980 gene galU 218 1090 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890959.1 protein_id gnl|my_center|LOCUS_80980 >Feature sequence1830 1326 1090 gene locus_tag LOCUS_80990 1326 1090 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_80990 1610 1323 gene locus_tag LOCUS_81000 1610 1323 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_81000 >Feature sequence1831 137 844 gene locus_tag LOCUS_81010 137 844 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_81010 844 1644 gene locus_tag LOCUS_81020 844 1644 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434000.1 protein_id gnl|my_center|LOCUS_81020 >Feature sequence1832 1107 169 gene locus_tag LOCUS_81030 1107 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81030 1475 2167 gene locus_tag LOCUS_81040 1475 2167 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161338.1 protein_id gnl|my_center|LOCUS_81040 >Feature sequence1833 1037 6 gene locus_tag LOCUS_81050 1037 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81050 2057 1053 gene locus_tag LOCUS_81060 2057 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81060 >Feature sequence1834 494 1279 gene locus_tag LOCUS_81070 494 1279 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964117.1 protein_id gnl|my_center|LOCUS_81070 >Feature sequence1835 <1 1079 gene locus_tag LOCUS_81080 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289265.1:formate C-acetyltransferase 1291 2019 gene locus_tag LOCUS_81090 gene pflA 1291 2019 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_81090 >Feature sequence1836 2 235 gene locus_tag LOCUS_81100 2 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81100 303 1196 gene locus_tag LOCUS_81110 303 1196 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433936.1 protein_id gnl|my_center|LOCUS_81110 1217 1954 gene locus_tag LOCUS_81120 1217 1954 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433939.1 protein_id gnl|my_center|LOCUS_81120 >Feature sequence1837 615 82 gene locus_tag LOCUS_81130 615 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81130 2270 615 gene locus_tag LOCUS_81140 2270 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81140 >Feature sequence1838 660 1 gene locus_tag LOCUS_81150 660 1 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398827.1 protein_id gnl|my_center|LOCUS_81150 1486 704 gene locus_tag LOCUS_81160 1486 704 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429300.1 protein_id gnl|my_center|LOCUS_81160 2089 1763 gene locus_tag LOCUS_81170 gene rnpA 2089 1763 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_81170 >Feature sequence1839 238 651 gene locus_tag LOCUS_81180 238 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81180 >Feature sequence1840 <1 1248 gene locus_tag LOCUS_81190 <1 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061827.1:sugar ABC transporter substrate-binding protein 1220 2134 gene locus_tag LOCUS_81200 1220 2134 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898777.1 protein_id gnl|my_center|LOCUS_81200 >Feature sequence1841 <1 758 gene locus_tag LOCUS_81210 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015137.1:carbohydrate ABC transporter permease >Feature sequence1842 87 512 gene locus_tag LOCUS_81220 87 512 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379854.1 protein_id gnl|my_center|LOCUS_81220 522 647 gene locus_tag LOCUS_81230 522 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81230 686 1525 gene locus_tag LOCUS_81240 686 1525 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861516.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_81240 >Feature sequence1843 478 1242 gene locus_tag LOCUS_81250 478 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81250 1252 1605 gene locus_tag LOCUS_81260 1252 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81260 >Feature sequence1844 1197 31 gene locus_tag LOCUS_81270 gene cytX 1197 31 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225706.1 protein_id gnl|my_center|LOCUS_81270 2002 1190 gene locus_tag LOCUS_81280 gene thiD 2002 1190 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_81280 >Feature sequence1845 >Feature sequence1846 1939 104 gene locus_tag LOCUS_81290 1939 104 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_81290 >Feature sequence1847 264 115 gene locus_tag LOCUS_81300 264 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81300 561 331 gene locus_tag LOCUS_81310 561 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81310 1035 841 gene locus_tag LOCUS_81320 1035 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81320 1403 1257 gene locus_tag LOCUS_81330 1403 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81330 1834 1400 gene locus_tag LOCUS_81340 1834 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81340 >Feature sequence1848 29 955 gene locus_tag LOCUS_81350 gene miaA 29 955 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_81350 >Feature sequence1849 1545 1060 gene locus_tag LOCUS_81360 1545 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81360 2020 1577 gene locus_tag LOCUS_81370 2020 1577 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797437.1 protein_id gnl|my_center|LOCUS_81370 >Feature sequence1850 2188 1808 gene locus_tag LOCUS_81380 2188 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81380 >Feature sequence1851 1263 406 gene locus_tag LOCUS_81390 1263 406 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261394.1 protein_id gnl|my_center|LOCUS_81390 >Feature sequence1852 >Feature sequence1853 >Feature sequence1854 720 403 gene locus_tag LOCUS_81400 720 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81400 1820 831 gene locus_tag LOCUS_81410 1820 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81410 >Feature sequence1855 <2229 814 gene locus_tag LOCUS_81420 <2229 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000960113.1:(2,3-dihydroxybenzoyl)adenylate synthase >Feature sequence1856 541 1353 gene locus_tag LOCUS_81430 541 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81430 1441 2070 gene locus_tag LOCUS_81440 gene upp 1441 2070 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_81440 >Feature sequence1857 >Feature sequence1858 >Feature sequence1859 >Feature sequence1860 <2220 1672 gene locus_tag LOCUS_81450 <2220 1672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878541.1:chemotaxis response regulator protein-glutamate methylesterase >Feature sequence1861 1172 249 gene locus_tag LOCUS_81460 1172 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81460 2143 1169 gene locus_tag LOCUS_81470 2143 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81470 >Feature sequence1862 >Feature sequence1863 1873 50 gene locus_tag LOCUS_81480 1873 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81480 >Feature sequence1864 <1 809 gene locus_tag LOCUS_81490 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003426959.1:ribosome biogenesis GTPase Der 809 1441 gene locus_tag LOCUS_81500 gene plsY 809 1441 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_81500 >Feature sequence1865 <1 1695 gene locus_tag LOCUS_81510 <1 1695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272774.1:FtsX-like permease family protein >Feature sequence1866 >Feature sequence1867 102 509 gene locus_tag LOCUS_81520 102 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81520 710 1057 gene locus_tag LOCUS_81530 710 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81530 1787 1110 gene locus_tag LOCUS_81540 1787 1110 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_81540 >Feature sequence1868 231 1883 gene locus_tag LOCUS_81550 231 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81550 >Feature sequence1869 <1 692 gene locus_tag LOCUS_81560 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263121.1:CpaF family protein 692 1495 gene locus_tag LOCUS_81570 692 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81570 >Feature sequence1870 636 202 gene locus_tag LOCUS_81580 636 202 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773786.1 protein_id gnl|my_center|LOCUS_81580 1885 713 gene locus_tag LOCUS_81590 1885 713 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074782808.1 protein_id gnl|my_center|LOCUS_81590 >Feature sequence1871 515 1687 gene locus_tag LOCUS_81600 515 1687 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965365.1 protein_id gnl|my_center|LOCUS_81600 1684 2106 gene locus_tag LOCUS_81610 1684 2106 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086294.1 protein_id gnl|my_center|LOCUS_81610 >Feature sequence1872 <1 681 gene locus_tag LOCUS_81620 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015910.1:leucyl aminopeptidase 704 1231 gene locus_tag LOCUS_81630 704 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_81630 1313 1447 gene locus_tag LOCUS_81640 1313 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81640 1667 2146 gene locus_tag LOCUS_81650 1667 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81650 >Feature sequence1873 1840 683 gene locus_tag LOCUS_81660 1840 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81660 >Feature sequence1874 298 1683 gene locus_tag LOCUS_81670 298 1683 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_81670 1739 2005 gene locus_tag LOCUS_81680 1739 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81680 >Feature sequence1875 821 255 gene locus_tag LOCUS_81690 821 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81690 1227 796 gene locus_tag LOCUS_81700 1227 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81700 1768 1238 gene locus_tag LOCUS_81710 1768 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81710 2129 1851 gene locus_tag LOCUS_81720 2129 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81720 >Feature sequence1876 758 255 gene locus_tag LOCUS_81730 758 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81730 1692 763 gene locus_tag LOCUS_81740 1692 763 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048450.1 protein_id gnl|my_center|LOCUS_81740 >Feature sequence1877 280 1536 gene locus_tag LOCUS_81750 280 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81750 >Feature sequence1878 407 793 gene locus_tag LOCUS_81760 407 793 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903515.1 protein_id gnl|my_center|LOCUS_81760 806 1027 gene locus_tag LOCUS_81770 806 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_81770 >Feature sequence1879 716 964 gene locus_tag LOCUS_81780 716 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81780 985 1287 gene locus_tag LOCUS_81790 985 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81790 1299 1613 gene locus_tag LOCUS_81800 1299 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81800 1644 1982 gene locus_tag LOCUS_81810 1644 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81810 >Feature sequence1880 1480 680 gene locus_tag LOCUS_81820 1480 680 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546165.1 protein_id gnl|my_center|LOCUS_81820 <2182 1541 gene locus_tag LOCUS_81830 <2182 1541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016908.1:ABC transporter permease >Feature sequence1881 242 1918 gene locus_tag LOCUS_81840 242 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948484.1 protein_id gnl|my_center|LOCUS_81840 >Feature sequence1882 1386 136 gene locus_tag LOCUS_81850 1386 136 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948020.1 protein_id gnl|my_center|LOCUS_81850 >Feature sequence1883 2003 255 gene locus_tag LOCUS_81860 2003 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81860 >Feature sequence1884 <1 1546 gene locus_tag LOCUS_81870 <1 1546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454871.1:ATP-dependent DNA helicase RecG 1558 1812 gene locus_tag LOCUS_81880 1558 1812 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421412.1 protein_id gnl|my_center|LOCUS_81880 1799 2149 gene locus_tag LOCUS_81890 1799 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81890 >Feature sequence1885 119 574 gene locus_tag LOCUS_81900 119 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81900 586 2157 gene locus_tag LOCUS_81910 586 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81910 >Feature sequence1886 >Feature sequence1887 509 30 gene locus_tag LOCUS_81920 509 30 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_81920 <2173 602 gene locus_tag LOCUS_81930 <2173 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459352.1:heavy metal translocating P-type ATPase >Feature sequence1888 135 1265 gene locus_tag LOCUS_81940 135 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81940 >Feature sequence1889 994 1713 gene locus_tag LOCUS_81950 994 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81950 >Feature sequence1890 1254 1859 gene locus_tag LOCUS_81960 1254 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81960 >Feature sequence1891 <1 1359 gene locus_tag LOCUS_81970 <1 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009291950.1:HAD-IIIC family phosphatase 1421 1657 gene locus_tag LOCUS_81980 1421 1657 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336812.1 protein_id gnl|my_center|LOCUS_81980 1893 2135 gene locus_tag LOCUS_81990 1893 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81990 >Feature sequence1892 1858 113 gene locus_tag LOCUS_82000 1858 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82000 2030 1842 gene locus_tag LOCUS_82010 2030 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82010 >Feature sequence1893 842 300 gene locus_tag LOCUS_82020 gene lepB 842 300 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870097.1 protein_id gnl|my_center|LOCUS_82020 1064 864 gene locus_tag LOCUS_82030 1064 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82030 1415 1212 gene locus_tag LOCUS_82040 1415 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82040 >Feature sequence1894 <2159 789 gene locus_tag LOCUS_82050 <2159 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582720.1:response regulator >Feature sequence1895 138 272 gene locus_tag LOCUS_82060 138 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82060 365 724 gene locus_tag LOCUS_82070 365 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82070 