>Feature sequence001 1532 243 gene locus_tag LOCUS_00010 1532 243 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256439.1 protein_id gnl|my_center|LOCUS_00010 1910 1536 gene locus_tag LOCUS_00020 gene queD 1910 1536 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_00020 2403 1867 gene locus_tag LOCUS_00030 gene folK 2403 1867 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_00030 3372 2446 gene locus_tag LOCUS_00040 gene rnz 3372 2446 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086661.1 protein_id gnl|my_center|LOCUS_00040 4678 3377 gene locus_tag LOCUS_00050 4678 3377 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257786.1 protein_id gnl|my_center|LOCUS_00050 4818 4745 gene locus_tag LOCUS_t00010 4818 4745 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4896 4824 gene locus_tag LOCUS_t00020 4896 4824 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5524 5114 gene locus_tag LOCUS_00060 5524 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5782 6831 gene locus_tag LOCUS_00070 5782 6831 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301207.1 protein_id gnl|my_center|LOCUS_00070 6838 7683 gene locus_tag LOCUS_00080 gene mreC 6838 7683 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_00080 7839 8186 gene locus_tag LOCUS_00090 7839 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8180 10087 gene locus_tag LOCUS_00100 gene mrdA 8180 10087 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_00100 10176 10811 gene locus_tag LOCUS_00110 gene minC 10176 10811 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255923.1 protein_id gnl|my_center|LOCUS_00110 10994 11791 gene locus_tag LOCUS_00120 gene minD 10994 11791 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255922.1 protein_id gnl|my_center|LOCUS_00120 11804 12067 gene locus_tag LOCUS_00130 gene minE 11804 12067 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358099.1 protein_id gnl|my_center|LOCUS_00130 12077 13165 gene locus_tag LOCUS_00140 gene rodA 12077 13165 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_00140 13231 14286 gene locus_tag LOCUS_00150 13231 14286 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393885.1 protein_id gnl|my_center|LOCUS_00150 14406 15536 gene locus_tag LOCUS_00160 14406 15536 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393885.1 protein_id gnl|my_center|LOCUS_00160 17233 15569 gene locus_tag LOCUS_00170 gene argS 17233 15569 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869400.1 protein_id gnl|my_center|LOCUS_00170 17524 20247 gene locus_tag LOCUS_00180 gene alaS 17524 20247 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_00180 >Feature sequence002 1430 1975 gene locus_tag LOCUS_00190 1430 1975 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082498.1 protein_id gnl|my_center|LOCUS_00190 2095 2847 gene locus_tag LOCUS_00200 2095 2847 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203087.1 protein_id gnl|my_center|LOCUS_00200 2968 3540 gene locus_tag LOCUS_00210 gene xpt 2968 3540 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888255.1 protein_id gnl|my_center|LOCUS_00210 3558 4223 gene locus_tag LOCUS_00220 3558 4223 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_00220 4276 5571 gene locus_tag LOCUS_00230 gene miaB 4276 5571 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258276.1 protein_id gnl|my_center|LOCUS_00230 6248 5568 gene locus_tag LOCUS_00240 6248 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 6270 6698 gene locus_tag LOCUS_00250 6270 6698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 6661 7803 gene locus_tag LOCUS_00260 6661 7803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 7790 8434 gene locus_tag LOCUS_00270 7790 8434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 9430 8438 gene locus_tag LOCUS_00280 9430 8438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 9503 9676 gene locus_tag LOCUS_00290 9503 9676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 12853 9875 gene locus_tag LOCUS_00300 12853 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 13364 13633 gene locus_tag LOCUS_00310 gene rpsO 13364 13633 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257912.1 protein_id gnl|my_center|LOCUS_00310 13809 16007 gene locus_tag LOCUS_00320 13809 16007 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460388.1 protein_id gnl|my_center|LOCUS_00320 16059 16232 gene locus_tag LOCUS_00330 16059 16232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 16326 19025 gene locus_tag LOCUS_00340 gene ppdK 16326 19025 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_00340 19080 19928 gene locus_tag LOCUS_00350 19080 19928 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940312.1 protein_id gnl|my_center|LOCUS_00350 >Feature sequence003 424 2586 gene locus_tag LOCUS_00360 424 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 2649 3221 gene locus_tag LOCUS_00370 2649 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 4029 3313 gene locus_tag LOCUS_00380 4029 3313 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881332.1 protein_id gnl|my_center|LOCUS_00380 4812 4090 gene locus_tag LOCUS_00390 gene lgt 4812 4090 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880125.1 protein_id gnl|my_center|LOCUS_00390 7602 4873 gene locus_tag LOCUS_00400 7602 4873 CDS product interleukin-like EMT inducer domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141609734.1 protein_id gnl|my_center|LOCUS_00400 7972 8832 gene locus_tag LOCUS_00410 7972 8832 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989415.1 protein_id gnl|my_center|LOCUS_00410 8879 9391 gene locus_tag LOCUS_00420 8879 9391 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869802.1 protein_id gnl|my_center|LOCUS_00420 9393 11030 gene locus_tag LOCUS_00430 9393 11030 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256179.1 protein_id gnl|my_center|LOCUS_00430 11059 11631 gene locus_tag LOCUS_00440 11059 11631 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583472.1 protein_id gnl|my_center|LOCUS_00440 13010 11628 gene locus_tag LOCUS_00450 13010 11628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 14284 13262 gene locus_tag LOCUS_00460 gene gap 14284 13262 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_00460 15674 14388 gene locus_tag LOCUS_00470 15674 14388 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144150.1 protein_id gnl|my_center|LOCUS_00470 17502 15838 gene locus_tag LOCUS_00480 17502 15838 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_00480 18329 17817 gene locus_tag LOCUS_00490 18329 17817 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_00490 >Feature sequence004 2503 434 gene locus_tag LOCUS_00500 2503 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 2786 2505 gene locus_tag LOCUS_00510 2786 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 3378 2758 gene locus_tag LOCUS_00520 3378 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 3824 3414 gene locus_tag LOCUS_00530 3824 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 6597 3886 gene locus_tag LOCUS_00540 6597 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 7349 6663 gene locus_tag LOCUS_00550 7349 6663 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763220.1 protein_id gnl|my_center|LOCUS_00550 8004 7342 gene locus_tag LOCUS_00560 8004 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 8519 8001 gene locus_tag LOCUS_00570 8519 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 9467 8520 gene locus_tag LOCUS_00580 gene rfbB 9467 8520 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023242.1 protein_id gnl|my_center|LOCUS_00580 10507 9464 gene locus_tag LOCUS_00590 10507 9464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 11189 10494 gene locus_tag LOCUS_00600 11189 10494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 13423 11186 gene locus_tag LOCUS_00610 13423 11186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 14553 13420 gene locus_tag LOCUS_00620 14553 13420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 15017 14550 gene locus_tag LOCUS_00630 15017 14550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 15361 14999 gene locus_tag LOCUS_00640 15361 14999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 15549 15346 gene locus_tag LOCUS_00650 15549 15346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 15859 15536 gene locus_tag LOCUS_00660 15859 15536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 17246 15900 gene locus_tag LOCUS_00670 17246 15900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 18552 17230 gene locus_tag LOCUS_00680 18552 17230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 >Feature sequence005 <1 1176 gene locus_tag LOCUS_00690 <1 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403748.1:AAA family ATPase 1176 2465 gene locus_tag LOCUS_00700 1176 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 2523 3077 gene locus_tag LOCUS_00710 2523 3077 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762680.1 protein_id gnl|my_center|LOCUS_00710 3074 4096 gene locus_tag LOCUS_00720 gene hypE 3074 4096 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_00720 4306 4124 gene locus_tag LOCUS_00730 4306 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 4423 4668 gene locus_tag LOCUS_00740 4423 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 4656 5051 gene locus_tag LOCUS_00750 4656 5051 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812273.1 protein_id gnl|my_center|LOCUS_00750 5055 6020 gene locus_tag LOCUS_00760 gene trxB 5055 6020 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_00760 6783 6025 gene locus_tag LOCUS_00770 6783 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 7001 7870 gene locus_tag LOCUS_00780 7001 7870 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_00780 8487 9242 gene locus_tag LOCUS_00790 8487 9242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391776.1 protein_id gnl|my_center|LOCUS_00790 9309 10154 gene locus_tag LOCUS_00800 9309 10154 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003266758.1 protein_id gnl|my_center|LOCUS_00800 10254 10895 gene locus_tag LOCUS_00810 10254 10895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 11000 11851 gene locus_tag LOCUS_00820 11000 11851 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684725.1 protein_id gnl|my_center|LOCUS_00820 11835 12257 gene locus_tag LOCUS_00830 11835 12257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 12615 13628 gene locus_tag LOCUS_00840 gene plsX 12615 13628 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774380.1 protein_id gnl|my_center|LOCUS_00840 13651 14886 gene locus_tag LOCUS_00850 gene fabF 13651 14886 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_00850 14879 17152 gene locus_tag LOCUS_00860 14879 17152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 17445 17224 gene locus_tag LOCUS_00870 17445 17224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 >Feature sequence006 439 2250 gene locus_tag LOCUS_00880 439 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 2326 3162 gene locus_tag LOCUS_00890 2326 3162 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986474.1 protein_id gnl|my_center|LOCUS_00890 3251 4921 gene locus_tag LOCUS_00900 3251 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 4891 7143 gene locus_tag LOCUS_00910 4891 7143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 7459 9057 gene locus_tag LOCUS_00920 7459 9057 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257008.1 protein_id gnl|my_center|LOCUS_00920 9223 10302 gene locus_tag LOCUS_00930 9223 10302 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_00930 10340 11269 gene locus_tag LOCUS_00940 10340 11269 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_00940 11271 12599 gene locus_tag LOCUS_00950 gene ssnA 11271 12599 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393455.1 protein_id gnl|my_center|LOCUS_00950 12656 12877 gene locus_tag LOCUS_00960 12656 12877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 12888 13817 gene locus_tag LOCUS_00970 gene fmt 12888 13817 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_00970 13893 14507 gene locus_tag LOCUS_00980 13893 14507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 14507 15214 gene locus_tag LOCUS_00990 14507 15214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 15858 15211 gene locus_tag LOCUS_01000 15858 15211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 16984 15860 gene locus_tag LOCUS_01010 16984 15860 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259094.1 protein_id gnl|my_center|LOCUS_01010 >Feature sequence007 209 1240 gene locus_tag LOCUS_01020 209 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 1237 1842 gene locus_tag LOCUS_01030 gene tsf 1237 1842 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583563.1 protein_id gnl|my_center|LOCUS_01030 1832 2572 gene locus_tag LOCUS_01040 gene pyrH 1832 2572 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_01040 2605 3162 gene locus_tag LOCUS_01050 gene frr 2605 3162 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_01050 3173 3889 gene locus_tag LOCUS_01060 3173 3889 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_01060 3867 4712 gene locus_tag LOCUS_01070 3867 4712 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259407.1 protein_id gnl|my_center|LOCUS_01070 4714 5304 gene locus_tag LOCUS_01080 gene rdgB 4714 5304 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256394.1 protein_id gnl|my_center|LOCUS_01080 5680 5297 gene locus_tag LOCUS_01090 gene rsfS 5680 5297 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257176.1 protein_id gnl|my_center|LOCUS_01090 7142 5787 gene locus_tag LOCUS_01100 gene mgtE 7142 5787 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228410.1 protein_id gnl|my_center|LOCUS_01100 7988 7467 gene locus_tag LOCUS_01110 7988 7467 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080594.1 protein_id gnl|my_center|LOCUS_01110 8396 8031 gene locus_tag LOCUS_01120 8396 8031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 8647 8504 gene locus_tag LOCUS_01130 8647 8504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 9430 8660 gene locus_tag LOCUS_01140 gene tpiA 9430 8660 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880184.1 protein_id gnl|my_center|LOCUS_01140 10129 9788 gene locus_tag LOCUS_01150 10129 9788 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546371.1 protein_id gnl|my_center|LOCUS_01150 11622 10342 gene locus_tag LOCUS_01160 11622 10342 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815926.1 protein_id gnl|my_center|LOCUS_01160 12573 11698 gene locus_tag LOCUS_01170 12573 11698 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_01170 13503 12580 gene locus_tag LOCUS_01180 13503 12580 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257155.1 protein_id gnl|my_center|LOCUS_01180 14426 13518 gene locus_tag LOCUS_01190 14426 13518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 15694 14618 gene locus_tag LOCUS_01200 15694 14618 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870598.1 protein_id gnl|my_center|LOCUS_01200 >Feature sequence008 901 188 gene locus_tag LOCUS_01210 901 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 1600 2076 gene locus_tag LOCUS_01220 1600 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 2057 4300 gene locus_tag LOCUS_01230 2057 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 8289 4297 gene locus_tag LOCUS_01240 8289 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 10090 8291 gene locus_tag LOCUS_01250 10090 8291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 10296 10096 gene locus_tag LOCUS_01260 10296 10096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 10670 10293 gene locus_tag LOCUS_01270 10670 10293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 11485 10676 gene locus_tag LOCUS_01280 11485 10676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 12313 11531 gene locus_tag LOCUS_01290 12313 11531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 12741 12316 gene locus_tag LOCUS_01300 12741 12316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 13091 12738 gene locus_tag LOCUS_01310 13091 12738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 13726 13094 gene locus_tag LOCUS_01320 13726 13094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 14890 13829 gene locus_tag LOCUS_01330 14890 13829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 15167 14943 gene locus_tag LOCUS_01340 15167 14943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 15577 15170 gene locus_tag LOCUS_01350 15577 15170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 >Feature sequence009 223 32 gene locus_tag LOCUS_01360 223 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 481 839 gene locus_tag LOCUS_tm00010 481 839 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 991 2061 gene locus_tag LOCUS_01370 991 2061 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257004.1 protein_id gnl|my_center|LOCUS_01370 2117 3541 gene locus_tag LOCUS_01380 2117 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 4524 3565 gene locus_tag LOCUS_01390 4524 3565 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257470.1 protein_id gnl|my_center|LOCUS_01390 4618 4983 gene locus_tag LOCUS_01400 4618 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 7625 5256 gene locus_tag LOCUS_01410 7625 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 7924 8466 gene locus_tag LOCUS_01420 7924 8466 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_01420 8476 9288 gene locus_tag LOCUS_01430 8476 9288 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868514.1 protein_id gnl|my_center|LOCUS_01430 10354 9368 gene locus_tag LOCUS_01440 10354 9368 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_01440 11412 10423 gene locus_tag LOCUS_01450 11412 10423 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_01450 13261 11609 gene locus_tag LOCUS_01460 13261 11609 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_01460 14599 13379 gene locus_tag LOCUS_01470 14599 13379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 >Feature sequence010 307 122 gene locus_tag LOCUS_01480 307 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 263 1666 gene locus_tag LOCUS_01490 263 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 1663 2100 gene locus_tag LOCUS_01500 gene ruvX 1663 2100 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_01500 2710 2120 gene locus_tag LOCUS_01510 2710 2120 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257866.1 protein_id gnl|my_center|LOCUS_01510 3903 2842 gene locus_tag LOCUS_01520 3903 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 4629 7235 gene locus_tag LOCUS_01530 4629 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 7255 8691 gene locus_tag LOCUS_01540 7255 8691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 8724 9920 gene locus_tag LOCUS_01550 gene truD 8724 9920 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393246.1 protein_id gnl|my_center|LOCUS_01550 10265 11785 gene locus_tag LOCUS_01560 10265 11785 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_01560 11934 14120 gene locus_tag LOCUS_01570 11934 14120 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257190.1 protein_id gnl|my_center|LOCUS_01570 >Feature sequence011 147 716 gene locus_tag LOCUS_01580 147 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 713 1045 gene locus_tag LOCUS_01590 713 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 1042 1311 gene locus_tag LOCUS_01600 1042 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 1313 1528 gene locus_tag LOCUS_01610 1313 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 1521 1697 gene locus_tag LOCUS_01620 1521 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 1699 2025 gene locus_tag LOCUS_01630 1699 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 2022 2156 gene locus_tag LOCUS_01640 2022 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 2506 2643 gene locus_tag LOCUS_01650 2506 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 2640 2840 gene locus_tag LOCUS_01660 2640 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 2845 3258 gene locus_tag LOCUS_01670 2845 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 3240 3521 gene locus_tag LOCUS_01680 3240 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 3528 4421 gene locus_tag LOCUS_01690 3528 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 4418 4657 gene locus_tag LOCUS_01700 4418 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 4705 5346 gene locus_tag LOCUS_01710 4705 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 5357 5548 gene locus_tag LOCUS_01720 5357 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 5748 6878 gene locus_tag LOCUS_01730 5748 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 6875 7870 gene locus_tag LOCUS_01740 6875 7870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 7915 9000 gene locus_tag LOCUS_01750 7915 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 9016 9942 gene locus_tag LOCUS_01760 9016 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 9944 10327 gene locus_tag LOCUS_01770 9944 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 10317 10721 gene locus_tag LOCUS_01780 10317 10721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 10941 11108 gene locus_tag LOCUS_01790 10941 11108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 11302 12018 gene locus_tag LOCUS_01800 11302 12018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 12052 12213 gene locus_tag LOCUS_01810 12052 12213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 12282 12662 gene locus_tag LOCUS_01820 12282 12662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 12643 12882 gene locus_tag LOCUS_01830 12643 12882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 12885 13109 gene locus_tag LOCUS_01840 12885 13109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 13109 13279 gene locus_tag LOCUS_01850 13109 13279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 >Feature sequence012 828 115 gene locus_tag LOCUS_01860 828 115 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318933.1 protein_id gnl|my_center|LOCUS_01860 1568 831 gene locus_tag LOCUS_01870 1568 831 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_01870 2635 1643 gene locus_tag LOCUS_01880 2635 1643 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_01880 3680 2649 gene locus_tag LOCUS_01890 3680 2649 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_01890 4811 3759 gene locus_tag LOCUS_01900 4811 3759 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_01900 5007 5465 gene locus_tag LOCUS_01910 5007 5465 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418377.1 protein_id gnl|my_center|LOCUS_01910 6491 5607 gene locus_tag LOCUS_01920 6491 5607 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258504.1 protein_id gnl|my_center|LOCUS_01920 7134 6505 gene locus_tag LOCUS_01930 7134 6505 CDS product 4-vinyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256303.1 protein_id gnl|my_center|LOCUS_01930 7532 7158 gene locus_tag LOCUS_01940 7532 7158 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256185.1 protein_id gnl|my_center|LOCUS_01940 7738 7502 gene locus_tag LOCUS_01950 7738 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 8303 7731 gene locus_tag LOCUS_01960 8303 7731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 8852 8658 gene locus_tag LOCUS_01970 8852 8658 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418375.1 protein_id gnl|my_center|LOCUS_01970 9199 10221 gene locus_tag LOCUS_01980 9199 10221 CDS product C-GCAxxG-C-C family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812774.1 protein_id gnl|my_center|LOCUS_01980 10205 10870 gene locus_tag LOCUS_01990 10205 10870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 11103 11582 gene locus_tag LOCUS_02000 11103 11582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 11726 12376 gene locus_tag LOCUS_02010 11726 12376 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583150.1 protein_id gnl|my_center|LOCUS_02010 12875 12462 gene locus_tag LOCUS_02020 12875 12462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 13714 12929 gene locus_tag LOCUS_02030 13714 12929 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262133.1 protein_id gnl|my_center|LOCUS_02030 >Feature sequence013 2334 1300 gene locus_tag LOCUS_02040 2334 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 2886 2413 gene locus_tag LOCUS_02050 2886 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 4070 2952 gene locus_tag LOCUS_02060 4070 2952 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064526.1 protein_id gnl|my_center|LOCUS_02060 4747 4241 gene locus_tag LOCUS_02070 4747 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 5353 7485 gene locus_tag LOCUS_02080 5353 7485 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_02080 8676 7504 gene locus_tag LOCUS_02090 8676 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 9048 8767 gene locus_tag LOCUS_02100 gene rpsR 9048 8767 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359407.1 protein_id gnl|my_center|LOCUS_02100 9480 9073 gene locus_tag LOCUS_02110 9480 9073 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256912.1 protein_id gnl|my_center|LOCUS_02110 9845 9546 gene locus_tag LOCUS_02120 gene rpsF 9845 9546 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_02120 10771 10004 gene locus_tag LOCUS_02130 10771 10004 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658011.1 protein_id gnl|my_center|LOCUS_02130 11558 10785 gene locus_tag LOCUS_02140 11558 10785 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658011.1 protein_id gnl|my_center|LOCUS_02140 11810 12646 gene locus_tag LOCUS_02150 11810 12646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02150 >Feature sequence014 1641 301 gene locus_tag LOCUS_02160 1641 301 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_02160 2862 1702 gene locus_tag LOCUS_02170 2862 1702 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257780.1 protein_id gnl|my_center|LOCUS_02170 3708 2926 gene locus_tag LOCUS_02180 3708 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 4123 3734 gene locus_tag LOCUS_02190 4123 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 4409 4089 gene locus_tag LOCUS_02200 4409 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 4627 4412 gene locus_tag LOCUS_02210 4627 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 5711 4707 gene locus_tag LOCUS_02220 5711 4707 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257630.1 protein_id gnl|my_center|LOCUS_02220 6127 5783 gene locus_tag LOCUS_02230 6127 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 6209 6385 gene locus_tag LOCUS_02240 6209 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 6382 7683 gene locus_tag LOCUS_02250 6382 7683 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_02250 8955 7741 gene locus_tag LOCUS_02260 8955 7741 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763576.1 protein_id gnl|my_center|LOCUS_02260 11097 9025 gene locus_tag LOCUS_02270 11097 9025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:complement(10690..10692),aa:Sec) note codon on position 136 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_02270 11485 11219 gene locus_tag LOCUS_02280 11485 11219 CDS product DUF4926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403415.1 protein_id gnl|my_center|LOCUS_02280 12277 11507 gene locus_tag LOCUS_02290 12277 11507 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940765.1 protein_id gnl|my_center|LOCUS_02290 12711 12325 gene locus_tag LOCUS_02300 12711 12325 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857681.1 protein_id gnl|my_center|LOCUS_02300 13004 12708 gene locus_tag LOCUS_02310 13004 12708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 >Feature sequence015 421 1299 gene locus_tag LOCUS_02320 421 1299 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257889.1 protein_id gnl|my_center|LOCUS_02320 2487 1309 gene locus_tag LOCUS_02330 2487 1309 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_02330 3824 2667 gene locus_tag LOCUS_02340 3824 2667 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460503.1 protein_id gnl|my_center|LOCUS_02340 4505 3936 gene locus_tag LOCUS_02350 4505 3936 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443401.1 protein_id gnl|my_center|LOCUS_02350 6488 4812 gene locus_tag LOCUS_02360 6488 4812 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391777.1 protein_id gnl|my_center|LOCUS_02360 7342 6485 gene locus_tag LOCUS_02370 7342 6485 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232221.1 protein_id gnl|my_center|LOCUS_02370 7841 7407 gene locus_tag LOCUS_02380 7841 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 8577 7882 gene locus_tag LOCUS_02390 8577 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 8860 11169 gene locus_tag LOCUS_02400 8860 11169 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879109.1 protein_id gnl|my_center|LOCUS_02400 11144 11335 gene locus_tag LOCUS_02410 11144 11335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 11366 12301 gene locus_tag LOCUS_02420 11366 12301 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880854.1 protein_id gnl|my_center|LOCUS_02420 13319 12336 gene locus_tag LOCUS_02430 13319 12336 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817156.1 protein_id gnl|my_center|LOCUS_02430 >Feature sequence016 234 389 gene locus_tag LOCUS_02440 234 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 424 759 gene locus_tag LOCUS_02450 424 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 1146 2084 gene locus_tag LOCUS_02460 1146 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 2203 2039 gene locus_tag LOCUS_02470 2203 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 2256 2432 gene locus_tag LOCUS_02480 2256 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 3778 2444 gene locus_tag LOCUS_02490 3778 2444 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582827.1 protein_id gnl|my_center|LOCUS_02490 5103 3814 gene locus_tag LOCUS_02500 5103 3814 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763569.1 protein_id gnl|my_center|LOCUS_02500 6260 5235 gene locus_tag LOCUS_02510 6260 5235 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583055.1 protein_id gnl|my_center|LOCUS_02510 7207 6380 gene locus_tag LOCUS_02520 7207 6380 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967714.1 protein_id gnl|my_center|LOCUS_02520 8241 7219 gene locus_tag LOCUS_02530 8241 7219 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640182.1 protein_id gnl|my_center|LOCUS_02530 9615 8305 gene locus_tag LOCUS_02540 9615 8305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 10409 9612 gene locus_tag LOCUS_02550 10409 9612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 11462 10491 gene locus_tag LOCUS_02560 11462 10491 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867902.1 protein_id gnl|my_center|LOCUS_02560 11968 11459 gene locus_tag LOCUS_02570 11968 11459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 <12970 12297 gene locus_tag LOCUS_02580 <12970 12297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226190.1:sugar ABC transporter permease >Feature sequence017 1055 90 gene locus_tag LOCUS_02590 1055 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 1297 1052 gene locus_tag LOCUS_02600 1297 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 1608 1760 gene locus_tag LOCUS_02610 1608 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 1760 2779 gene locus_tag LOCUS_02620 1760 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 2776 2973 gene locus_tag LOCUS_02630 2776 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 3218 3808 gene locus_tag LOCUS_02640 3218 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 3916 4314 gene locus_tag LOCUS_02650 3916 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 4328 4621 gene locus_tag LOCUS_02660 4328 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 4614 5015 gene locus_tag LOCUS_02670 4614 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 7005 5116 gene locus_tag LOCUS_02680 7005 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 7338 7078 gene locus_tag LOCUS_02690 7338 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 7615 7325 gene locus_tag LOCUS_02700 7615 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 7809 7612 gene locus_tag LOCUS_02710 7809 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 8058 7825 gene locus_tag LOCUS_02720 8058 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 9359 8061 gene locus_tag LOCUS_02730 9359 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 9765 9352 gene locus_tag LOCUS_02740 9765 9352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 10151 9828 gene locus_tag LOCUS_02750 10151 9828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 10948 10166 gene locus_tag LOCUS_02760 10948 10166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 11425 10976 gene locus_tag LOCUS_02770 11425 10976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 11517 11714 gene locus_tag LOCUS_02780 11517 11714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 11674 12138 gene locus_tag LOCUS_02790 11674 12138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 12148 12471 gene locus_tag LOCUS_02800 12148 12471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 >Feature sequence018 452 153 gene locus_tag LOCUS_02810 452 153 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249719.1 protein_id gnl|my_center|LOCUS_02810 762 496 gene locus_tag LOCUS_02820 762 496 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392380.1 protein_id gnl|my_center|LOCUS_02820 1466 768 gene locus_tag LOCUS_02830 1466 768 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_02830 2265 1489 gene locus_tag LOCUS_02840 gene pgeF 2265 1489 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_02840 2392 2467 gene locus_tag LOCUS_t00030 2392 2467 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2505 2578 gene locus_tag LOCUS_t00040 2505 2578 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2594 2665 gene locus_tag LOCUS_t00050 2594 2665 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2727 3764 gene locus_tag LOCUS_02850 2727 3764 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257404.1 protein_id gnl|my_center|LOCUS_02850 3776 4999 gene locus_tag LOCUS_02860 3776 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 5048 5887 gene locus_tag LOCUS_02870 5048 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 6107 7030 gene locus_tag LOCUS_02880 gene argF 6107 7030 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_02880 7340 9535 gene locus_tag LOCUS_02890 7340 9535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 9547 10359 gene locus_tag LOCUS_02900 gene cdaA 9547 10359 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_02900 10375 11619 gene locus_tag LOCUS_02910 10375 11619 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869586.1 protein_id gnl|my_center|LOCUS_02910 11726 12274 gene locus_tag LOCUS_02920 11726 12274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 >Feature sequence019 349 897 gene locus_tag LOCUS_02930 349 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 995 4423 gene locus_tag LOCUS_02940 gene secA 995 4423 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228548.1 protein_id gnl|my_center|LOCUS_02940 4439 4828 gene locus_tag LOCUS_02950 4439 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 4828 5586 gene locus_tag LOCUS_02960 4828 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 5590 5886 gene locus_tag LOCUS_02970 5590 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 5874 6209 gene locus_tag LOCUS_02980 5874 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 6214 7932 gene locus_tag LOCUS_02990 6214 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 7934 8842 gene locus_tag LOCUS_03000 gene ptb 7934 8842 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966357.1 protein_id gnl|my_center|LOCUS_03000 8879 9976 gene locus_tag LOCUS_03010 gene add 8879 9976 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208444.1 protein_id gnl|my_center|LOCUS_03010 9967 10875 gene locus_tag LOCUS_03020 gene ptb 9967 10875 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869205.1 protein_id gnl|my_center|LOCUS_03020 11001 11267 gene locus_tag LOCUS_03030 11001 11267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 11242 11688 gene locus_tag LOCUS_03040 11242 11688 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391728.1 protein_id gnl|my_center|LOCUS_03040 >Feature sequence020 >Feature sequence021 951 19 gene locus_tag LOCUS_03050 951 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 2355 1018 gene locus_tag LOCUS_03060 gene gcvPA 2355 1018 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909428.1 protein_id gnl|my_center|LOCUS_03060 2819 2424 gene locus_tag LOCUS_03070 gene gcvH 2819 2424 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393442.1 protein_id gnl|my_center|LOCUS_03070 3011 4306 gene locus_tag LOCUS_03080 3011 4306 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082008.1 protein_id gnl|my_center|LOCUS_03080 5122 4379 gene locus_tag LOCUS_03090 5122 4379 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421578.1 protein_id gnl|my_center|LOCUS_03090 6182 5259 gene locus_tag LOCUS_03100 6182 5259 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403518.1 protein_id gnl|my_center|LOCUS_03100 9433 6221 gene locus_tag LOCUS_03110 9433 6221 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_03110 9901 9461 gene locus_tag LOCUS_03120 gene dtd 9901 9461 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_03120 11981 9933 gene locus_tag LOCUS_03130 11981 9933 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256027.1 protein_id gnl|my_center|LOCUS_03130 >Feature sequence022 1732 431 gene locus_tag LOCUS_03140 gene secY 1732 431 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258251.1 protein_id gnl|my_center|LOCUS_03140 2201 1749 gene locus_tag LOCUS_03150 gene rplO 2201 1749 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766074.1 protein_id gnl|my_center|LOCUS_03150 2404 2198 gene locus_tag LOCUS_03160 gene rpmD 2404 2198 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081798.1 protein_id gnl|my_center|LOCUS_03160 2936 2373 gene locus_tag LOCUS_03170 gene rpsE 2936 2373 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_03170 3323 2955 gene locus_tag LOCUS_03180 gene rplR 3323 2955 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_03180 3886 3332 gene locus_tag LOCUS_03190 gene rplF 3886 3332 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055950.1 protein_id gnl|my_center|LOCUS_03190 4296 3898 gene locus_tag LOCUS_03200 gene rpsH 4296 3898 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966398.1 protein_id gnl|my_center|LOCUS_03200 4494 4312 gene locus_tag LOCUS_03210 4494 4312 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670020.1 protein_id gnl|my_center|LOCUS_03210 4893 4516 gene locus_tag LOCUS_03220 4893 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 5122 4910 gene locus_tag LOCUS_03230 5122 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 5723 5169 gene locus_tag LOCUS_03240 gene rplE 5723 5169 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_03240 6082 5735 gene locus_tag LOCUS_03250 gene rplX 6082 5735 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_03250 6498 6130 gene locus_tag LOCUS_03260 gene rplN 6498 6130 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403649.1 protein_id gnl|my_center|LOCUS_03260 6783 6529 gene locus_tag LOCUS_03270 gene rpsQ 6783 6529 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_03270 6996 6784 gene locus_tag LOCUS_03280 gene rpmC 6996 6784 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403594.1 protein_id gnl|my_center|LOCUS_03280 7425 7000 gene locus_tag LOCUS_03290 gene rplP 7425 7000 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055943.1 protein_id gnl|my_center|LOCUS_03290 8130 7447 gene locus_tag LOCUS_03300 gene rpsC 8130 7447 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258237.1 protein_id gnl|my_center|LOCUS_03300 8552 8202 gene locus_tag LOCUS_03310 gene rplV 8552 8202 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258236.1 protein_id gnl|my_center|LOCUS_03310 8909 8619 gene locus_tag LOCUS_03320 gene rpsS 8909 8619 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_03320 9784 8960 gene locus_tag LOCUS_03330 gene rplB 9784 8960 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258234.1 protein_id gnl|my_center|LOCUS_03330 10102 9815 gene locus_tag LOCUS_03340 gene rplW 10102 9815 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_03340 10744 10118 gene locus_tag LOCUS_03350 gene rplD 10744 10118 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_03350 11420 10767 gene locus_tag LOCUS_03360 gene rplC 11420 10767 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258231.1 protein_id gnl|my_center|LOCUS_03360 11769 11461 gene locus_tag LOCUS_03370 gene rpsJ 11769 11461 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258230.1 protein_id gnl|my_center|LOCUS_03370 >Feature sequence023 1379 2176 gene locus_tag LOCUS_03380 1379 2176 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258346.1 protein_id gnl|my_center|LOCUS_03380 2246 3103 gene locus_tag LOCUS_03390 2246 3103 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016086425.1 protein_id gnl|my_center|LOCUS_03390 3113 3838 gene locus_tag LOCUS_03400 3113 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 3851 4270 gene locus_tag LOCUS_03410 3851 4270 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358712.1 protein_id gnl|my_center|LOCUS_03410 4582 4494 gene locus_tag LOCUS_t00060 4582 4494 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6035 4671 gene locus_tag LOCUS_03420 6035 4671 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_03420 6245 6054 gene locus_tag LOCUS_03430 6245 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 7396 6257 gene locus_tag LOCUS_03440 7396 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 8912 7479 gene locus_tag LOCUS_03450 8912 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 10450 8999 gene locus_tag LOCUS_03460 10450 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 11594 10503 gene locus_tag LOCUS_03470 11594 10503 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_03470 >Feature sequence024 301 1761 gene locus_tag LOCUS_03480 301 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 1845 2675 gene locus_tag LOCUS_03490 1845 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 3062 3745 gene locus_tag LOCUS_03500 3062 3745 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080208.1 protein_id gnl|my_center|LOCUS_03500 4376 3801 gene locus_tag LOCUS_03510 4376 3801 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459824.1 protein_id gnl|my_center|LOCUS_03510 5659 4415 gene locus_tag LOCUS_03520 5659 4415 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909096.1 protein_id gnl|my_center|LOCUS_03520 6946 5762 gene locus_tag LOCUS_03530 gene hpnI 6946 5762 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941358.1 protein_id gnl|my_center|LOCUS_03530 7794 6943 gene locus_tag LOCUS_03540 gene hpnK 7794 6943 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_03540 8910 7798 gene locus_tag LOCUS_03550 8910 7798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 9241 8882 gene locus_tag LOCUS_03560 9241 8882 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660457.1 