>Feature sequence001 1193 738 gene locus_tag LOCUS_00010 1193 738 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250202.1 protein_id gnl|my_center|LOCUS_00010 1689 1174 gene locus_tag LOCUS_00020 1689 1174 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868811.1 protein_id gnl|my_center|LOCUS_00020 2374 1730 gene locus_tag LOCUS_00030 2374 1730 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868707.1 protein_id gnl|my_center|LOCUS_00030 3342 2365 gene locus_tag LOCUS_00040 3342 2365 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251076.1 protein_id gnl|my_center|LOCUS_00040 3508 3359 gene locus_tag LOCUS_00050 3508 3359 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013748365.1 protein_id gnl|my_center|LOCUS_00050 3816 3508 gene locus_tag LOCUS_00060 3816 3508 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875906.1 protein_id gnl|my_center|LOCUS_00060 4306 3770 gene locus_tag LOCUS_00070 4306 3770 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878611.1 protein_id gnl|my_center|LOCUS_00070 4494 4306 gene locus_tag LOCUS_00080 4494 4306 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868804.1 protein_id gnl|my_center|LOCUS_00080 5068 4505 gene locus_tag LOCUS_00090 gene rpoE 5068 4505 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875903.1 protein_id gnl|my_center|LOCUS_00090 5507 5079 gene locus_tag LOCUS_00100 5507 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 6685 5474 gene locus_tag LOCUS_00110 gene eif2g 6685 5474 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875900.1 protein_id gnl|my_center|LOCUS_00110 7066 6689 gene locus_tag LOCUS_00120 7066 6689 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878018.1 protein_id gnl|my_center|LOCUS_00120 8823 7051 gene locus_tag LOCUS_00130 gene infB 8823 7051 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875898.1 protein_id gnl|my_center|LOCUS_00130 9278 8826 gene locus_tag LOCUS_00140 gene ndk 9278 8826 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_00140 9457 9284 gene locus_tag LOCUS_00150 9457 9284 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875896.1 protein_id gnl|my_center|LOCUS_00150 9680 9468 gene locus_tag LOCUS_00160 9680 9468 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867791.1 protein_id gnl|my_center|LOCUS_00160 10062 9691 gene locus_tag LOCUS_00170 gene rpl7ae 10062 9691 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053845.1 protein_id gnl|my_center|LOCUS_00170 10215 10484 gene locus_tag LOCUS_00180 10215 10484 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147167.1 protein_id gnl|my_center|LOCUS_00180 10459 11343 gene locus_tag LOCUS_00190 10459 11343 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250758.1 protein_id gnl|my_center|LOCUS_00190 12747 11740 gene locus_tag LOCUS_00200 12747 11740 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021397.1 protein_id gnl|my_center|LOCUS_00200 12904 13755 gene locus_tag LOCUS_00210 12904 13755 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_00210 13888 15750 gene locus_tag LOCUS_00220 13888 15750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 15756 16514 gene locus_tag LOCUS_00230 gene pstB 15756 16514 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020934.1 protein_id gnl|my_center|LOCUS_00230 16525 17178 gene locus_tag LOCUS_00240 gene phoU 16525 17178 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_00240 >Feature sequence002 115 318 gene locus_tag LOCUS_00250 115 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 1743 484 gene locus_tag LOCUS_00260 gene gdhA 1743 484 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_00260 2140 2065 gene locus_tag LOCUS_t00010 2140 2065 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2200 3192 gene locus_tag LOCUS_00270 2200 3192 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258144.1 protein_id gnl|my_center|LOCUS_00270 3769 3197 gene locus_tag LOCUS_00280 3769 3197 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_00280 4641 3766 gene locus_tag LOCUS_00290 gene folD 4641 3766 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226720.1 protein_id gnl|my_center|LOCUS_00290 5354 4620 gene locus_tag LOCUS_00300 gene purN 5354 4620 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_00300 5970 5344 gene locus_tag LOCUS_00310 5970 5344 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879988.1 protein_id