852 1856 gene locus_tag LOCUS_82080 852 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82080 >Feature sequence1896 367 1179 gene locus_tag LOCUS_82090 367 1179 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437555.1 protein_id gnl|my_center|LOCUS_82090 >Feature sequence1897 391 1002 gene locus_tag LOCUS_82100 391 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82100 1295 2074 gene locus_tag LOCUS_82110 1295 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82110 >Feature sequence1898 4 1311 gene locus_tag LOCUS_82120 4 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82120 >Feature sequence1899 56 442 gene locus_tag LOCUS_82130 56 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82130 484 981 gene locus_tag LOCUS_82140 484 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82140 987 1388 gene locus_tag LOCUS_82150 987 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_82150 >Feature sequence1900 637 1581 gene locus_tag LOCUS_82160 637 1581 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017864718.1 protein_id gnl|my_center|LOCUS_82160 >Feature sequence1901 1199 81 gene locus_tag LOCUS_82170 gene rpoD 1199 81 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861220.1 protein_id gnl|my_center|LOCUS_82170 <2153 1248 gene locus_tag LOCUS_82180 <2153 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081732.1:DNA primase >Feature sequence1902 <1 811 gene locus_tag LOCUS_82190 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000528788.1:ABC transporter ATP-binding protein 798 1511 gene locus_tag LOCUS_82200 798 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82200 1619 1915 gene locus_tag LOCUS_82210 1619 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82210 >Feature sequence1903 >Feature sequence1904 >Feature sequence1905 132 830 gene locus_tag LOCUS_82220 132 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82220 2005 884 gene locus_tag LOCUS_82230 2005 884 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379407.1 protein_id gnl|my_center|LOCUS_82230 >Feature sequence1906 521 84 gene locus_tag LOCUS_82240 521 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82240 1615 536 gene locus_tag LOCUS_82250 1615 536 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861188.1 protein_id gnl|my_center|LOCUS_82250 2065 1628 gene locus_tag LOCUS_82260 2065 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82260 >Feature sequence1907 351 166 gene locus_tag LOCUS_82270 351 166 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_82270 1418 360 gene locus_tag LOCUS_82280 1418 360 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_82280 1919 1443 gene locus_tag LOCUS_82290 1919 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82290 >Feature sequence1908 <2145 188 gene locus_tag LOCUS_82300 <2145 188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267592.1:RHS repeat-associated core domain-containing protein >Feature sequence1909 1213 227 gene locus_tag LOCUS_82310 1213 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82310 >Feature sequence1910 >Feature sequence1911 408 1187 gene locus_tag LOCUS_82320 gene rfbF 408 1187 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816687.1 protein_id gnl|my_center|LOCUS_82320 >Feature sequence1912 <1 1120 gene locus_tag LOCUS_82330 <1 1120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964719.1:YceG family protein >Feature sequence1913 486 893 gene locus_tag LOCUS_82340 486 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82340 897 1973 gene locus_tag LOCUS_82350 897 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82350 >Feature sequence1914 1067 531 gene locus_tag LOCUS_82360 1067 531 CDS product DUF3841 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459262.1 protein_id gnl|my_center|LOCUS_82360 1282 1998 gene locus_tag LOCUS_82370 1282 1998 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138570.1 protein_id gnl|my_center|LOCUS_82370 >Feature sequence1915 287 1582 gene locus_tag LOCUS_82380 287 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82380 >Feature sequence1916 >Feature sequence1917 1844 1713 gene locus_tag LOCUS_82390 1844 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82390 >Feature sequence1918 1713 469 gene locus_tag LOCUS_82400 1713 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82400 >Feature sequence1919 <2124 950 gene locus_tag LOCUS_82410 <2124 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949155.1:homocysteine S-methyltransferase family protein note possible pseudo, frameshifted >Feature sequence1920 919 56 gene locus_tag LOCUS_82420 919 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82420 1445 1008 gene locus_tag LOCUS_82430 1445 1008 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288165.1 protein_id gnl|my_center|LOCUS_82430 1787 1473 gene locus_tag LOCUS_82440 gene trxA 1787 1473 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018928.1 protein_id gnl|my_center|LOCUS_82440 >Feature sequence1921 601 56 gene locus_tag LOCUS_82450 601 56 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_82450 744 1076 gene locus_tag LOCUS_82460 744 1076 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420359.1 protein_id gnl|my_center|LOCUS_82460 1306 1085 gene locus_tag LOCUS_82470 1306 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82470 2121 1315 gene locus_tag LOCUS_82480 2121 1315 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900005.1 protein_id gnl|my_center|LOCUS_82480 >Feature sequence1922 <1 1687 gene locus_tag LOCUS_82490 <1 1687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043943623.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence1923 274 20 gene locus_tag LOCUS_82500 274 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492945.1 protein_id gnl|my_center|LOCUS_82500 1773 655 gene locus_tag LOCUS_82510 1773 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82510 >Feature sequence1924 1399 587 gene locus_tag LOCUS_82520 1399 587 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921761.1 protein_id gnl|my_center|LOCUS_82520 <2119 1408 gene locus_tag LOCUS_82530 <2119 1408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002939305.1:sugar ABC transporter permease >Feature sequence1925 1190 813 gene locus_tag LOCUS_82540 1190 813 CDS product DUF1310 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835879.1 protein_id gnl|my_center|LOCUS_82540 1507 1361 gene locus_tag LOCUS_82550 1507 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82550 1996 1826 gene locus_tag LOCUS_82560 1996 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82560 >Feature sequence1926 1121 132 gene locus_tag LOCUS_82570 1121 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_82570 1891 1184 gene locus_tag LOCUS_82580 1891 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_82580 >Feature sequence1927 70 1152 gene locus_tag LOCUS_82590 70 1152 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546117.1 protein_id gnl|my_center|LOCUS_82590 1152 1667 gene locus_tag LOCUS_82600 1152 1667 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544978.1 protein_id