protein_id gnl|my_center|LOCUS_03560 >Feature sequence025 379 454 gene locus_tag LOCUS_t00070 379 454 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 650 1072 gene locus_tag LOCUS_03570 gene infC 650 1072 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918933.1 protein_id gnl|my_center|LOCUS_03570 1094 1309 gene locus_tag LOCUS_03580 gene rpmI 1094 1309 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429729.1 protein_id gnl|my_center|LOCUS_03580 1321 1671 gene locus_tag LOCUS_03590 gene rplT 1321 1671 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138360.1 protein_id gnl|my_center|LOCUS_03590 1710 2483 gene locus_tag LOCUS_03600 1710 2483 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256291.1 protein_id gnl|my_center|LOCUS_03600 2521 3564 gene locus_tag LOCUS_03610 2521 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 3661 4035 gene locus_tag LOCUS_03620 3661 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 4046 4420 gene locus_tag LOCUS_03630 4046 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 4436 5896 gene locus_tag LOCUS_03640 gene cysS 4436 5896 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228277.1 protein_id gnl|my_center|LOCUS_03640 6067 6750 gene locus_tag LOCUS_03650 gene rlmB 6067 6750 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257938.1 protein_id gnl|my_center|LOCUS_03650 6753 7937 gene locus_tag LOCUS_03660 6753 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 8054 8782 gene locus_tag LOCUS_03670 8054 8782 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403241.1 protein_id gnl|my_center|LOCUS_03670 9846 8824 gene locus_tag LOCUS_03680 9846 8824 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256314.1 protein_id gnl|my_center|LOCUS_03680 10699 9830 gene locus_tag LOCUS_03690 gene rfbD 10699 9830 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256315.1 protein_id gnl|my_center|LOCUS_03690 >Feature sequence026 190 1623 gene locus_tag LOCUS_03700 190 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 1755 2585 gene locus_tag LOCUS_03710 1755 2585 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582612.1 protein_id gnl|my_center|LOCUS_03710 2668 3915 gene locus_tag LOCUS_03720 2668 3915 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777076.1 protein_id gnl|my_center|LOCUS_03720 3875 6589 gene locus_tag LOCUS_03730 3875 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 6603 8717 gene locus_tag LOCUS_03740 6603 8717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 8793 10013 gene locus_tag LOCUS_03750 8793 10013 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228579.1 protein_id gnl|my_center|LOCUS_03750 10098 10370 gene locus_tag LOCUS_03760 10098 10370 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 protein_id gnl|my_center|LOCUS_03760 10458 11354 gene locus_tag LOCUS_03770 10458 11354 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938772.1 protein_id gnl|my_center|LOCUS_03770 >Feature sequence027 815 339 gene locus_tag LOCUS_03780 815 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 1783 1025 gene locus_tag LOCUS_03790 1783 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 1904 1770 gene locus_tag LOCUS_03800 1904 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 2066 3976 gene locus_tag LOCUS_03810 2066 3976 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258668.1 protein_id gnl|my_center|LOCUS_03810 3957 4958 gene locus_tag LOCUS_03820 3957 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 4945 7074 gene locus_tag LOCUS_03830 4945 7074 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257113.1 protein_id gnl|my_center|LOCUS_03830 7148 7393 gene locus_tag LOCUS_03840 gene infA 7148 7393 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258253.1 protein_id gnl|my_center|LOCUS_03840 7549 8322 gene locus_tag LOCUS_03850 7549 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 10045 8279 gene locus_tag LOCUS_03860 10045 8279 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223224.1 protein_id gnl|my_center|LOCUS_03860 11347 10280 gene locus_tag LOCUS_03870 11347 10280 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_03870 >Feature sequence028 486 2909 gene locus_tag LOCUS_03880 486 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 2881 3582 gene locus_tag LOCUS_03890 2881 3582 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_03890 3587 3967 gene locus_tag LOCUS_03900 3587 3967 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546768.1 protein_id gnl|my_center|LOCUS_03900 4931 4074 gene locus_tag LOCUS_03910 4931 4074 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257265.1 protein_id gnl|my_center|LOCUS_03910 5932 4928 gene locus_tag LOCUS_03920 5932 4928 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969643.1 protein_id gnl|my_center|LOCUS_03920 6537 5938 gene locus_tag LOCUS_03930 gene recR 6537 5938 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256424.1 protein_id gnl|my_center|LOCUS_03930 6894 6541 gene locus_tag LOCUS_03940 6894 6541 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391577.1 protein_id gnl|my_center|LOCUS_03940 8698 7091 gene locus_tag LOCUS_03950 gene dnaX 8698 7091 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458896.1 protein_id gnl|my_center|LOCUS_03950 <11017 8710 gene locus_tag LOCUS_03960 <11017 8710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870187.1:intein-containing RctB family protein >Feature sequence029 231 1457 gene locus_tag LOCUS_03970 231 1457 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583067.1 protein_id gnl|my_center|LOCUS_03970 1707 2690 gene locus_tag LOCUS_03980 1707 2690 CDS product bifunctional ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258219.1 protein_id gnl|my_center|LOCUS_03980 2698 3210 gene locus_tag LOCUS_03990 2698 3210 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258042.1 protein_id gnl|my_center|LOCUS_03990 4242 3295 gene locus_tag LOCUS_04000 4242 3295 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978653.1 protein_id gnl|my_center|LOCUS_04000 5008 4244 gene locus_tag LOCUS_04010 5008 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013597.1 protein_id gnl|my_center|LOCUS_04010 5515 5072 gene locus_tag LOCUS_04020 5515 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 5982 5515 gene locus_tag LOCUS_04030 5982 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 7826 6129 gene locus_tag LOCUS_04040 7826 6129 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979023.1 protein_id gnl|my_center|LOCUS_04040 >Feature sequence030 921 439 gene locus_tag LOCUS_04050 921 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 1211 1444 gene locus_tag LOCUS_04060 1211 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 1604 1858 gene locus_tag LOCUS_04070 1604 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 3189 1900 gene locus_tag LOCUS_04080 gene cytX 3189 1900 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256688.1 protein_id gnl|my_center|LOCUS_04080 3977 3444 gene locus_tag LOCUS_04090 gene raiA 3977 3444 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773749.1 protein_id gnl|my_center|LOCUS_04090 4606 4004 gene locus_tag LOCUS_04100 4606 4004 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_04100 5650 4709 gene locus_tag LOCUS_04110 5650 4709 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_04110 6623 5664 gene locus_tag LOCUS_04120 6623 5664 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256415.1 protein_id gnl|my_center|LOCUS_04120 8009 6630 gene locus_tag LOCUS_04130 8009 6630 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_04130 9242 8034 gene locus_tag LOCUS_04140 9242 8034 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_04140 10145 9252 gene locus_tag LOCUS_04150 10145 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 10549 10175 gene locus_tag LOCUS_04160 10549 10175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 >Feature sequence031 93 857 gene locus_tag LOCUS_04170 gene trmD 93 857 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_04170 2715 859 gene locus_tag LOCUS_04180 2715 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 5744 2715 gene locus_tag LOCUS_04190 5744 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 8097 5812 gene locus_tag LOCUS_04200 gene acsB 8097 5812 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811727.1 protein_id gnl|my_center|LOCUS_04200 10141 8153 gene locus_tag LOCUS_04210 gene cooS 10141 8153 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_04210 10615 10283 gene locus_tag LOCUS_04220 10615 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 >Feature sequence032 1094 1744 gene locus_tag LOCUS_04230 1094 1744 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392339.1 protein_id gnl|my_center|LOCUS_04230 2723 1899 gene locus_tag LOCUS_04240 2723 1899 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249686.1 protein_id gnl|my_center|LOCUS_04240 4381 2726 gene locus_tag LOCUS_04250 4381 2726 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256378.1 protein_id gnl|my_center|LOCUS_04250 5178 4378 gene locus_tag LOCUS_04260 5178 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 6257 5196 gene locus_tag LOCUS_04270 6257 5196 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257187.1 protein_id gnl|my_center|LOCUS_04270 6954 6262 gene locus_tag LOCUS_04280 6954 6262 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258485.1 protein_id gnl|my_center|LOCUS_04280 7801 6983 gene locus_tag LOCUS_04290 7801 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 7957 8304 gene locus_tag LOCUS_04300 7957 8304 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251013.1 protein_id gnl|my_center|LOCUS_04300 8304 9527 gene locus_tag LOCUS_04310 8304 9527 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742961.1 protein_id gnl|my_center|LOCUS_04310 9609 10763 gene locus_tag LOCUS_04320 gene iolM 9609 10763 CDS product scyllo-inosose 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083260.1 protein_id gnl|my_center|LOCUS_04320 >Feature sequence033 765 448 gene locus_tag LOCUS_04330 765 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 1744 773 gene locus_tag LOCUS_04340 1744 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 1825 2169 gene locus_tag LOCUS_04350 1825 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 3330 2236 gene locus_tag LOCUS_04360 3330 2236 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082727.1 protein_id gnl|my_center|LOCUS_04360 3685 3446 gene locus_tag LOCUS_04370 3685 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 3678 4415 gene locus_tag LOCUS_04380 3678 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 4576 6384 gene locus_tag LOCUS_04390 4576 6384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 7295 6468 gene locus_tag LOCUS_04400 7295 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 7470 7306 gene locus_tag LOCUS_04410 7470 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 7977 7543 gene locus_tag LOCUS_04420 7977 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 8609 8253 gene locus_tag LOCUS_04430 8609 8253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 10068 8857 gene locus_tag LOCUS_04440 10068 8857 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476549.1 protein_id gnl|my_center|LOCUS_04440 10656 10276 gene locus_tag LOCUS_04450 10656 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 >Feature sequence034 605 138 gene locus_tag LOCUS_04460 605 138 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107788.1 protein_id gnl|my_center|LOCUS_04460 2113 599 gene locus_tag LOCUS_04470 gene oadA 2113 599 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_04470 3924 2317 gene locus_tag LOCUS_04480 3924 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 5204 3936 gene locus_tag LOCUS_04490 5204 3936 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_04490 5858 5205 gene locus_tag LOCUS_04500 5858 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 6590 5949 gene locus_tag LOCUS_04510 6590 5949 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082876.1 protein_id gnl|my_center|LOCUS_04510 6791 8872 gene locus_tag LOCUS_04520 gene fusA 6791 8872 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_04520 9887 8922 gene locus_tag LOCUS_04530 9887 8922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 >Feature sequence035 <1 939 gene locus_tag LOCUS_04540 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546843.1:nodulation protein NfeD 1076 1507 gene locus_tag LOCUS_04550 1076 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 1610 5134 gene locus_tag LOCUS_04560 gene mfd 1610 5134 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258948.1 protein_id gnl|my_center|LOCUS_04560 5181 5564 gene locus_tag LOCUS_04570 5181 5564 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816830.1 protein_id gnl|my_center|LOCUS_04570 5675 6895 gene locus_tag LOCUS_04580 gene rpsA 5675 6895 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258334.1 protein_id gnl|my_center|LOCUS_04580 6918 9431 gene locus_tag LOCUS_04590 6918 9431 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142062.1 protein_id gnl|my_center|LOCUS_04590 >Feature sequence036 555 130 gene locus_tag LOCUS_04600 555 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 1904 600 gene locus_tag LOCUS_04610 gene asnS 1904 600 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257312.1 protein_id gnl|my_center|LOCUS_04610 2171 3106 gene locus_tag LOCUS_04620 2171 3106 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256215.1 protein_id gnl|my_center|LOCUS_04620 3114 3437 gene locus_tag LOCUS_04630 3114 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 3456 4544 gene locus_tag LOCUS_04640 3456 4544 CDS product Vms1/Ankzf1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546631.1 protein_id gnl|my_center|LOCUS_04640 4606 7098 gene locus_tag LOCUS_04650 4606 7098 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256922.1 protein_id gnl|my_center|LOCUS_04650 7163 7729 gene locus_tag LOCUS_04660 7163 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 7935 9407 gene locus_tag LOCUS_04670 7935 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 9516 10097 gene locus_tag LOCUS_04680 9516 10097 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583110.1 protein_id gnl|my_center|LOCUS_04680 10367 10125 gene locus_tag LOCUS_04690 10367 10125 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938477.1 protein_id gnl|my_center|LOCUS_04690 >Feature sequence037 933 649 gene locus_tag LOCUS_04700 933 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 1019 2206 gene locus_tag LOCUS_04710 1019 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 3357 2191 gene locus_tag LOCUS_04720 3357 2191 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257412.1 protein_id gnl|my_center|LOCUS_04720 3816 4667 gene locus_tag LOCUS_04730 3816 4667 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256954.1 protein_id gnl|my_center|LOCUS_04730 4725 6035 gene locus_tag LOCUS_04740 gene purB 4725 6035 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393548.1 protein_id gnl|my_center|LOCUS_04740 6569 6048 gene locus_tag LOCUS_04750 6569 6048 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258099.1 protein_id gnl|my_center|LOCUS_04750 7025 6642 gene locus_tag LOCUS_04760 gene rplL 7025 6642 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870240.1 protein_id gnl|my_center|LOCUS_04760 7608 7072 gene locus_tag LOCUS_04770 gene rplJ 7608 7072 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258052.1 protein_id gnl|my_center|LOCUS_04770 8571 7855 gene locus_tag LOCUS_04780 gene rplA 8571 7855 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_04780 9047 8622 gene locus_tag LOCUS_04790 gene rplK 9047 8622 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966425.1 protein_id gnl|my_center|LOCUS_04790 9712 9059 gene locus_tag LOCUS_04800 gene nusG 9712 9059 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258049.1 protein_id gnl|my_center|LOCUS_04800 9996 9790 gene locus_tag LOCUS_04810 gene secE 9996 9790 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943499.1 protein_id gnl|my_center|LOCUS_04810 10140 10065 gene locus_tag LOCUS_t00080 10140 10065 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence038 1161 2576 gene locus_tag LOCUS_04820 gene nusA 1161 2576 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258863.1 protein_id gnl|my_center|LOCUS_04820 2690 2938 gene locus_tag LOCUS_04830 2690 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 2943 4859 gene locus_tag LOCUS_04840 2943 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 4860 5243 gene locus_tag LOCUS_04850 gene rbfA 4860 5243 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545236.1 protein_id gnl|my_center|LOCUS_04850 5215 6159 gene locus_tag LOCUS_04860 5215 6159 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_04860 6413 7840 gene locus_tag LOCUS_04870 gene proS 6413 7840 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583195.1 protein_id gnl|my_center|LOCUS_04870 7861 8775 gene locus_tag LOCUS_04880 7861 8775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 8998 8750 gene locus_tag LOCUS_04890 8998 8750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 9257 9541 gene locus_tag LOCUS_04900 9257 9541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 9538 10029 gene locus_tag LOCUS_04910 9538 10029 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229164.1 protein_id gnl|my_center|LOCUS_04910 10036 10314 gene locus_tag LOCUS_04920 10036 10314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 >Feature sequence039 562 1623 gene locus_tag LOCUS_04930 562 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 2001 2144 gene locus_tag LOCUS_04940 2001 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 2597 3064 gene locus_tag LOCUS_04950 2597 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 3070 3522 gene locus_tag LOCUS_04960 3070 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 3544 5694 gene locus_tag LOCUS_04970 3544 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 5994 5716 gene locus_tag LOCUS_04980 5994 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 >Feature sequence040 726 869 gene locus_tag LOCUS_04990 726 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 875 1387 gene locus_tag LOCUS_05000 875 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 1384 1800 gene locus_tag LOCUS_05010 1384 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 1840 2520 gene locus_tag LOCUS_05020 1840 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 2530 4323 gene locus_tag LOCUS_05030 2530 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 4335 4475 gene locus_tag LOCUS_05040 4335 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 4556 4708 gene locus_tag LOCUS_05050 4556 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 4820 5851 gene locus_tag LOCUS_05060 4820 5851 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052352081.1 protein_id gnl|my_center|LOCUS_05060 6241 7590 gene locus_tag LOCUS_05070 6241 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 7571 7843 gene locus_tag LOCUS_05080 7571 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 7843 8241 gene locus_tag LOCUS_05090 7843 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 8249 8707 gene locus_tag LOCUS_05100 8249 8707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 8764 9036 gene locus_tag LOCUS_05110 8764 9036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 >Feature sequence041 80 1273 gene locus_tag LOCUS_05120 80 1273 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257413.1 protein_id gnl|my_center|LOCUS_05120 1334 2779 gene locus_tag LOCUS_05130 1334 2779 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582600.1 protein_id gnl|my_center|LOCUS_05130 2826 3830 gene locus_tag LOCUS_05140 2826 3830 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816804.1 protein_id gnl|my_center|LOCUS_05140 3855 4376 gene locus_tag LOCUS_05150 3855 4376 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_05150 4461 4910 gene locus_tag LOCUS_05160 4461 4910 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385810.1 protein_id gnl|my_center|LOCUS_05160 5140 7428 gene locus_tag LOCUS_05170 5140 7428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 8831 7455 gene locus_tag LOCUS_05180 8831 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 9795 8896 gene locus_tag LOCUS_05190 gene truB 9795 8896 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_05190 >Feature sequence042 148 1038 gene locus_tag LOCUS_05200 148 1038 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083266.1 protein_id gnl|my_center|LOCUS_05200 1382 3094 gene locus_tag LOCUS_05210 1382 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 3839 3084 gene locus_tag LOCUS_05220 3839 3084 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223778.1 protein_id gnl|my_center|LOCUS_05220 4393 3836 gene locus_tag LOCUS_05230 4393 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 4814 4401 gene locus_tag LOCUS_05240 4814 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 5466 4816 gene locus_tag LOCUS_05250 5466 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 5715 6287 gene locus_tag LOCUS_05260 5715 6287 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_05260 6500 6706 gene locus_tag LOCUS_05270 6500 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 6710 8200 gene locus_tag LOCUS_05280 6710 8200 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258188.1 protein_id gnl|my_center|LOCUS_05280 8961 8197 gene locus_tag LOCUS_05290 8961 8197 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869224.1 protein_id gnl|my_center|LOCUS_05290 <10021 9224 gene locus_tag LOCUS_05300 <10021 9224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393387.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence043 1158 943 gene locus_tag LOCUS_05310 1158 943 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404471.1 protein_id gnl|my_center|LOCUS_05310 1442 1518 gene locus_tag LOCUS_t00090 1442 1518 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1526 1599 gene locus_tag LOCUS_t00100 1526 1599 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1604 1690 gene locus_tag LOCUS_t00110 1604 1690 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2162 2248 gene locus_tag LOCUS_t00120 2162 2248 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2254 2325 gene locus_tag LOCUS_t00130 2254 2325 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2740 3003 gene locus_tag LOCUS_05320 2740 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 3005 3427 gene locus_tag LOCUS_05330 3005 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 3582 3908 gene locus_tag LOCUS_05340 3582 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 4110 4406 gene locus_tag LOCUS_05350 4110 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 4393 4800 gene locus_tag LOCUS_05360 4393 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 4797 5273 gene locus_tag LOCUS_05370 4797 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 5293 5571 gene locus_tag LOCUS_05380 5293 5571 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888483.1 protein_id gnl|my_center|LOCUS_05380 5605 6849 gene locus_tag LOCUS_05390 5605 6849 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_05390 6878 7945 gene locus_tag LOCUS_05400 6878 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 8033 8599 gene locus_tag LOCUS_05410 8033 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 8663 9724 gene locus_tag LOCUS_05420 gene argF 8663 9724 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393492.1 protein_id gnl|my_center|LOCUS_05420 >Feature sequence044 <1 8837 gene locus_tag LOCUS_05430 <1 8837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064883.1:DUF2341 domain-containing protein 8839 9603 gene locus_tag LOCUS_05440 8839 9603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence045 855 4 gene locus_tag LOCUS_05450 855 4 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257864.1 protein_id gnl|my_center|LOCUS_05450 1670 852 gene locus_tag LOCUS_05460 1670 852 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257863.1 protein_id gnl|my_center|LOCUS_05460 2653 1682 gene locus_tag LOCUS_05470 2653 1682 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966160.1 protein_id gnl|my_center|LOCUS_05470 3097 2657 gene locus_tag LOCUS_05480 3097 2657 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392661.1 protein_id gnl|my_center|LOCUS_05480 3548 4975 gene locus_tag LOCUS_05490 3548 4975 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083271.1 protein_id gnl|my_center|LOCUS_05490 5052 6017 gene locus_tag LOCUS_05500 5052 6017 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083273.1 protein_id gnl|my_center|LOCUS_05500 6053 6877 gene locus_tag LOCUS_05510 6053 6877 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015918758.1 protein_id gnl|my_center|LOCUS_05510 6928 8007 gene locus_tag LOCUS_05520 6928 8007 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083278.1 protein_id gnl|my_center|LOCUS_05520 8396 8833 gene locus_tag LOCUS_05530 8396 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 >Feature sequence046 13 102 gene locus_tag LOCUS_t00140 13 102 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 346 1458 gene locus_tag LOCUS_05540 346 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 1463 3226 gene locus_tag LOCUS_05550 1463 3226 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546477.1 protein_id gnl|my_center|LOCUS_05550 3274 3696 gene locus_tag LOCUS_05560 3274 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 3693 6623 gene locus_tag LOCUS_05570 3693 6623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 8383 6647 gene locus_tag LOCUS_05580 8383 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 >Feature sequence047 1335 583 gene locus_tag LOCUS_05590 1335 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 2232 1345 gene locus_tag LOCUS_05600 2232 1345 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258504.1 protein_id gnl|my_center|LOCUS_05600 3286 2252 gene locus_tag LOCUS_05610 3286 2252 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391697.1 protein_id gnl|my_center|LOCUS_05610 3918 3304 gene locus_tag LOCUS_05620 3918 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 5183 3939 gene locus_tag LOCUS_05630 5183 3939 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258503.1 protein_id gnl|my_center|LOCUS_05630 5872 5231 gene locus_tag LOCUS_05640 5872 5231 CDS product 4-vinyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256303.1 protein_id gnl|my_center|LOCUS_05640 6770 5973 gene locus_tag LOCUS_05650 6770 5973 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257492.1 protein_id gnl|my_center|LOCUS_05650 7310 6783 gene locus_tag LOCUS_05660 7310 6783 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256561.1 protein_id gnl|my_center|LOCUS_05660 8137 7316 gene locus_tag LOCUS_05670 8137 7316 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256562.1 protein_id gnl|my_center|LOCUS_05670 8854 8243 gene locus_tag LOCUS_05680 gene rsmD 8854 8243 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460510.1 protein_id gnl|my_center|LOCUS_05680 9380 8835 gene locus_tag LOCUS_05690 9380 8835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 >Feature sequence048 910 65 gene locus_tag LOCUS_05700 910 65 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963436.1 protein_id gnl|my_center|LOCUS_05700 2101 935 gene locus_tag LOCUS_05710 gene lat 2101 935 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900004.1 protein_id gnl|my_center|LOCUS_05710 3211 2105 gene locus_tag LOCUS_05720 3211 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 4313 3279 gene locus_tag LOCUS_05730 gene aroB 4313 3279 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583419.1 protein_id gnl|my_center|LOCUS_05730 4977 4291 gene locus_tag LOCUS_05740 gene fabG 4977 4291 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881113.1 protein_id gnl|my_center|LOCUS_05740 5536 4979 gene locus_tag LOCUS_05750 gene gmhA 5536 4979 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566736.1 protein_id gnl|my_center|LOCUS_05750 6521 5511 gene locus_tag LOCUS_05760 6521 5511 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734411.1 protein_id gnl|my_center|LOCUS_05760 7218 6523 gene locus_tag LOCUS_05770 7218 6523 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143772.1 protein_id gnl|my_center|LOCUS_05770 8142 7219 gene locus_tag LOCUS_05780 8142 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 8953 8132 gene locus_tag LOCUS_05790 8953 8132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 >Feature sequence049 520 7032 gene locus_tag LOCUS_05800 520 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 7072 7977 gene locus_tag LOCUS_05810 7072 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 >Feature sequence050 <1 1672 gene locus_tag LOCUS_05820 <1 1672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256763.1:DNA-directed RNA polymerase subunit beta 1732 5925 gene locus_tag LOCUS_05830 gene rpoC 1732 5925 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256762.1 protein_id gnl|my_center|LOCUS_05830 6013 6444 gene locus_tag LOCUS_05840 gene rpsL 6013 6444 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_05840 6467 6937 gene locus_tag LOCUS_05850 gene rpsG 6467 6937 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545233.1 protein_id gnl|my_center|LOCUS_05850 7083 9167 gene locus_tag LOCUS_05860 gene fusA 7083 9167 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence051 136 345 gene locus_tag LOCUS_05870 136 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 442 759 gene locus_tag LOCUS_05880 442 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 766 3378 gene locus_tag LOCUS_05890 766 3378 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938942.1 protein_id gnl|my_center|LOCUS_05890 3496 4542 gene locus_tag LOCUS_05900 3496 4542 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546086.1 protein_id gnl|my_center|LOCUS_05900 4569 5399 gene locus_tag LOCUS_05910 4569 5399 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546652.1 protein_id gnl|my_center|LOCUS_05910 5484 6821 gene locus_tag LOCUS_05920 5484 6821 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392943.1 protein_id gnl|my_center|LOCUS_05920 6890 7630 gene locus_tag LOCUS_05930 6890 7630 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546316.1 protein_id gnl|my_center|LOCUS_05930 7627 8916 gene locus_tag LOCUS_05940 7627 8916 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544964.1 protein_id gnl|my_center|LOCUS_05940 >Feature sequence052 1441 1046 gene locus_tag LOCUS_05950 gene nifU 1441 1046 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_05950 3847 1523 gene locus_tag LOCUS_05960 3847 1523 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_05960 4425 3844 gene locus_tag LOCUS_05970 4425 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 5732 4425 gene locus_tag LOCUS_05980 5732 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 7292 5736 gene locus_tag LOCUS_05990 7292 5736 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963376.1 protein_id gnl|my_center|LOCUS_05990 8044 7292 gene locus_tag LOCUS_06000 8044 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 8606 8028 gene locus_tag LOCUS_06010 8606 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 8909 8610 gene locus_tag LOCUS_06020 8909 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 >Feature sequence053 1112 546 gene locus_tag LOCUS_06030 1112 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 1423 1232 gene locus_tag LOCUS_06040 1423 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 2520 1438 gene locus_tag LOCUS_06050 2520 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 2908 2525 gene locus_tag LOCUS_06060 2908 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 3749 3105 gene locus_tag LOCUS_06070 3749 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 4045 3749 gene locus_tag LOCUS_06080 4045 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 4184 4005 gene locus_tag LOCUS_06090 4184 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 4381 4181 gene locus_tag LOCUS_06100 4381 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 5462 4410 gene locus_tag LOCUS_06110 5462 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 5696 5514 gene locus_tag LOCUS_06120 5696 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 5874 5698 gene locus_tag LOCUS_06130 5874 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 6614 5871 gene locus_tag LOCUS_06140 6614 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 7010 6720 gene locus_tag LOCUS_06150 7010 6720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 7306 7013 gene locus_tag LOCUS_06160 7306 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 7601 7290 gene locus_tag LOCUS_06170 7601 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 7836 7573 gene locus_tag LOCUS_06180 7836 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 8023 7826 gene locus_tag LOCUS_06190 8023 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 8637 8020 gene locus_tag LOCUS_06200 8637 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 8899 8654 gene locus_tag LOCUS_06210 8899 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 >Feature sequence054 118 318 gene locus_tag LOCUS_06220 118 318 CDS product DUF6485 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584058.1 protein_id gnl|my_center|LOCUS_06220 395 1612 gene locus_tag LOCUS_06230 395 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 1746 2195 gene locus_tag LOCUS_06240 1746 2195 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582602.1 protein_id gnl|my_center|LOCUS_06240 2355 2603 gene locus_tag LOCUS_06250 2355 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 3869 2706 gene locus_tag LOCUS_06260 3869 2706 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256214.1 protein_id gnl|my_center|LOCUS_06260 5148 3889 gene locus_tag LOCUS_06270 5148 3889 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258551.1 protein_id gnl|my_center|LOCUS_06270 7904 5145 gene locus_tag LOCUS_06280 gene polA 7904 5145 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082086.1 protein_id gnl|my_center|LOCUS_06280 8696 7911 gene locus_tag LOCUS_06290 8696 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 >Feature sequence055 567 1847 gene locus_tag LOCUS_06300 567 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 1860 2105 gene locus_tag LOCUS_06310 1860 2105 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942410.1 protein_id gnl|my_center|LOCUS_06310 2098 2544 gene locus_tag LOCUS_06320 2098 2544 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921062.1 protein_id gnl|my_center|LOCUS_06320 3841 2528 gene locus_tag LOCUS_06330 3841 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 4011 4718 gene locus_tag LOCUS_06340 4011 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 6239 4692 gene locus_tag LOCUS_06350 gene murJ 6239 4692 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258283.1 protein_id gnl|my_center|LOCUS_06350 8573 6252 gene locus_tag LOCUS_06360 gene topA 8573 6252 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541498.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence056 400 89 gene locus_tag LOCUS_06370 400 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 1746 400 gene locus_tag LOCUS_06380 1746 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 4157 1746 gene locus_tag LOCUS_06390 4157 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 5661 4144 gene locus_tag LOCUS_06400 5661 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 6178 5648 gene locus_tag LOCUS_06410 6178 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 6954 7262 gene locus_tag LOCUS_06420 6954 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 7354 7956 gene locus_tag LOCUS_06430 7354 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 7969 8202 gene locus_tag LOCUS_06440 7969 8202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 8204 8413 gene locus_tag LOCUS_06450 8204 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 8449 8637 gene locus_tag LOCUS_06460 8449 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 >Feature sequence057 333 1007 gene locus_tag LOCUS_06470 333 1007 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_06470 1018 1434 gene locus_tag LOCUS_06480 1018 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 1447 2391 gene locus_tag LOCUS_06490 gene era 1447 2391 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392137.1 protein_id gnl|my_center|LOCUS_06490 2513 3190 gene locus_tag LOCUS_06500 2513 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 3215 4894 gene locus_tag LOCUS_06510 3215 4894 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256598.1 protein_id gnl|my_center|LOCUS_06510 6817 4871 gene locus_tag LOCUS_06520 6817 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 8155 6962 gene locus_tag LOCUS_06530 8155 6962 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393432.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence058 <1 711 gene locus_tag LOCUS_06540 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545101.1:adenylate/guanylate cyclase domain-containing protein 2011 686 gene locus_tag LOCUS_06550 2011 686 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140787.1 protein_id gnl|my_center|LOCUS_06550 3690 2155 gene locus_tag LOCUS_06560 gene recJ 3690 2155 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257020.1 protein_id gnl|my_center|LOCUS_06560 4293 3997 gene locus_tag LOCUS_06570 4293 3997 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329069.1 protein_id gnl|my_center|LOCUS_06570 4890 4312 gene locus_tag LOCUS_06580 4890 4312 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583168.1 protein_id gnl|my_center|LOCUS_06580 5183 4911 gene locus_tag LOCUS_06590 5183 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 5488 5228 gene locus_tag LOCUS_06600 gene rpmA 5488 5228 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545975.1 protein_id gnl|my_center|LOCUS_06600 5815 5504 gene locus_tag LOCUS_06610 gene rplU 5815 5504 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_06610 6141 7058 gene locus_tag LOCUS_06620 6141 7058 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814873.1 protein_id gnl|my_center|LOCUS_06620 7058 8356 gene locus_tag LOCUS_06630 7058 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 >Feature sequence059 375 731 gene locus_tag LOCUS_06640 gene rplS 375 731 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081989.1 protein_id gnl|my_center|LOCUS_06640 737 1366 gene locus_tag LOCUS_06650 737 1366 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944761.1 protein_id gnl|my_center|LOCUS_06650 5634 1363 gene locus_tag LOCUS_06660 5634 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 7011 5770 gene locus_tag LOCUS_06670 7011 5770 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_06670 7694 7008 gene locus_tag LOCUS_06680 7694 7008 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_06680 <8753 7708 gene locus_tag LOCUS_06690 <8753 7708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546795.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence060 3436 2117 gene locus_tag LOCUS_06700 3436 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 4989 4132 gene locus_tag LOCUS_06710 4989 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 5278 4991 gene locus_tag LOCUS_06720 5278 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 6050 5262 gene locus_tag LOCUS_06730 6050 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 6535 6077 gene locus_tag LOCUS_06740 6535 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 7518 6544 gene locus_tag LOCUS_06750 7518 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 >Feature sequence061 787 2259 gene locus_tag LOCUS_06760 787 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06760 2350 5406 gene locus_tag LOCUS_06770 2350 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 >Feature sequence062 172 1842 gene locus_tag LOCUS_06780 172 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 1874 3496 gene locus_tag LOCUS_06790 1874 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 3582 3947 gene locus_tag LOCUS_06800 3582 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4088 5611 gene locus_tag LOCUS_06810 4088 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 5669 6004 gene locus_tag LOCUS_06820 gene bldG 5669 6004 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_06820 6001 6420 gene locus_tag LOCUS_06830 6001 6420 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892343.1 protein_id gnl|my_center|LOCUS_06830 6417 7559 gene locus_tag LOCUS_06840 6417 7559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 >Feature sequence063 116 1610 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatcccttattcctcaggtctaaac 1975 1823 gene locus_tag LOCUS_06850 1975 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 3290 1980 gene locus_tag LOCUS_06860 gene csm5 3290 1980 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021931.1 protein_id gnl|my_center|LOCUS_06860 4336 3287 gene locus_tag LOCUS_06870 gene csm4 4336 3287 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876703.1 protein_id gnl|my_center|LOCUS_06870 5277 4312 gene locus_tag LOCUS_06880 gene csm3 5277 4312 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876704.1 protein_id gnl|my_center|LOCUS_06880 5709 5287 gene locus_tag LOCUS_06890 gene csm2 5709 5287 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296332.1 protein_id gnl|my_center|LOCUS_06890 8142 5713 gene locus_tag LOCUS_06900 gene cas10 8142 5713 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261170.