gnl|my_center|LOCUS_00310 6121 8451 gene locus_tag LOCUS_00320 6121 8451 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879160.1 protein_id gnl|my_center|LOCUS_00320 8418 9155 gene locus_tag LOCUS_00330 8418 9155 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083177.1 protein_id gnl|my_center|LOCUS_00330 9155 9910 gene locus_tag LOCUS_00340 9155 9910 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249977.1 protein_id gnl|my_center|LOCUS_00340 10008 10943 gene locus_tag LOCUS_00350 10008 10943 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_00350 11086 12564 gene locus_tag LOCUS_00360 gene cysS 11086 12564 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_00360 <13268 12541 gene locus_tag LOCUS_00370 <13268 12541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867237.1:class I SAM-dependent methyltransferase family protein >Feature sequence003 348 545 gene locus_tag LOCUS_00380 348 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 1004 1210 gene locus_tag LOCUS_00390 1004 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 1131 1427 gene locus_tag LOCUS_00400 1131 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 2295 2098 gene locus_tag LOCUS_00410 2295 2098 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867658.1 protein_id gnl|my_center|LOCUS_00410 2732 2304 gene locus_tag LOCUS_00420 2732 2304 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 protein_id gnl|my_center|LOCUS_00420 3163 2729 gene locus_tag LOCUS_00430 gene rplM 3163 2729 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250452.1 protein_id gnl|my_center|LOCUS_00430 3551 3168 gene locus_tag LOCUS_00440 3551 3168 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869688.1 protein_id gnl|my_center|LOCUS_00440 3647 3571 gene locus_tag LOCUS_t00020 3647 3571 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3725 3650 gene locus_tag LOCUS_t00030 3725 3650 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5255 3711 gene locus_tag LOCUS_00450 5255 3711 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080231.1 protein_id gnl|my_center|LOCUS_00450 5374 5299 gene locus_tag LOCUS_t00040 5374 5299 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5384 5572 gene locus_tag LOCUS_00460 5384 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 6368 5574 gene locus_tag LOCUS_00470 gene cofE 6368 5574 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023428.1 protein_id gnl|my_center|LOCUS_00470 7533 6337 gene locus_tag LOCUS_00480 gene folP 7533 6337 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065738.1 protein_id gnl|my_center|LOCUS_00480 8636 7530 gene locus_tag LOCUS_00490 8636 7530 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870473.1 protein_id gnl|my_center|LOCUS_00490 8677 9423 gene locus_tag LOCUS_00500 8677 9423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 9384 10490 gene locus_tag LOCUS_00510 gene larA 9384 10490 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065079.1 protein_id gnl|my_center|LOCUS_00510 10487 11353 gene locus_tag LOCUS_00520 10487 11353 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876421.1 protein_id gnl|my_center|LOCUS_00520 11358 12329 gene locus_tag LOCUS_00530 11358 12329 CDS product TIGR01177 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876363.1 protein_id gnl|my_center|LOCUS_00530 >Feature sequence004 516 25 gene locus_tag LOCUS_00540 516 25 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878466.1 protein_id gnl|my_center|LOCUS_00540 1678 521 gene locus_tag LOCUS_00550 1678 521 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878467.1 protein_id gnl|my_center|LOCUS_00550 2806 1685 gene locus_tag LOCUS_00560 2806 1685 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081868529.1 protein_id gnl|my_center|LOCUS_00560 3965 3099 gene locus_tag LOCUS_00570 3965 3099 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249652.1 protein_id gnl|my_center|LOCUS_00570 4816 3956 gene locus_tag LOCUS_00580 4816 3956 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867985.1 protein_id gnl|my_center|LOCUS_00580 5208 4798 gene locus_tag LOCUS_00590 5208 4798 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249683.1 protein_id gnl|my_center|LOCUS_00590 6723 5329 gene locus_tag LOCUS_00600 6723 5329 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868207.1 protein_id gnl|my_center|LOCUS_00600 7828 6737 gene locus_tag