gnl|my_center|LOCUS_82600 >Feature sequence1928 1240 158 gene locus_tag LOCUS_82610 1240 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82610 1565 1275 gene locus_tag LOCUS_82620 gene cas2 1565 1275 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414276.1 protein_id gnl|my_center|LOCUS_82620 1999 1571 gene locus_tag LOCUS_82630 1999 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82630 >Feature sequence1929 581 1120 gene locus_tag LOCUS_82640 581 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82640 >Feature sequence1930 <1 1158 gene locus_tag LOCUS_82650 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000365401.1:ATP-dependent chaperone ClpB >Feature sequence1931 964 83 gene locus_tag LOCUS_82660 964 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82660 2082 991 gene locus_tag LOCUS_82670 2082 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82670 >Feature sequence1932 139 468 gene locus_tag LOCUS_82680 gene azlD 139 468 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_82680 617 1384 gene locus_tag LOCUS_82690 617 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82690 >Feature sequence1933 150 986 gene locus_tag LOCUS_82700 150 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82700 1119 1517 gene locus_tag LOCUS_82710 gene mgsA 1119 1517 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230640.1 protein_id gnl|my_center|LOCUS_82710 >Feature sequence1934 2018 48 gene locus_tag LOCUS_82720 2018 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82720 >Feature sequence1935 727 257 gene locus_tag LOCUS_82730 727 257 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461289.1 protein_id gnl|my_center|LOCUS_82730 1474 746 gene locus_tag LOCUS_82740 1474 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82740 <2094 1577 gene locus_tag LOCUS_82750 <2094 1577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467385.1:VWA domain-containing protein >Feature sequence1936 >Feature sequence1937 1329 613 gene locus_tag LOCUS_82760 1329 613 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_82760 >Feature sequence1938 2009 678 gene locus_tag LOCUS_82770 2009 678 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865052.1 protein_id gnl|my_center|LOCUS_82770 >Feature sequence1939 1348 107 gene locus_tag LOCUS_82780 1348 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82780 >Feature sequence1940 826 11 gene locus_tag LOCUS_82790 826 11 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972486.1 protein_id gnl|my_center|LOCUS_82790 1429 986 gene locus_tag LOCUS_82800 1429 986 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890423.1 protein_id gnl|my_center|LOCUS_82800 <2086 1442 gene locus_tag LOCUS_82810 <2086 1442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000654136.1:N-acetylneuraminate lyase >Feature sequence1941 <1 647 gene locus_tag LOCUS_82820 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964117.1:phosphatidylserine decarboxylase 625 1590 gene locus_tag LOCUS_82830 625 1590 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002906717.1 protein_id gnl|my_center|LOCUS_82830 >Feature sequence1942 >Feature sequence1943 327 1022 gene locus_tag LOCUS_82840 gene ric 327 1022 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948383.1 protein_id gnl|my_center|LOCUS_82840 <2083 1083 gene locus_tag LOCUS_82850 <2083 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005666065.1:sodium:alanine symporter family protein >Feature sequence1944 150 356 gene locus_tag LOCUS_82860 gene rpmE 150 356 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_82860 551 1492 gene locus_tag LOCUS_82870 551 1492 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421392.1 protein_id gnl|my_center|LOCUS_82870 >Feature sequence1945 243 1022 gene locus_tag LOCUS_82880 gene proC 243 1022 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783010.1 protein_id gnl|my_center|LOCUS_82880 1737 1204 gene locus_tag LOCUS_82890 1737 1204 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218952.1 protein_id gnl|my_center|LOCUS_82890 >Feature sequence1946 77 1072 gene locus_tag LOCUS_82900 77 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82900 1115 1531 gene locus_tag LOCUS_82910 1115 1531 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_82910 >Feature sequence1947 >Feature sequence1948 <1 817 gene locus_tag LOCUS_82920 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029494823.1:DUF4846 domain-containing protein 827 1474 gene locus_tag LOCUS_82930 827 1474 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920606.1 protein_id gnl|my_center|LOCUS_82930 >Feature sequence1949 215 976 gene locus_tag LOCUS_82940 215 976 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775663.1 protein_id gnl|my_center|LOCUS_82940 >Feature sequence1950 701 111 gene locus_tag LOCUS_82950 701 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82950 1718 951 gene locus_tag LOCUS_82960 1718 951 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_82960 >Feature sequence1951 1491 250 gene locus_tag LOCUS_82970 1491 250 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861185.1 protein_id gnl|my_center|LOCUS_82970 <2060 1470 gene locus_tag LOCUS_82980 <2060 1470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437316.1:two-component system response regulator CprR >Feature sequence1952 <1 1046 gene locus_tag LOCUS_82990 <1 1046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003427022.1:redox-regulated ATPase YchF 1071 1553 gene locus_tag LOCUS_83000 1071 1553 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680355.1 protein_id gnl|my_center|LOCUS_83000 >Feature sequence1953 252 560 gene locus_tag LOCUS_83010 252 560 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421415.1 protein_id gnl|my_center|LOCUS_83010 <2057 777 gene locus_tag LOCUS_83020 <2057 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986521.1:molecular chaperone HtpG >Feature sequence1954 524 24 gene locus_tag LOCUS_83030 524 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83030 1856 528 gene locus_tag LOCUS_83040 1856 528 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_83040 >Feature sequence1955 1056 532 gene locus_tag LOCUS_83050 1056 532 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_83050 >Feature sequence1956 1076 417 gene locus_tag LOCUS_83060 1076 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83060 <2052 1088 gene locus_tag LOCUS_83070 <2052 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003403040.1:pilus assembly protein PilM >Feature sequence1957 386 526 gene locus_tag LOCUS_83080 386 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83080 >Feature sequence1958 >Feature sequence1959 <2050 797 gene locus_tag LOCUS_83090 <2050 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987091.1:NAD-dependent dihydropyrimidine dehydrogenase subunit PreA >Feature sequence1960 971 141 gene locus_tag LOCUS_83100 971 141 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837453.1 protein_id gnl|my_center|LOCUS_83100 1867 1049 gene locus_tag LOCUS_83110 gene accD 1867 1049 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966832.1 