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence064 <1 853 gene locus_tag LOCUS_06910 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392921.1:ATP-binding protein 3923 1023 gene locus_tag LOCUS_06920 3923 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 6130 3920 gene locus_tag LOCUS_06930 6130 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 8633 6393 gene locus_tag LOCUS_06940 8633 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 >Feature sequence065 165 238 gene locus_tag LOCUS_t00150 165 238 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 281 355 gene locus_tag LOCUS_t00160 281 355 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1634 414 gene locus_tag LOCUS_06950 gene rpoD 1634 414 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_06950 2375 1755 gene locus_tag LOCUS_06960 2375 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 3957 2410 gene locus_tag LOCUS_06970 3957 2410 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_06970 4678 3959 gene locus_tag LOCUS_06980 4678 3959 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524099.1 protein_id gnl|my_center|LOCUS_06980 5597 4662 gene locus_tag LOCUS_06990 5597 4662 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_06990 6700 5795 gene locus_tag LOCUS_07000 6700 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 <8628 6792 gene locus_tag LOCUS_07010 <8628 6792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258108.1:SMC family ATPase >Feature sequence066 235 384 gene locus_tag LOCUS_07020 235 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 491 1327 gene locus_tag LOCUS_07030 491 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 1309 2124 gene locus_tag LOCUS_07040 1309 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 2161 3723 gene locus_tag LOCUS_07050 2161 3723 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_07050 4254 5321 gene locus_tag LOCUS_07060 4254 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 5703 5479 gene locus_tag LOCUS_07070 5703 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 6893 8026 gene locus_tag LOCUS_07080 6893 8026 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119728.1 protein_id gnl|my_center|LOCUS_07080 8188 8547 gene locus_tag LOCUS_07090 8188 8547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 >Feature sequence067 784 548 gene locus_tag LOCUS_07100 784 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 1028 804 gene locus_tag LOCUS_07110 1028 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 2272 1355 gene locus_tag LOCUS_07120 2272 1355 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095780.1 protein_id gnl|my_center|LOCUS_07120 2462 8101 gene locus_tag LOCUS_07130 2462 8101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence068 <1 797 gene locus_tag LOCUS_07140 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223900.1:exo-alpha-sialidase 1283 807 gene locus_tag LOCUS_07150 1283 807 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879700.1 protein_id gnl|my_center|LOCUS_07150 2660 1338 gene locus_tag LOCUS_07160 2660 1338 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258274.1 protein_id gnl|my_center|LOCUS_07160 2856 3743 gene locus_tag LOCUS_07170 2856 3743 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061504.1 protein_id gnl|my_center|LOCUS_07170 3740 5077 gene locus_tag LOCUS_07180 3740 5077 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141779.1 protein_id gnl|my_center|LOCUS_07180 5074 6285 gene locus_tag LOCUS_07190 5074 6285 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485734.1 protein_id gnl|my_center|LOCUS_07190 6245 7312 gene locus_tag LOCUS_07200 6245 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 7417 8148 gene locus_tag LOCUS_07210 7417 8148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence069 1474 944 gene locus_tag LOCUS_07220 gene scpB 1474 944 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259764.1 protein_id gnl|my_center|LOCUS_07220 1916 2464 gene locus_tag LOCUS_07230 1916 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 3008 2454 gene locus_tag LOCUS_07240 3008 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 3216 4421 gene locus_tag LOCUS_07250 3216 4421 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259083.1 protein_id gnl|my_center|LOCUS_07250 4458 5435 gene locus_tag LOCUS_07260 4458 5435 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_07260 5455 6264 gene locus_tag LOCUS_07270 5455 6264 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965626.1 protein_id gnl|my_center|LOCUS_07270 6270 7922 gene locus_tag LOCUS_07280 6270 7922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 >Feature sequence070 263 1975 gene locus_tag LOCUS_07290 gene ade 263 1975 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_07290 1972 2619 gene locus_tag LOCUS_07300 1972 2619 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_07300 3852 2746 gene locus_tag LOCUS_07310 3852 2746 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_07310 4635 3904 gene locus_tag LOCUS_07320 4635 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 4702 4878 gene locus_tag LOCUS_07330 4702 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 5512 4853 gene locus_tag LOCUS_07340 5512 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 5826 5581 gene locus_tag LOCUS_07350 5826 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 6465 5839 gene locus_tag LOCUS_07360 6465 5839 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_07360 7147 6476 gene locus_tag LOCUS_07370 7147 6476 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227680.1 protein_id gnl|my_center|LOCUS_07370 7577 7200 gene locus_tag LOCUS_07380 7577 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 8073 7597 gene locus_tag LOCUS_07390 gene moaC 8073 7597 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence071 1216 344 gene locus_tag LOCUS_07400 1216 344 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_07400 2098 1328 gene locus_tag LOCUS_07410 2098 1328 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_07410 2946 2089 gene locus_tag LOCUS_07420 2946 2089 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256060.1 protein_id gnl|my_center|LOCUS_07420 3617 2943 gene locus_tag LOCUS_07430 3617 2943 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256032.1 protein_id gnl|my_center|LOCUS_07430 4371 3571 gene locus_tag LOCUS_07440 gene yidC 4371 3571 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723726.1 protein_id gnl|my_center|LOCUS_07440 5376 5236 gene locus_tag LOCUS_07450 gene rpmH 5376 5236 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081758.1 protein_id gnl|my_center|LOCUS_07450 5769 5431 gene locus_tag LOCUS_07460 gene trxA 5769 5431 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140882.1 protein_id gnl|my_center|LOCUS_07460 6043 5792 gene locus_tag LOCUS_07470 6043 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 6485 6003 gene locus_tag LOCUS_07480 6485 6003 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938185.1 protein_id gnl|my_center|LOCUS_07480 7862 6606 gene locus_tag LOCUS_07490 7862 6606 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence072 >Feature sequence073 3039 3150 gene locus_tag LOCUS_r00010 3039 3150 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3183 3998 gene locus_tag LOCUS_07500 gene speB 3183 3998 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869807.1 protein_id gnl|my_center|LOCUS_07500 4258 5229 gene locus_tag LOCUS_07510 4258 5229 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965021.1 protein_id gnl|my_center|LOCUS_07510 5239 5943 gene locus_tag LOCUS_07520 5239 5943 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889063.1 protein_id gnl|my_center|LOCUS_07520 5940 6527 gene locus_tag LOCUS_07530 5940 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 6527 7297 gene locus_tag LOCUS_07540 gene rsmG 6527 7297 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393994.1 protein_id gnl|my_center|LOCUS_07540 <8103 7334 gene locus_tag LOCUS_07550 <8103 7334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905433.1:LysM peptidoglycan-binding domain-containing protein >Feature sequence074 974 624 gene locus_tag LOCUS_07560 974 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 1996 965 gene locus_tag LOCUS_07570 1996 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 3429 1993 gene locus_tag LOCUS_07580 3429 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 5018 3420 gene locus_tag LOCUS_07590 5018 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 5679 5029 gene locus_tag LOCUS_07600 5679 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 6080 5694 gene locus_tag LOCUS_07610 6080 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 >Feature sequence075 2 172 gene locus_tag LOCUS_07620 2 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 222 3254 gene locus_tag LOCUS_07630 222 3254 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909245.1 protein_id gnl|my_center|LOCUS_07630 4408 3260 gene locus_tag LOCUS_07640 gene cruC 4408 3260 CDS product hydroxychlorobactene glucosyltransferase CruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_07640 5027 4419 gene locus_tag LOCUS_07650 5027 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 6012 5263 gene locus_tag LOCUS_07660 6012 5263 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_07660 6671 7840 gene locus_tag LOCUS_07670 6671 7840 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence076 454 1353 gene locus_tag LOCUS_07680 454 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 1649 1939 gene locus_tag LOCUS_07690 1649 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 1908 2468 gene locus_tag LOCUS_07700 1908 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 2507 5086 gene locus_tag LOCUS_07710 gene mutS 2507 5086 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_07710 6016 5132 gene locus_tag LOCUS_07720 6016 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 6574 6137 gene locus_tag LOCUS_07730 gene aroQ 6574 6137 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_07730 <7929 6620 gene locus_tag LOCUS_07740 <7929 6620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393064.1:3-dehydroquinate synthase >Feature sequence077 1208 243 gene locus_tag LOCUS_07750 1208 243 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023177.1 protein_id gnl|my_center|LOCUS_07750 2705 1290 gene locus_tag LOCUS_07760 2705 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 3061 3489 gene locus_tag LOCUS_07770 gene mraZ 3061 3489 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_07770 3541 4425 gene locus_tag LOCUS_07780 gene rsmH 3541 4425 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_07780 4426 4773 gene locus_tag LOCUS_07790 4426 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 4861 6669 gene locus_tag LOCUS_07800 4861 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 >Feature sequence078 6288 1195 gene locus_tag LOCUS_07810 6288 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 6607 6290 gene locus_tag LOCUS_07820 6607 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 7574 6669 gene locus_tag LOCUS_07830 7574 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence079 1578 739 gene locus_tag LOCUS_07840 gene pstB 1578 739 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_07840 2514 1597 gene locus_tag LOCUS_07850 gene pstA 2514 1597 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582861.1 protein_id gnl|my_center|LOCUS_07850 3486 2518 gene locus_tag LOCUS_07860 gene pstC 3486 2518 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770815.1 protein_id gnl|my_center|LOCUS_07860 4539 3511 gene locus_tag LOCUS_07870 gene pstS 4539 3511 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250815.1 protein_id gnl|my_center|LOCUS_07870 5013 5672 gene locus_tag LOCUS_07880 gene fsa 5013 5672 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667661.1 protein_id gnl|my_center|LOCUS_07880 5707 5961 gene locus_tag LOCUS_07890 5707 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 6092 6769 gene locus_tag LOCUS_07900 6092 6769 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258353.1 protein_id gnl|my_center|LOCUS_07900 6741 6989 gene locus_tag LOCUS_07910 6741 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 7227 7631 gene locus_tag LOCUS_07920 7227 7631 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660364.1 protein_id gnl|my_center|LOCUS_07920 7694 7840 gene locus_tag LOCUS_07930 7694 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence080 2462 69 gene locus_tag LOCUS_07940 2462 69 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545339.1 protein_id gnl|my_center|LOCUS_07940 3864 2899 gene locus_tag LOCUS_07950 3864 2899 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_07950 6352 3977 gene locus_tag LOCUS_07960 6352 3977 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256869.1 protein_id gnl|my_center|LOCUS_07960 7242 6349 gene locus_tag LOCUS_07970 7242 6349 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142163.1 protein_id gnl|my_center|LOCUS_07970 7835 7215 gene locus_tag LOCUS_07980 7835 7215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 >Feature sequence081 9 1043 gene locus_tag LOCUS_07990 9 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 1051 1803 gene locus_tag LOCUS_08000 1051 1803 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258224.1 protein_id gnl|my_center|LOCUS_08000 1859 2155 gene locus_tag LOCUS_08010 1859 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 2575 4296 gene locus_tag LOCUS_08020 gene polX 2575 4296 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_08020 4405 4716 gene locus_tag LOCUS_08030 4405 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 4720 5085 gene locus_tag LOCUS_08040 4720 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence082 804 1943 gene locus_tag LOCUS_08050 804 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 1988 3385 gene locus_tag LOCUS_08060 gene mocA 1988 3385 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393499.1 protein_id gnl|my_center|LOCUS_08060 4601 3363 gene locus_tag LOCUS_08070 gene rlmD 4601 3363 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461354.1 protein_id gnl|my_center|LOCUS_08070 5477 4641 gene locus_tag LOCUS_08080 5477 4641 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030050.1 protein_id gnl|my_center|LOCUS_08080 6605 5571 gene locus_tag LOCUS_08090 6605 5571 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868871.1 protein_id gnl|my_center|LOCUS_08090 <7764 6618 gene locus_tag LOCUS_08100 <7764 6618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228420.1:dihydropyrimidinase >Feature sequence083 48 422 gene locus_tag LOCUS_08110 48 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 521 1390 gene locus_tag LOCUS_08120 gene rsmA 521 1390 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_08120 2616 1369 gene locus_tag LOCUS_08130 2616 1369 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 protein_id gnl|my_center|LOCUS_08130 3952 2645 gene locus_tag LOCUS_08140 3952 2645 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037226281.1 protein_id gnl|my_center|LOCUS_08140 4162 4458 gene locus_tag LOCUS_08150 4162 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 4451 4834 gene locus_tag LOCUS_08160 gene vapC 4451 4834 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331362.1 protein_id gnl|my_center|LOCUS_08160 5852 4839 gene locus_tag LOCUS_08170 5852 4839 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868854.1 protein_id gnl|my_center|LOCUS_08170 6944 5922 gene locus_tag LOCUS_08180 6944 5922 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868853.1 protein_id gnl|my_center|LOCUS_08180 <7605 6966 gene locus_tag LOCUS_08190 <7605 6966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011173056.1:ABC transporter ATP-binding protein >Feature sequence084 256 657 gene locus_tag LOCUS_08200 256 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 674 1174 gene locus_tag LOCUS_08210 gene nikR 674 1174 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250390.1 protein_id gnl|my_center|LOCUS_08210 1161 1463 gene locus_tag LOCUS_08220 1161 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 1479 1892 gene locus_tag LOCUS_08230 1479 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 1889 2167 gene locus_tag LOCUS_08240 1889 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 2145 2381 gene locus_tag LOCUS_08250 2145 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 2397 2558 gene locus_tag LOCUS_08260 2397 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 2552 2839 gene locus_tag LOCUS_08270 2552 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 2836 3156 gene locus_tag LOCUS_08280 2836 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 3149 3832 gene locus_tag LOCUS_08290 3149 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 3944 4069 gene locus_tag LOCUS_08300 3944 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 4073 4327 gene locus_tag LOCUS_08310 4073 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 4311 4619 gene locus_tag LOCUS_08320 4311 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 4669 5004 gene locus_tag LOCUS_08330 4669 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 5020 5667 gene locus_tag LOCUS_08340 5020 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 5675 6502 gene locus_tag LOCUS_08350 5675 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence085 <1 596 gene locus_tag LOCUS_08360 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256646.1:UDP-N-acetylmuramate dehydrogenase 651 980 gene locus_tag LOCUS_08370 651 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 961 1338 gene locus_tag LOCUS_08380 961 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 1352 2479 gene locus_tag LOCUS_08390 1352 2479 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459778.1 protein_id gnl|my_center|LOCUS_08390 2482 3264 gene locus_tag LOCUS_08400 2482 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 3348 4577 gene locus_tag LOCUS_08410 gene ftsA 3348 4577 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_08410 4681 5751 gene locus_tag LOCUS_08420 gene ftsZ 4681 5751 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_08420 6777 5794 gene locus_tag LOCUS_08430 6777 5794 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence086 2495 1041 gene locus_tag LOCUS_08440 2495 1041 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021506.1 protein_id gnl|my_center|LOCUS_08440 2972 2505 gene locus_tag LOCUS_08450 2972 2505 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879802.1 protein_id gnl|my_center|LOCUS_08450 3675 2995 gene locus_tag LOCUS_08460 gene walR 3675 2995 CDS product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971865.1 protein_id gnl|my_center|LOCUS_08460 4458 3715 gene locus_tag LOCUS_08470 4458 3715 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_08470 6766 4415 gene locus_tag LOCUS_08480 6766 4415 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941298.1 protein_id gnl|my_center|LOCUS_08480 6734 6910 gene locus_tag LOCUS_08490 6734 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence087 807 466 gene locus_tag LOCUS_08500 807 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1072 827 gene locus_tag LOCUS_08510 1072 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 1476 1069 gene locus_tag LOCUS_08520 1476 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 1622 1981 gene locus_tag LOCUS_08530 1622 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 1984 3606 gene locus_tag LOCUS_08540 1984 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 3603 4583 gene locus_tag LOCUS_08550 3603 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 4588 5448 gene locus_tag LOCUS_08560 4588 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 5460 5666 gene locus_tag LOCUS_08570 5460 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 5647 6105 gene locus_tag LOCUS_08580 5647 6105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 6188 6559 gene locus_tag LOCUS_08590 6188 6559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence088 <1 527 gene locus_tag LOCUS_08600 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003722709.1:sugar ABC transporter permease 583 1440 gene locus_tag LOCUS_08610 583 1440 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_08610 1569 2891 gene locus_tag LOCUS_08620 1569 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 3018 4001 gene locus_tag LOCUS_08630 3018 4001 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 protein_id gnl|my_center|LOCUS_08630 4037 5272 gene locus_tag LOCUS_08640 4037 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 6184 5276 gene locus_tag LOCUS_08650 6184 5276 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083159.1 protein_id gnl|my_center|LOCUS_08650 6773 6192 gene locus_tag LOCUS_08660 gene pth 6773 6192 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence089 1669 1421 gene locus_tag LOCUS_08670 1669 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 2091 1672 gene locus_tag LOCUS_08680 2091 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 3072 2101 gene locus_tag LOCUS_08690 3072 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 3250 3077 gene locus_tag LOCUS_08700 3250 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 3706 3266 gene locus_tag LOCUS_08710 3706 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 4273 3803 gene locus_tag LOCUS_08720 4273 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 4976 4275 gene locus_tag LOCUS_08730 4976 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 <7126 4927 gene locus_tag LOCUS_08740 <7126 4927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902345.1:DNA polymerase elongation subunit >Feature sequence090 495 569 gene locus_tag LOCUS_t00170 495 569 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 583 1605 gene locus_tag LOCUS_08750 gene amrS 583 1605 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879767.1 protein_id gnl|my_center|LOCUS_08750 1618 2370 gene locus_tag LOCUS_08760 1618 2370 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259075.1 protein_id gnl|my_center|LOCUS_08760 2411 3286 gene locus_tag LOCUS_08770 2411 3286 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_08770 3715 4779 gene locus_tag LOCUS_08780 3715 4779 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249136.1 protein_id gnl|my_center|LOCUS_08780 4783 5940 gene locus_tag LOCUS_08790 4783 5940 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868485.1 protein_id gnl|my_center|LOCUS_08790 6091 6501 gene locus_tag LOCUS_08800 6091 6501 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249134.1 protein_id gnl|my_center|LOCUS_08800 >Feature sequence091 <1 1047 gene locus_tag LOCUS_08810 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146756.1:ABC transporter substrate-binding protein 1119 2108 gene locus_tag LOCUS_08820 1119 2108 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776034.1 protein_id gnl|my_center|LOCUS_08820 2112 3005 gene locus_tag LOCUS_08830 2112 3005 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980619.1 protein_id gnl|my_center|LOCUS_08830 3002 3973 gene locus_tag LOCUS_08840 3002 3973 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_08840 4089 5093 gene locus_tag LOCUS_08850 4089 5093 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_08850 5078 5302 gene locus_tag LOCUS_08860 5078 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 5670 5422 gene locus_tag LOCUS_08870 5670 5422 CDS product YgiT-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393077.1 protein_id gnl|my_center|LOCUS_08870 6059 5676 gene locus_tag LOCUS_08880 6059 5676 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393300.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence092 459 2051 gene locus_tag LOCUS_08890 459 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 2051 2275 gene locus_tag LOCUS_08900 2051 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 >Feature sequence093 357 878 gene locus_tag LOCUS_08910 357 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 2063 1008 gene locus_tag LOCUS_08920 gene rfbB 2063 1008 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258175.1 protein_id gnl|my_center|LOCUS_08920 2681 2181 gene locus_tag LOCUS_08930 2681 2181 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940796.1 protein_id gnl|my_center|LOCUS_08930 3453 2782 gene locus_tag LOCUS_08940 gene cybH 3453 2782 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940797.1 protein_id gnl|my_center|LOCUS_08940 5174 3465 gene locus_tag LOCUS_08950 5174 3465 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940798.1 protein_id gnl|my_center|LOCUS_08950 6281 5190 gene locus_tag LOCUS_08960 6281 5190 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940799.1 protein_id gnl|my_center|LOCUS_08960 <7048 6409 gene locus_tag LOCUS_08970 <7048 6409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256556.1:response regulator transcription factor >Feature sequence094 445 1515 gene locus_tag LOCUS_08980 445 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1568 2683 gene locus_tag LOCUS_08990 1568 2683 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392196.1 protein_id gnl|my_center|LOCUS_08990 2685 3575 gene locus_tag LOCUS_09000 2685 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 3675 4274 gene locus_tag LOCUS_09010 3675 4274 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107355.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence095 503 1432 gene locus_tag LOCUS_09020 503 1432 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_09020 1436 2977 gene locus_tag LOCUS_09030 1436 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 6002 3309 gene locus_tag LOCUS_09040 6002 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence096 695 138 gene locus_tag LOCUS_09050 695 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09050 843 992 gene locus_tag LOCUS_09060 843 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1032 1607 gene locus_tag LOCUS_09070 1032 1607 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_09070 1620 3284 gene locus_tag LOCUS_09080 1620 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 3775 3960 gene locus_tag LOCUS_09090 3775 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 5749 4340 gene locus_tag LOCUS_09100 gene sucC 5749 4340 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_09100 6644 5784 gene locus_tag LOCUS_09110 6644 5784 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09110 >Feature sequence097 3356 2811 gene locus_tag LOCUS_09120 3356 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 3686 3450 gene locus_tag LOCUS_09130 3686 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 4642 3971 gene locus_tag LOCUS_09140 4642 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 5823 4675 gene locus_tag LOCUS_09150 5823 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence098 <1 568 gene locus_tag LOCUS_09160 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080425.1:glycoside hydrolase family 2 protein 555 1895 gene locus_tag LOCUS_09170 gene lplD 555 1895 CDS product alpha-galacturonidase LplD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244472.1 protein_id gnl|my_center|LOCUS_09170 2586 1873 gene locus_tag LOCUS_09180 2586 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 3396 2599 gene locus_tag LOCUS_09190 3396 2599 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_09190 4232 3396 gene locus_tag LOCUS_09200 4232 3396 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868388.1 protein_id gnl|my_center|LOCUS_09200 5182 4463 gene locus_tag LOCUS_09210 5182 4463 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892774.1 protein_id gnl|my_center|LOCUS_09210 6224 5229 gene locus_tag LOCUS_09220 6224 5229 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243040.1 protein_id gnl|my_center|LOCUS_09220 <6899 6293 gene locus_tag LOCUS_09230 <6899 6293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941936.1:ABC transporter ATP-binding protein >Feature sequence099 <1 2518 gene locus_tag LOCUS_09240 <1 2518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066275.1:PKD domain-containing protein 2593 2994 gene locus_tag LOCUS_09250 2593 2994 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229003.1 protein_id gnl|my_center|LOCUS_09250 2954 3346 gene locus_tag LOCUS_09260 2954 3346 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249914.1 protein_id gnl|my_center|LOCUS_09260 3425 5248 gene locus_tag LOCUS_09270 gene for 3425 5248 CDS product tungsten-containing formaldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868317.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence100 185 39 gene locus_tag LOCUS_09280 185 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 644 189 gene locus_tag LOCUS_09290 644 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1123 737 gene locus_tag LOCUS_09300 1123 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1642 1130 gene locus_tag LOCUS_09310 1642 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 2700 1648 gene locus_tag LOCUS_09320 2700 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 2974 2687 gene locus_tag LOCUS_09330 2974 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 3373 4032 gene locus_tag LOCUS_09340 3373 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 4092 5093 gene locus_tag LOCUS_09350 4092 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 5080 6477 gene locus_tag LOCUS_09360 5080 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence101 <1 1653 gene locus_tag LOCUS_09370 <1 1653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392243.1:aldehyde ferredoxin oxidoreductase family protein 1798 3048 gene locus_tag LOCUS_09380 1798 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 3133 3354 gene locus_tag LOCUS_09390 3133 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 3468 4445 gene locus_tag LOCUS_09400 gene trpS 3468 4445 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942477.1 protein_id gnl|my_center|LOCUS_09400 4501 6015 gene locus_tag LOCUS_09410 4501 6015 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence102 2122 485 gene locus_tag LOCUS_09420 2122 485 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877166.1 protein_id gnl|my_center|LOCUS_09420 3525 2254 gene locus_tag LOCUS_09430 3525 2254 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774548.1 protein_id gnl|my_center|LOCUS_09430 3851 3516 gene locus_tag LOCUS_09440 3851 3516 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879421.1 protein_id gnl|my_center|LOCUS_09440 4382 3879 gene locus_tag LOCUS_09450 4382 3879 CDS product DUF111 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990917.1 protein_id gnl|my_center|LOCUS_09450 6465 4684 gene locus_tag LOCUS_09460 6465 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020427.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence103 325 2214 gene locus_tag LOCUS_09470 325 2214 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259648.1 protein_id gnl|my_center|LOCUS_09470 2211 3671 gene locus_tag LOCUS_09480 2211 3671 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259646.1 protein_id gnl|my_center|LOCUS_09480 3668 4087 gene locus_tag LOCUS_09490 3668 4087 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259645.1 protein_id gnl|my_center|LOCUS_09490 4093 4338 gene locus_tag LOCUS_09500 4093 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259644.1 protein_id gnl|my_center|LOCUS_09500 4963 4340 gene locus_tag LOCUS_09510 4963 4340 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255966.1 protein_id gnl|my_center|LOCUS_09510 5016 6002 gene locus_tag LOCUS_09520 5016 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 6522 6280 gene locus_tag LOCUS_09530 gene acpP 6522 6280 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631656.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence104 1996 209 gene locus_tag LOCUS_09540 1996 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 3060 2125 gene locus_tag LOCUS_09550 3060 2125 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047751.1 protein_id gnl|my_center|LOCUS_09550 4204 3077 gene locus_tag LOCUS_09560 4204 3077 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256755.1 protein_id gnl|my_center|LOCUS_09560 4646 4251 gene locus_tag LOCUS_09570 4646 4251 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545896.1 protein_id gnl|my_center|LOCUS_09570 <6828 4704 gene locus_tag LOCUS_09580 <6828 4704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228144.1:tetratricopeptide repeat protein >Feature sequence105 <1 1215 gene locus_tag LOCUS_09590 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990901.1:MEDS domain-containing protein 1219 1599 gene locus_tag LOCUS_09600 1219 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1603 2370 gene locus_tag LOCUS_09610 1603 2370 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258506.1 protein_id gnl|my_center|LOCUS_09610 2412 3350 gene locus_tag LOCUS_09620 gene fabD 2412 3350 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258269.1 protein_id gnl|my_center|LOCUS_09620 3387 4130 gene locus_tag LOCUS_09630 gene fabG 3387 4130 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_09630 4375 4710 gene locus_tag LOCUS_09640 4375 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 4792 5256 gene locus_tag LOCUS_09650 gene nusB 4792 5256 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_09650 5263 5499 gene locus_tag LOCUS_09660 5263 5499 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392792.1 protein_id gnl|my_center|LOCUS_09660 5456 6220 gene locus_tag LOCUS_09670 gene tatC 5456 6220 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545000.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence106 2708 600 gene locus_tag LOCUS_09680 2708 600 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_09680 3926 2781 gene locus_tag LOCUS_09690 3926 2781 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257578.1 protein_id gnl|my_center|LOCUS_09690 5461 3923 gene locus_tag LOCUS_09700 5461 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 6806 5631 gene locus_tag LOCUS_09710 6806 5631 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973141.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence107 1131 1475 gene locus_tag LOCUS_09720 1131 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 2173 1472 gene locus_tag LOCUS_09730 2173 1472 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_09730 2537 2860 gene locus_tag LOCUS_09740 2537 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 2796 3839 gene locus_tag LOCUS_09750 gene tdh 2796 3839 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244880.1 protein_id gnl|my_center|LOCUS_09750 4075 3854 gene locus_tag LOCUS_09760 4075 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 <6802 4243 gene locus_tag LOCUS_09770 <6802 4243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037394238.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence108 3071 3319 gene locus_tag LOCUS_09780 3071 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 4326 3316 gene locus_tag LOCUS_09790 4326 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 5060 4380 gene locus_tag LOCUS_09800 5060 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 5361 5672 gene locus_tag LOCUS_09810 5361 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 5669 6769 gene locus_tag LOCUS_09820 5669 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence109 440 1189 gene locus_tag LOCUS_09830 gene map 440 1189 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_09830 1332 1721 gene locus_tag LOCUS_09840 gene rpsM 1332 1721 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_09840 2006 2398 gene locus_tag LOCUS_09850 gene rpsK 2006 2398 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258256.1 protein_id gnl|my_center|LOCUS_09850 2419 3054 gene locus_tag LOCUS_09860 gene rpsD 2419 3054 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173699.1 protein_id gnl|my_center|LOCUS_09860 3165 4160 gene locus_tag LOCUS_09870 3165 4160 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_09870 4129 4482 gene locus_tag LOCUS_09880 4129 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 4484 5230 gene locus_tag LOCUS_09890 gene truA 4484 5230 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_09890 5568 6002 gene locus_tag LOCUS_09900 gene rplM 5568 6002 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_09900 6076 6477 gene locus_tag LOCUS_09910 gene rpsI 6076 6477 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393901.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence110 235 582 gene locus_tag LOCUS_09920 235 582 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930998.1 protein_id gnl|my_center|LOCUS_09920 585 2501 gene locus_tag LOCUS_09930 585 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3036 2470 gene locus_tag LOCUS_09940 3036 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 4143 3061 gene locus_tag LOCUS_09950 gene buk 4143 3061 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 protein_id gnl|my_center|LOCUS_09950 <6782 4146 gene locus_tag LOCUS_09960 <6782 4146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257267.1:response regulator >Feature sequence111 <1 1054 gene locus_tag LOCUS_09970 <1 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391684.1:DUF763 domain-containing protein 2175 1048 gene locus_tag LOCUS_09980 2175 1048 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256942.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09980 2454 2218 gene locus_tag LOCUS_09990 2454 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 3362 2454 gene locus_tag LOCUS_10000 3362 2454 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256941.1 protein_id gnl|my_center|LOCUS_10000 4223 3468 gene locus_tag LOCUS_10010 4223 3468 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258938.1 protein_id gnl|my_center|LOCUS_10010 5219 4278 gene locus_tag LOCUS_10020 5219 4278 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258568.1 protein_id gnl|my_center|LOCUS_10020 5461 5964 gene locus_tag LOCUS_10030 5461 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 5873 6154 gene locus_tag LOCUS_10040 5873 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence112 3188 1314 gene locus_tag LOCUS_10050 3188 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 4820 3246 gene locus_tag LOCUS_10060 4820 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 6255 4960 gene locus_tag LOCUS_10070 6255 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 6526 6278 gene locus_tag LOCUS_10080 6526 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence113 228 398 gene locus_tag LOCUS_10090 228 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 2004 586 gene locus_tag LOCUS_10100 gene lpdA 2004 586 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949165.1 protein_id gnl|my_center|LOCUS_10100 3494 2007 gene locus_tag LOCUS_10110 3494 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 3899 3540 gene locus_tag LOCUS_10120 3899 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 4696 3947 gene locus_tag LOCUS_10130 4696 3947 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430913.1 protein_id gnl|my_center|LOCUS_10130 5640 4714 gene locus_tag LOCUS_10140 5640 4714 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257710.1 protein_id gnl|my_center|LOCUS_10140 <6708 5719 gene locus_tag LOCUS_10150 <6708 5719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392123.1:molecular chaperone DnaJ >Feature sequence114 532 1704 gene locus_tag LOCUS_10160 532 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2853 1885 gene locus_tag LOCUS_10170 2853 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 4217 2889 gene locus_tag LOCUS_10180 4217 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4890 4345 gene locus_tag LOCUS_10190 4890 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 5560 4955 gene locus_tag LOCUS_10200 5560 4955 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_10200 <6624 5656 gene locus_tag LOCUS_10210 <6624 5656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948291.1:carbon starvation protein A >Feature sequence115 <1 1116 gene locus_tag LOCUS_10220 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256605.1:glycosyltransferase family 39 protein 2320 1088 gene locus_tag LOCUS_10230 2320 1088 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_10230 3147 2293 gene locus_tag LOCUS_10240 3147 2293 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_10240 3950 3144 gene locus_tag LOCUS_10250 gene iolO 3950 3144 CDS product 5-keto-L-gluconate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083268.1 protein_id gnl|my_center|LOCUS_10250 4347 5840 gene locus_tag LOCUS_10260 4347 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence116 29 2341 gene locus_tag LOCUS_10270 29 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 2747 3688 gene locus_tag LOCUS_10280 2747 3688 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064840.1 protein_id gnl|my_center|LOCUS_10280 4363 3836 gene locus_tag LOCUS_10290 4363 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 4646 4377 gene locus_tag LOCUS_10300 4646 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 4897 4709 gene locus_tag LOCUS_10310 4897 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 5507 4887 gene locus_tag LOCUS_10320 5507 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 5689 5850 gene locus_tag LOCUS_10330 5689 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence117 269 1432 gene locus_tag LOCUS_10340 269 1432 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_10340 1384 2370 gene locus_tag LOCUS_10350 1384 2370 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251204.1 protein_id gnl|my_center|LOCUS_10350 2497 3729 gene locus_tag LOCUS_10360 2497 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 3755 4879 gene locus_tag LOCUS_10370 3755 4879 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765279.1 protein_id gnl|my_center|LOCUS_10370 4959 5606 gene locus_tag LOCUS_10380 4959 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 5696 6163 gene locus_tag LOCUS_10390 5696 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 6476 6282 gene locus_tag LOCUS_10400 6476 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 >Feature sequence118 49 717 gene locus_tag LOCUS_10410 49 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256161.1 protein_id gnl|my_center|LOCUS_10410 711 2465 gene locus_tag LOCUS_10420 711 2465 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_10420 2465 3523 gene locus_tag LOCUS_10430 2465 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 3551 3991 gene locus_tag LOCUS_10440 3551 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 4025 4405 gene locus_tag LOCUS_10450 4025 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 4432 4833 gene locus_tag LOCUS_10460 4432 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 4870 5853 gene locus_tag LOCUS_10470 gene moaA 4870 5853 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_10470 6012 5869 gene locus_tag LOCUS_10480 6012 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 >Feature sequence119 1376 174 gene locus_tag LOCUS_10490 gene alr 1376 174 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_10490 2071 1373 gene locus_tag LOCUS_10500 2071 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 2474 4183 gene locus_tag LOCUS_10510 2474 4183 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228698.1 protein_id gnl|my_center|LOCUS_10510 4184 5611 gene locus_tag LOCUS_10520 4184 5611 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081252.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence120 <1 684 gene locus_tag LOCUS_10530 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010951140.1:NgoMIV family type II restriction endonuclease 698 1339 gene locus_tag LOCUS_10540 698 1339 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_10540 2475 1312 gene locus_tag LOCUS_10550 gene waaF 2475 1312 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_10550 4171 2528 gene locus_tag LOCUS_10560 gene murJ 4171 2528 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256387.1 protein_id gnl|my_center|LOCUS_10560 5225 4143 gene locus_tag LOCUS_10570 gene hypD 5225 4143 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582513.1 protein_id gnl|my_center|LOCUS_10570 5928 5236 gene locus_tag LOCUS_10580 5928 5236 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228805.1 protein_id gnl|my_center|LOCUS_10580 >Feature sequence121 794 453 gene locus_tag LOCUS_10590 794 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1233 1003 gene locus_tag LOCUS_10600 1233 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 1490 1248 gene locus_tag LOCUS_10610 1490 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1799 1611 gene locus_tag LOCUS_10620 1799 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 3072 3305 gene locus_tag LOCUS_10630 3072 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 4020 3856 gene locus_tag LOCUS_10640 4020 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 4332 4610 gene locus_tag LOCUS_10650 4332 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 4906 5142 gene locus_tag LOCUS_10660 4906 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 5139 5531 gene locus_tag LOCUS_10670 5139 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 5572 5841 gene locus_tag LOCUS_10680 5572 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 5843 6280 gene locus_tag LOCUS_10690 5843 6280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence122 453 3509 gene locus_tag LOCUS_10700 453 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 3506 4603 gene locus_tag LOCUS_10710 gene ychF 3506 4603 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228498.1 protein_id gnl|my_center|LOCUS_10710 4692 5465 gene locus_tag LOCUS_10720 4692 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 5540 6121 gene locus_tag LOCUS_10730 5540 6121 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459818.