LOCUS_00610 7828 6737 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877631.1 protein_id gnl|my_center|LOCUS_00610 7871 9553 gene locus_tag LOCUS_00620 7871 9553 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545924.1 protein_id gnl|my_center|LOCUS_00620 9554 10891 gene locus_tag LOCUS_00630 9554 10891 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877907.1 protein_id gnl|my_center|LOCUS_00630 11644 10847 gene locus_tag LOCUS_00640 gene folE2 11644 10847 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582988.1 protein_id gnl|my_center|LOCUS_00640 12059 11703 gene locus_tag LOCUS_00650 gene queD 12059 11703 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065925.1 protein_id gnl|my_center|LOCUS_00650 12316 12056 gene locus_tag LOCUS_00660 12316 12056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 >Feature sequence005 <1 696 gene locus_tag LOCUS_00670 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869672.1:50S ribosomal protein L4 697 957 gene locus_tag LOCUS_00680 697 957 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867462.1 protein_id gnl|my_center|LOCUS_00680 961 1689 gene locus_tag LOCUS_00690 961 1689 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875647.1 protein_id gnl|my_center|LOCUS_00690 1695 2102 gene locus_tag LOCUS_00700 gene rpsS 1695 2102 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875648.1 protein_id gnl|my_center|LOCUS_00700 2118 2585 gene locus_tag LOCUS_00710 gene rplV 2118 2585 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875649.1 protein_id gnl|my_center|LOCUS_00710 2590 3318 gene locus_tag LOCUS_00720 2590 3318 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875650.1 protein_id gnl|my_center|LOCUS_00720 3275 3478 gene locus_tag LOCUS_00730 gene rpmC 3275 3478 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869962.1 protein_id gnl|my_center|LOCUS_00730 3512 3820 gene locus_tag LOCUS_00740 gene yciH 3512 3820 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875652.1 protein_id gnl|my_center|LOCUS_00740 3820 4086 gene locus_tag LOCUS_00750 3820 4086 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869964.1 protein_id gnl|my_center|LOCUS_00750 4083 4409 gene locus_tag LOCUS_00760 4083 4409 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869965.1 protein_id gnl|my_center|LOCUS_00760 4415 4834 gene locus_tag LOCUS_00770 4415 4834 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875655.1 protein_id gnl|my_center|LOCUS_00770 4847 5215 gene locus_tag LOCUS_00780 gene rplX 4847 5215 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867452.1 protein_id gnl|my_center|LOCUS_00780 5220 5930 gene locus_tag LOCUS_00790 5220 5930 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869968.1 protein_id gnl|my_center|LOCUS_00790 5943 6476 gene locus_tag LOCUS_00800 5943 6476 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250479.1 protein_id gnl|my_center|LOCUS_00800 6466 6621 gene locus_tag LOCUS_00810 6466 6621 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295326.1 protein_id gnl|my_center|LOCUS_00810 6635 7027 gene locus_tag LOCUS_00820 6635 7027 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867448.1 protein_id gnl|my_center|LOCUS_00820 7038 7598 gene locus_tag LOCUS_00830 7038 7598 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867447.1 protein_id gnl|my_center|LOCUS_00830 7595 7972 gene locus_tag LOCUS_00840 7595 7972 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869973.1 protein_id gnl|my_center|LOCUS_00840 7978 8448 gene locus_tag LOCUS_00850 7978 8448 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496504.1 protein_id gnl|my_center|LOCUS_00850 8432 9013 gene locus_tag LOCUS_00860 8432 9013 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875664.1 protein_id gnl|my_center|LOCUS_00860 9018 9635 gene locus_tag LOCUS_00870 gene rpsE 9018 9635 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192961070.1 protein_id gnl|my_center|LOCUS_00870 9628 10104 gene locus_tag LOCUS_00880 9628 10104 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867442.1 protein_id gnl|my_center|LOCUS_00880 10118 10555 gene locus_tag LOCUS_00890 10118 10555 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875667.1 protein_id gnl|my_center|LOCUS_00890 10548 11975 gene locus_tag LOCUS_00900 gene secY 10548 11975 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867440.1 protein_id