protein_id gnl|my_center|LOCUS_83110 >Feature sequence1961 294 572 gene locus_tag LOCUS_83120 294 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83120 >Feature sequence1962 411 908 gene locus_tag LOCUS_83130 411 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83130 1314 1051 gene locus_tag LOCUS_83140 1314 1051 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016227.1 protein_id gnl|my_center|LOCUS_83140 1535 1311 gene locus_tag LOCUS_83150 1535 1311 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016897.1 protein_id gnl|my_center|LOCUS_83150 >Feature sequence1963 <1 539 gene locus_tag LOCUS_83160 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065644.1:shikimate kinase 529 1101 gene locus_tag LOCUS_83170 529 1101 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840898.1 protein_id gnl|my_center|LOCUS_83170 >Feature sequence1964 >Feature sequence1965 >Feature sequence1966 1082 1960 gene locus_tag LOCUS_83180 1082 1960 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861630.1 protein_id gnl|my_center|LOCUS_83180 >Feature sequence1967 12 1271 gene locus_tag LOCUS_83190 12 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83190 >Feature sequence1968 <2031 1312 gene locus_tag LOCUS_83200 <2031 1312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860946.1:ATP-dependent helicase >Feature sequence1969 <1 503 gene locus_tag LOCUS_83210 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288289.1:alpha/beta hydrolase 752 1159 gene locus_tag LOCUS_83220 752 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83220 1182 1856 gene locus_tag LOCUS_83230 1182 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83230 >Feature sequence1970 >Feature sequence1971 1956 535 gene locus_tag LOCUS_83240 1956 535 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054029.1 protein_id gnl|my_center|LOCUS_83240 >Feature sequence1972 <1 659 gene locus_tag LOCUS_83250 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232020.1:signal recognition particle protein 790 1032 gene locus_tag LOCUS_83260 gene rpsP 790 1032 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419338.1 protein_id gnl|my_center|LOCUS_83260 1070 1300 gene locus_tag LOCUS_83270 1070 1300 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_83270 1410 1970 gene locus_tag LOCUS_83280 1410 1970 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948135.1 protein_id gnl|my_center|LOCUS_83280 >Feature sequence1973 802 386 gene locus_tag LOCUS_83290 802 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956671.1 protein_id gnl|my_center|LOCUS_83290 1074 799 gene locus_tag LOCUS_83300 1074 799 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666876.1 protein_id gnl|my_center|LOCUS_83300 1668 1087 gene locus_tag LOCUS_83310 1668 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83310 >Feature sequence1974 >Feature sequence1975 858 316 gene locus_tag LOCUS_83320 858 316 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902203.1 protein_id gnl|my_center|LOCUS_83320 1482 868 gene locus_tag LOCUS_83330 1482 868 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016144.1 protein_id gnl|my_center|LOCUS_83330 >Feature sequence1976 1547 573 gene locus_tag LOCUS_83340 gene pfkA 1547 573 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963839.1 protein_id gnl|my_center|LOCUS_83340 >Feature sequence1977 170 931 gene locus_tag LOCUS_83350 170 931 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681611.1 protein_id gnl|my_center|LOCUS_83350 982 1299 gene locus_tag LOCUS_83360 982 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83360 1277 1843 gene locus_tag LOCUS_83370 1277 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83370 >Feature sequence1978 187 35 gene locus_tag LOCUS_83380 187 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83380 961 278 gene locus_tag LOCUS_83390 961 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83390 1613 1458 gene locus_tag LOCUS_83400 1613 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83400 >Feature sequence1979 1105 1902 gene locus_tag LOCUS_83410 1105 1902 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494981.1 protein_id gnl|my_center|LOCUS_83410 >Feature sequence1980 1621 359 gene locus_tag LOCUS_83420 1621 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83420 1865 1674 gene locus_tag LOCUS_83430 1865 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83430 >Feature sequence1981 39 941 gene locus_tag LOCUS_83440 39 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83440 966 1793 gene locus_tag LOCUS_83450 966 1793 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015798.1 protein_id gnl|my_center|LOCUS_83450 >Feature sequence1982 <1 1961 gene locus_tag LOCUS_83460 <1 1961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010922036.1:heparinase II/III family protein >Feature sequence1983 >Feature sequence1984 >Feature sequence1985 149 754 gene locus_tag LOCUS_83470 149 754 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680282.1 protein_id gnl|my_center|LOCUS_83470 747 1175 gene locus_tag LOCUS_83480 747 1175 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966983.1 protein_id gnl|my_center|LOCUS_83480 1196 1798 gene locus_tag LOCUS_83490 1196 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83490 >Feature sequence1986 553 1692 gene locus_tag LOCUS_83500 553 1692 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_83500 >Feature sequence1987 >Feature sequence1988 394 933 gene locus_tag LOCUS_83510 394 933 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_83510 >Feature sequence1989 >Feature sequence1990 1764 1183 gene locus_tag LOCUS_83520 1764 1183 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420269.1 protein_id gnl|my_center|LOCUS_83520 >Feature sequence1991 1704 556 gene locus_tag LOCUS_83530 1704 556 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681416.1 protein_id gnl|my_center|LOCUS_83530 >Feature sequence1992 >Feature sequence1993 50 1603 gene locus_tag LOCUS_83540 gene cls 50 1603 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638280.1 protein_id gnl|my_center|LOCUS_83540 >Feature sequence1994 762 118 gene locus_tag LOCUS_83550 762 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83550 1919 771 gene locus_tag LOCUS_83560 gene csm5 1919 771 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414285.1 protein_id gnl|my_center|LOCUS_83560 >Feature sequence1995 >Feature sequence1996 <1 1194 gene locus_tag LOCUS_83570 <1 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948687.1:nickel-dependent lactate racemase >Feature sequence1997 467 1657 gene locus_tag LOCUS_83580 467 1657 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897664.1 protein_id gnl|my_center|LOCUS_83580 >Feature sequence1998 1246 242 gene locus_tag LOCUS_83590 gene pta 1246 242 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067215.1 protein_id gnl|my_center|LOCUS_83590 1731 1540 gene locus_tag LOCUS_83600 1731 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83600 >Feature sequence1999 239 568 gene locus_tag LOCUS_83610 gene azlD 239 