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence123 2127 2576 gene locus_tag LOCUS_10740 gene rplI 2127 2576 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256838.1 protein_id gnl|my_center|LOCUS_10740 2580 2921 gene locus_tag LOCUS_10750 2580 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 3676 2915 gene locus_tag LOCUS_10760 3676 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 4107 3688 gene locus_tag LOCUS_10770 4107 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 5113 4238 gene locus_tag LOCUS_10780 5113 4238 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421593.1 protein_id gnl|my_center|LOCUS_10780 6081 5170 gene locus_tag LOCUS_10790 6081 5170 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868480.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence124 947 120 gene locus_tag LOCUS_10800 947 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1647 1402 gene locus_tag LOCUS_10810 1647 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 2663 2304 gene locus_tag LOCUS_10820 2663 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 3505 2660 gene locus_tag LOCUS_10830 3505 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 3668 3516 gene locus_tag LOCUS_10840 3668 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 4514 3678 gene locus_tag LOCUS_10850 4514 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 5317 4628 gene locus_tag LOCUS_10860 5317 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 6032 5301 gene locus_tag LOCUS_10870 6032 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence125 1645 221 gene locus_tag LOCUS_10880 1645 221 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_10880 1941 1690 gene locus_tag LOCUS_10890 1941 1690 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_10890 4357 2048 gene locus_tag LOCUS_10900 4357 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 4876 4382 gene locus_tag LOCUS_10910 4876 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 5207 4827 gene locus_tag LOCUS_10920 5207 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 6186 5215 gene locus_tag LOCUS_10930 6186 5215 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_10930 >Feature sequence126 41 226 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aatgcatcgccacgatccgaagagaggatactgaaag 639 812 gene locus_tag LOCUS_10940 639 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1834 755 gene locus_tag LOCUS_10950 1834 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877363.1 protein_id gnl|my_center|LOCUS_10950 3317 1803 gene locus_tag LOCUS_10960 gene glgA 3317 1803 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393434.1 protein_id gnl|my_center|LOCUS_10960 5280 3355 gene locus_tag LOCUS_10970 5280 3355 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392714.1 protein_id gnl|my_center|LOCUS_10970 5907 5293 gene locus_tag LOCUS_10980 5907 5293 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392990.1 protein_id gnl|my_center|LOCUS_10980 6077 5904 gene locus_tag LOCUS_10990 6077 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 >Feature sequence127 1388 600 gene locus_tag LOCUS_11000 gene larB 1388 600 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020480.1 protein_id gnl|my_center|LOCUS_11000 2452 1424 gene locus_tag LOCUS_11010 2452 1424 CDS product DNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876855.1 protein_id gnl|my_center|LOCUS_11010 3397 2513 gene locus_tag LOCUS_11020 3397 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 4347 3394 gene locus_tag LOCUS_11030 gene mch 4347 3394 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021714.1 protein_id gnl|my_center|LOCUS_11030 5299 4466 gene locus_tag LOCUS_11040 5299 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 >Feature sequence128 207 1247 gene locus_tag LOCUS_11050 gene ahbD 207 1247 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_11050 1263 1832 gene locus_tag LOCUS_11060 1263 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1845 2093 gene locus_tag LOCUS_11070 1845 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 2973 2143 gene locus_tag LOCUS_11080 2973 2143 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434727.1 protein_id gnl|my_center|LOCUS_11080 4387 3005 gene locus_tag LOCUS_11090 4387 3005 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256515.1 protein_id gnl|my_center|LOCUS_11090 5456 4443 gene locus_tag LOCUS_11100 5456 4443 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081252.1 protein_id gnl|my_center|LOCUS_11100 5560 5766 gene locus_tag LOCUS_11110 5560 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 >Feature sequence129 2037 1063 gene locus_tag LOCUS_11120 2037 1063 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122178.1 protein_id gnl|my_center|LOCUS_11120 2300 3358 gene locus_tag LOCUS_11130 2300 3358 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009927050.1 protein_id gnl|my_center|LOCUS_11130 3428 4822 gene locus_tag LOCUS_11140 3428 4822 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241336.1 protein_id gnl|my_center|LOCUS_11140 4931 5800 gene locus_tag LOCUS_11150 4931 5800 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258587.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence130 228 1838 gene locus_tag LOCUS_11160 228 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1911 3038 gene locus_tag LOCUS_11170 1911 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 5213 3366 gene locus_tag LOCUS_11180 5213 3366 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460899.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence131 667 981 gene locus_tag LOCUS_11190 667 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1254 1084 gene locus_tag LOCUS_11200 1254 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 2230 1277 gene locus_tag LOCUS_11210 2230 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 3252 2227 gene locus_tag LOCUS_11220 3252 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 4441 3329 gene locus_tag LOCUS_11230 4441 3329 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_11230 5572 4457 gene locus_tag LOCUS_11240 5572 4457 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545696.1 protein_id gnl|my_center|LOCUS_11240 <6108 5598 gene locus_tag LOCUS_11250 <6108 5598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944016.1:amino acid ABC transporter permease >Feature sequence132 302 1474 gene locus_tag LOCUS_11260 302 1474 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940010.1 protein_id gnl|my_center|LOCUS_11260 1599 2528 gene locus_tag LOCUS_11270 1599 2528 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940009.1 protein_id gnl|my_center|LOCUS_11270 2550 3911 gene locus_tag LOCUS_11280 2550 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 3892 4662 gene locus_tag LOCUS_11290 3892 4662 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940007.1 protein_id gnl|my_center|LOCUS_11290 4662 5375 gene locus_tag LOCUS_11300 4662 5375 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940006.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence133 1659 556 gene locus_tag LOCUS_11310 gene iolN 1659 556 CDS product 3-dehydro-scyllo-inosose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083262.1 protein_id gnl|my_center|LOCUS_11310 2917 1625 gene locus_tag LOCUS_11320 2917 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 3107 2901 gene locus_tag LOCUS_11330 3107 2901 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545155.1 protein_id gnl|my_center|LOCUS_11330 3531 3118 gene locus_tag LOCUS_11340 3531 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 4574 3528 gene locus_tag LOCUS_11350 4574 3528 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582467.1 protein_id gnl|my_center|LOCUS_11350 6054 4843 gene locus_tag LOCUS_11360 6054 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence134 270 935 gene locus_tag LOCUS_11370 270 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1031 1807 gene locus_tag LOCUS_11380 1031 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 2258 2572 gene locus_tag LOCUS_11390 2258 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 3127 2684 gene locus_tag LOCUS_11400 3127 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 3402 3124 gene locus_tag LOCUS_11410 3402 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 3597 3800 gene locus_tag LOCUS_11420 3597 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 3813 4010 gene locus_tag LOCUS_11430 3813 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 4139 4960 gene locus_tag LOCUS_11440 4139 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 5524 5129 gene locus_tag LOCUS_11450 5524 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence135 253 1023 gene locus_tag LOCUS_11460 253 1023 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_11460 1029 2306 gene locus_tag LOCUS_11470 gene murA 1029 2306 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257774.1 protein_id gnl|my_center|LOCUS_11470 2366 2887 gene locus_tag LOCUS_11480 2366 2887 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391792.1 protein_id gnl|my_center|LOCUS_11480 2948 3955 gene locus_tag LOCUS_11490 2948 3955 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393336.1 protein_id gnl|my_center|LOCUS_11490 4024 4572 gene locus_tag LOCUS_11500 4024 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence136 <1 3948 gene locus_tag LOCUS_11510 <1 3948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860269.1:NosD domain-containing protein 3958 4635 gene locus_tag LOCUS_11520 gene flaK 3958 4635 CDS product preflagellin peptidase FlaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496655.1 protein_id gnl|my_center|LOCUS_11520 4628 5134 gene locus_tag LOCUS_11530 4628 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 5131 5691 gene locus_tag LOCUS_11540 5131 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence137 2371 1307 gene locus_tag LOCUS_11550 2371 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 3139 2933 gene locus_tag LOCUS_11560 3139 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 4211 3171 gene locus_tag LOCUS_11570 gene cax 4211 3171 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_11570 5171 4236 gene locus_tag LOCUS_11580 5171 4236 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_11580 5854 5168 gene locus_tag LOCUS_11590 5854 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence138 4696 5394 gene locus_tag LOCUS_11600 4696 5394 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence139 311 1021 gene locus_tag LOCUS_11610 gene yycF 311 1021 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100856.1 protein_id gnl|my_center|LOCUS_11610 2267 1005 gene locus_tag LOCUS_11620 gene hutI 2267 1005 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256863.1 protein_id gnl|my_center|LOCUS_11620 2934 2254 gene locus_tag LOCUS_11630 2934 2254 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_11630 3632 2931 gene locus_tag LOCUS_11640 gene deoC 3632 2931 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_11640 4264 3641 gene locus_tag LOCUS_11650 gene lepB 4264 3641 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257166.1 protein_id gnl|my_center|LOCUS_11650 5003 4353 gene locus_tag LOCUS_11660 5003 4353 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_11660 5692 5000 gene locus_tag LOCUS_11670 5692 5000 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_11670 5801 5726 gene locus_tag LOCUS_t00180 5801 5726 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence140 455 1354 gene locus_tag LOCUS_11680 gene ftcD 455 1354 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869662.1 protein_id gnl|my_center|LOCUS_11680 1468 2289 gene locus_tag LOCUS_11690 gene amrB 1468 2289 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082616.1 protein_id gnl|my_center|LOCUS_11690 2307 2933 gene locus_tag LOCUS_11700 2307 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 >Feature sequence141 <1 1241 gene locus_tag LOCUS_11710 <1 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392141.1:glycine--tRNA ligase subunit beta 1254 1514 gene locus_tag LOCUS_11720 1254 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1498 1710 gene locus_tag LOCUS_11730 1498 1710 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546452.1 protein_id gnl|my_center|LOCUS_11730 1786 2286 gene locus_tag LOCUS_11740 1786 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 2289 3260 gene locus_tag LOCUS_11750 gene holA 2289 3260 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583467.1 protein_id gnl|my_center|LOCUS_11750 3491 3273 gene locus_tag LOCUS_11760 3491 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 3870 3508 gene locus_tag LOCUS_11770 3870 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 4139 3867 gene locus_tag LOCUS_11780 4139 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 5316 4219 gene locus_tag LOCUS_11790 5316 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 >Feature sequence142 2247 1357 gene locus_tag LOCUS_11800 2247 1357 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258205.1 protein_id gnl|my_center|LOCUS_11800 3517 2216 gene locus_tag LOCUS_11810 3517 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 4884 3514 gene locus_tag LOCUS_11820 gene glmU 4884 3514 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391623.1 protein_id gnl|my_center|LOCUS_11820 5678 4995 gene locus_tag LOCUS_11830 5678 4995 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence143 2431 1169 gene locus_tag LOCUS_11840 gene larA 2431 1169 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_11840 3121 2471 gene locus_tag LOCUS_11850 3121 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 4047 3118 gene locus_tag LOCUS_11860 4047 3118 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256294.1 protein_id gnl|my_center|LOCUS_11860 5867 4044 gene locus_tag LOCUS_11870 5867 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 >Feature sequence144 481 107 gene locus_tag LOCUS_11880 481 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 632 471 gene locus_tag LOCUS_11890 632 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 811 632 gene locus_tag LOCUS_11900 811 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1400 1137 gene locus_tag LOCUS_11910 1400 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1656 1450 gene locus_tag LOCUS_11920 1656 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 2501 1665 gene locus_tag LOCUS_11930 2501 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 2959 2504 gene locus_tag LOCUS_11940 2959 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 3348 2959 gene locus_tag LOCUS_11950 3348 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 3520 3290 gene locus_tag LOCUS_11960 3520 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 4135 3530 gene locus_tag LOCUS_11970 4135 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 4417 4181 gene locus_tag LOCUS_11980 4417 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 4629 4429 gene locus_tag LOCUS_11990 4629 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 5822 4629 gene locus_tag LOCUS_12000 5822 4629 CDS product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144597911.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence145 144 968 gene locus_tag LOCUS_12010 144 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 946 1065 gene locus_tag LOCUS_12020 946 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1080 2060 gene locus_tag LOCUS_12030 1080 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2282 2707 gene locus_tag LOCUS_12040 2282 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 2722 5286 gene locus_tag LOCUS_12050 gene lon 2722 5286 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_12050 >Feature sequence146 1280 414 gene locus_tag LOCUS_12060 1280 414 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_12060 2135 1284 gene locus_tag LOCUS_12070 2135 1284 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435660.1 protein_id gnl|my_center|LOCUS_12070 2448 3113 gene locus_tag LOCUS_12080 2448 3113 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_12080 3179 4036 gene locus_tag LOCUS_12090 gene panB 3179 4036 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_12090 4043 4966 gene locus_tag LOCUS_12100 4043 4966 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258713.1 protein_id gnl|my_center|LOCUS_12100 >Feature sequence147 417 728 gene locus_tag LOCUS_12110 417 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2595 793 gene locus_tag LOCUS_12120 gene lepA 2595 793 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258913.1 protein_id gnl|my_center|LOCUS_12120 2726 5587 gene locus_tag LOCUS_12130 2726 5587 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257493.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence148 <1 1312 gene locus_tag LOCUS_12140 <1 1312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729741.1:FAD-binding oxidoreductase 1841 1479 gene locus_tag LOCUS_12150 1841 1479 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256335.1 protein_id gnl|my_center|LOCUS_12150 2241 1867 gene locus_tag LOCUS_12160 2241 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256894.1 protein_id gnl|my_center|LOCUS_12160 3238 2231 gene locus_tag LOCUS_12170 3238 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 4549 3332 gene locus_tag LOCUS_12180 4549 3332 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799718.1 protein_id gnl|my_center|LOCUS_12180 4938 4552 gene locus_tag LOCUS_12190 4938 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 5395 5021 gene locus_tag LOCUS_12200 5395 5021 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966283.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence149 47 1957 gene locus_tag LOCUS_12210 47 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1991 2791 gene locus_tag LOCUS_12220 1991 2791 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 protein_id gnl|my_center|LOCUS_12220 2840 3712 gene locus_tag LOCUS_12230 2840 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 3781 5325 gene locus_tag LOCUS_12240 3781 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence150 1279 1797 gene locus_tag LOCUS_12250 1279 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1806 3170 gene locus_tag LOCUS_12260 gene dnaB 1806 3170 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256839.1 protein_id gnl|my_center|LOCUS_12260 3167 3880 gene locus_tag LOCUS_12270 3167 3880 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257454.1 protein_id gnl|my_center|LOCUS_12270 3798 5216 gene locus_tag LOCUS_12280 3798 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 >Feature sequence151 329 511 gene locus_tag LOCUS_12290 329 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 508 1443 gene locus_tag LOCUS_12300 508 1443 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_12300 1463 1702 gene locus_tag LOCUS_12310 1463 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1699 2115 gene locus_tag LOCUS_12320 1699 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 2141 3523 gene locus_tag LOCUS_12330 2141 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 3594 3878 gene locus_tag LOCUS_12340 3594 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 3865 4122 gene locus_tag LOCUS_12350 3865 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 4145 4768 gene locus_tag LOCUS_12360 4145 4768 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583068.1 protein_id gnl|my_center|LOCUS_12360 4779 5684 gene locus_tag LOCUS_12370 4779 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 >Feature sequence152 521 210 gene locus_tag LOCUS_12380 521 210 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227760.1 protein_id gnl|my_center|LOCUS_12380 1067 828 gene locus_tag LOCUS_12390 1067 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1304 1098 gene locus_tag LOCUS_12400 1304 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1303 1500 gene locus_tag LOCUS_12410 1303 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1445 1786 gene locus_tag LOCUS_12420 1445 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 2470 1928 gene locus_tag LOCUS_12430 2470 1928 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963654.1 protein_id gnl|my_center|LOCUS_12430 3642 2677 gene locus_tag LOCUS_12440 3642 2677 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384240.1 protein_id gnl|my_center|LOCUS_12440 4887 3658 gene locus_tag LOCUS_12450 4887 3658 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_12450 <5680 4954 gene locus_tag LOCUS_12460 <5680 4954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357319.1:energy-coupling factor transporter transmembrane protein EcfT >Feature sequence153 196 435 gene locus_tag LOCUS_12470 196 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 437 1432 gene locus_tag LOCUS_12480 437 1432 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 protein_id gnl|my_center|LOCUS_12480 1563 2150 gene locus_tag LOCUS_12490 gene folE 1563 2150 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391949.1 protein_id gnl|my_center|LOCUS_12490 2173 3411 gene locus_tag LOCUS_12500 gene folP 2173 3411 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391658.1 protein_id gnl|my_center|LOCUS_12500 3516 4571 gene locus_tag LOCUS_12510 3516 4571 CDS product lipoate protein ligase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881270.1 protein_id gnl|my_center|LOCUS_12510 4805 4969 gene locus_tag LOCUS_12520 4805 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence154 227 1414 gene locus_tag LOCUS_12530 227 1414 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393160.1 protein_id gnl|my_center|LOCUS_12530 1432 2565 gene locus_tag LOCUS_12540 gene wecB 1432 2565 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_12540 3312 4067 gene locus_tag LOCUS_12550 3312 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 4064 5266 gene locus_tag LOCUS_12560 4064 5266 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966332.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence155 346 179 gene locus_tag LOCUS_12570 346 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 885 535 gene locus_tag LOCUS_12580 885 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 2268 901 gene locus_tag LOCUS_12590 2268 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 3397 2297 gene locus_tag LOCUS_12600 3397 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 3658 3503 gene locus_tag LOCUS_12610 3658 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 5236 3836 gene locus_tag LOCUS_12620 5236 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 5419 5270 gene locus_tag LOCUS_12630 5419 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence156 318 773 gene locus_tag LOCUS_12640 318 773 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880961.1 protein_id gnl|my_center|LOCUS_12640 1123 4083 gene locus_tag LOCUS_12650 1123 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 4129 4839 gene locus_tag LOCUS_12660 4129 4839 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_12660 <5624 4852 gene locus_tag LOCUS_12670 <5624 4852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257826.1:LysM domain-containing protein >Feature sequence157 <1 893 gene locus_tag LOCUS_12680 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927078.1:DUF559 domain-containing protein note possible pseudo, frameshifted 826 1509 gene locus_tag LOCUS_12690 826 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12690 1509 4292 gene locus_tag LOCUS_12700 1509 4292 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933392.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence158 259 1302 gene locus_tag LOCUS_12710 259 1302 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249610.1 protein_id gnl|my_center|LOCUS_12710 1299 2276 gene locus_tag LOCUS_12720 1299 2276 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249611.1 protein_id gnl|my_center|LOCUS_12720 2651 3586 gene locus_tag LOCUS_12730 gene ftsY 2651 3586 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081293.1 protein_id gnl|my_center|LOCUS_12730 3729 4733 gene locus_tag LOCUS_12740 gene prfB 3729 4733 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772533.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence159 <1 647 gene locus_tag LOCUS_12750 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258159.1:RAMP superfamily CRISPR-associated protein 644 1261 gene locus_tag LOCUS_12760 644 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1248 2246 gene locus_tag LOCUS_12770 1248 2246 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258161.1 protein_id gnl|my_center|LOCUS_12770 2268 2573 gene locus_tag LOCUS_12780 2268 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 2581 3168 gene locus_tag LOCUS_12790 2581 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 3165 4064 gene locus_tag LOCUS_12800 3165 4064 CDS product DUF1887 family CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258165.1 protein_id gnl|my_center|LOCUS_12800 4034 4417 gene locus_tag LOCUS_12810 gene csx15 4034 4417 CDS product CRISPR-associated protein Csx15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257334.1 protein_id gnl|my_center|LOCUS_12810 4440 5288 gene locus_tag LOCUS_12820 4440 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence160 492 2903 gene locus_tag LOCUS_12830 gene lon 492 2903 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_12830 3014 4252 gene locus_tag LOCUS_12840 3014 4252 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353378.1 protein_id gnl|my_center|LOCUS_12840 5354 4215 gene locus_tag LOCUS_12850 5354 4215 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence161 <1 2049 gene locus_tag LOCUS_12860 <1 2049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265821.1:M28 family metallopeptidase 2363 2079 gene locus_tag LOCUS_12870 2363 2079 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257138.1 protein_id gnl|my_center|LOCUS_12870 3484 2372 gene locus_tag LOCUS_12880 3484 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 4310 3504 gene locus_tag LOCUS_12890 4310 3504 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_12890 5260 4313 gene locus_tag LOCUS_12900 5260 4313 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867338.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence162 165 1340 gene locus_tag LOCUS_12910 165 1340 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_12910 1401 2318 gene locus_tag LOCUS_12920 1401 2318 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_12920 2353 3459 gene locus_tag LOCUS_12930 gene amrS 2353 3459 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_12930 4857 3472 gene locus_tag LOCUS_12940 4857 3472 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_12940 5412 5053 gene locus_tag LOCUS_12950 5412 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence163 <1 644 gene locus_tag LOCUS_12960 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870830.1:aconitase X 749 1417 gene locus_tag LOCUS_12970 749 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931057.1 protein_id gnl|my_center|LOCUS_12970 1414 1803 gene locus_tag LOCUS_12980 gene cdd 1414 1803 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_12980 3745 1838 gene locus_tag LOCUS_12990 gene gyrB 3745 1838 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947898.1 protein_id gnl|my_center|LOCUS_12990 <5479 3809 gene locus_tag LOCUS_13000 <5479 3809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257484.1:immune inhibitor A >Feature sequence164 1785 505 gene locus_tag LOCUS_13010 1785 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 2066 1866 gene locus_tag LOCUS_13020 2066 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 5350 2177 gene locus_tag LOCUS_13030 5350 2177 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258122.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence165 <1 944 gene locus_tag LOCUS_13040 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003233927.1:DUF3048 domain-containing protein 941 1951 gene locus_tag LOCUS_13050 941 1951 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046594.1 protein_id gnl|my_center|LOCUS_13050 1932 3371 gene locus_tag LOCUS_13060 1932 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 3356 4639 gene locus_tag LOCUS_13070 3356 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 5138 4524 gene locus_tag LOCUS_13080 5138 4524 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545581.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence166 518 1537 gene locus_tag LOCUS_13090 518 1537 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257892.1 protein_id gnl|my_center|LOCUS_13090 1672 3075 gene locus_tag LOCUS_13100 1672 3075 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065231.1 protein_id gnl|my_center|LOCUS_13100 3141 4025 gene locus_tag LOCUS_13110 3141 4025 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228343.1 protein_id gnl|my_center|LOCUS_13110 4022 4849 gene locus_tag LOCUS_13120 4022 4849 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228342.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence167 335 1717 gene locus_tag LOCUS_13130 335 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1746 2567 gene locus_tag LOCUS_13140 1746 2567 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879825.1 protein_id gnl|my_center|LOCUS_13140 2622 3875 gene locus_tag LOCUS_13150 2622 3875 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393402.1 protein_id gnl|my_center|LOCUS_13150 3974 4249 gene locus_tag LOCUS_13160 3974 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 4221 5291 gene locus_tag LOCUS_13170 4221 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence168 >Feature sequence169 8 1570 gene locus_tag LOCUS_13180 8 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1627 1890 gene locus_tag LOCUS_13190 1627 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1883 2554 gene locus_tag LOCUS_13200 1883 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 2705 3547 gene locus_tag LOCUS_13210 2705 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 4197 3670 gene locus_tag LOCUS_13220 4197 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 4517 4296 gene locus_tag LOCUS_13230 4517 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence170 186 1154 gene locus_tag LOCUS_13240 186 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1156 1992 gene locus_tag LOCUS_13250 1156 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1989 4364 gene locus_tag LOCUS_13260 1989 4364 CDS product DNA polymerase elongation subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902345.1 protein_id gnl|my_center|LOCUS_13260 4372 4659 gene locus_tag LOCUS_13270 4372 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence171 31 1338 gene locus_tag LOCUS_13280 31 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1281 2408 gene locus_tag LOCUS_13290 1281 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 2392 3735 gene locus_tag LOCUS_13300 2392 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 3810 4979 gene locus_tag LOCUS_13310 3810 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 4993 5139 gene locus_tag LOCUS_13320 4993 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence172 156 1442 gene locus_tag LOCUS_13330 gene larA 156 1442 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393426.1 protein_id gnl|my_center|LOCUS_13330 1550 2842 gene locus_tag LOCUS_13340 1550 2842 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942269.1 protein_id gnl|my_center|LOCUS_13340 2869 4269 gene locus_tag LOCUS_13350 2869 4269 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence173 1223 189 gene locus_tag LOCUS_13360 1223 189 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256249.1 protein_id gnl|my_center|LOCUS_13360 2434 1256 gene locus_tag LOCUS_13370 2434 1256 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257466.1 protein_id gnl|my_center|LOCUS_13370 3482 2481 gene locus_tag LOCUS_13380 3482 2481 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259392.1 protein_id gnl|my_center|LOCUS_13380 4450 3479 gene locus_tag LOCUS_13390 4450 3479 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460185.1 protein_id gnl|my_center|LOCUS_13390 5283 4468 gene locus_tag LOCUS_13400 5283 4468 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391597.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence174 531 334 gene locus_tag LOCUS_13410 531 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1459 500 gene locus_tag LOCUS_13420 1459 500 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020974.1 protein_id gnl|my_center|LOCUS_13420 2288 1443 gene locus_tag LOCUS_13430 2288 1443 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020975.1 protein_id gnl|my_center|LOCUS_13430 3553 2378 gene locus_tag LOCUS_13440 3553 2378 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755814.1 protein_id gnl|my_center|LOCUS_13440 4047 4121 gene locus_tag LOCUS_t00190 4047 4121 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4374 5294 gene locus_tag LOCUS_13450 4374 5294 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence175 849 400 gene locus_tag LOCUS_13460 gene ndk 849 400 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_13460 2802 892 gene locus_tag LOCUS_13470 2802 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 3741 2869 gene locus_tag LOCUS_13480 3741 2869 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969937.1 protein_id gnl|my_center|LOCUS_13480 4459 3743 gene locus_tag LOCUS_13490 4459 3743 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_13490 5254 4490 gene locus_tag LOCUS_13500 5254 4490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938016.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence176 1378 767 gene locus_tag LOCUS_13510 1378 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1475 2443 gene locus_tag LOCUS_13520 gene pepQ 1475 2443 CDS product Xaa-Pro dipeptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146836.1 protein_id gnl|my_center|LOCUS_13520 2733 2440 gene locus_tag LOCUS_13530 2733 2440 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250247.1 protein_id gnl|my_center|LOCUS_13530 3118 2768 gene locus_tag LOCUS_13540 3118 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 3145 4290 gene locus_tag LOCUS_13550 3145 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 4759 4211 gene locus_tag LOCUS_13560 4759 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 4939 5202 gene locus_tag LOCUS_13570 4939 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence177 802 2076 gene locus_tag LOCUS_13580 gene nirJ2 802 2076 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392759.1 protein_id gnl|my_center|LOCUS_13580 2147 2971 gene locus_tag LOCUS_13590 gene mutM 2147 2971 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_13590 3292 4617 gene locus_tag LOCUS_13600 gene rho 3292 4617 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256183.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence178 2308 173 gene locus_tag LOCUS_13610 2308 173 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257189.1 protein_id gnl|my_center|LOCUS_13610 3464 2283 gene locus_tag LOCUS_13620 3464 2283 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257829.1 protein_id gnl|my_center|LOCUS_13620 3585 3761 gene locus_tag LOCUS_13630 3585 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 5038 3758 gene locus_tag LOCUS_13640 5038 3758 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256145.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence179 1901 1044 gene locus_tag LOCUS_13650 1901 1044 CDS product NADP-dependent methylenetetrahydromethanopterin/methylenetetrahydrofolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122705.1 protein_id gnl|my_center|LOCUS_13650 2463 1945 gene locus_tag LOCUS_13660 2463 1945 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044348005.1 protein_id gnl|my_center|LOCUS_13660 2871 3728 gene locus_tag LOCUS_13670 2871 3728 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583216.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence180 256 1359 gene locus_tag LOCUS_13680 256 1359 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259287.1 protein_id gnl|my_center|LOCUS_13680 2812 1844 gene locus_tag LOCUS_13690 2812 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3973 2900 gene locus_tag LOCUS_13700 3973 2900 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_13700 4912 4121 gene locus_tag LOCUS_13710 4912 4121 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227815.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence181 1484 1723 gene locus_tag LOCUS_13720 1484 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 2249 1713 gene locus_tag LOCUS_13730 2249 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 2478 2179 gene locus_tag LOCUS_13740 2478 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 2828 3469 gene locus_tag LOCUS_13750 2828 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 4610 4095 gene locus_tag LOCUS_13760 4610 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 4891 4610 gene locus_tag LOCUS_13770 4891 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence182 1525 449 gene locus_tag LOCUS_13780 1525 449 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_13780 2697 1660 gene locus_tag LOCUS_13790 gene dprA 2697 1660 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_13790 3537 2974 gene locus_tag LOCUS_13800 gene rimM 3537 2974 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583885.1 protein_id gnl|my_center|LOCUS_13800 3900 3616 gene locus_tag LOCUS_13810 3900 3616 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362589.1 protein_id gnl|my_center|LOCUS_13810 4251 3985 gene locus_tag LOCUS_13820 gene rpsP 4251 3985 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419338.1 protein_id gnl|my_center|LOCUS_13820 5219 4293 gene locus_tag LOCUS_13830 gene menA 5219 4293 CDS product 2-carboxy-1,4-naphthoquinone phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141577.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence183 97 603 gene locus_tag LOCUS_13840 97 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 604 3669 gene locus_tag LOCUS_13850 604 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence184 2091 1171 gene locus_tag LOCUS_13860 2091 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 2819 2115 gene locus_tag LOCUS_13870 2819 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 4724 2922 gene locus_tag LOCUS_13880 4724 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence185 340 1149 gene locus_tag LOCUS_13890 gene thiD 340 1149 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256279.1 protein_id gnl|my_center|LOCUS_13890 2338 1388 gene locus_tag LOCUS_13900 2338 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876595.1 protein_id gnl|my_center|LOCUS_13900 2791 2447 gene locus_tag LOCUS_13910 2791 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 3398 2814 gene locus_tag LOCUS_13920 gene ruvA 3398 2814 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257302.1 protein_id gnl|my_center|LOCUS_13920 3932 3450 gene locus_tag LOCUS_13930 gene ruvC 3932 3450 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_13930 4687 3929 gene locus_tag LOCUS_13940 4687 3929 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583963.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence186 1585 461 gene locus_tag LOCUS_13950 1585 461 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_13950 2512 1970 gene locus_tag LOCUS_13960 2512 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 3702 2734 gene locus_tag LOCUS_13970 3702 2734 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256709.1 protein_id gnl|my_center|LOCUS_13970 4473 3721 gene locus_tag LOCUS_13980 4473 3721 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256708.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence187 1054 1275 gene locus_tag LOCUS_13990 1054 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1340 3004 gene locus_tag LOCUS_14000 1340 3004 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258196.1 protein_id gnl|my_center|LOCUS_14000 3010 3666 gene locus_tag LOCUS_14010 3010 3666 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249655.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence188 119 1159 gene locus_tag LOCUS_14020 gene argF 119 1159 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393492.1 protein_id gnl|my_center|LOCUS_14020 1217 2173 gene locus_tag LOCUS_14030 gene arcC 1217 2173 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393607.1 protein_id gnl|my_center|LOCUS_14030 2191 2964 gene locus_tag LOCUS_14040 2191 2964 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496701.1 protein_id gnl|my_center|LOCUS_14040 2977 3636 gene locus_tag LOCUS_14050 gene phoU 2977 3636 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_14050 4791 3643 gene locus_tag LOCUS_14060 4791 3643 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227919.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence189 <1 693 gene locus_tag LOCUS_14070 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140259.1:phosphotransacetylase family protein 1169 723 gene locus_tag LOCUS_14080 1169 723 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545624.1 protein_id gnl|my_center|LOCUS_14080 1269 2597 gene locus_tag LOCUS_14090 1269 2597 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986845.1 protein_id gnl|my_center|LOCUS_14090 4852 2540 gene locus_tag LOCUS_14100 4852 2540 CDS product transglutaminaseTgpA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259434.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence190 1196 2704 gene locus_tag LOCUS_14110 1196 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 2856 3605 gene locus_tag LOCUS_14120 2856 3605 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948648.1 protein_id gnl|my_center|LOCUS_14120 4429 3638 gene locus_tag LOCUS_14130 4429 3638 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258662.