gnl|my_center|LOCUS_00900 11993 12574 gene locus_tag LOCUS_00910 11993 12574 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875670.1 protein_id gnl|my_center|LOCUS_00910 >Feature sequence006 2333 1083 gene locus_tag LOCUS_00920 2333 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 3393 2671 gene locus_tag LOCUS_00930 3393 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 3443 4111 gene locus_tag LOCUS_00940 3443 4111 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867891.1 protein_id gnl|my_center|LOCUS_00940 4104 4460 gene locus_tag LOCUS_00950 4104 4460 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248986.1 protein_id gnl|my_center|LOCUS_00950 4426 4761 gene locus_tag LOCUS_00960 4426 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 4745 5194 gene locus_tag LOCUS_00970 4745 5194 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870197.1 protein_id gnl|my_center|LOCUS_00970 5200 5523 gene locus_tag LOCUS_00980 5200 5523 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877223.1 protein_id gnl|my_center|LOCUS_00980 5524 5679 gene locus_tag LOCUS_00990 5524 5679 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868637.1 protein_id gnl|my_center|LOCUS_00990 5692 5970 gene locus_tag LOCUS_01000 5692 5970 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250271.1 protein_id gnl|my_center|LOCUS_01000 5949 6620 gene locus_tag LOCUS_01010 5949 6620 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024003.1 protein_id gnl|my_center|LOCUS_01010 6626 6880 gene locus_tag LOCUS_01020 gene rpl18a 6626 6880 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061100.1 protein_id gnl|my_center|LOCUS_01020 6972 7289 gene locus_tag LOCUS_01030 6972 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 7276 8157 gene locus_tag LOCUS_01040 gene ftsY 7276 8157 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867626.1 protein_id gnl|my_center|LOCUS_01040 8159 9484 gene locus_tag LOCUS_01050 8159 9484 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250437.1 protein_id gnl|my_center|LOCUS_01050 9481 10791 gene locus_tag LOCUS_01060 9481 10791 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496374.1 protein_id gnl|my_center|LOCUS_01060 10793 11086 gene locus_tag LOCUS_01070 10793 11086 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869531.1 protein_id gnl|my_center|LOCUS_01070 11083 11421 gene locus_tag LOCUS_01080 11083 11421 CDS product RNA polymerase Rpb4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902841.1 protein_id gnl|my_center|LOCUS_01080 11428 12036 gene locus_tag LOCUS_01090 11428 12036 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867500.1 protein_id gnl|my_center|LOCUS_01090 >Feature sequence007 169 1146 gene locus_tag LOCUS_01100 169 1146 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876818.1 protein_id gnl|my_center|LOCUS_01100 2293 1112 gene locus_tag LOCUS_01110 2293 1112 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868844.1 protein_id gnl|my_center|LOCUS_01110 3430 2294 gene locus_tag LOCUS_01120 3430 2294 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868754.1 protein_id gnl|my_center|LOCUS_01120 3544 4146 gene locus_tag LOCUS_01130 gene psmB 3544 4146 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867872.1 protein_id gnl|my_center|LOCUS_01130 4139 5008 gene locus_tag LOCUS_01140 4139 5008 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013188.1 protein_id gnl|my_center|LOCUS_01140 5013 5576 gene locus_tag LOCUS_01150 5013 5576 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_01150 6245 5577 gene locus_tag LOCUS_01160 6245 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 6338 7111 gene locus_tag LOCUS_01170 gene dph5 6338 7111 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868439.1 protein_id gnl|my_center|LOCUS_01170 7480 7229 gene locus_tag LOCUS_01180 7480 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 8239 7730 gene locus_tag LOCUS_01190 8239 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 9537 8242 gene locus_tag LOCUS_01200 gene glyA 9537 8242 CDS product bifunctional serine hydroxymethyltransferase/L-allo-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871121.1 protein_id gnl|my_center|LOCUS_01200 9608 10702 gene locus_tag LOCUS_01210 gene gcvT 9608 10702 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583865.1 protein_id gnl|my_center|LOCUS_01210 10699 11091 