568 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_83610 >Feature sequence2000 411 896 gene locus_tag LOCUS_83620 411 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83620 842 1333 gene locus_tag LOCUS_83630 842 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83630 1352 1807 gene locus_tag LOCUS_83640 1352 1807 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770492.1 protein_id gnl|my_center|LOCUS_83640 >Feature sequence2001 333 1226 gene locus_tag LOCUS_83650 gene ftcD 333 1226 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681237.1 protein_id gnl|my_center|LOCUS_83650 >Feature sequence2002 1785 433 gene locus_tag LOCUS_83660 1785 433 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389377.1 protein_id gnl|my_center|LOCUS_83660 >Feature sequence2003 1188 373 gene locus_tag LOCUS_83670 1188 373 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679293.1 protein_id gnl|my_center|LOCUS_83670 1354 1872 gene locus_tag LOCUS_83680 1354 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83680 >Feature sequence2004 2 211 gene locus_tag LOCUS_83690 2 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83690 1011 265 gene locus_tag LOCUS_83700 1011 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83700 1747 1214 gene locus_tag LOCUS_83710 1747 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_83710 >Feature sequence2005 989 456 gene locus_tag LOCUS_83720 989 456 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_83720 1303 1554 gene locus_tag LOCUS_83730 1303 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83730 >Feature sequence2006 <1 995 gene locus_tag LOCUS_83740 <1 995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836618.1:ABC transporter permease 997 1443 gene locus_tag LOCUS_83750 997 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_83750 1465 1728 gene locus_tag LOCUS_83760 1465 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_83760 >Feature sequence2007 974 141 gene locus_tag LOCUS_83770 974 141 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498756.1 protein_id gnl|my_center|LOCUS_83770 1665 943 gene locus_tag LOCUS_83780 1665 943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922088.1 protein_id gnl|my_center|LOCUS_83780 1919 1692 gene locus_tag LOCUS_83790 1919 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83790 >Feature sequence2008 742 326 gene locus_tag LOCUS_83800 742 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83800 1426 821 gene locus_tag LOCUS_83810 1426 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83810 1727 1449 gene locus_tag LOCUS_83820 1727 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83820 >Feature sequence2009 41 988 gene locus_tag LOCUS_83830 41 988 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016831.1 protein_id gnl|my_center|LOCUS_83830 981 1865 gene locus_tag LOCUS_83840 gene truB 981 1865 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_83840 >Feature sequence2010 1019 30 gene locus_tag LOCUS_83850 1019 30 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948107.1 protein_id gnl|my_center|LOCUS_83850 1695 1009 gene locus_tag LOCUS_83860 1695 1009 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429090.1 protein_id gnl|my_center|LOCUS_83860 >Feature sequence2011 45 704 gene locus_tag LOCUS_83870 45 704 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469518.1 protein_id gnl|my_center|LOCUS_83870 701 1603 gene locus_tag LOCUS_83880 701 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83880 >Feature sequence2012 <1912 574 gene locus_tag LOCUS_83890 <1912 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002995654.1:ABC transporter substrate-binding protein >Feature sequence2013 635 1552 gene locus_tag LOCUS_83900 gene cysK 635 1552 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948015.1 protein_id gnl|my_center|LOCUS_83900 >Feature sequence2014 1427 393 gene locus_tag LOCUS_83910 1427 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83910 >Feature sequence2015 >Feature sequence2016 317 1450 gene locus_tag LOCUS_83920 317 1450 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369660.1 protein_id gnl|my_center|LOCUS_83920 >Feature sequence2017 278 1039 gene locus_tag LOCUS_83930 gene aroD 278 1039 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897376.1 protein_id gnl|my_center|LOCUS_83930 1780 1103 gene locus_tag LOCUS_83940 1780 1103 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861170.1 protein_id gnl|my_center|LOCUS_83940 >Feature sequence2018 <1 723 gene locus_tag LOCUS_83950 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002356901.1:ABC transporter ATP-binding protein 910 1263 gene locus_tag LOCUS_83960 910 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83960 >Feature sequence2019 874 1512 gene locus_tag LOCUS_83970 874 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049695.1 protein_id gnl|my_center|LOCUS_83970 >Feature sequence2020 723 214 gene locus_tag LOCUS_83980 723 214 CDS product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483841.1 protein_id gnl|my_center|LOCUS_83980 1800 1126 gene locus_tag LOCUS_83990 1800 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83990 >Feature sequence2021 399 782 gene locus_tag LOCUS_84000 399 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84000 >Feature sequence2022 <1 854 gene locus_tag LOCUS_84010 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048350.1:energy-coupling factor transporter ATPase 847 1653 gene locus_tag LOCUS_84020 847 1653 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_84020 >Feature sequence2023 1628 1044 gene locus_tag LOCUS_84030 1628 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84030 >Feature sequence2024 988 794 gene locus_tag LOCUS_84040 988 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84040 >Feature sequence2025 >Feature sequence2026 1553 435 gene locus_tag LOCUS_84050 1553 435 CDS product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989698.1 protein_id gnl|my_center|LOCUS_84050 >Feature sequence2027 1358 255 gene locus_tag LOCUS_84060 gene rodA 1358 255 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888916.1 protein_id gnl|my_center|LOCUS_84060 1817 1548 gene locus_tag LOCUS_84070 gene minE 1817 1548 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419058.1 protein_id gnl|my_center|LOCUS_84070 >Feature sequence2028 430 1278 gene locus_tag LOCUS_84080 430 1278 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_84080 >Feature sequence2029 1335 787 gene locus_tag LOCUS_84090 1335 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681650.1 protein_id gnl|my_center|LOCUS_84090 1569 1351 gene locus_tag LOCUS_84100 1569 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84100 >Feature sequence2030 136 468 gene locus_tag LOCUS_84110 136 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84110 >Feature sequence2031 1665 1799 gene locus_tag LOCUS_84120 1665 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84120 >Feature sequence2032 250 1056 gene locus_tag LOCUS_84130 250 1056 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494981.1 