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence191 1607 666 gene locus_tag LOCUS_14140 gene secF 1607 666 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258878.1 protein_id gnl|my_center|LOCUS_14140 3228 1726 gene locus_tag LOCUS_14150 gene secD 3228 1726 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258879.1 protein_id gnl|my_center|LOCUS_14150 3471 4973 gene locus_tag LOCUS_14160 3471 4973 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence192 1594 194 gene locus_tag LOCUS_14170 1594 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1837 2154 gene locus_tag LOCUS_14180 1837 2154 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460053.1 protein_id gnl|my_center|LOCUS_14180 2166 3059 gene locus_tag LOCUS_14190 2166 3059 CDS product PTO1314 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980496.1 protein_id gnl|my_center|LOCUS_14190 3160 3402 gene locus_tag LOCUS_14200 3160 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 3850 3515 gene locus_tag LOCUS_14210 3850 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 4140 3847 gene locus_tag LOCUS_14220 4140 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 <5098 4155 gene locus_tag LOCUS_14230 <5098 4155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066275.1:PKD domain-containing protein >Feature sequence193 <1 1133 gene locus_tag LOCUS_14240 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061827.1:sugar ABC transporter substrate-binding protein 1509 2918 gene locus_tag LOCUS_14250 1509 2918 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486252.1 protein_id gnl|my_center|LOCUS_14250 3063 3944 gene locus_tag LOCUS_14260 3063 3944 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805139.1 protein_id gnl|my_center|LOCUS_14260 3944 4780 gene locus_tag LOCUS_14270 3944 4780 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225765.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence194 62 472 gene locus_tag LOCUS_14280 62 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 469 879 gene locus_tag LOCUS_14290 469 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 936 1619 gene locus_tag LOCUS_14300 936 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1683 1964 gene locus_tag LOCUS_14310 1683 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1981 2487 gene locus_tag LOCUS_14320 1981 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 2556 2987 gene locus_tag LOCUS_14330 2556 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 2990 3421 gene locus_tag LOCUS_14340 2990 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 3418 4086 gene locus_tag LOCUS_14350 3418 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 4095 4289 gene locus_tag LOCUS_14360 4095 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence195 324 461 gene locus_tag LOCUS_14370 324 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 550 813 gene locus_tag LOCUS_14380 550 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 833 2026 gene locus_tag LOCUS_14390 833 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 3314 3523 gene locus_tag LOCUS_14400 3314 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 3620 3817 gene locus_tag LOCUS_14410 3620 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 3822 4106 gene locus_tag LOCUS_14420 3822 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 4204 4758 gene locus_tag LOCUS_14430 4204 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence196 703 2 gene locus_tag LOCUS_14440 703 2 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583618.1 protein_id gnl|my_center|LOCUS_14440 2470 788 gene locus_tag LOCUS_14450 2470 788 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence197 987 847 gene locus_tag LOCUS_14460 987 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1285 977 gene locus_tag LOCUS_14470 1285 977 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879182.1 protein_id gnl|my_center|LOCUS_14470 1708 3357 gene locus_tag LOCUS_14480 1708 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 3798 3364 gene locus_tag LOCUS_14490 3798 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 4520 3801 gene locus_tag LOCUS_14500 4520 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 >Feature sequence198 103 1200 gene locus_tag LOCUS_14510 103 1200 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258875.1 protein_id gnl|my_center|LOCUS_14510 1166 1957 gene locus_tag LOCUS_14520 1166 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 2028 3233 gene locus_tag LOCUS_14530 2028 3233 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583286.1 protein_id gnl|my_center|LOCUS_14530 3300 4562 gene locus_tag LOCUS_14540 gene ahcY 3300 4562 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_14540 4607 4783 gene locus_tag LOCUS_14550 4607 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence199 <1 957 gene locus_tag LOCUS_14560 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083774549.1:restriction endonuclease subunit S 941 4090 gene locus_tag LOCUS_14570 941 4090 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087773.1 protein_id gnl|my_center|LOCUS_14570 4095 4265 gene locus_tag LOCUS_14580 4095 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 4268 4765 gene locus_tag LOCUS_14590 4268 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence200 1600 269 gene locus_tag LOCUS_14600 1600 269 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480153.1 protein_id gnl|my_center|LOCUS_14600 3254 1728 gene locus_tag LOCUS_14610 3254 1728 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539284.1 protein_id gnl|my_center|LOCUS_14610 4861 3266 gene locus_tag LOCUS_14620 4861 3266 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205720.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence201 960 2867 gene locus_tag LOCUS_14630 960 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 4765 2864 gene locus_tag LOCUS_14640 4765 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence202 823 1317 gene locus_tag LOCUS_14650 823 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 2734 1394 gene locus_tag LOCUS_14660 2734 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 3728 2751 gene locus_tag LOCUS_14670 3728 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 <4988 3902 gene locus_tag LOCUS_14680 <4988 3902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108596.1:Na+:solute symporter >Feature sequence203 928 269 gene locus_tag LOCUS_14690 928 269 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060848.1 protein_id gnl|my_center|LOCUS_14690 2133 1030 gene locus_tag LOCUS_14700 gene fbp 2133 1030 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393749.1 protein_id gnl|my_center|LOCUS_14700 3122 2130 gene locus_tag LOCUS_14710 3122 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 4471 3134 gene locus_tag LOCUS_14720 4471 3134 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582601.1 protein_id gnl|my_center|LOCUS_14720 4623 4474 gene locus_tag LOCUS_14730 4623 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 4688 4614 gene locus_tag LOCUS_t00200 4688 4614 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence204 95 2533 gene locus_tag LOCUS_14740 gene gyrA 95 2533 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_14740 2589 2900 gene locus_tag LOCUS_14750 2589 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 2824 3399 gene locus_tag LOCUS_14760 2824 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 3407 4777 gene locus_tag LOCUS_14770 3407 4777 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909443.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence205 38 256 gene locus_tag LOCUS_14780 38 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 259 633 gene locus_tag LOCUS_14790 259 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 626 826 gene locus_tag LOCUS_14800 626 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 828 1142 gene locus_tag LOCUS_14810 828 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1160 1423 gene locus_tag LOCUS_14820 1160 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1416 1613 gene locus_tag LOCUS_14830 1416 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1610 1903 gene locus_tag LOCUS_14840 1610 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 1900 2199 gene locus_tag LOCUS_14850 1900 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 2174 2356 gene locus_tag LOCUS_14860 2174 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 2441 2797 gene locus_tag LOCUS_14870 2441 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 2781 2984 gene locus_tag LOCUS_14880 2781 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 4267 3245 gene locus_tag LOCUS_14890 4267 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 <4914 4270 gene locus_tag LOCUS_14900 <4914 4270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763395.1:replication factor C small subunit >Feature sequence206 2395 1877 gene locus_tag LOCUS_14910 2395 1877 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258555.1 protein_id gnl|my_center|LOCUS_14910 2563 2490 gene locus_tag LOCUS_t00210 2563 2490 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3307 3834 gene locus_tag LOCUS_14920 gene cobO 3307 3834 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942222.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence207 4184 3555 gene locus_tag LOCUS_14930 4184 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 4538 4239 gene locus_tag LOCUS_14940 4538 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence208 >Feature sequence209 791 90 gene locus_tag LOCUS_14950 791 90 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257033.1 protein_id gnl|my_center|LOCUS_14950 1187 2455 gene locus_tag LOCUS_14960 gene mtaB 1187 2455 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392125.1 protein_id gnl|my_center|LOCUS_14960 3899 2631 gene locus_tag LOCUS_14970 gene hisS 3899 2631 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422928.1 protein_id gnl|my_center|LOCUS_14970 4611 3979 gene locus_tag LOCUS_14980 4611 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence210 264 776 gene locus_tag LOCUS_14990 264 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 776 2125 gene locus_tag LOCUS_15000 776 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 2151 3539 gene locus_tag LOCUS_15010 2151 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 3620 4591 gene locus_tag LOCUS_15020 3620 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 >Feature sequence211 <1 1878 gene locus_tag LOCUS_15030 <1 1878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942299.1:response regulator 1882 4632 gene locus_tag LOCUS_15040 1882 4632 CDS product interleukin-like EMT inducer domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141609734.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence212 <1 1874 gene locus_tag LOCUS_15050 <1 1874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000384831.1:class I SAM-dependent DNA methyltransferase 2045 2953 gene locus_tag LOCUS_15060 2045 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2956 3714 gene locus_tag LOCUS_15070 2956 3714 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_15070 3711 3881 gene locus_tag LOCUS_15080 3711 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence213 1121 2137 gene locus_tag LOCUS_15090 gene add 1121 2137 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704281.1 protein_id gnl|my_center|LOCUS_15090 2696 2130 gene locus_tag LOCUS_15100 2696 2130 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_15100 2865 3392 gene locus_tag LOCUS_15110 2865 3392 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258966.1 protein_id gnl|my_center|LOCUS_15110 3389 4795 gene locus_tag LOCUS_15120 3389 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence214 <1 3877 gene locus_tag LOCUS_15130 <1 3877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227759.1:DNA polymerase III subunit alpha >Feature sequence215 395 1567 gene locus_tag LOCUS_15140 395 1567 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258328.1 protein_id gnl|my_center|LOCUS_15140 1660 2595 gene locus_tag LOCUS_15150 1660 2595 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258329.1 protein_id gnl|my_center|LOCUS_15150 2672 3652 gene locus_tag LOCUS_15160 2672 3652 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258330.1 protein_id gnl|my_center|LOCUS_15160 3683 4228 gene locus_tag LOCUS_15170 3683 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 <4770 4209 gene locus_tag LOCUS_15180 <4770 4209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272585.1:PEP/pyruvate-binding domain-containing protein >Feature sequence216 434 2644 gene locus_tag LOCUS_15190 434 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 2655 2900 gene locus_tag LOCUS_15200 2655 2900 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909342.1 protein_id gnl|my_center|LOCUS_15200 2997 3971 gene locus_tag LOCUS_15210 2997 3971 CDS product acetyl-CoA decarbonylase/synthase complex subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944232.1 protein_id gnl|my_center|LOCUS_15210 4029 4322 gene locus_tag LOCUS_15220 4029 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 4371 4541 gene locus_tag LOCUS_15230 4371 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence217 955 4080 gene locus_tag LOCUS_15240 955 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 4564 4142 gene locus_tag LOCUS_15250 4564 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence218 4056 3883 gene locus_tag LOCUS_15260 4056 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 4722 4225 gene locus_tag LOCUS_15270 4722 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence219 1532 579 gene locus_tag LOCUS_15280 gene fabK 1532 579 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392462.1 protein_id gnl|my_center|LOCUS_15280 2319 1783 gene locus_tag LOCUS_15290 2319 1783 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583304.1 protein_id gnl|my_center|LOCUS_15290 3170 2664 gene locus_tag LOCUS_15300 3170 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 4014 3262 gene locus_tag LOCUS_15310 4014 3262 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545035.1 protein_id gnl|my_center|LOCUS_15310 <4718 4078 gene locus_tag LOCUS_15320 <4718 4078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868648.1:sulfite exporter TauE/SafE family protein >Feature sequence220 1145 480 gene locus_tag LOCUS_15330 gene tsaB 1145 480 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257859.1 protein_id gnl|my_center|LOCUS_15330 1663 1157 gene locus_tag LOCUS_15340 gene tsaE 1663 1157 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257860.1 protein_id gnl|my_center|LOCUS_15340 2845 1922 gene locus_tag LOCUS_15350 2845 1922 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_15350 4069 2855 gene locus_tag LOCUS_15360 4069 2855 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence221 1671 1075 gene locus_tag LOCUS_15370 1671 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 2732 1809 gene locus_tag LOCUS_15380 2732 1809 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_15380 4323 2845 gene locus_tag LOCUS_15390 4323 2845 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence222 194 577 gene locus_tag LOCUS_15400 194 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 935 657 gene locus_tag LOCUS_15410 935 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1478 1014 gene locus_tag LOCUS_15420 gene lspA 1478 1014 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_15420 1847 1479 gene locus_tag LOCUS_15430 1847 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 <4697 1929 gene locus_tag LOCUS_15440 <4697 1929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228416.1:isoleucine--tRNA ligase >Feature sequence223 <1 1067 gene locus_tag LOCUS_15450 <1 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880356.1:RNA polymerase factor sigma-54 1083 4517 gene locus_tag LOCUS_15460 1083 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence224 1552 152 gene locus_tag LOCUS_15470 1552 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 2526 1549 gene locus_tag LOCUS_15480 2526 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3155 2529 gene locus_tag LOCUS_15490 3155 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 3755 3159 gene locus_tag LOCUS_15500 3755 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence225 859 383 gene locus_tag LOCUS_15510 859 383 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_15510 1446 856 gene locus_tag LOCUS_15520 gene thpR 1446 856 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392592.1 protein_id gnl|my_center|LOCUS_15520 2721 1513 gene locus_tag LOCUS_15530 2721 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 4262 2727 gene locus_tag LOCUS_15540 4262 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence226 2 1129 gene locus_tag LOCUS_15550 2 1129 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875981.1 protein_id gnl|my_center|LOCUS_15550 1157 2776 gene locus_tag LOCUS_15560 1157 2776 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144207.1 protein_id gnl|my_center|LOCUS_15560 2868 4346 gene locus_tag LOCUS_15570 2868 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence227 1703 3157 gene locus_tag LOCUS_15580 1703 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 3395 4009 gene locus_tag LOCUS_15590 gene thyX 3395 4009 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546288.1 protein_id gnl|my_center|LOCUS_15590 <4584 4022 gene locus_tag LOCUS_15600 <4584 4022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256118.1:radical SAM family heme chaperone HemW >Feature sequence228 >Feature sequence229 472 762 gene locus_tag LOCUS_15610 472 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 772 1053 gene locus_tag LOCUS_15620 772 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1150 1302 gene locus_tag LOCUS_15630 1150 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1324 1464 gene locus_tag LOCUS_15640 1324 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1588 1821 gene locus_tag LOCUS_15650 1588 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1945 2763 gene locus_tag LOCUS_15660 1945 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2788 3213 gene locus_tag LOCUS_15670 2788 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 3214 3552 gene locus_tag LOCUS_15680 3214 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 3577 3843 gene locus_tag LOCUS_15690 3577 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 3958 4116 gene locus_tag LOCUS_15700 3958 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 4120 4284 gene locus_tag LOCUS_15710 4120 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence230 230 355 gene locus_tag LOCUS_15720 230 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 336 740 gene locus_tag LOCUS_15730 336 740 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460706.1 protein_id gnl|my_center|LOCUS_15730 741 1190 gene locus_tag LOCUS_15740 741 1190 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868764.1 protein_id gnl|my_center|LOCUS_15740 1222 1836 gene locus_tag LOCUS_15750 gene prxU 1222 1836 CDS product selenocysteine-containing peroxiredoxin PrxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q9L3Q5 transl_except (pos:1381..1383,aa:Sec) note codon on position 54 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_15750 2815 1961 gene locus_tag LOCUS_15760 2815 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 4183 2972 gene locus_tag LOCUS_15770 4183 2972 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869039.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence231 204 1334 gene locus_tag LOCUS_15780 204 1334 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_15780 1340 2764 gene locus_tag LOCUS_15790 1340 2764 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_15790 2896 4083 gene locus_tag LOCUS_15800 2896 4083 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393148.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence232 1413 175 gene locus_tag LOCUS_15810 1413 175 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_15810 2522 1413 gene locus_tag LOCUS_15820 2522 1413 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257269.1 protein_id gnl|my_center|LOCUS_15820 3041 2547 gene locus_tag LOCUS_15830 3041 2547 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226078.1 protein_id gnl|my_center|LOCUS_15830 3934 3056 gene locus_tag LOCUS_15840 3934 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 4056 4346 gene locus_tag LOCUS_15850 4056 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence233 211 582 gene locus_tag LOCUS_15860 211 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 570 1436 gene locus_tag LOCUS_15870 570 1436 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436928.1 protein_id gnl|my_center|LOCUS_15870 1611 1988 gene locus_tag LOCUS_15880 1611 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 2193 2771 gene locus_tag LOCUS_15890 2193 2771 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_15890 2773 3090 gene locus_tag LOCUS_15900 gene porD 2773 3090 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082458.1 protein_id gnl|my_center|LOCUS_15900 3092 4288 gene locus_tag LOCUS_15910 3092 4288 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545720.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence234 945 463 gene locus_tag LOCUS_15920 945 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140850.1 protein_id gnl|my_center|LOCUS_15920 1474 956 gene locus_tag LOCUS_15930 gene coaD 1474 956 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393371.1 protein_id gnl|my_center|LOCUS_15930 3975 1519 gene locus_tag LOCUS_15940 gene recG 3975 1519 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence235 1454 585 gene locus_tag LOCUS_15950 1454 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1981 1451 gene locus_tag LOCUS_15960 1981 1451 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259071.1 protein_id gnl|my_center|LOCUS_15960 <4523 2030 gene locus_tag LOCUS_15970 <4523 2030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942467.1:DNA mismatch repair protein MutS >Feature sequence236 <1 1388 gene locus_tag LOCUS_15980 <1 1388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256298.1:NEW3 domain-containing protein >Feature sequence237 695 153 gene locus_tag LOCUS_15990 695 153 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943011.1 protein_id gnl|my_center|LOCUS_15990 1115 696 gene locus_tag LOCUS_16000 1115 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1563 1117 gene locus_tag LOCUS_16010 1563 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 2176 1577 gene locus_tag LOCUS_16020 2176 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2740 2420 gene locus_tag LOCUS_16030 2740 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 3101 2889 gene locus_tag LOCUS_16040 3101 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 3358 3104 gene locus_tag LOCUS_16050 3358 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 3720 3355 gene locus_tag LOCUS_16060 3720 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 4513 3863 gene locus_tag LOCUS_16070 4513 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence238 537 1253 gene locus_tag LOCUS_16080 537 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1327 2460 gene locus_tag LOCUS_16090 1327 2460 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990002.1 protein_id gnl|my_center|LOCUS_16090 2959 2498 gene locus_tag LOCUS_16100 2959 2498 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_16100 3862 3005 gene locus_tag LOCUS_16110 3862 3005 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393454.1 protein_id gnl|my_center|LOCUS_16110 4471 3896 gene locus_tag LOCUS_16120 4471 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence239 569 1894 gene locus_tag LOCUS_16130 569 1894 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257589.1 protein_id gnl|my_center|LOCUS_16130 1905 3101 gene locus_tag LOCUS_16140 1905 3101 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986828.1 protein_id gnl|my_center|LOCUS_16140 3267 4082 gene locus_tag LOCUS_16150 gene murI 3267 4082 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964198.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence240 141 1088 gene locus_tag LOCUS_16160 141 1088 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258205.1 protein_id gnl|my_center|LOCUS_16160 2227 1085 gene locus_tag LOCUS_16170 gene rpoD 2227 1085 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_16170 4239 2254 gene locus_tag LOCUS_16180 gene dnaG 4239 2254 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258766.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence241 2150 1650 gene locus_tag LOCUS_16190 2150 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 2526 2164 gene locus_tag LOCUS_16200 2526 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence242 1264 143 gene locus_tag LOCUS_16210 1264 143 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938015.1 protein_id gnl|my_center|LOCUS_16210 2195 1281 gene locus_tag LOCUS_16220 2195 1281 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938014.1 protein_id gnl|my_center|LOCUS_16220 3564 2416 gene locus_tag LOCUS_16230 3564 2416 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938013.1 protein_id gnl|my_center|LOCUS_16230 <4432 3760 gene locus_tag LOCUS_16240 <4432 3760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545618.1:thiamine pyrophosphate-dependent enzyme >Feature sequence243 <1 805 gene locus_tag LOCUS_16250 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082403.1:glycosidase 1923 787 gene locus_tag LOCUS_16260 gene waaF 1923 787 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_16260 3011 1920 gene locus_tag LOCUS_16270 3011 1920 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_16270 3515 3060 gene locus_tag LOCUS_16280 gene rpiB 3515 3060 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966164.1 protein_id gnl|my_center|LOCUS_16280 3965 3681 gene locus_tag LOCUS_16290 gene rpsT 3965 3681 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930762.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence244 129 1064 gene locus_tag LOCUS_16300 129 1064 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258828.1 protein_id gnl|my_center|LOCUS_16300 1069 2316 gene locus_tag LOCUS_16310 1069 2316 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257931.1 protein_id gnl|my_center|LOCUS_16310 2330 3736 gene locus_tag LOCUS_16320 2330 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 4417 3707 gene locus_tag LOCUS_16330 4417 3707 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938559.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence245 <1 966 gene locus_tag LOCUS_16340 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393104.1:tetratricopeptide repeat protein 1007 1306 gene locus_tag LOCUS_16350 1007 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249266.1 protein_id gnl|my_center|LOCUS_16350 1577 3628 gene locus_tag LOCUS_16360 gene ligA 1577 3628 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_16360 4234 3629 gene locus_tag LOCUS_16370 gene udg 4234 3629 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147255.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence246 263 517 gene locus_tag LOCUS_16380 263 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1109 732 gene locus_tag LOCUS_16390 1109 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1365 1102 gene locus_tag LOCUS_16400 1365 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1490 2599 gene locus_tag LOCUS_16410 1490 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 2856 3869 gene locus_tag LOCUS_16420 2856 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence247 <1 3519 gene locus_tag LOCUS_16430 <1 3519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838180.1:hybrid sensor histidine kinase/response regulator 3532 4107 gene locus_tag LOCUS_16440 3532 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence248 94 171 gene locus_tag LOCUS_t00220 94 171 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 996 1133 gene locus_tag LOCUS_16450 996 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 1266 1463 gene locus_tag LOCUS_16460 1266 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1623 1880 gene locus_tag LOCUS_16470 1623 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1981 2154 gene locus_tag LOCUS_16480 1981 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 4015 2270 gene locus_tag LOCUS_16490 4015 2270 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251214.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence249 1151 1654 gene locus_tag LOCUS_16500 1151 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 1655 3226 gene locus_tag LOCUS_16510 1655 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence250 1566 229 gene locus_tag LOCUS_16520 1566 229 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_16520 2602 1604 gene locus_tag LOCUS_16530 2602 1604 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256508.1 protein_id gnl|my_center|LOCUS_16530 <4345 2637 gene locus_tag LOCUS_16540 <4345 2637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927098.1:tetratricopeptide repeat protein >Feature sequence251 229 996 gene locus_tag LOCUS_16550 229 996 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 protein_id gnl|my_center|LOCUS_16550 980 1969 gene locus_tag LOCUS_16560 980 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1998 2933 gene locus_tag LOCUS_16570 gene mvk 1998 2933 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256769.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence252 879 1826 gene locus_tag LOCUS_16580 879 1826 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_16580 1854 3161 gene locus_tag LOCUS_16590 1854 3161 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence253 325 1494 gene locus_tag LOCUS_16600 325 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence254 302 1735 gene locus_tag LOCUS_16610 302 1735 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_16610 1732 2556 gene locus_tag LOCUS_16620 1732 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 2687 3403 gene locus_tag LOCUS_16630 2687 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 3416 4093 gene locus_tag LOCUS_16640 3416 4093 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence255 782 150 gene locus_tag LOCUS_16650 782 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2851 812 gene locus_tag LOCUS_16660 2851 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 3612 2848 gene locus_tag LOCUS_16670 3612 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence256 1435 1770 gene locus_tag LOCUS_16680 1435 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 1770 2561 gene locus_tag LOCUS_16690 1770 2561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_16690 2596 4023 gene locus_tag LOCUS_16700 2596 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence257 827 102 gene locus_tag LOCUS_16710 827 102 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532981.1 protein_id gnl|my_center|LOCUS_16710 1846 827 gene locus_tag LOCUS_16720 1846 827 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080270.1 protein_id gnl|my_center|LOCUS_16720 3036 1843 gene locus_tag LOCUS_16730 3036 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 <4277 3167 gene locus_tag LOCUS_16740 <4277 3167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064221.1:ABC transporter substrate-binding protein >Feature sequence258 <1 778 gene locus_tag LOCUS_16750 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096330.1:Clp protease ClpP 883 1221 gene locus_tag LOCUS_16760 883 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 1226 1582 gene locus_tag LOCUS_16770 1226 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 1601 3898 gene locus_tag LOCUS_16780 1601 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence259 124 987 gene locus_tag LOCUS_16790 124 987 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865273.1 protein_id gnl|my_center|LOCUS_16790 991 1953 gene locus_tag LOCUS_16800 991 1953 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_16800 1966 2949 gene locus_tag LOCUS_16810 1966 2949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080230.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence260 572 1072 gene locus_tag LOCUS_16820 572 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1084 3552 gene locus_tag LOCUS_16830 1084 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence261 741 1361 gene locus_tag LOCUS_16840 741 1361 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_16840 2154 1363 gene locus_tag LOCUS_16850 2154 1363 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868851.1 protein_id gnl|my_center|LOCUS_16850 2896 2096 gene locus_tag LOCUS_16860 2896 2096 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941055.1 protein_id gnl|my_center|LOCUS_16860 4042 2897 gene locus_tag LOCUS_16870 gene tgt 4042 2897 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence262 119 403 gene locus_tag LOCUS_16880 119 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1542 460 gene locus_tag LOCUS_16890 1542 460 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391568.1 protein_id gnl|my_center|LOCUS_16890 1706 2092 gene locus_tag LOCUS_16900 1706 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 2092 2343 gene locus_tag LOCUS_16910 2092 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 3777 2419 gene locus_tag LOCUS_16920 3777 2419 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_16920 4014 3793 gene locus_tag LOCUS_16930 4014 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence263 >Feature sequence264 1077 562 gene locus_tag LOCUS_16940 1077 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 1378 1061 gene locus_tag LOCUS_16950 1378 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1583 1464 gene locus_tag LOCUS_16960 1583 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 1642 2610 gene locus_tag LOCUS_16970 1642 2610 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037025.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence265 1467 1613 gene locus_tag LOCUS_16980 1467 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1610 1969 gene locus_tag LOCUS_16990 1610 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 2026 2811 gene locus_tag LOCUS_17000 2026 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 2863 3081 gene locus_tag LOCUS_17010 2863 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 3170 3511 gene locus_tag LOCUS_17020 3170 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 3501 3806 gene locus_tag LOCUS_17030 3501 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 3807 4187 gene locus_tag LOCUS_17040 3807 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence266 <1 695 gene locus_tag LOCUS_17050 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081242.1:carbohydrate ABC transporter permease 2639 720 gene locus_tag LOCUS_17060 gene selB 2639 720 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256152.1 protein_id gnl|my_center|LOCUS_17060 3820 2645 gene locus_tag LOCUS_17070 3820 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence267 599 54 gene locus_tag LOCUS_17080 599 54 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881093.1 protein_id gnl|my_center|LOCUS_17080 1169 948 gene locus_tag LOCUS_17090 1169 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402859.1 protein_id gnl|my_center|LOCUS_17090 2218 1373 gene locus_tag LOCUS_17100 2218 1373 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393766.1 protein_id gnl|my_center|LOCUS_17100 2891 2379 gene locus_tag LOCUS_17110 gene def 2891 2379 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392416.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence268 186 1628 gene locus_tag LOCUS_17120 186 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1637 3064 gene locus_tag LOCUS_17130 1637 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 3064 3564 gene locus_tag LOCUS_17140 3064 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence269 269 1183 gene locus_tag LOCUS_17150 269 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1188 2261 gene locus_tag LOCUS_17160 1188 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 2261 3400 gene locus_tag LOCUS_17170 2261 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence270 742 170 gene locus_tag LOCUS_17180 742 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 960 736 gene locus_tag LOCUS_17190 960 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 2091 1090 gene locus_tag LOCUS_17200 2091 1090 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_17200 2985 2113 gene locus_tag LOCUS_17210 2985 2113 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172393.1 protein_id gnl|my_center|LOCUS_17210 <4202 3052 gene locus_tag LOCUS_17220 <4202 3052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965775.1:ABC transporter substrate-binding protein >Feature sequence271 1277 1143 gene locus_tag LOCUS_17230 1277 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 3777 1882 gene locus_tag LOCUS_17240 3777 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence272 <1 1695 gene locus_tag LOCUS_17250 <1 1695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227894.1:aldehyde ferredoxin oxidoreductase family protein 2290 1703 gene locus_tag LOCUS_17260 2290 1703 CDS product HAS-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256340.1 protein_id gnl|my_center|LOCUS_17260 4159 2387 gene locus_tag LOCUS_17270 4159 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence273 >Feature sequence274 <1 567 gene locus_tag LOCUS_17280 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048369.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase 579 1796 gene locus_tag LOCUS_17290 gene ftsW 579 1796 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256650.1 protein_id gnl|my_center|LOCUS_17290 1717 2805 gene locus_tag LOCUS_17300 1717 2805 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256649.1 protein_id gnl|my_center|LOCUS_17300 2802 3377 gene locus_tag LOCUS_17310 2802 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence275 565 1512 gene locus_tag LOCUS_17320 565 1512 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_17320 1527 3281 gene locus_tag LOCUS_17330 1527 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 3345 4163 gene locus_tag LOCUS_17340 3345 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence276 606 890 gene locus_tag LOCUS_17350 606 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 887 1573 gene locus_tag LOCUS_17360 887 1573 CDS product ERCC4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879905.1 protein_id gnl|my_center|LOCUS_17360 1542 1817 gene locus_tag LOCUS_17370 1542 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1814 2659 gene locus_tag LOCUS_17380 1814 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 3020 3382 gene locus_tag LOCUS_17390 3020 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 3485 3748 gene locus_tag LOCUS_17400 3485 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 3745 4128 gene locus_tag LOCUS_17410 3745 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence277 <1 1681 gene locus_tag LOCUS_17420 <1 1681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943687.1:radical SAM protein 1725 2900 gene locus_tag LOCUS_17430 1725 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 2901 3530 gene locus_tag LOCUS_17440 2901 3530 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence278 <1 1159 gene locus_tag LOCUS_17450 <1 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012660626.1:endonuclease MutS2 1343 3337 gene locus_tag LOCUS_17460 1343 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 3503 4057 gene locus_tag LOCUS_17470 3503 4057 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249257.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence279 349 570 gene locus_tag LOCUS_17480 349 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 567 896 gene locus_tag LOCUS_17490 567 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 896 1663 gene locus_tag LOCUS_17500 gene atpB 896 1663 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768272.1 protein_id gnl|my_center|LOCUS_17500 1698 1934 gene locus_tag LOCUS_17510 gene atpE 1698 1934 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258898.1 protein_id gnl|my_center|LOCUS_17510 2217 2711 gene locus_tag LOCUS_17520 2217 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 2837 3373 gene locus_tag LOCUS_17530 2837 3373 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_17530 3642 3767 gene locus_tag LOCUS_17540 3642 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence280 49 765 gene locus_tag LOCUS_17550 49 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 1002 823 gene locus_tag LOCUS_17560 gene rpmB 1002 823 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256168.1 protein_id gnl|my_center|LOCUS_17560 1347 1697 gene locus_tag LOCUS_17570 1347 1697 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583499.1 protein_id gnl|my_center|LOCUS_17570 1835 3481 gene locus_tag LOCUS_17580 1835 3481 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence281 475 41 gene locus_tag LOCUS_17590 475 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 746 450 gene locus_tag LOCUS_17600 746 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 972 3011 gene locus_tag LOCUS_17610 972 3011 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027129.1 protein_id gnl|my_center|LOCUS_17610 3008 3883 gene locus_tag LOCUS_17620 3008 3883 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence282 276 3902 gene locus_tag LOCUS_17630 276 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence283 295 3564 gene locus_tag LOCUS_17640 295 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence284 2614 551 gene locus_tag LOCUS_17650 2614 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 3367 2690 gene locus_tag LOCUS_17660 3367 2690 CDS product DUF2085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871015.1 protein_id gnl|my_center|LOCUS_17660 <4083 3579 gene locus_tag LOCUS_17670 <4083 3579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966352.1:glycosyltransferase family 4 protein >Feature sequence285 4077 178 gene locus_tag LOCUS_17680 4077 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 >Feature sequence286 1636 212 gene locus_tag LOCUS_17690 gene gcvPB 1636 212 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230209.1 protein_id gnl|my_center|LOCUS_17690 1784 2878 gene locus_tag LOCUS_17700 1784 2878 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135177497.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence287 <1 742 gene locus_tag LOCUS_17710 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393156.1:Mrp/NBP35 family ATP-binding protein 745 1146 gene locus_tag LOCUS_17720 745 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1184 1381 gene locus_tag LOCUS_17730 1184 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 1431 1754 gene locus_tag LOCUS_17740 1431 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 1892 2485 gene locus_tag LOCUS_17750 1892 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 2567 3001 gene locus_tag LOCUS_17760 2567 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 3265 3711 gene locus_tag LOCUS_17770 3265 3711 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310199.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence288 293 613 gene locus_tag LOCUS_17780 293 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 1480 644 gene locus_tag LOCUS_17790 1480 644 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877742.1 protein_id gnl|my_center|LOCUS_17790 2588 1443 gene locus_tag LOCUS_17800 2588 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258216.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence289 55 2271 gene locus_tag LOCUS_17810 55 2271 CDS product putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257734.1 protein_id gnl|my_center|LOCUS_17810 3992 2340 gene locus_tag LOCUS_17820 gene aspS 3992 2340 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258183.1 protein_id gnl|my_center|LOCUS_17820 >Feature sequence290 402 935 gene locus_tag LOCUS_17830 402 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 923 3451 gene locus_tag LOCUS_17840 923 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence291 324 1325 gene locus_tag LOCUS_17850 324 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 1291 2025 gene locus_tag LOCUS_17860 gene kdsB 1291 2025 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072444.1 protein_id gnl|my_center|LOCUS_17860 2026 2436 gene locus_tag LOCUS_17870 2026 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 2451 2678 gene locus_tag LOCUS_17880 2451 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2679 3134 gene locus_tag LOCUS_17890 2679 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 3146 3319 gene locus_tag LOCUS_17900 3146 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 3328 3900 gene locus_tag LOCUS_17910 3328 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence292 2610 658 gene locus_tag LOCUS_17920 2610 658 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_17920 3044 2610 gene locus_tag LOCUS_17930 3044 2610 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938350.1 protein_id gnl|my_center|LOCUS_17930 <4018 3135 gene locus_tag LOCUS_17940 <4018 3135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940703.1:Tol-Pal system beta propeller repeat protein TolB >Feature sequence293 205 32 gene locus_tag LOCUS_17950 205 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 341 463 gene locus_tag LOCUS_17960 341 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 453 1268 gene locus_tag LOCUS_17970 453 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1281 2465 gene locus_tag LOCUS_17980 1281 2465 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927646.1 protein_id gnl|my_center|LOCUS_17980 2467 3543 gene locus_tag LOCUS_17990 gene nirJ2 2467 3543 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392759.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence294 127 3477 gene locus_tag LOCUS_18000 127 3477 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015902.1 protein_id gnl|my_center|LOCUS_18000 3719 3925 gene locus_tag LOCUS_18010 3719 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence295 381 1622 gene locus_tag LOCUS_18020 381 1622 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083215.1 protein_id gnl|my_center|LOCUS_18020 2437 1670 gene locus_tag LOCUS_18030 2437 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811766.1 protein_id gnl|my_center|LOCUS_18030 3664 2519 gene locus_tag LOCUS_18040 3664 2519 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence296 470 2236 gene locus_tag LOCUS_18050 470 2236 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257185.1 protein_id gnl|my_center|LOCUS_18050 2338 3186 gene locus_tag LOCUS_18060 2338 3186 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence297 1971 160 gene locus_tag LOCUS_18070 1971 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 2600 3217 gene locus_tag LOCUS_18080 2600 3217 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064860.1 protein_id gnl|my_center|LOCUS_18080 3214 3411 gene locus_tag LOCUS_18090 3214 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 3401 3658 gene locus_tag LOCUS_18100 3401 3658 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080272.1 protein_id gnl|my_center|LOCUS_18100 3675 3938 gene locus_tag LOCUS_18110 3675 3938 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence298 2137 1463 gene locus_tag LOCUS_18120 2137 1463 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_18120 2910 2263 gene locus_tag LOCUS_18130 2910 2263 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_18130 3620 2928 gene locus_tag LOCUS_18140 gene cmk 3620 2928 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256860.1 protein_id gnl|my_center|LOCUS_18140 3951 3676 gene locus_tag LOCUS_18150 3951 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence299 1601 1053 gene locus_tag LOCUS_18160 1601 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 2299 1595 gene locus_tag LOCUS_18170 2299 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 3254 2277 gene locus_tag LOCUS_18180 3254 2277 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582952.1 protein_id gnl|my_center|LOCUS_18180 3811 3605 gene locus_tag LOCUS_18190 3811 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence300 1015 1368 gene locus_tag LOCUS_18200 1015 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1365 2246 gene locus_tag LOCUS_18210 1365 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence301 3488 948 gene locus_tag LOCUS_18220 3488 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence302 2688 2987 gene locus_tag LOCUS_18230 2688 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 3283 3570 gene locus_tag LOCUS_18240 3283 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence303 572 171 gene locus_tag LOCUS_18250 572 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 780 1667 gene locus_tag LOCUS_18260 gene pdxS 780 1667 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391558.1 protein_id gnl|my_center|LOCUS_18260 1669 2271 gene locus_tag LOCUS_18270 gene pdxT 1669 2271 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391559.1 protein_id gnl|my_center|LOCUS_18270 2291 3313 gene locus_tag LOCUS_18280 2291 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence304 >Feature sequence305 1047 160 gene locus_tag LOCUS_18290 1047 160 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_18290 2283 1213 gene locus_tag LOCUS_18300 2283 1213 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763625.1 protein_id gnl|my_center|LOCUS_18300 3499 2552 gene locus_tag LOCUS_18310 3499 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 >Feature sequence306 337 206 gene locus_tag LOCUS_18320 337 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 2272 347 gene locus_tag LOCUS_18330 2272 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 3798 2344 gene locus_tag LOCUS_18340 3798 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence307 2158 1655 gene locus_tag LOCUS_18350 2158 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 2409 2173 gene locus_tag LOCUS_18360 2409 2173 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582917.1 protein_id gnl|my_center|LOCUS_18360 2691 2455 gene locus_tag LOCUS_18370 2691 2455 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023401.1 protein_id gnl|my_center|LOCUS_18370 3744 2782 gene locus_tag LOCUS_18380 3744 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence308 7 795 gene locus_tag LOCUS_18390 7 795 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583689.1 protein_id gnl|my_center|LOCUS_18390 792 1472 gene locus_tag LOCUS_18400 792 1472 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258849.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence309 2785 167 gene locus_tag LOCUS_18410 2785 167 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906004.1 protein_id gnl|my_center|LOCUS_18410 <3859 2848 gene locus_tag LOCUS_18420 <3859 2848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860128.1:lectin like domain-containing protein >Feature sequence310 23 1312 gene locus_tag LOCUS_18430 23 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 1461 3794 gene locus_tag LOCUS_18440 1461 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 >Feature sequence311 758 1564 gene locus_tag LOCUS_18450 758 1564 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_18450 <3836 1666 gene locus_tag LOCUS_18460 <3836 1666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080066.1:ABC transporter substrate-binding protein >Feature sequence312 1198 845 gene locus_tag LOCUS_18470 1198 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1800 1195 gene locus_tag LOCUS_18480 1800 1195 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392954.1 protein_id gnl|my_center|LOCUS_18480 2198 1800 gene locus_tag LOCUS_18490 2198 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 3034 2201 gene locus_tag LOCUS_18500 3034 2201 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007204.1 protein_id gnl|my_center|LOCUS_18500 <3830 3118 gene locus_tag LOCUS_18510 <3830 3118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081428946.1:ABC transporter ATP-binding protein >Feature sequence313 <3811 254 gene locus_tag LOCUS_18520 <3811 254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030220.1:polarized growth protein Scy >Feature sequence314 317 39 gene locus_tag LOCUS_18530 317 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 3431 417 gene locus_tag LOCUS_18540 3431 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence315 <1 629 gene locus_tag LOCUS_18550 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763251.1:ABC transporter ATP-binding protein 773 1477 gene locus_tag LOCUS_18560 773 1477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_18560 1491 2540 gene locus_tag LOCUS_18570 1491 2540 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965993.1 protein_id gnl|my_center|LOCUS_18570 2563 3615 gene locus_tag LOCUS_18580 2563 3615 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727510.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence316 403 188 gene locus_tag LOCUS_18590 403 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1490 375 gene locus_tag LOCUS_18600 1490 375 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007784895.1 protein_id gnl|my_center|LOCUS_18600 2351 1491 gene locus_tag LOCUS_18610 2351 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 3673 2378 gene locus_tag LOCUS_18620 3673 2378 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence317 49 1089 gene locus_tag LOCUS_18630 gene pheS 49 1089 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_18630 1229 3661 gene locus_tag LOCUS_18640 gene pheT 1229 3661 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256770.1 protein_id gnl|my_center|LOCUS_18640 >Feature sequence318 >Feature sequence319 1956 3554 gene locus_tag LOCUS_18650 1956 3554 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence320 <1 1470 gene locus_tag LOCUS_18660 <1 1470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939434.1:phage tail tape measure C-terminal domain-containing protein 1470 1871 gene locus_tag LOCUS_18670 1470 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence321 22 735 gene locus_tag LOCUS_18680 22 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 842 1198 gene locus_tag LOCUS_18690 gene ndhC 842 1198 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_18690 1303 1815 gene locus_tag LOCUS_18700 1303 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 1912 2418 gene locus_tag LOCUS_18710 1912 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 2673 3782 gene locus_tag LOCUS_18720 2673 3782 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257853.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence322 1054 398 gene locus_tag LOCUS_18730 1054 398 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257077.1 protein_id gnl|my_center|LOCUS_18730 1838 1314 gene locus_tag LOCUS_18740 1838 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2431 1946 gene locus_tag LOCUS_18750 2431 1946 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583265.1 protein_id gnl|my_center|LOCUS_18750 <3781 2570 gene locus_tag LOCUS_18760 <3781 2570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144388.1:DUF87 domain-containing protein >Feature sequence323 1114 245 gene locus_tag LOCUS_18770 1114 245 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015918758.1 protein_id gnl|my_center|LOCUS_18770 2054 1116 gene locus_tag LOCUS_18780 2054 1116 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083273.1 protein_id gnl|my_center|LOCUS_18780 3615 2152 gene locus_tag LOCUS_18790 3615 2152 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083271.1 protein_id gnl|my_center|LOCUS_18790 >Feature sequence324 493 1116 gene locus_tag LOCUS_18800 493 1116 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_18800 1138 2010 gene locus_tag LOCUS_18810 1138 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 2186 3571 gene locus_tag LOCUS_18820 2186 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 >Feature sequence325 129 695 gene locus_tag LOCUS_18830 129 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 720 905 gene locus_tag LOCUS_18840 720 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 912 1283 gene locus_tag LOCUS_18850 912 1283 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_18850 1280 2239 gene locus_tag LOCUS_18860 gene miaA 1280 2239 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256258.1 protein_id gnl|my_center|LOCUS_18860 2969 2214 gene locus_tag LOCUS_18870 2969 2214 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244958.1 protein_id gnl|my_center|LOCUS_18870 3484 2981 gene locus_tag LOCUS_18880 gene cas4 3484 2981 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259413.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence326 418 801 gene locus_tag LOCUS_18890 418 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 1539 805 gene locus_tag LOCUS_18900 1539 805 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_18900 2514 1825 gene locus_tag LOCUS_18910 2514 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 3549 2536 gene locus_tag LOCUS_18920 gene amrS 3549 2536 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence327 54 139 gene locus_tag LOCUS_t00230 54 139 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 330 1655 gene locus_tag LOCUS_18930 gene tig 330 1655 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_18930 1655 2299 gene locus_tag LOCUS_18940 1655 2299 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257401.1 protein_id gnl|my_center|LOCUS_18940 2296 3594 gene locus_tag LOCUS_18950 gene clpX 2296 3594 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence328 17 829 gene locus_tag LOCUS_18960 17 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence329 17 1759 gene locus_tag LOCUS_18970 17 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 1762 2007 gene locus_tag LOCUS_18980 1762 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 2357 3523 gene locus_tag LOCUS_18990 2357 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence330 210 503 gene locus_tag LOCUS_19000 210 503 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878101.1 protein_id gnl|my_center|LOCUS_19000 500 982 gene locus_tag LOCUS_19010 500 982 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 protein_id gnl|my_center|LOCUS_19010 1699 1010 gene locus_tag LOCUS_19020 1699 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 2135 1734 gene locus_tag LOCUS_19030 2135 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 <3727 2197 gene locus_tag LOCUS_19040 <3727 2197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084126.1:tetratricopeptide repeat protein >Feature sequence331 1011 250 gene locus_tag LOCUS_19050 1011 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 1096 2256 gene locus_tag LOCUS_19060 gene thiI 1096 2256 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_19060 2323 3141 gene locus_tag LOCUS_19070 gene lgt 2323 3141 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257228.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence332 2220 379 gene locus_tag LOCUS_19080 2220 379 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870139.1 protein_id gnl|my_center|LOCUS_19080 3027 2245 gene locus_tag LOCUS_19090 3027 2245 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence333 <1 3067 gene locus_tag LOCUS_19100 <1 3067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392708.1:FAD-dependent oxidoreductase >Feature sequence334 697 158 gene locus_tag LOCUS_19110 697 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240220.1 protein_id gnl|my_center|LOCUS_19110 674 1405 gene locus_tag LOCUS_19120 674 1405 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877090.1 protein_id gnl|my_center|LOCUS_19120 1406 1759 gene locus_tag LOCUS_19130 1406 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 1789 2223 gene locus_tag LOCUS_19140 1789 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 2669 2220 gene locus_tag LOCUS_19150 2669 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 3242 2712 gene locus_tag LOCUS_19160 3242 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 3662 3324 gene locus_tag LOCUS_19170 3662 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 >Feature sequence335 1319 324 gene locus_tag LOCUS_19180 1319 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 2671 1331 gene locus_tag LOCUS_19190 2671 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 3448 2690 gene locus_tag LOCUS_19200 3448 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 >Feature sequence336 1213 140 gene locus_tag LOCUS_19210 1213 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 1362 1210 gene locus_tag LOCUS_19220 1362 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 3140 1395 gene locus_tag LOCUS_19230 3140 1395 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence337 67 894 gene locus_tag LOCUS_19240 67 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 913 1092 gene locus_tag LOCUS_19250 913 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 1109 1309 gene locus_tag LOCUS_19260 1109 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 1326 1943 gene locus_tag LOCUS_19270 1326 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 1958 3550 gene locus_tag LOCUS_19280 1958 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 >Feature sequence338 731 180 gene locus_tag LOCUS_19290 731 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2130 1087 gene locus_tag LOCUS_19300 2130 1087 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970910.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence339 704 309 gene locus_tag LOCUS_19310 704 309 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053649.1 protein_id gnl|my_center|LOCUS_19310 1000 701 gene locus_tag LOCUS_19320 1000 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 1224 1024 gene locus_tag LOCUS_19330 1224 1024 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140566.1 protein_id gnl|my_center|LOCUS_19330 1506 1228 gene locus_tag LOCUS_19340 1506 1228 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928542.1 protein_id gnl|my_center|LOCUS_19340 2639 1518 gene locus_tag LOCUS_19350 2639 1518 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869498.1 protein_id gnl|my_center|LOCUS_19350 3015 2686 gene locus_tag LOCUS_19360 3015 2686 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869934.1 protein_id gnl|my_center|LOCUS_19360 3247 2996 gene locus_tag LOCUS_19370 3247 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 3463 3251 gene locus_tag LOCUS_19380 3463 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence340 1851 1090 gene locus_tag LOCUS_19390 gene cobB2 1851 1090 CDS product NAD-dependent protein deacylase Cob2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877626.1 protein_id gnl|my_center|LOCUS_19390 2972 2280 gene locus_tag LOCUS_19400 gene nfi 2972 2280 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082416.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence341 3339 439 gene locus_tag LOCUS_19410 3339 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 >Feature sequence342 1404 2678 gene locus_tag LOCUS_19420 1404 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2714 3112 gene locus_tag LOCUS_19430 2714 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 >Feature sequence343 308 643 gene locus_tag LOCUS_19440 308 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978731.1 protein_id gnl|my_center|LOCUS_19440 890 1510 gene locus_tag LOCUS_19450 890 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2077 1406 gene locus_tag LOCUS_19460 2077 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 <3640 2126 gene locus_tag LOCUS_19470 <3640 2126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546166.1:aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein >Feature sequence344 1559 1329 gene locus_tag LOCUS_19480 1559 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2334 1561 gene locus_tag LOCUS_19490 gene recO 2334 1561 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909322.1 protein_id gnl|my_center|LOCUS_19490 2705 2334 gene locus_tag LOCUS_19500 2705 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 2956 2702 gene locus_tag LOCUS_19510 2956 2702 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_19510 3270 2962 gene locus_tag LOCUS_19520 3270 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 >Feature sequence345 38 1393 gene locus_tag LOCUS_19530 gene der 38 1393 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_19530 1450 2025 gene locus_tag LOCUS_19540 1450 2025 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877282.1 protein_id gnl|my_center|LOCUS_19540 2095 2652 gene locus_tag LOCUS_19550 2095 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 2748 3617 gene locus_tag LOCUS_19560 2748 3617 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684725.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence346 830 219 gene locus_tag LOCUS_19570 830 219 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257428.1 protein_id gnl|my_center|LOCUS_19570 959 1372 gene locus_tag LOCUS_19580 959 1372 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256377.1 protein_id gnl|my_center|LOCUS_19580 2094 1453 gene locus_tag LOCUS_19590 gene tmk 2094 1453 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258097.1 protein_id gnl|my_center|LOCUS_19590 2373 2143 gene locus_tag LOCUS_19600 2373 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 <3621 2433 gene locus_tag LOCUS_19610 <3621 2433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583152.1:AAA family ATPase >Feature sequence347 192 1790 gene locus_tag LOCUS_19620 192 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 3196 1787 gene locus_tag LOCUS_19630 3196 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 3586 3224 gene locus_tag LOCUS_19640 3586 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence348 1987 650 gene locus_tag LOCUS_19650 gene trmFO 1987 650 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244725.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence349 757 374 gene locus_tag LOCUS_19660 757 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 1483 821 gene locus_tag LOCUS_19670 1483 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence350 3 290 gene locus_tag LOCUS_19680 3 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 1113 307 gene locus_tag LOCUS_19690 1113 307 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920665.1 protein_id gnl|my_center|LOCUS_19690 2122 1151 gene locus_tag LOCUS_19700 2122 1151 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868678.1 protein_id gnl|my_center|LOCUS_19700 2312 3100 gene locus_tag LOCUS_19710 2312 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence351 205 546 gene locus_tag LOCUS_19720 205 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 578 790 gene locus_tag LOCUS_19730 578 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 806 1036 gene locus_tag LOCUS_19740 806 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 1033 1383 gene locus_tag LOCUS_19750 1033 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 1932 2306 gene locus_tag LOCUS_19760 1932 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 2312 2455 gene locus_tag LOCUS_19770 2312 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 2459 2632 gene locus_tag LOCUS_19780 2459 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2633 2821 gene locus_tag LOCUS_19790 2633 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2818 3039 gene locus_tag LOCUS_19800 2818 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 3042 3308 gene locus_tag LOCUS_19810 3042 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence352 <1 1204 gene locus_tag LOCUS_19820 <1 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259590.1:glycosyltransferase family 4 protein >Feature sequence353 434 204 gene locus_tag LOCUS_19830 434 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 1057 431 gene locus_tag LOCUS_19840 1057 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 1803 1054 gene locus_tag LOCUS_19850 1803 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 2039 1800 gene locus_tag LOCUS_19860 2039 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 2580 2056 gene locus_tag LOCUS_19870 2580 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2800 2591 gene locus_tag LOCUS_19880 2800 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 3314 2880 gene locus_tag LOCUS_19890 3314 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence354 680 2104 gene locus_tag LOCUS_19900 680 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2174 3199 gene locus_tag LOCUS_19910 gene tsaD 2174 3199 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256815.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence355 949 1083 gene locus_tag LOCUS_19920 949 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 >Feature sequence356 >Feature sequence357 268 672 gene locus_tag LOCUS_19930 268 672 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259070.1 protein_id gnl|my_center|LOCUS_19930 605 979 gene locus_tag LOCUS_19940 605 979 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228087.1 protein_id gnl|my_center|LOCUS_19940 1016 1282 gene locus_tag LOCUS_19950 1016 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 1260 1793 gene locus_tag LOCUS_19960 1260 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 1812 3539 gene locus_tag LOCUS_19970 1812 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 >Feature sequence358 1556 513 gene locus_tag LOCUS_19980 1556 513 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259505.1 protein_id gnl|my_center|LOCUS_19980 2014 1553 gene locus_tag LOCUS_19990 2014 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 3096 2089 gene locus_tag LOCUS_20000 3096 2089 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence359 237 761 gene locus_tag LOCUS_20010 237 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 1063 1422 gene locus_tag LOCUS_20020 1063 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 1419 1622 gene locus_tag LOCUS_20030 1419 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 1619 1789 gene locus_tag LOCUS_20040 1619 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 1786 2010 gene locus_tag LOCUS_20050 1786 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 2100 2270 gene locus_tag LOCUS_20060 2100 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 2479 2817 gene locus_tag LOCUS_20070 2479 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 >Feature sequence360 36 123 gene locus_tag LOCUS_t00240 36 123 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 235 3141 gene locus_tag LOCUS_20080 235 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 >Feature sequence361 82 1530 gene locus_tag LOCUS_20090 82 1530 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259158.1 protein_id gnl|my_center|LOCUS_20090 1527 3080 gene locus_tag LOCUS_20100 1527 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 >Feature sequence362 269 84 gene locus_tag LOCUS_20110 269 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 430 269 gene locus_tag LOCUS_20120 430 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 822 430 gene locus_tag LOCUS_20130 822 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 3225 832 gene locus_tag LOCUS_20140 3225 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 3469 3218 gene locus_tag LOCUS_20150 3469 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence363 69 479 gene locus_tag LOCUS_20160 69 479 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172491.1 protein_id gnl|my_center|LOCUS_20160 493 1659 gene locus_tag LOCUS_20170 493 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 1757 2620 gene locus_tag LOCUS_20180 1757 2620 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257722.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence364 677 105 gene locus_tag LOCUS_20190 677 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 990 730 gene locus_tag LOCUS_20200 990 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 2391 1015 gene locus_tag LOCUS_20210 2391 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 2547 2425 gene locus_tag LOCUS_20220 2547 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2739 2551 gene locus_tag LOCUS_20230 2739 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence365 941 1453 gene locus_tag LOCUS_20240 941 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879749.1 protein_id gnl|my_center|LOCUS_20240 1425 2099 gene locus_tag LOCUS_20250 gene nfi 1425 2099 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258210.1 protein_id gnl|my_center|LOCUS_20250 2781 2083 gene locus_tag LOCUS_20260 2781 2083 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979298.1 protein_id gnl|my_center|LOCUS_20260 <3494 2742 gene locus_tag LOCUS_20270 <3494 2742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249061.1:diphthine synthase >Feature sequence366 >Feature sequence367 2083 1025 gene locus_tag LOCUS_20280 2083 1025 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393048.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence368 1144 2136 gene locus_tag LOCUS_20290 1144 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence369 2105 3142 gene locus_tag LOCUS_20300 2105 3142 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257043.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence370 81 1220 gene locus_tag LOCUS_20310 gene nuoH 81 1220 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_20310 1264 1788 gene locus_tag LOCUS_20320 1264 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 1817 2305 gene locus_tag LOCUS_20330 1817 2305 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_20330 2309 2617 gene locus_tag LOCUS_20340 gene nuoK 2309 2617 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_20340 2625 2768 gene locus_tag LOCUS_20350 2625 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2777 3202 gene locus_tag LOCUS_20360 2777 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence371 >Feature sequence372 970 197 gene locus_tag LOCUS_20370 970 197 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 protein_id gnl|my_center|LOCUS_20370 1982 1023 gene locus_tag LOCUS_20380 1982 1023 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 protein_id gnl|my_center|LOCUS_20380 2680 1985 gene locus_tag LOCUS_20390 gene pxpB 2680 1985 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249288.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence373 1094 81 gene locus_tag LOCUS_20400 1094 81 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064459.1 protein_id gnl|my_center|LOCUS_20400 <3448 1269 gene locus_tag LOCUS_20410 <3448 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762356.1:ABC transporter substrate-binding protein >Feature sequence374 276 635 gene locus_tag LOCUS_20420 276 635 CDS product Lin0512 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949160.1 protein_id gnl|my_center|LOCUS_20420 749 1711 gene locus_tag LOCUS_20430 gene pdhA 749 1711 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_20430 1751 2728 gene locus_tag LOCUS_20440 1751 2728 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949162.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence375 >Feature sequence376 278 724 gene locus_tag LOCUS_20450 278 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 758 2065 gene locus_tag LOCUS_20460 758 2065 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257589.1 protein_id gnl|my_center|LOCUS_20460 2076 3086 gene locus_tag LOCUS_20470 2076 3086 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222782.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence377 2187 1093 gene locus_tag LOCUS_20480 gene rlmN 2187 1093 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626897.1 protein_id gnl|my_center|LOCUS_20480 3103 2411 gene locus_tag LOCUS_20490 3103 2411 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence378 327 542 gene locus_tag LOCUS_20500 327 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 599 1222 gene locus_tag LOCUS_20510 599 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 <3399 1213 gene locus_tag LOCUS_20520 <3399 1213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927835.1:FtsX-like permease family protein >Feature sequence379 2555 1497 gene locus_tag LOCUS_20530 2555 1497 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228588.1 protein_id gnl|my_center|LOCUS_20530 3077 2637 gene locus_tag LOCUS_20540 3077 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence380 358 1518 gene locus_tag LOCUS_20550 358 1518 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_20550 3151 1541 gene locus_tag LOCUS_20560 3151 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence381 366 163 gene locus_tag LOCUS_20570 366 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 1552 509 gene locus_tag LOCUS_20580 1552 509 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256572.1 protein_id gnl|my_center|LOCUS_20580 3250 1715 gene locus_tag LOCUS_20590 3250 1715 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393174.1 protein_id gnl|my_center|LOCUS_20590 >Feature sequence382 2822 372 gene locus_tag LOCUS_20600 2822 372 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020807.1 protein_id gnl|my_center|LOCUS_20600 >Feature sequence383 689 931 gene locus_tag LOCUS_20610 689 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 942 2975 gene locus_tag LOCUS_20620 gene feoB 942 2975 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583918.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence384 1830 583 gene locus_tag LOCUS_20630 1830 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 2007 1840 gene locus_tag LOCUS_20640 2007 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2673 2011 gene locus_tag LOCUS_20650 2673 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence385 52 480 gene locus_tag LOCUS_20660 52 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 480 1334 gene locus_tag LOCUS_20670 480 1334 CDS product nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240366.1 protein_id gnl|my_center|LOCUS_20670 >Feature sequence386 1961 594 gene locus_tag LOCUS_20680 1961 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 2966 1980 gene locus_tag LOCUS_20690 2966 1980 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812947.1 protein_id gnl|my_center|LOCUS_20690 >Feature sequence387 16 150 gene locus_tag LOCUS_20700 16 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 163 2856 gene locus_tag LOCUS_20710 163 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 >Feature sequence388 583 92 gene locus_tag LOCUS_20720 583 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 840 1892 gene locus_tag LOCUS_20730 840 1892 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878029.1 protein_id gnl|my_center|LOCUS_20730 2369 1863 gene locus_tag LOCUS_20740 2369 1863 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880961.1 protein_id gnl|my_center|LOCUS_20740 3117 2422 gene locus_tag LOCUS_20750 3117 2422 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937452.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence389 127 1674 gene locus_tag LOCUS_20760 gene guaA 127 1674 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_20760 1742 1909 gene locus_tag LOCUS_20770 1742 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 1887 2243 gene locus_tag LOCUS_20780 1887 2243 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229003.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence390 >Feature sequence391 1503 643 gene locus_tag LOCUS_20790 gene xerC 1503 643 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_20790 2837 1875 gene locus_tag LOCUS_20800 2837 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 >Feature sequence392 222 2141 gene locus_tag LOCUS_20810 222 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2151 2927 gene locus_tag LOCUS_20820 2151 2927 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565341.1 protein_id gnl|my_center|LOCUS_20820 3039 2890 gene locus_tag LOCUS_20830 3039 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence393 >Feature sequence394 528 103 gene locus_tag LOCUS_20840 528 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 993 538 gene locus_tag LOCUS_20850 993 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 1381 947 gene locus_tag LOCUS_20860 1381 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 1937 1284 gene locus_tag LOCUS_20870 1937 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2169 1924 gene locus_tag LOCUS_20880 2169 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2601 2368 gene locus_tag LOCUS_20890 2601 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2934 2737 gene locus_tag LOCUS_20900 2934 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 >Feature sequence395 113 1294 gene locus_tag LOCUS_20910 113 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 1460 1675 gene locus_tag LOCUS_20920 1460 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258117.1 protein_id gnl|my_center|LOCUS_20920 1672 2064 gene locus_tag LOCUS_20930 1672 2064 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_20930 2207 2632 gene locus_tag LOCUS_20940 2207 2632 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973593.1 protein_id gnl|my_center|LOCUS_20940 3061 2657 gene locus_tag LOCUS_20950 3061 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 >Feature sequence396 181 393 gene locus_tag LOCUS_20960 181 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 394 1233 gene locus_tag LOCUS_20970 394 1233 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867222.1 protein_id gnl|my_center|LOCUS_20970 1267 1575 gene locus_tag LOCUS_20980 1267 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 1563 1787 gene locus_tag LOCUS_20990 1563 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 1866 2624 gene locus_tag LOCUS_21000 gene fsa 1866 2624 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227626.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence397 510 1532 gene locus_tag LOCUS_21010 gene hrcA 510 1532 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257942.1 protein_id gnl|my_center|LOCUS_21010 1562 2227 gene locus_tag LOCUS_21020 1562 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence398 1420 326 gene locus_tag LOCUS_21030 1420 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2442 1414 gene locus_tag LOCUS_21040 2442 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 <3220 2445 gene locus_tag LOCUS_21050 <3220 2445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937404.1:glycosyltransferase >Feature sequence399 2236 578 gene locus_tag LOCUS_21060 2236 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 <3217 2356 gene locus_tag LOCUS_21070 <3217 2356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000108789.1:sulfate adenylyltransferase >Feature sequence400 809 1078 gene locus_tag LOCUS_21080 809 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 1059 1274 gene locus_tag LOCUS_21090 1059 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 1241 1393 gene locus_tag LOCUS_21100 1241 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 1508 1705 gene locus_tag LOCUS_21110 1508 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 1706 2398 gene locus_tag LOCUS_21120 1706 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 2427 3209 gene locus_tag LOCUS_21130 2427 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 >Feature sequence401 >Feature sequence402 >Feature sequence403 1778 300 gene locus_tag LOCUS_21140 gene lysS 1778 300 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257111.1 protein_id gnl|my_center|LOCUS_21140 2309 1833 gene locus_tag LOCUS_21150 gene greA 2309 1833 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391698.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence404 103 5 gene locus_tag LOCUS_t00250 103 5 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 1190 297 gene locus_tag LOCUS_21160 1190 297 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232400.1 protein_id gnl|my_center|LOCUS_21160 1592 1206 gene locus_tag LOCUS_21170 1592 1206 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_21170 1837 1589 gene locus_tag LOCUS_21180 1837 1589 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143545.1 protein_id gnl|my_center|LOCUS_21180 3174 1879 gene locus_tag LOCUS_21190 3174 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 >Feature sequence405 962 99 gene locus_tag LOCUS_21200 962 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 1691 1113 gene locus_tag LOCUS_21210 gene dcd 1691 1113 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869929.1 protein_id gnl|my_center|LOCUS_21210 2247 1675 gene locus_tag LOCUS_21220 gene dcd 2247 1675 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582476.1 protein_id gnl|my_center|LOCUS_21220 2926 2249 gene locus_tag LOCUS_21230 2926 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence406 <1 1884 gene locus_tag LOCUS_21240 <1 1884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257612.1:glycosyltransferase 1881 2762 gene locus_tag LOCUS_21250 1881 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 >Feature sequence407 <1 568 gene locus_tag LOCUS_21260 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082320.