protein_id gnl|my_center|LOCUS_84130 >Feature sequence2033 >Feature sequence2034 1447 1650 gene locus_tag LOCUS_84140 1447 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84140 >Feature sequence2035 532 1389 gene locus_tag LOCUS_84150 532 1389 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402124.1 protein_id gnl|my_center|LOCUS_84150 >Feature sequence2036 >Feature sequence2037 <1840 626 gene locus_tag LOCUS_84160 <1840 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582800.1:sugar ABC transporter ATP-binding protein >Feature sequence2038 509 261 gene locus_tag LOCUS_84170 509 261 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476650.1 protein_id gnl|my_center|LOCUS_84170 1767 553 gene locus_tag LOCUS_84180 1767 553 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_84180 >Feature sequence2039 1468 668 gene locus_tag LOCUS_84190 1468 668 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373316.1 protein_id gnl|my_center|LOCUS_84190 >Feature sequence2040 <1 1093 gene locus_tag LOCUS_84200 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987112.1:FprA family A-type flavoprotein >Feature sequence2041 276 1151 gene locus_tag LOCUS_84210 276 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84210 1356 1481 gene locus_tag LOCUS_84220 1356 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84220 >Feature sequence2042 <1 883 gene locus_tag LOCUS_84230 <1 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001212886.1:DNA polymerase III subunit beta 905 1123 gene locus_tag LOCUS_84240 905 1123 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140229.1 protein_id gnl|my_center|LOCUS_84240 >Feature sequence2043 >Feature sequence2044 80 733 gene locus_tag LOCUS_84250 gene trmB 80 733 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_84250 1038 772 gene locus_tag LOCUS_84260 gene rpsT 1038 772 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774009.1 protein_id gnl|my_center|LOCUS_84260 1356 1778 gene locus_tag LOCUS_84270 1356 1778 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_84270 >Feature sequence2045 332 1582 gene locus_tag LOCUS_84280 332 1582 CDS product immunity 26/phosphotriesterase HocA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672157.1 protein_id gnl|my_center|LOCUS_84280 1579 1773 gene locus_tag LOCUS_84290 1579 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84290 >Feature sequence2046 112 888 gene locus_tag LOCUS_84300 112 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84300 1805 966 gene locus_tag LOCUS_84310 1805 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84310 >Feature sequence2047 1565 537 gene locus_tag LOCUS_84320 1565 537 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_84320 >Feature sequence2048 277 1089 gene locus_tag LOCUS_84330 277 1089 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047741.1 protein_id gnl|my_center|LOCUS_84330 >Feature sequence2049 <1 916 gene locus_tag LOCUS_84340 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010247013.1:type IV secretory system conjugative DNA transfer family protein >Feature sequence2050 1750 644 gene locus_tag LOCUS_84350 1750 644 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_84350 >Feature sequence2051 1675 20 gene locus_tag LOCUS_84360 1675 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84360 >Feature sequence2052 >Feature sequence2053 330 55 gene locus_tag LOCUS_84370 330 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84370 1495 689 gene locus_tag LOCUS_84380 1495 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84380 >Feature sequence2054 1468 101 gene locus_tag LOCUS_84390 gene mnmE 1468 101 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966994.1 protein_id gnl|my_center|LOCUS_84390 >Feature sequence2055 583 188 gene locus_tag LOCUS_84400 583 188 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358712.1 protein_id gnl|my_center|LOCUS_84400 1518 613 gene locus_tag LOCUS_84410 1518 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84410 >Feature sequence2056 >Feature sequence2057 <1 686 gene locus_tag LOCUS_84420 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246292.1:ABC transporter ATP-binding protein 670 1377 gene locus_tag LOCUS_84430 670 1377 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073287660.1 protein_id gnl|my_center|LOCUS_84430 1380 1595 gene locus_tag LOCUS_84440 1380 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84440 >Feature sequence2058 1206 301 gene locus_tag LOCUS_84450 1206 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84450 >Feature sequence2059 >Feature sequence2060 572 1189 gene locus_tag LOCUS_84460 572 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84460 >Feature sequence2061 202 690 gene locus_tag LOCUS_84470 202 690 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429434.1 protein_id gnl|my_center|LOCUS_84470 690 1508 gene locus_tag LOCUS_84480 gene yidA 690 1508 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048269.1 protein_id gnl|my_center|LOCUS_84480 >Feature sequence2062 830 1240 gene locus_tag LOCUS_84490 830 1240 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385810.1 protein_id gnl|my_center|LOCUS_84490 >Feature sequence2063 <1 1024 gene locus_tag LOCUS_84500 <1 1024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003732661.1:iron-containing alcohol dehydrogenase >Feature sequence2064 <1 1053 gene locus_tag LOCUS_84510 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454999.1:SpoIIE family protein phosphatase >Feature sequence2065 1542 514 gene locus_tag LOCUS_84520 1542 514 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_84520 >Feature sequence2066 642 166 gene locus_tag LOCUS_84530 gene agaV 642 166 CDS product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387360.1 protein_id gnl|my_center|LOCUS_84530 >Feature sequence2067 3 1121 gene locus_tag LOCUS_84540 3 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84540 >Feature sequence2068 694 473 gene locus_tag LOCUS_84550 694 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84550 1207 767 gene locus_tag LOCUS_84560 1207 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84560 >Feature sequence2069 1414 365 gene locus_tag LOCUS_84570 1414 365 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027778.1 protein_id gnl|my_center|LOCUS_84570 >Feature sequence2070 1518 628 gene locus_tag LOCUS_84580 1518 628 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965380.1 protein_id gnl|my_center|LOCUS_84580 1723 1511 gene locus_tag LOCUS_84590 1723 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84590 >Feature sequence2071 337 59 gene locus_tag LOCUS_84600 337 59 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944457.1 protein_id gnl|my_center|LOCUS_84600 595 338 gene locus_tag LOCUS_84610 595 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84610 <1750 877 gene locus_tag LOCUS_84620 <1750 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009895984.1:spermidine/putrescine ABC transporter substrate-binding protein >Feature sequence2072 >Feature sequence2073 107 1426 gene locus_tag LOCUS_84630 107 