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase 589 1773 gene locus_tag LOCUS_21270 gene recF 589 1773 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470750.1 protein_id gnl|my_center|LOCUS_21270 2485 1787 gene locus_tag LOCUS_21280 2485 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence408 <3156 2435 gene locus_tag LOCUS_21290 <3156 2435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839758.1:basic secretory protein-like protein >Feature sequence409 >Feature sequence410 659 2383 gene locus_tag LOCUS_21300 659 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence411 1278 259 gene locus_tag LOCUS_21310 1278 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 2907 1288 gene locus_tag LOCUS_21320 2907 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 >Feature sequence412 363 683 gene locus_tag LOCUS_21330 363 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 1777 668 gene locus_tag LOCUS_21340 1777 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 2283 1756 gene locus_tag LOCUS_21350 2283 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 2489 2274 gene locus_tag LOCUS_21360 2489 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 >Feature sequence413 2080 2607 gene locus_tag LOCUS_21370 2080 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 2620 3036 gene locus_tag LOCUS_21380 2620 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence414 372 1238 gene locus_tag LOCUS_21390 gene mtnP 372 1238 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_21390 1300 1923 gene locus_tag LOCUS_21400 1300 1923 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_21400 1940 2800 gene locus_tag LOCUS_21410 1940 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 >Feature sequence415 1415 1167 gene locus_tag LOCUS_21420 1415 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 >Feature sequence416 >Feature sequence417 288 2831 gene locus_tag LOCUS_21430 288 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence418 <1 1512 gene locus_tag LOCUS_21440 <1 1512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868798.1:COG1361 S-layer family protein 1514 2857 gene locus_tag LOCUS_21450 1514 2857 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986231.1 protein_id gnl|my_center|LOCUS_21450 >Feature sequence419 1700 1143 gene locus_tag LOCUS_21460 gene efp 1700 1143 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_21460 2363 2079 gene locus_tag LOCUS_21470 2363 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256207.1 protein_id gnl|my_center|LOCUS_21470 >Feature sequence420 >Feature sequence421 766 551 gene locus_tag LOCUS_21480 766 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 1513 1355 gene locus_tag LOCUS_21490 1513 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 1745 1476 gene locus_tag LOCUS_21500 1745 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 2170 1742 gene locus_tag LOCUS_21510 2170 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 2465 2127 gene locus_tag LOCUS_21520 2465 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence422 <1 1798 gene locus_tag LOCUS_21530 <1 1798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786503.1:transketolase 2758 1886 gene locus_tag LOCUS_21540 2758 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 >Feature sequence423 381 617 gene locus_tag LOCUS_21550 381 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 634 1161 gene locus_tag LOCUS_21560 634 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 1656 1255 gene locus_tag LOCUS_21570 1656 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 1955 1587 gene locus_tag LOCUS_21580 1955 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 >Feature sequence424 90 791 gene locus_tag LOCUS_21590 90 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 813 1976 gene locus_tag LOCUS_21600 813 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 1973 2746 gene locus_tag LOCUS_21610 1973 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence425 <3039 231 gene locus_tag LOCUS_21620 <3039 231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001764195.1:glycosyltransferase family 39 protein >Feature sequence426 113 913 gene locus_tag LOCUS_21630 113 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 929 1081 gene locus_tag LOCUS_21640 929 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 1085 1687 gene locus_tag LOCUS_21650 1085 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence427 262 393 gene locus_tag LOCUS_21660 262 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 390 1601 gene locus_tag LOCUS_21670 390 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence428 148 270 gene locus_tag LOCUS_21680 148 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 615 1412 gene locus_tag LOCUS_21690 615 1412 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence429 2120 567 gene locus_tag LOCUS_21700 2120 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence430 94 2927 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcagaagaacttagtagtgtggaaac >Feature sequence431 >Feature sequence432 <1 984 gene locus_tag LOCUS_21710 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023607.1:PKD domain-containing protein 1816 1067 gene locus_tag LOCUS_21720 1816 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 <2998 2114 gene locus_tag LOCUS_21730 <2998 2114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083755983.1:PKD domain-containing protein >Feature sequence433 588 340 gene locus_tag LOCUS_21740 588 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 951 769 gene locus_tag LOCUS_21750 951 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 1130 954 gene locus_tag LOCUS_21760 1130 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 1377 1156 gene locus_tag LOCUS_21770 1377 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2024 1377 gene locus_tag LOCUS_21780 2024 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2619 2026 gene locus_tag LOCUS_21790 2619 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 2954 2778 gene locus_tag LOCUS_21800 2954 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence434 213 539 gene locus_tag LOCUS_21810 213 539 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_21810 1458 556 gene locus_tag LOCUS_21820 gene ptb 1458 556 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869205.1 protein_id gnl|my_center|LOCUS_21820 2610 1558 gene locus_tag LOCUS_21830 gene tdh 2610 1558 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249867.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence435 1560 295 gene locus_tag LOCUS_21840 1560 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 1983 1910 gene locus_tag LOCUS_t00260 1983 1910 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2133 2936 gene locus_tag LOCUS_21850 2133 2936 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727285.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence436 1439 132 gene locus_tag LOCUS_21860 1439 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2704 1877 gene locus_tag LOCUS_21870 2704 1877 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_21870 >Feature sequence437 2172 1177 gene locus_tag LOCUS_21880 2172 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 >Feature sequence438 1465 203 gene locus_tag LOCUS_21890 1465 203 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249831.1 protein_id gnl|my_center|LOCUS_21890 2335 1478 gene locus_tag LOCUS_21900 2335 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 <2975 2304 gene locus_tag LOCUS_21910 <2975 2304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816897.1:glycosyltransferase >Feature sequence439 1199 6 gene locus_tag LOCUS_21920 gene tuf 1199 6 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940180.1 protein_id gnl|my_center|LOCUS_21920 1720 1250 gene locus_tag LOCUS_21930 gene rpsG 1720 1250 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938594.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence440 <1 646 gene locus_tag LOCUS_21940 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259009.1:L-threonylcarbamoyladenylate synthase 782 2596 gene locus_tag LOCUS_21950 782 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence441 994 203 gene locus_tag LOCUS_21960 994 203 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257299.1 protein_id gnl|my_center|LOCUS_21960 <2972 994 gene locus_tag LOCUS_21970 <2972 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011172918.1:polyamine aminopropyltransferase >Feature sequence442 868 233 gene locus_tag LOCUS_21980 868 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 1909 947 gene locus_tag LOCUS_21990 1909 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 <2970 1936 gene locus_tag LOCUS_22000 <2970 1936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459729.1:L-fucose/L-arabinose isomerase family protein >Feature sequence443 652 810 gene locus_tag LOCUS_22010 652 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 973 1404 gene locus_tag LOCUS_22020 gene gcvH 973 1404 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391976.1 protein_id gnl|my_center|LOCUS_22020 1572 2444 gene locus_tag LOCUS_22030 1572 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 >Feature sequence444 <1 1315 gene locus_tag LOCUS_22040 <1 1315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974200.1:glycerol-3-phosphate dehydrogenase/oxidase 1343 2275 gene locus_tag LOCUS_22050 1343 2275 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146595.1 protein_id gnl|my_center|LOCUS_22050 >Feature sequence445 310 660 gene locus_tag LOCUS_22060 310 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 657 890 gene locus_tag LOCUS_22070 657 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 970 1212 gene locus_tag LOCUS_22080 970 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 1215 1391 gene locus_tag LOCUS_22090 1215 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 1416 1610 gene locus_tag LOCUS_22100 1416 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 1607 2386 gene locus_tag LOCUS_22110 1607 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 2392 2904 gene locus_tag LOCUS_22120 2392 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 >Feature sequence446 553 275 gene locus_tag LOCUS_22130 553 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 1172 963 gene locus_tag LOCUS_22140 1172 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 1539 1156 gene locus_tag LOCUS_22150 1539 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 1763 1548 gene locus_tag LOCUS_22160 1763 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 2309 1773 gene locus_tag LOCUS_22170 2309 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 2631 2278 gene locus_tag LOCUS_22180 2631 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence447 <1 946 gene locus_tag LOCUS_22190 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005110217.1:aspartate aminotransferase family protein 982 2436 gene locus_tag LOCUS_22200 982 2436 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979130.1 protein_id gnl|my_center|LOCUS_22200 >Feature sequence448 1708 101 gene locus_tag LOCUS_22210 1708 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 1846 2142 gene locus_tag LOCUS_22220 1846 2142 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence449 627 508 gene locus_tag LOCUS_22230 627 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 1038 2882 gene locus_tag LOCUS_22240 1038 2882 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963517.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence450 1061 1510 gene locus_tag LOCUS_22250 1061 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 >Feature sequence451 192 1523 gene locus_tag LOCUS_22260 192 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence452 29 2840 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccacactactaagttcttctgaaac >Feature sequence453 695 1225 gene locus_tag LOCUS_22270 695 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 >Feature sequence454 410 631 gene locus_tag LOCUS_22280 410 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 1209 838 gene locus_tag LOCUS_22290 1209 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 1989 1237 gene locus_tag LOCUS_22300 1989 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 2205 1999 gene locus_tag LOCUS_22310 2205 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 >Feature sequence455 2 271 gene locus_tag LOCUS_22320 2 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence456 762 307 gene locus_tag LOCUS_22330 762 307 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391728.1 protein_id gnl|my_center|LOCUS_22330 1060 737 gene locus_tag LOCUS_22340 1060 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 1264 1515 gene locus_tag LOCUS_22350 1264 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 1505 1963 gene locus_tag LOCUS_22360 1505 1963 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545852.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence457 658 2661 gene locus_tag LOCUS_22370 658 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 2678 2842 gene locus_tag LOCUS_22380 2678 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 >Feature sequence458 <1 1540 gene locus_tag LOCUS_22390 <1 1540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256976.1:C25 family cysteine peptidase <2900 1562 gene locus_tag LOCUS_22400 <2900 1562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083333.1:ABC transporter permease >Feature sequence459 842 2326 gene locus_tag LOCUS_22410 842 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence460 1564 26 gene locus_tag LOCUS_22420 1564 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 1997 1569 gene locus_tag LOCUS_22430 1997 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 2268 1999 gene locus_tag LOCUS_22440 2268 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2754 2350 gene locus_tag LOCUS_22450 2754 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence461 316 747 gene locus_tag LOCUS_22460 316 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 744 1403 gene locus_tag LOCUS_22470 744 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 1424 1609 gene locus_tag LOCUS_22480 1424 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 1730 2647 gene locus_tag LOCUS_22490 1730 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence462 <1 1038 gene locus_tag LOCUS_22500 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_091304903.1:DUF11 domain-containing protein 1124 2338 gene locus_tag LOCUS_22510 1124 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence463 <2889 2180 gene locus_tag LOCUS_22520 <2889 2180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393024.1:exodeoxyribonuclease VII large subunit >Feature sequence464 1166 156 gene locus_tag LOCUS_22530 1166 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 2528 1170 gene locus_tag LOCUS_22540 gene acsC 2528 1170 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811725.1 protein_id gnl|my_center|LOCUS_22540 2728 2573 gene locus_tag LOCUS_22550 2728 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 >Feature sequence465 307 1053 gene locus_tag LOCUS_22560 307 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 1125 1343 gene locus_tag LOCUS_22570 1125 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 1563 1817 gene locus_tag LOCUS_22580 1563 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 1795 1998 gene locus_tag LOCUS_22590 1795 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 1989 2795 gene locus_tag LOCUS_22600 1989 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence466 <1 624 gene locus_tag LOCUS_22610 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966545.1:TetR/AcrR family transcriptional regulator 628 1749 gene locus_tag LOCUS_22620 628 1749 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393399.1 protein_id gnl|my_center|LOCUS_22620 1899 2480 gene locus_tag LOCUS_22630 1899 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 >Feature sequence467 866 249 gene locus_tag LOCUS_22640 866 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 2731 887 gene locus_tag LOCUS_22650 gene glmS 2731 887 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256373.1 protein_id gnl|my_center|LOCUS_22650 >Feature sequence468 624 220 gene locus_tag LOCUS_22660 624 220 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053649.1 protein_id gnl|my_center|LOCUS_22660 904 614 gene locus_tag LOCUS_22670 904 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 996 1238 gene locus_tag LOCUS_22680 996 1238 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_22680 1263 2393 gene locus_tag LOCUS_22690 1263 2393 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence469 682 287 gene locus_tag LOCUS_22700 682 287 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405106.1 protein_id gnl|my_center|LOCUS_22700 2653 707 gene locus_tag LOCUS_22710 2653 707 CDS product DUF2194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964051.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence470 466 248 gene locus_tag LOCUS_22720 466 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 752 459 gene locus_tag LOCUS_22730 752 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 1782 742 gene locus_tag LOCUS_22740 1782 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546406.1 protein_id gnl|my_center|LOCUS_22740 2713 1799 gene locus_tag LOCUS_22750 2713 1799 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081221.1 protein_id gnl|my_center|LOCUS_22750 >Feature sequence471 1152 538 gene locus_tag LOCUS_22760 1152 538 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_22760 1576 2730 gene locus_tag LOCUS_22770 1576 2730 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence472 >Feature sequence473 <2846 4 gene locus_tag LOCUS_22780 <2846 4 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256800.1:SdrD B-like domain-containing protein >Feature sequence474 2153 975 gene locus_tag LOCUS_22790 gene nifS 2153 975 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_22790 2777 2349 gene locus_tag LOCUS_22800 2777 2349 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_22800 >Feature sequence475 <1 1010 gene locus_tag LOCUS_22810 <1 1010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250863.1:DUF4910 domain-containing protein 1159 2115 gene locus_tag LOCUS_22820 1159 2115 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065100.1 protein_id gnl|my_center|LOCUS_22820 <2843 2288 gene locus_tag LOCUS_22830 <2843 2288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256864.1:urocanate hydratase >Feature sequence476 982 293 gene locus_tag LOCUS_22840 982 293 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256823.1 protein_id gnl|my_center|LOCUS_22840 1678 995 gene locus_tag LOCUS_22850 1678 995 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_22850 2395 1751 gene locus_tag LOCUS_22860 2395 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence477 26 277 gene locus_tag LOCUS_22870 26 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 314 625 gene locus_tag LOCUS_22880 314 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 618 974 gene locus_tag LOCUS_22890 618 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 2148 1066 gene locus_tag LOCUS_22900 2148 1066 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_22900 <2843 2150 gene locus_tag LOCUS_22910 <2843 2150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391594.1:16S rRNA (cytidine(1402)-2'-O)-methyltransferase >Feature sequence478 1210 140 gene locus_tag LOCUS_22920 1210 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 2683 1277 gene locus_tag LOCUS_22930 2683 1277 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093094.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence479 223 570 gene locus_tag LOCUS_22940 223 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 584 1735 gene locus_tag LOCUS_22950 584 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 2473 2601 gene locus_tag LOCUS_22960 2473 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence480 321 100 gene locus_tag LOCUS_22970 321 100 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545805.1 protein_id gnl|my_center|LOCUS_22970 541 314 gene locus_tag LOCUS_22980 541 314 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546765.1 protein_id gnl|my_center|LOCUS_22980 789 577 gene locus_tag LOCUS_22990 789 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 1236 817 gene locus_tag LOCUS_23000 1236 817 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876760.1 protein_id gnl|my_center|LOCUS_23000 1945 1301 gene locus_tag LOCUS_23010 1945 1301 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257688.1 protein_id gnl|my_center|LOCUS_23010 2669 2031 gene locus_tag LOCUS_23020 2669 2031 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257688.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence481 855 1784 gene locus_tag LOCUS_23030 855 1784 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120110396.1 protein_id gnl|my_center|LOCUS_23030 1768 2664 gene locus_tag LOCUS_23040 1768 2664 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence482 >Feature sequence483 301 149 gene locus_tag LOCUS_23050 301 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 1025 465 gene locus_tag LOCUS_23060 1025 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 1691 1029 gene locus_tag LOCUS_23070 1691 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2560 1829 gene locus_tag LOCUS_23080 2560 1829 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814256.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence484 226 1071 gene locus_tag LOCUS_23090 226 1071 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514171.1 protein_id gnl|my_center|LOCUS_23090 1081 2301 gene locus_tag LOCUS_23100 1081 2301 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040680916.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence485 1177 2235 gene locus_tag LOCUS_23110 1177 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 2549 2238 gene locus_tag LOCUS_23120 2549 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence486 1483 206 gene locus_tag LOCUS_23130 gene eno 1483 206 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_23130 2727 1543 gene locus_tag LOCUS_23140 gene dnaN 2727 1543 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence487 >Feature sequence488 <1 954 gene locus_tag LOCUS_23150 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870653.1:TRC40/GET3/ArsA family transport-energizing ATPase 1015 1989 gene locus_tag LOCUS_23160 1015 1989 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870653.1 protein_id gnl|my_center|LOCUS_23160 >Feature sequence489 401 1117 gene locus_tag LOCUS_23170 401 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 1114 1674 gene locus_tag LOCUS_23180 1114 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 1903 2589 gene locus_tag LOCUS_23190 1903 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence490 >Feature sequence491 <1 543 gene locus_tag LOCUS_23200 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020890.1:ABC transporter permease 560 1174 gene locus_tag LOCUS_23210 560 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 1200 1661 gene locus_tag LOCUS_23220 1200 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 1693 2142 gene locus_tag LOCUS_23230 1693 2142 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_23230 >Feature sequence492 200 427 gene locus_tag LOCUS_23240 200 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 >Feature sequence493 28 504 gene locus_tag LOCUS_23250 28 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence494 141 1151 gene locus_tag LOCUS_23260 141 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 1197 1970 gene locus_tag LOCUS_23270 gene tpiA 1197 1970 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_23270 1997 2281 gene locus_tag LOCUS_23280 1997 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 2285 2479 gene locus_tag LOCUS_23290 2285 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence495 2768 2229 gene locus_tag LOCUS_23300 2768 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 >Feature sequence496 <1 1210 gene locus_tag LOCUS_23310 <1 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258322.1:O-antigen ligase family protein 1436 2425 gene locus_tag LOCUS_23320 gene pyrB 1436 2425 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence497 <1 1203 gene locus_tag LOCUS_23330 <1 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762231.1:BMP family protein >Feature sequence498 1081 29 gene locus_tag LOCUS_23340 1081 29 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_23340 1488 1312 gene locus_tag LOCUS_23350 1488 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 1876 1502 gene locus_tag LOCUS_23360 1876 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 2458 1934 gene locus_tag LOCUS_23370 2458 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence499 191 667 gene locus_tag LOCUS_23380 191 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 2396 807 gene locus_tag LOCUS_23390 2396 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 >Feature sequence500 1421 624 gene locus_tag LOCUS_23400 1421 624 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250080.1 protein_id gnl|my_center|LOCUS_23400 1584 1396 gene locus_tag LOCUS_23410 1584 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 2273 1584 gene locus_tag LOCUS_23420 2273 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 2561 2286 gene locus_tag LOCUS_23430 2561 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 >Feature sequence501 1937 789 gene locus_tag LOCUS_23440 gene wecB 1937 789 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_23440 <2756 1934 gene locus_tag LOCUS_23450 <2756 1934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582957.1:glycosyltransferase family 4 protein >Feature sequence502 578 934 gene locus_tag LOCUS_23460 578 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 1814 957 gene locus_tag LOCUS_23470 1814 957 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393781.1 protein_id gnl|my_center|LOCUS_23470 2755 1853 gene locus_tag LOCUS_23480 2755 1853 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_23480 >Feature sequence503 1531 257 gene locus_tag LOCUS_23490 1531 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257476.1 protein_id gnl|my_center|LOCUS_23490 2184 1537 gene locus_tag LOCUS_23500 2184 1537 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256686.1 protein_id gnl|my_center|LOCUS_23500 >Feature sequence504 92 2653 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcagaagaacttagtagtgtggaaac >Feature sequence505 1939 230 gene locus_tag LOCUS_23510 1939 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 >Feature sequence506 279 106 gene locus_tag LOCUS_23520 279 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 344 580 gene locus_tag LOCUS_23530 344 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 577 1002 gene locus_tag LOCUS_23540 577 1002 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484774.1 protein_id gnl|my_center|LOCUS_23540 1131 2075 gene locus_tag LOCUS_23550 1131 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 2144 2217 gene locus_tag LOCUS_t00270 2144 2217 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2246 2337 gene locus_tag LOCUS_t00280 2246 2337 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2347 2420 gene locus_tag LOCUS_t00290 2347 2420 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2466 2537 gene locus_tag LOCUS_t00300 2466 2537 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2542 2616 gene locus_tag LOCUS_t00310 2542 2616 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence507 2433 904 gene locus_tag LOCUS_23560 2433 904 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 protein_id gnl|my_center|LOCUS_23560 >Feature sequence508 284 1534 gene locus_tag LOCUS_23570 284 1534 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808599.1 protein_id gnl|my_center|LOCUS_23570 >Feature sequence509 466 1071 gene locus_tag LOCUS_23580 466 1071 CDS product TasA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096033.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence510 2176 1457 gene locus_tag LOCUS_23590 2176 1457 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813919.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence511 1527 196 gene locus_tag LOCUS_23600 gene hflX 1527 196 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_23600 <2718 1527 gene locus_tag LOCUS_23610 <2718 1527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942275.1:ATP-binding protein >Feature sequence512 283 951 gene locus_tag LOCUS_23620 gene thyX 283 951 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099542.1 protein_id gnl|my_center|LOCUS_23620 948 1322 gene locus_tag LOCUS_23630 948 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 1388 1933 gene locus_tag LOCUS_23640 1388 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2009 2701 gene locus_tag LOCUS_23650 2009 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence513 689 150 gene locus_tag LOCUS_23660 689 150 CDS product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072197.1 protein_id gnl|my_center|LOCUS_23660 1777 704 gene locus_tag LOCUS_23670 1777 704 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249584.1 protein_id gnl|my_center|LOCUS_23670 2303 1788 gene locus_tag LOCUS_23680 2303 1788 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 protein_id gnl|my_center|LOCUS_23680 >Feature sequence514 504 1595 gene locus_tag LOCUS_23690 504 1595 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230702.1 protein_id gnl|my_center|LOCUS_23690 1564 2133 gene locus_tag LOCUS_23700 1564 2133 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396860.1 protein_id gnl|my_center|LOCUS_23700 2174 2428 gene locus_tag LOCUS_23710 2174 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence515 811 494 gene locus_tag LOCUS_23720 811 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 2607 889 gene locus_tag LOCUS_23730 2607 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence516 154 2340 gene locus_tag LOCUS_23740 154 2340 CDS product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990677.1 protein_id gnl|my_center|LOCUS_23740 >Feature sequence517 1724 2350 gene locus_tag LOCUS_23750 1724 2350 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259716.1 protein_id gnl|my_center|LOCUS_23750 >Feature sequence518 <1 630 gene locus_tag LOCUS_23760 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392399.1:dihydroorotase 728 2551 gene locus_tag LOCUS_23770 728 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence519 >Feature sequence520 589 1203 gene locus_tag LOCUS_23780 589 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 1289 2110 gene locus_tag LOCUS_23790 1289 2110 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250671.1 protein_id gnl|my_center|LOCUS_23790 >Feature sequence521 >Feature sequence522 1678 164 gene locus_tag LOCUS_23800 1678 164 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258202.1 protein_id gnl|my_center|LOCUS_23800 <2670 1692 gene locus_tag LOCUS_23810 <2670 1692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530143.1:alkaline phosphatase family protein >Feature sequence523 >Feature sequence524 663 818 gene locus_tag LOCUS_23820 663 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 1132 1383 gene locus_tag LOCUS_23830 1132 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 1414 1533 gene locus_tag LOCUS_23840 1414 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 1544 1828 gene locus_tag LOCUS_23850 1544 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 1821 2447 gene locus_tag LOCUS_23860 gene pyrE 1821 2447 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 protein_id gnl|my_center|LOCUS_23860 >Feature sequence525 <1 1110 gene locus_tag LOCUS_23870 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258161.1:RAMP superfamily CRISPR-associated protein 1131 2027 gene locus_tag LOCUS_23880 1131 2027 CDS product DUF1887 family CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258165.1 protein_id gnl|my_center|LOCUS_23880 2221 2502 gene locus_tag LOCUS_23890 2221 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence526 770 591 gene locus_tag LOCUS_23900 770 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 882 754 gene locus_tag LOCUS_23910 882 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 1309 887 gene locus_tag LOCUS_23920 1309 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 1458 1643 gene locus_tag LOCUS_23930 1458 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 1633 1818 gene locus_tag LOCUS_23940 1633 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 1815 2072 gene locus_tag LOCUS_23950 1815 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 2102 2515 gene locus_tag LOCUS_23960 2102 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 >Feature sequence527 2135 2320 gene locus_tag LOCUS_23970 2135 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 >Feature sequence528 162 851 gene locus_tag LOCUS_23980 162 851 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200392305.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence529 479 637 gene locus_tag LOCUS_23990 479 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 851 618 gene locus_tag LOCUS_24000 851 618 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545707.1 protein_id gnl|my_center|LOCUS_24000 1607 930 gene locus_tag LOCUS_24010 1607 930 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_24010 >Feature sequence530 522 103 gene locus_tag LOCUS_24020 gene glmS 522 103 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816944.1 protein_id gnl|my_center|LOCUS_24020 2564 561 gene locus_tag LOCUS_24030 2564 561 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869551.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence531 1338 2543 gene locus_tag LOCUS_24040 1338 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence532 438 1 gene locus_tag LOCUS_24050 438 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 2164 443 gene locus_tag LOCUS_24060 2164 443 CDS product 6-pyruvoyl-tetrahydropterin synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225355332.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence533 125 457 gene locus_tag LOCUS_24070 125 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 1453 440 gene locus_tag LOCUS_24080 1453 440 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250018.1 protein_id gnl|my_center|LOCUS_24080 1663 1962 gene locus_tag LOCUS_24090 1663 1962 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249488.1 protein_id gnl|my_center|LOCUS_24090 <2634 1959 gene locus_tag LOCUS_24100 <2634 1959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060851.1:multidrug transporter >Feature sequence534 1381 1037 gene locus_tag LOCUS_24110 1381 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 2095 1403 gene locus_tag LOCUS_24120 2095 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 2486 2561 gene locus_tag LOCUS_t00320 2486 2561 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence535 52 311 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccctcttcagggattaccccctttcggac 357 1778 gene locus_tag LOCUS_24130 357 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence536 1371 115 gene locus_tag LOCUS_24140 gene obgE 1371 115 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence537 94 2589 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcagaagaacttagtagtgtggaaac >Feature sequence538 <1 1650 gene locus_tag LOCUS_24150 <1 1650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000039472.1:DNA polymerase 1735 2019 gene locus_tag LOCUS_24160 1735 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 2021 2245 gene locus_tag LOCUS_24170 2021 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 2245 2553 gene locus_tag LOCUS_24180 2245 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 >Feature sequence539 32 913 gene locus_tag LOCUS_24190 32 913 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258894.1 protein_id gnl|my_center|LOCUS_24190 971 1180 gene locus_tag LOCUS_24200 971 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 >Feature sequence540 <2601 241 gene locus_tag LOCUS_24210 <2601 241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256365.1:GAF domain-containing protein >Feature sequence541 219 521 gene locus_tag LOCUS_24220 219 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 661 1779 gene locus_tag LOCUS_24230 661 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 1960 2157 gene locus_tag LOCUS_24240 1960 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence542 478 1149 gene locus_tag LOCUS_24250 478 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24250 1139 1498 gene locus_tag LOCUS_24260 1139 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24260 1754 1587 gene locus_tag LOCUS_24270 1754 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence543 1262 258 gene locus_tag LOCUS_24280 gene cmr4 1262 258 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546538.1 protein_id gnl|my_center|LOCUS_24280 >Feature sequence544 965 207 gene locus_tag LOCUS_24290 965 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 1200 967 gene locus_tag LOCUS_24300 1200 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 2072 1206 gene locus_tag LOCUS_24310 2072 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 <2592 2063 gene locus_tag LOCUS_24320 <2592 2063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925475.1:macro domain-containing protein >Feature sequence545 211 576 gene locus_tag LOCUS_24330 211 576 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391729.1 protein_id gnl|my_center|LOCUS_24330 593 1948 gene locus_tag LOCUS_24340 593 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 1987 2307 gene locus_tag LOCUS_24350 1987 2307 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250024.1 protein_id gnl|my_center|LOCUS_24350 >Feature sequence546 459 1838 gene locus_tag LOCUS_24360 459 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 1994 2554 gene locus_tag LOCUS_24370 1994 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 >Feature sequence547 1191 994 gene locus_tag LOCUS_24380 1191 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 >Feature sequence548 270 1154 gene locus_tag LOCUS_24390 270 1154 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_24390 1166 2497 gene locus_tag LOCUS_24400 1166 2497 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990698.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence549 <1 1987 gene locus_tag LOCUS_24410 <1 1987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109247.1:DUF1735 and LamG domain-containing protein 1987 2238 gene locus_tag LOCUS_24420 1987 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 >Feature sequence550 1834 980 gene locus_tag LOCUS_24430 1834 980 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582729.1 protein_id gnl|my_center|LOCUS_24430 2222 1878 gene locus_tag LOCUS_24440 2222 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 >Feature sequence551 2 1069 gene locus_tag LOCUS_24450 2 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 1140 1904 gene locus_tag LOCUS_24460 1140 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 >Feature sequence552 14 1381 gene locus_tag LOCUS_24470 14 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 >Feature sequence553 363 566 gene locus_tag LOCUS_24480 363 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 710 940 gene locus_tag LOCUS_24490 710 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 1036 1875 gene locus_tag LOCUS_24500 1036 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 >Feature sequence554 >Feature sequence555 >Feature sequence556 1685 1389 gene locus_tag LOCUS_24510 1685 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence557 406 2280 gene locus_tag LOCUS_24520 406 2280 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399994.1 protein_id gnl|my_center|LOCUS_24520 >Feature sequence558 993 1880 gene locus_tag LOCUS_24530 993 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24530 1777 2373 gene locus_tag LOCUS_24540 1777 2373 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020574.1 protein_id gnl|my_center|LOCUS_24540 >Feature sequence559 173 373 gene locus_tag LOCUS_24550 173 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence560 193 717 gene locus_tag LOCUS_24560 gene amrA 193 717 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546745.1 protein_id gnl|my_center|LOCUS_24560 783 1277 gene locus_tag LOCUS_24570 783 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 2351 1251 gene locus_tag LOCUS_24580 2351 1251 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891591.1 protein_id gnl|my_center|LOCUS_24580 >Feature sequence561 <1 2109 gene locus_tag LOCUS_24590 <1 2109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392131.1:HDIG domain-containing protein 2165 2491 gene locus_tag LOCUS_24600 2165 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 >Feature sequence562 428 129 gene locus_tag LOCUS_24610 428 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 >Feature sequence563 1274 99 gene locus_tag LOCUS_24620 1274 99 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878467.1 protein_id gnl|my_center|LOCUS_24620 1469 1347 gene locus_tag LOCUS_24630 1469 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 1707 1462 gene locus_tag LOCUS_24640 1707 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 2055 1780 gene locus_tag LOCUS_24650 2055 1780 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249916.1 protein_id gnl|my_center|LOCUS_24650 2338 2042 gene locus_tag LOCUS_24660 2338 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 2541 2362 gene locus_tag LOCUS_24670 2541 2362 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence564 223 1527 gene locus_tag LOCUS_24680 223 1527 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964854.1 protein_id gnl|my_center|LOCUS_24680 <2540 1587 gene locus_tag LOCUS_24690 <2540 1587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259564.1:flippase >Feature sequence565 748 119 gene locus_tag LOCUS_24700 748 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 915 1067 gene locus_tag LOCUS_24710 915 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 >Feature sequence566 1098 274 gene locus_tag LOCUS_24720 1098 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 1432 1668 gene locus_tag LOCUS_24730 1432 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 >Feature sequence567 92 757 gene locus_tag LOCUS_24740 92 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 723 1931 gene locus_tag LOCUS_24750 723 1931 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583100.1 protein_id gnl|my_center|LOCUS_24750 1924 2331 gene locus_tag LOCUS_24760 1924 2331 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583101.1 protein_id gnl|my_center|LOCUS_24760 >Feature sequence568 764 1219 gene locus_tag LOCUS_24770 764 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 2516 2040 gene locus_tag LOCUS_24780 2516 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 >Feature sequence569 1841 1347 gene locus_tag LOCUS_24790 1841 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 >Feature sequence570 119 463 gene locus_tag LOCUS_24800 119 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 614 1159 gene locus_tag LOCUS_24810 614 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 1172 1354 gene locus_tag LOCUS_24820 1172 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 1351 1728 gene locus_tag LOCUS_24830 1351 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 1733 1942 gene locus_tag LOCUS_24840 1733 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 1943 2143 gene locus_tag LOCUS_24850 1943 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 2136 2408 gene locus_tag LOCUS_24860 2136 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence571 >Feature sequence572 190 621 gene locus_tag LOCUS_24870 gene tsaA 190 621 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877399.1 protein_id gnl|my_center|LOCUS_24870 587 1048 gene locus_tag LOCUS_24880 587 1048 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250199.1 protein_id gnl|my_center|LOCUS_24880 984 1814 gene locus_tag LOCUS_24890 984 1814 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256410.1 protein_id gnl|my_center|LOCUS_24890 1925 2161 gene locus_tag LOCUS_24900 1925 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 >Feature sequence573 990 25 gene locus_tag LOCUS_24910 990 25 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257461.1 protein_id gnl|my_center|LOCUS_24910 1365 1198 gene locus_tag LOCUS_24920 1365 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 1478 2356 gene locus_tag LOCUS_24930 1478 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 >Feature sequence574 230 1228 gene locus_tag LOCUS_24940 gene xerD 230 1228 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_24940 <2504 1244 gene locus_tag LOCUS_24950 <2504 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:transglutaminase-like domain-containing protein >Feature sequence575 86 1942 gene locus_tag LOCUS_24960 86 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 >Feature sequence576 476 682 gene locus_tag LOCUS_24970 476 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 774 1028 gene locus_tag LOCUS_24980 774 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 1025 1420 gene locus_tag LOCUS_24990 1025 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 1464 1865 gene locus_tag LOCUS_25000 1464 1865 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582526.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence577 20 409 gene locus_tag LOCUS_25010 20 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence578 1587 541 gene locus_tag LOCUS_25020 1587 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 2401 1607 gene locus_tag LOCUS_25030 2401 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 >Feature sequence579 608 150 gene locus_tag LOCUS_25040 608 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 1603 605 gene locus_tag LOCUS_25050 1603 605 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_25050 1730 1960 gene locus_tag LOCUS_25060 1730 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 2127 2396 gene locus_tag LOCUS_25070 2127 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence580 726 2327 gene locus_tag LOCUS_25080 726 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 >Feature sequence581 314 1642 gene locus_tag LOCUS_25090 314 1642 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411121.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence582 1427 207 gene locus_tag LOCUS_25100 1427 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 >Feature sequence583 1192 59 gene locus_tag LOCUS_25110 1192 59 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775268.1 protein_id gnl|my_center|LOCUS_25110 2382 1246 gene locus_tag LOCUS_25120 2382 1246 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080272.1 protein_id gnl|my_center|LOCUS_25120 >Feature sequence584 837 34 gene locus_tag LOCUS_25130 837 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 2093 834 gene locus_tag LOCUS_25140 2093 834 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163760282.1 protein_id gnl|my_center|LOCUS_25140 >Feature sequence585 107 1564 gene locus_tag LOCUS_25150 107 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 1557 2321 gene locus_tag LOCUS_25160 1557 2321 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259075.1 protein_id gnl|my_center|LOCUS_25160 >Feature sequence586 >Feature sequence587 3 1244 gene locus_tag LOCUS_25170 3 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence588 2 77 gene locus_tag LOCUS_t00330 2 77 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 96 413 gene locus_tag LOCUS_25180 96 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 501 650 gene locus_tag LOCUS_25190 501 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 991 1230 gene locus_tag LOCUS_25200 991 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 1472 1702 gene locus_tag LOCUS_25210 1472 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 >Feature sequence589 63 692 gene locus_tag LOCUS_25220 63 692 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_25220 677 1564 gene locus_tag LOCUS_25230 gene xerD 677 1564 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_25230 >Feature sequence590 >Feature sequence591 425 180 gene locus_tag LOCUS_25240 425 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 690 439 gene locus_tag LOCUS_25250 690 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 1007 753 gene locus_tag LOCUS_25260 1007 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 1282 1019 gene locus_tag LOCUS_25270 1282 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 1452 1285 gene locus_tag LOCUS_25280 1452 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 1784 1449 gene locus_tag LOCUS_25290 1784 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 2238 1777 gene locus_tag LOCUS_25300 2238 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 >Feature sequence592 519 794 gene locus_tag LOCUS_25310 519 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 1067 1309 gene locus_tag LOCUS_25320 1067 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 1316 1489 gene locus_tag LOCUS_25330 1316 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 2110 2415 gene locus_tag LOCUS_25340 2110 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 >Feature sequence593 294 2198 gene locus_tag LOCUS_25350 294 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 >Feature sequence594 1853 1098 gene locus_tag LOCUS_25360 1853 1098 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086690.1 protein_id gnl|my_center|LOCUS_25360 <2432 1865 gene locus_tag LOCUS_25370 <2432 1865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707115.1:sodium/pantothenate symporter >Feature sequence595 2007 1132 gene locus_tag LOCUS_25380 2007 1132 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080614.1 protein_id gnl|my_center|LOCUS_25380 >Feature sequence596 972 754 gene locus_tag LOCUS_25390 gene hpkB 972 754 CDS product archaeal histone HpkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251239.1 protein_id gnl|my_center|LOCUS_25390 >Feature sequence597 1060 926 gene locus_tag LOCUS_25400 1060 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 1358 1882 gene locus_tag LOCUS_25410 gene pyrR 1358 1882 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence598 1312 230 gene locus_tag LOCUS_25420 1312 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 2251 1412 gene locus_tag LOCUS_25430 2251 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence599 29 2320 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccacactactaagttcttctgaaac >Feature sequence600 1898 942 gene locus_tag LOCUS_25440 1898 942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_25440 2412 1903 gene locus_tag LOCUS_25450 2412 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 >Feature sequence601 563 435 gene locus_tag LOCUS_25460 563 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 686 1099 gene locus_tag LOCUS_25470 686 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 1096 1596 gene locus_tag LOCUS_25480 1096 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092693868.1 protein_id gnl|my_center|LOCUS_25480 1586 2053 gene locus_tag LOCUS_25490 1586 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 >Feature sequence602 >Feature sequence603 1792 83 gene locus_tag LOCUS_25500 1792 83 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660601.1 protein_id gnl|my_center|LOCUS_25500 >Feature sequence604 566 1966 gene locus_tag LOCUS_25510 566 1966 CDS product bifunctional orotidine-5'-phosphate decarboxylase/orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141081.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence605 171 449 gene locus_tag LOCUS_25520 171 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 1807 446 gene locus_tag LOCUS_25530 1807 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 2300 1794 gene locus_tag LOCUS_25540 2300 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 >Feature sequence606 968 165 gene locus_tag LOCUS_25550 gene ccsB 968 165 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393687.1 protein_id gnl|my_center|LOCUS_25550 1766 969 gene locus_tag LOCUS_25560 1766 969 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909158.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence607 <1 518 gene locus_tag LOCUS_25570 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929319.1:tetratricopeptide repeat protein 605 994 gene locus_tag LOCUS_25580 605 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 >Feature sequence608 >Feature sequence609 >Feature sequence610 828 316 gene locus_tag LOCUS_25590 828 316 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111658546.1 protein_id gnl|my_center|LOCUS_25590 1420 902 gene locus_tag LOCUS_25600 1420 902 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395815.1 protein_id gnl|my_center|LOCUS_25600 <2387 1428 gene locus_tag LOCUS_25610 <2387 1428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391632.1:nucleoside triphosphate pyrophosphohydrolase >Feature sequence611 >Feature sequence612 1576 584 gene locus_tag LOCUS_25620 1576 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 2094 1630 gene locus_tag LOCUS_25630 2094 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 >Feature sequence613 433 780 gene locus_tag LOCUS_25640 433 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 899 1777 gene locus_tag LOCUS_25650 899 1777 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940917.1 protein_id gnl|my_center|LOCUS_25650 >Feature sequence614 247 441 gene locus_tag LOCUS_25660 247 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 461 736 gene locus_tag LOCUS_25670 461 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 <2380 816 gene locus_tag LOCUS_25680 <2380 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255983.1:CHAT domain-containing protein >Feature sequence615 >Feature sequence616 >Feature sequence617 1276 1695 gene locus_tag LOCUS_25690 1276 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence618 >Feature sequence619 145 939 gene locus_tag LOCUS_25700 145 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 936 1238 gene locus_tag LOCUS_25710 936 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 1223 1474 gene locus_tag LOCUS_25720 1223 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 >Feature sequence620 >Feature sequence621 1112 462 gene locus_tag LOCUS_25730 1112 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 1836 1099 gene locus_tag LOCUS_25740 1836 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 2211 1840 gene locus_tag LOCUS_25750 2211 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 >Feature sequence622 >Feature sequence623 48 209 gene locus_tag LOCUS_25760 48 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 331 663 gene locus_tag LOCUS_25770 331 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence624 1271 2221 gene locus_tag LOCUS_25780 gene cas7i 1271 2221 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023574.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence625 1259 2065 gene locus_tag LOCUS_25790 1259 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 >Feature sequence626 <1 817 gene locus_tag LOCUS_25800 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404336.1:YifB family Mg chelatase-like AAA ATPase >Feature sequence627 2213 1608 gene locus_tag LOCUS_25810 2213 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 >Feature sequence628 134 661 gene locus_tag LOCUS_25820 134 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 658 1182 gene locus_tag LOCUS_25830 658 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 >Feature sequence629 64 2250 gene locus_tag LOCUS_25840 64 2250 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207707612.1 protein_id gnl|my_center|LOCUS_25840 >Feature sequence630 >Feature sequence631 270 76 gene locus_tag LOCUS_25850 270 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 630 283 gene locus_tag LOCUS_25860 630 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 849 640 gene locus_tag LOCUS_25870 849 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 1115 849 gene locus_tag LOCUS_25880 1115 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 1414 1118 gene locus_tag LOCUS_25890 1414 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 1781 1620 gene locus_tag LOCUS_25900 1781 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 2016 1879 gene locus_tag LOCUS_25910 2016 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 >Feature sequence632 747 91 gene locus_tag LOCUS_25920 747 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 904 2202 gene locus_tag LOCUS_25930 904 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence633 >Feature sequence634 >Feature sequence635 >Feature sequence636 224 535 gene locus_tag LOCUS_25940 224 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 631 1674 gene locus_tag LOCUS_25950 631 1674 CDS product bis-aminopropyl spermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870786.1 protein_id gnl|my_center|LOCUS_25950 1722 2180 gene locus_tag LOCUS_25960 1722 2180 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060917.1 protein_id gnl|my_center|LOCUS_25960 >Feature sequence637 >Feature sequence638 1035 94 gene locus_tag LOCUS_25970 1035 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 1472 993 gene locus_tag LOCUS_25980 1472 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence639 >Feature sequence640 >Feature sequence641 213 839 gene locus_tag LOCUS_25990 213 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 983 1405 gene locus_tag LOCUS_26000 983 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26000 >Feature sequence642 <1 648 gene locus_tag LOCUS_26010 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258894.1:F0F1 ATP synthase subunit gamma 657 2033 gene locus_tag LOCUS_26020 gene atpD 657 2033 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_26020 >Feature sequence643 963 670 gene locus_tag LOCUS_26030 963 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 1139 960 gene locus_tag LOCUS_26040 1139 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 1358 1182 gene locus_tag LOCUS_26050 1358 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 1752 1369 gene locus_tag LOCUS_26060 1752 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 2238 1867 gene locus_tag LOCUS_26070 2238 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 >Feature sequence644 1308 349 gene locus_tag LOCUS_26080 1308 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 >Feature sequence645 33 1088 gene locus_tag LOCUS_26090 33 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 >Feature sequence646 871 485 gene locus_tag LOCUS_26100 871 485 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_26100 1104 868 gene locus_tag LOCUS_26110 1104 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 1524 1183 gene locus_tag LOCUS_26120 1524 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 1861 1514 gene locus_tag LOCUS_26130 1861 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 2204 1848 gene locus_tag LOCUS_26140 2204 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 >Feature sequence647 372 707 gene locus_tag LOCUS_26150 372 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 697 927 gene locus_tag LOCUS_26160 697 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 986 1642 gene locus_tag LOCUS_26170 986 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 >Feature sequence648 >Feature sequence649 >Feature sequence650 1445 681 gene locus_tag LOCUS_26180 1445 681 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816178.1 protein_id gnl|my_center|LOCUS_26180 2271 1522 gene locus_tag LOCUS_26190 2271 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 >Feature sequence651 790 1398 gene locus_tag LOCUS_26200 790 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 >Feature sequence652 1232 219 gene locus_tag LOCUS_26210 1232 219 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 protein_id gnl|my_center|LOCUS_26210 2226 1252 gene locus_tag LOCUS_26220 gene oppB 2226 1252 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245554.1 protein_id gnl|my_center|LOCUS_26220 >Feature sequence653 1243 386 gene locus_tag LOCUS_26230 1243 386 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_26230 <2308 1247 gene locus_tag LOCUS_26240 <2308 1247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158296321.1:glycosyltransferase >Feature sequence654 883 1026 gene locus_tag LOCUS_26250 883 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 1040 1303 gene locus_tag LOCUS_26260 1040 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 >Feature sequence655 1865 381 gene locus_tag LOCUS_26270 1865 381 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767818.1 protein_id gnl|my_center|LOCUS_26270 >Feature sequence656 >Feature sequence657 2293 1187 gene locus_tag LOCUS_26280 2293 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 >Feature sequence658 35 481 gene locus_tag LOCUS_26290 gene rplO 35 481 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766080.1 protein_id gnl|my_center|LOCUS_26290 534 2252 gene locus_tag LOCUS_26300 gene secY 534 2252 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326816.1 protein_id gnl|my_center|LOCUS_26300 >Feature sequence659 1602 130 gene locus_tag LOCUS_26310 1602 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence660 542 285 gene locus_tag LOCUS_26320 542 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 835 623 gene locus_tag LOCUS_26330 835 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 1679 828 gene locus_tag LOCUS_26340 1679 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence661 <1 609 gene locus_tag LOCUS_26350 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762851.1:AmmeMemoRadiSam system protein B 639 1223 gene locus_tag LOCUS_26360 639 1223 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722009.1 protein_id gnl|my_center|LOCUS_26360 1326 1400 gene locus_tag LOCUS_t00340 1326 1400 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1595 1520 gene locus_tag LOCUS_t00350 1595 1520 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence662 >Feature sequence663 >Feature sequence664 703 71 gene locus_tag LOCUS_26370 703 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 2022 763 gene locus_tag LOCUS_26380 2022 763 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070775.1 protein_id gnl|my_center|LOCUS_26380 >Feature sequence665 165 404 gene locus_tag LOCUS_26390 165 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 406 768 gene locus_tag LOCUS_26400 406 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 771 1034 gene locus_tag LOCUS_26410 771 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 1031 1354 gene locus_tag LOCUS_26420 1031 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 1398 1658 gene locus_tag LOCUS_26430 1398 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence666 >Feature sequence667 <1 638 gene locus_tag LOCUS_26440 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030442.1:recombinase RecA 871 1527 gene locus_tag LOCUS_26450 871 1527 CDS product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257010.1 protein_id gnl|my_center|LOCUS_26450 >Feature sequence668 796 617 gene locus_tag LOCUS_26460 796 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 2129 2004 gene locus_tag LOCUS_26470 2129 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence669 <2272 250 gene locus_tag LOCUS_26480 <2272 250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257190.1:sodium-translocating pyrophosphatase >Feature sequence670 >Feature sequence671 795 484 gene locus_tag LOCUS_26490 795 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 1468 965 gene locus_tag LOCUS_26500 1468 965 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014952.1 protein_id gnl|my_center|LOCUS_26500 >Feature sequence672 >Feature sequence673 1333 182 gene locus_tag LOCUS_26510 1333 182 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878013.1 protein_id gnl|my_center|LOCUS_26510 1534 1767 gene locus_tag LOCUS_26520 1534 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 1767 2000 gene locus_tag LOCUS_26530 1767 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 >Feature sequence674 >Feature sequence675 806 555 gene locus_tag LOCUS_26540 806 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 1228 803 gene locus_tag LOCUS_26550 1228 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 >Feature sequence676 2181 1453 gene locus_tag LOCUS_26560 2181 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 >Feature sequence677 336 94 gene locus_tag LOCUS_26570 336 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 423 1442 gene locus_tag LOCUS_26580 gene cas6 423 1442 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258802.1 protein_id gnl|my_center|LOCUS_26580 1478 1891 gene locus_tag LOCUS_26590 1478 1891 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404877.1 protein_id gnl|my_center|LOCUS_26590 1964 2134 gene locus_tag LOCUS_26600 1964 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence678 1330 752 gene locus_tag LOCUS_26610 1330 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 1570 1331 gene locus_tag LOCUS_26620 1570 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence679 2254 1490 gene locus_tag LOCUS_26630 2254 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence680 1678 887 gene locus_tag LOCUS_26640 1678 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 >Feature sequence681 <1 944 gene locus_tag LOCUS_26650 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064630.1:cell division protein FtsZ 1074 1361 gene locus_tag LOCUS_26660 1074 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 1379 1882 gene locus_tag LOCUS_26670 1379 1882 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250370.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence682 247 876 gene locus_tag LOCUS_26680 247 876 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259489.1 protein_id gnl|my_center|LOCUS_26680 1889 885 gene locus_tag LOCUS_26690 1889 885 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258891.1 protein_id gnl|my_center|LOCUS_26690 2253 1882 gene locus_tag LOCUS_26700 2253 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence683 357 118 gene locus_tag LOCUS_26710 357 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 610 359 gene locus_tag LOCUS_26720 610 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 1690 1857 gene locus_tag LOCUS_26730 1690 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 >Feature sequence684 165 1163 gene locus_tag LOCUS_26740 165 1163 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253036.1 protein_id gnl|my_center|LOCUS_26740 1231 1716 gene locus_tag LOCUS_26750 1231 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 >Feature sequence685 <1 1029 gene locus_tag LOCUS_26760 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020794.1:cysteine--tRNA ligase 1181 2227 gene locus_tag LOCUS_26770 1181 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 >Feature sequence686 >Feature sequence687 <1 969 gene locus_tag LOCUS_26780 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392937.1:iron ABC transporter permease 959 1762 gene locus_tag LOCUS_26790 959 1762 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_26790 >Feature sequence688 2178 310 gene locus_tag LOCUS_26800 gene recQ 2178 310 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941564.1 protein_id gnl|my_center|LOCUS_26800 >Feature sequence689 >Feature sequence690 >Feature sequence691 2031 475 gene locus_tag LOCUS_26810 gene hutH 2031 475 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256862.1 protein_id gnl|my_center|LOCUS_26810 >Feature sequence692 487 1221 gene locus_tag LOCUS_26820 487 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 1649 1239 gene locus_tag LOCUS_26830 1649 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 >Feature sequence693 <2225 1109 gene locus_tag LOCUS_26840 <2225 1109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583272.1:zinc metalloprotease HtpX >Feature sequence694 731 2206 gene locus_tag LOCUS_26850 731 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence695 >Feature sequence696 >Feature sequence697 304 1329 gene locus_tag LOCUS_26860 304 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 1333 1644 gene locus_tag LOCUS_26870 1333 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 >Feature sequence698 2018 153 gene locus_tag LOCUS_26880 2018 153 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251214.1 protein_id gnl|my_center|LOCUS_26880 >Feature sequence699 104 751 gene locus_tag LOCUS_26890 104 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 >Feature sequence700 68 1159 gene locus_tag LOCUS_26900 68 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 2185 1136 gene locus_tag LOCUS_26910 2185 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 >Feature sequence701 <1 1900 gene locus_tag LOCUS_26920 <1 1900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868544.1:DNA topoisomerase I 1860 2078 gene locus_tag LOCUS_26930 1860 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 >Feature sequence702 >Feature sequence703 >Feature sequence704 833 1792 gene locus_tag LOCUS_26940 833 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 >Feature sequence705 513 139 gene locus_tag LOCUS_26950 513 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 1599 541 gene locus_tag LOCUS_26960 1599 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 2150 1674 gene locus_tag LOCUS_26970 2150 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence706 243 1103 gene locus_tag LOCUS_26980 243 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 1231 2166 gene locus_tag LOCUS_26990 1231 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 >Feature sequence707 453 656 gene locus_tag LOCUS_27000 453 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 637 1155 gene locus_tag LOCUS_27010 637 1155 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870488.1 protein_id gnl|my_center|LOCUS_27010 1274 2047 gene locus_tag LOCUS_27020 1274 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 >Feature sequence708 419 243 gene locus_tag LOCUS_27030 419 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 481 843 gene locus_tag LOCUS_27040 481 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 753 980 gene locus_tag LOCUS_27050 753 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 1762 977 gene locus_tag LOCUS_27060 1762 977 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142640.1 protein_id gnl|my_center|LOCUS_27060 >Feature sequence709 1671 1021 gene locus_tag LOCUS_27070 1671 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 >Feature sequence710 >Feature sequence711 <1 1175 gene locus_tag LOCUS_27080 <1 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964979.1:ATP-dependent DNA helicase <2176 1172 gene locus_tag LOCUS_27090 <2176 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016356999.1:RtcB family protein >Feature sequence712 >Feature sequence713 1756 164 gene locus_tag LOCUS_27100 1756 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 2161 1850 gene locus_tag LOCUS_27110 2161 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence714 102 326 gene locus_tag LOCUS_27120 102 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 328 759 gene locus_tag LOCUS_27130 328 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 752 1015 gene locus_tag LOCUS_27140 752 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 996 1160 gene locus_tag LOCUS_27150 996 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 1162 1920 gene locus_tag LOCUS_27160 1162 1920 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082697.1 protein_id gnl|my_center|LOCUS_27160 >Feature sequence715 558 220 gene locus_tag LOCUS_27170 558 220 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978982.1 protein_id gnl|my_center|LOCUS_27170 1000 596 gene locus_tag LOCUS_27180 1000 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 1298 1681 gene locus_tag LOCUS_27190 1298 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 1943 1674 gene locus_tag LOCUS_27200 1943 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 >Feature sequence716 <1 727 gene locus_tag LOCUS_27210 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937646.1:phosphoglycerate dehydrogenase 728 1657 gene locus_tag LOCUS_27220 728 1657 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937649.1 protein_id gnl|my_center|LOCUS_27220 >Feature sequence717 >Feature sequence718 775 1971 gene locus_tag LOCUS_27230 775 1971 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545872.1 protein_id gnl|my_center|LOCUS_27230 >Feature sequence719 <1 1483 gene locus_tag LOCUS_27240 <1 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224004.1:site-specific DNA-methyltransferase 1493 1702 gene locus_tag LOCUS_27250 1493 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence720 986 213 gene locus_tag LOCUS_27260 986 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 1750 1487 gene locus_tag LOCUS_27270 1750 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 1977 1756 gene locus_tag LOCUS_27280 1977 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 >Feature sequence721 >Feature sequence722 <2148 424 gene locus_tag LOCUS_27290 <2148 424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020139.1:endonuclease MutS2 >Feature sequence723 223 867 gene locus_tag LOCUS_27300 223 867 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403961.1 protein_id gnl|my_center|LOCUS_27300 885 2087 gene locus_tag LOCUS_27310 885 2087 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000552083.1 protein_id gnl|my_center|LOCUS_27310 >Feature sequence724 193 1191 gene locus_tag LOCUS_27320 gene prmC 193 1191 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_27320 1238 2059 gene locus_tag LOCUS_27330 gene surE 1238 2059 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250088.1 protein_id gnl|my_center|LOCUS_27330 >Feature sequence725 >Feature sequence726 >Feature sequence727 393 118 gene locus_tag LOCUS_27340 393 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 642 394 gene locus_tag LOCUS_27350 642 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 1179 769 gene locus_tag LOCUS_27360 1179 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 1411 1169 gene locus_tag LOCUS_27370 1411 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 >Feature sequence728 603 1880 gene locus_tag LOCUS_27380 603 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 >Feature sequence729 1953 310 gene locus_tag LOCUS_27390 1953 310 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057022.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence730 >Feature sequence731 793 503 gene locus_tag LOCUS_27400 793 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 1330 1130 gene locus_tag LOCUS_27410 1330 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 1471 1812 gene locus_tag LOCUS_27420 1471 1812 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249913.1 protein_id gnl|my_center|LOCUS_27420 >Feature sequence732 1130 270 gene locus_tag LOCUS_27430 1130 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 1495 1046 gene locus_tag LOCUS_27440 1495 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 2000 1518 gene locus_tag LOCUS_27450 2000 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 >Feature sequence733 1535 549 gene locus_tag LOCUS_27460 1535 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 >Feature sequence734 <1 686 gene locus_tag LOCUS_27470 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_144685205.1:alpha/beta hydrolase 1862 828 gene locus_tag LOCUS_27480 1862 828 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_27480 >Feature sequence735 309 431 gene locus_tag LOCUS_27490 309 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 495 1841 gene locus_tag LOCUS_27500 gene glnA 495 1841 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_27500 >Feature sequence736 1274 189 gene locus_tag LOCUS_27510 1274 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 1956 1255 gene locus_tag LOCUS_27520 1956 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence737 >Feature sequence738 <1 859 gene locus_tag LOCUS_27530 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257663.1:YbaK/EbsC family protein 1991 831 gene locus_tag LOCUS_27540 gene mltG 1991 831 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257814.1 protein_id gnl|my_center|LOCUS_27540 1900 2088 gene locus_tag LOCUS_27550 1900 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 >Feature sequence739 432 773 gene locus_tag LOCUS_27560 432 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 >Feature sequence740 1156 503 gene locus_tag LOCUS_27570 1156 503 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200392305.1 protein_id gnl|my_center|LOCUS_27570 1560 1159 gene locus_tag LOCUS_27580 1560 1159 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_27580 1862 1626 gene locus_tag LOCUS_27590 1862 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 >Feature sequence741 1159 680 gene locus_tag LOCUS_27600 1159 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 1584 1408 gene locus_tag LOCUS_27610 1584 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 1826 1605 gene locus_tag LOCUS_27620 1826 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 2071 1823 gene locus_tag LOCUS_27630 2071 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 >Feature sequence742 <2117 69 gene locus_tag LOCUS_27640 <2117 69 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022478.1:NosD domain-containing protein >Feature sequence743 389 36 gene locus_tag LOCUS_27650 389 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 1006 614 gene locus_tag LOCUS_27660 1006 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 1450 1151 gene locus_tag LOCUS_27670 1450 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 >Feature sequence744 987 1730 gene locus_tag LOCUS_27680 987 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 1747 1971 gene locus_tag LOCUS_27690 1747 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence745 >Feature sequence746 1088 177 gene locus_tag LOCUS_27700 1088 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 1942 1106 gene locus_tag LOCUS_27710 1942 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 >Feature sequence747 425 18 gene locus_tag LOCUS_27720 425 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 2055 415 gene locus_tag LOCUS_27730 2055 415 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_27730 >Feature sequence748 512 1168 gene locus_tag LOCUS_27740 512 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 1143 1721 gene locus_tag LOCUS_27750 1143 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 1772 2107 gene locus_tag LOCUS_27760 1772 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence749 <1 1887 gene locus_tag LOCUS_27770 <1 1887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846340.1:minichromosome maintenance protein MCM >Feature sequence750 >Feature sequence751 181 1122 gene locus_tag LOCUS_27780 181 1122 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060800.1 protein_id gnl|my_center|LOCUS_27780 >Feature sequence752 <1 862 gene locus_tag LOCUS_27790 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942417.1:peptidoglycan DD-metalloendopeptidase family protein >Feature sequence753 1008 529 gene locus_tag LOCUS_27800 1008 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 1352 1657 gene locus_tag LOCUS_27810 1352 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 2032 1661 gene locus_tag LOCUS_27820 2032 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 >Feature sequence754 1 426 gene locus_tag LOCUS_27830 1 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 426 1388 gene locus_tag LOCUS_27840 426 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 1406 1831 gene locus_tag LOCUS_27850 1406 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067432.1 protein_id gnl|my_center|LOCUS_27850 >Feature sequence755 144 1943 gene locus_tag LOCUS_27860 144 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 >Feature sequence756 572 288 gene locus_tag LOCUS_27870 572 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 <2095 703 gene locus_tag LOCUS_27880 <2095 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259097.1:O-antigen ligase family protein >Feature sequence757 134 1507 gene locus_tag LOCUS_27890 134 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 1577 2044 gene locus_tag LOCUS_27900 1577 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 >Feature sequence758 690 932 gene locus_tag LOCUS_27910 690 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 1461 2075 gene locus_tag LOCUS_27920 1461 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 >Feature sequence759 585 466 gene locus_tag LOCUS_27930 585 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 1350 1952 gene locus_tag LOCUS_27940 1350 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 >Feature sequence760 1524 163 gene locus_tag LOCUS_27950 1524 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 >Feature sequence761 <1 591 gene locus_tag LOCUS_27960 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868281.1:nucleotide sugar dehydrogenase 1025 606 gene locus_tag LOCUS_27970 1025 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 1980 1219 gene locus_tag LOCUS_27980 1980 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 >Feature sequence762 132 1145 gene locus_tag LOCUS_27990 132 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 >Feature sequence763 712 293 gene locus_tag LOCUS_28000 712 293 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876762.1 protein_id gnl|my_center|LOCUS_28000 913 831 gene locus_tag LOCUS_t00360 913 831 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1810 1334 gene locus_tag LOCUS_28010 1810 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 >Feature sequence764 1793 423 gene locus_tag LOCUS_28020 1793 423 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence765 1766 1557 gene locus_tag LOCUS_28030 1766 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 >Feature sequence766 >Feature sequence767 <1 1896 gene locus_tag LOCUS_28040 <1 1896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921441.1:cadherin domain-containing protein >Feature sequence768 >Feature sequence769 <1 785 gene locus_tag LOCUS_28050 <1 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_174849896.1:glycosyltransferase family 4 protein >Feature sequence770 <2067 981 gene locus_tag LOCUS_28060 <2067 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245629.1:bacillopeptidase F >Feature sequence771 1250 1483 gene locus_tag LOCUS_28070 1250 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 1742 1951 gene locus_tag LOCUS_28080 1742 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 >Feature sequence772 29 361 gene locus_tag LOCUS_28090 29 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 379 825 gene locus_tag LOCUS_28100 379 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 822 1685 gene locus_tag LOCUS_28110 822 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 >Feature sequence773 1313 567 gene locus_tag LOCUS_28120 1313 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 >Feature sequence774 <1 769 gene locus_tag LOCUS_28130 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528450.1:molybdopterin-dependent oxidoreductase 867 1856 gene locus_tag LOCUS_28140 867 1856 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949070.1 protein_id gnl|my_center|LOCUS_28140 >Feature sequence775 594 316 gene locus_tag LOCUS_28150 594 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 >Feature sequence776 208 1557 gene locus_tag LOCUS_28160 208 1557 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390841.1 protein_id gnl|my_center|LOCUS_28160 1636 1941 gene locus_tag LOCUS_28170 1636 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 >Feature sequence777 >Feature sequence778 1104 181 gene locus_tag LOCUS_28180 1104 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 <2057 1162 gene locus_tag LOCUS_28190 <2057 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583645.1:Ig-like domain-containing protein >Feature sequence779 >Feature sequence780 689 318 gene locus_tag LOCUS_28200 689 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 1058 693 gene locus_tag LOCUS_28210 1058 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 >Feature sequence781 >Feature sequence782 >Feature sequence783 240 28 gene locus_tag LOCUS_28220 240 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 1873 185 gene locus_tag LOCUS_28230 gene nrdD 1873 185 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083208.1 protein_id gnl|my_center|LOCUS_28230 >Feature sequence784 >Feature sequence785 310 188 gene locus_tag LOCUS_28240 310 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 482 282 gene locus_tag LOCUS_28250 482 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 784 455 gene locus_tag LOCUS_28260 784 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 1184 1032 gene locus_tag LOCUS_28270 1184 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 1326 1189 gene locus_tag LOCUS_28280 1326 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 1649 1521 gene locus_tag LOCUS_28290 1649 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 >Feature sequence786 70 1314 gene locus_tag LOCUS_28300 gene ahcY 70 1314 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870905.1 protein_id gnl|my_center|LOCUS_28300 >Feature sequence787 >Feature sequence788 830 639 gene locus_tag LOCUS_28310 830 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 1394 915 gene locus_tag LOCUS_28320 1394 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 >Feature sequence789 769 110 gene locus_tag LOCUS_28330 769 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 1073 762 gene locus_tag LOCUS_28340 1073 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 1300 1118 gene locus_tag LOCUS_28350 1300 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 1493 1293 gene locus_tag LOCUS_28360 1493 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 1746 1495 gene locus_tag LOCUS_28370 1746 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 >Feature sequence790 371 565 gene locus_tag LOCUS_28380 371 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 562 729 gene locus_tag LOCUS_28390 562 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 993 1187 gene locus_tag LOCUS_28400 993 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 1211 1465 gene locus_tag LOCUS_28410 1211 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 >Feature sequence791 >Feature sequence792 1057 677 gene locus_tag LOCUS_28420 gene csx15 1057 677 CDS product CRISPR-associated protein Csx15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257334.1 protein_id gnl|my_center|LOCUS_28420 >Feature sequence793 190 1071 gene locus_tag LOCUS_28430 190 1071 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_28430 1080 1556 gene locus_tag LOCUS_28440 1080 1556 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_28440 >Feature sequence794 >Feature sequence795 >Feature sequence796 1326 82 gene locus_tag LOCUS_28450 gene pgk 1326 82 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061271.1 protein_id gnl|my_center|LOCUS_28450 <2021 1344 gene locus_tag LOCUS_28460 <2021 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948756.1:type I glyceraldehyde-3-phosphate dehydrogenase >Feature sequence797 1229 957 gene locus_tag LOCUS_28470 1229 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 1522 1226 gene locus_tag LOCUS_28480 1522 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 1704 1522 gene locus_tag LOCUS_28490 1704 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 >Feature sequence798 1618 713 gene locus_tag LOCUS_28500 1618 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 >Feature sequence799 >Feature sequence800 686 1699 gene locus_tag LOCUS_28510 686 1699 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122968.1 protein_id gnl|my_center|LOCUS_28510 >Feature sequence801 >Feature sequence802 319 50 gene locus_tag LOCUS_28520 319 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 507 334 gene locus_tag LOCUS_28530 507 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 773 498 gene locus_tag LOCUS_28540 773 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 1066 770 gene locus_tag LOCUS_28550 1066 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 1647 1063 gene locus_tag LOCUS_28560 gene pyrE 1647 1063 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 protein_id gnl|my_center|LOCUS_28560 >Feature sequence803 <2006 816 gene locus_tag LOCUS_28570 <2006 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003022291.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence804 198 506 gene locus_tag LOCUS_28580 gene rpsJ 198 506 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876685.1 protein_id gnl|my_center|LOCUS_28580 <2000 522 gene locus_tag LOCUS_28590 <2000 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868660.1:beta-galactosidase BgaS