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84630 >Feature sequence2074 895 179 gene locus_tag LOCUS_84640 895 179 CDS product DUF4241 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681658.1 protein_id gnl|my_center|LOCUS_84640 1154 1474 gene locus_tag LOCUS_84650 1154 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84650 1478 1684 gene locus_tag LOCUS_84660 1478 1684 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860795.1 protein_id gnl|my_center|LOCUS_84660 >Feature sequence2075 275 1222 gene locus_tag LOCUS_84670 gene hprK 275 1222 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_84670 >Feature sequence2076 1698 856 gene locus_tag LOCUS_84680 1698 856 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814367.1 protein_id gnl|my_center|LOCUS_84680 >Feature sequence2077 1613 756 gene locus_tag LOCUS_84690 1613 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84690 >Feature sequence2078 <1 1266 gene locus_tag LOCUS_84700 <1 1266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681381.1:type I restriction-modification system subunit M >Feature sequence2079 1401 1619 gene locus_tag LOCUS_84710 1401 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84710 >Feature sequence2080 672 154 gene locus_tag LOCUS_84720 672 154 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318917.1 protein_id gnl|my_center|LOCUS_84720 805 1671 gene locus_tag LOCUS_84730 805 1671 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892682.1 protein_id gnl|my_center|LOCUS_84730 >Feature sequence2081 >Feature sequence2082 <1670 340 gene locus_tag LOCUS_84740 <1670 340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681164.1:ABC transporter ATP-binding protein >Feature sequence2083 <1 1297 gene locus_tag LOCUS_84750 <1 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389118.1:sugar ABC transporter ATP-binding protein >Feature sequence2084 192 1172 gene locus_tag LOCUS_84760 192 1172 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875811.1 protein_id gnl|my_center|LOCUS_84760 >Feature sequence2085 >Feature sequence2086 984 313 gene locus_tag LOCUS_84770 984 313 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989471.1 protein_id gnl|my_center|LOCUS_84770 >Feature sequence2087 <1 580 gene locus_tag LOCUS_84780 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966758.1:radical SAM protein 645 1124 gene locus_tag LOCUS_84790 645 1124 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261902.1 protein_id gnl|my_center|LOCUS_84790 >Feature sequence2088 <1649 792 gene locus_tag LOCUS_84800 <1649 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022091.1:restriction endonuclease subunit S >Feature sequence2089 >Feature sequence2090 1264 233 gene locus_tag LOCUS_84810 1264 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84810 1640 1275 gene locus_tag LOCUS_84820 1640 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84820 >Feature sequence2091 >Feature sequence2092 25 813 gene locus_tag LOCUS_84830 25 813 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_84830 >Feature sequence2093 >Feature sequence2094 541 212 gene locus_tag LOCUS_84840 541 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84840 <1590 552 gene locus_tag LOCUS_84850 <1590 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880450.1:type II secretion system F family protein >Feature sequence2095 255 539 gene locus_tag LOCUS_84860 255 539 CDS product CD1845 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860780.1 protein_id gnl|my_center|LOCUS_84860 >Feature sequence2096 <1589 1000 gene locus_tag LOCUS_84870 <1589 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_018365292.1:YafY family protein >Feature sequence2097 <1 600 gene locus_tag LOCUS_84880 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015979.1:glycine betaine ABC transporter substrate-binding protein 614 1411 gene locus_tag LOCUS_84890 614 1411 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438780.1 protein_id gnl|my_center|LOCUS_84890 >Feature sequence2098 304 23 gene locus_tag LOCUS_84900 304 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84900 786 301 gene locus_tag LOCUS_84910 786 301 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425085.1 protein_id gnl|my_center|LOCUS_84910 1480 854 gene locus_tag LOCUS_84920 1480 854 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006874833.1 protein_id gnl|my_center|LOCUS_84920 >Feature sequence2099 999 829 gene locus_tag LOCUS_84930 999 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84930 >Feature sequence2100 81 569 gene locus_tag LOCUS_84940 81 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84940 >Feature sequence2101 907 482 gene locus_tag LOCUS_84950 907 482 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670063.1 protein_id gnl|my_center|LOCUS_84950 <1567 980 gene locus_tag LOCUS_84960 <1567 980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681885.1:DMT family transporter >Feature sequence2102 >Feature sequence2103 853 413 gene locus_tag LOCUS_84970 853 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84970 <1562 932 gene locus_tag LOCUS_84980 <1562 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437034.1:HAMP domain-containing sensor histidine kinase >Feature sequence2104 >Feature sequence2105 >Feature sequence2106 <1 767 gene locus_tag LOCUS_84990 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003385115.1:50S ribosomal protein L11 methyltransferase >Feature sequence2107 1493 504 gene locus_tag LOCUS_85000 1493 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_85000 >Feature sequence2108 563 820 gene locus_tag LOCUS_85010 563 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_85010 >Feature sequence2109 874 62 gene locus_tag LOCUS_85020 874 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_85020 <1499 948 gene locus_tag LOCUS_85030 <1499 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_120770826.1:LD-carboxypeptidase >Feature sequence2110 <1 1306 gene locus_tag LOCUS_85040 <1 1306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405061.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence2111 >Feature sequence2112 >Feature sequence2113 >Feature sequence2114 1060 1437 gene locus_tag LOCUS_85050 1060 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_85050 >Feature sequence2115 14 1129 gene locus_tag LOCUS_85060 14 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_85060 >Feature sequence2116 1087 206 gene locus_tag LOCUS_85070 1087 206 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059807.1 protein_id gnl|my_center|LOCUS_85070 >Feature sequence2117 <1 856 gene locus_tag LOCUS_85080 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243860.1:ABC transporter substrate-binding protein >Feature sequence2118 81 710 gene locus_tag LOCUS_85090 81 710 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_85090 >Feature sequence2119 498 169 gene locus_tag LOCUS_85100 498 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_85100 <1120 540 gene locus_tag LOCUS_85110 <1120 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096552.1:sucrose-6-phosphate hydrolase