gene locus_tag LOCUS_01220 gene gcvH 10699 11091 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146698.1 protein_id gnl|my_center|LOCUS_01220 11094 12431 gene locus_tag LOCUS_01230 gene gcvPA 11094 12431 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250331.1 protein_id gnl|my_center|LOCUS_01230 >Feature sequence008 <1 850 gene locus_tag LOCUS_01240 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876249.1:NAD(P)-dependent glycerol-1-phosphate dehydrogenase 863 1300 gene locus_tag LOCUS_01250 863 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 1934 1269 gene locus_tag LOCUS_01260 1934 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 2222 3208 gene locus_tag LOCUS_01270 2222 3208 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146738.1 protein_id gnl|my_center|LOCUS_01270 3210 4298 gene locus_tag LOCUS_01280 3210 4298 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870036.1 protein_id gnl|my_center|LOCUS_01280 4300 5028 gene locus_tag LOCUS_01290 4300 5028 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250847.1 protein_id gnl|my_center|LOCUS_01290 5043 5411 gene locus_tag LOCUS_01300 5043 5411 CDS product DUF473 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867249.1 protein_id gnl|my_center|LOCUS_01300 6009 5380 gene locus_tag LOCUS_01310 6009 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 7051 6095 gene locus_tag LOCUS_01320 7051 6095 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867671.1 protein_id gnl|my_center|LOCUS_01320 7176 8261 gene locus_tag LOCUS_01330 7176 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 8500 8258 gene locus_tag LOCUS_01340 8500 8258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 8537 9784 gene locus_tag LOCUS_01350 gene wecB 8537 9784 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867673.1 protein_id gnl|my_center|LOCUS_01350 9781 10623 gene locus_tag LOCUS_01360 9781 10623 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496485.1 protein_id gnl|my_center|LOCUS_01360 11035 10532 gene locus_tag LOCUS_01370 11035 10532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 11125 12027 gene locus_tag LOCUS_01380 gene dph2 11125 12027 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250878.1 protein_id gnl|my_center|LOCUS_01380 >Feature sequence009 666 2966 gene locus_tag LOCUS_01390 666 2966 CDS product tRNA(Met) cytidine acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249705.1 protein_id gnl|my_center|LOCUS_01390 2986 3579 gene locus_tag LOCUS_01400 2986 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 3766 3569 gene locus_tag LOCUS_01410 3766 3569 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762842.1 protein_id gnl|my_center|LOCUS_01410 3846 4619 gene locus_tag LOCUS_01420 3846 4619 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250279.1 protein_id gnl|my_center|LOCUS_01420 4619 5419 gene locus_tag LOCUS_01430 4619 5419 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020633.1 protein_id gnl|my_center|LOCUS_01430 5416 5565 gene locus_tag LOCUS_01440 5416 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 5562 5942 gene locus_tag LOCUS_01450 5562 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 5932 7509 gene locus_tag LOCUS_01460 5932 7509 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496733.1 protein_id gnl|my_center|LOCUS_01460 7992 7522 gene locus_tag LOCUS_01470 7992 7522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 10069 8006 gene locus_tag LOCUS_01480 10069 8006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 >Feature sequence010 <1 1401 gene locus_tag LOCUS_01490 <1 1401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868896.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPB 1376 2500 gene locus_tag LOCUS_01500 1376 2500 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146565.1 protein_id gnl|my_center|LOCUS_01500 3605 2484 gene locus_tag LOCUS_01510 gene thiI 3605 2484 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958056.1 protein_id gnl|my_center|LOCUS_01510 4874 3642 gene locus_tag LOCUS_01520 gene larA 4874 3642 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_01520 4959 5387 gene locus_tag LOCUS_01530 gene trxA 4959 5387 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_01530 5388 6332 gene locus_tag LOCUS_01540 gene trxB 5388 6332 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846363.1 protein_id gnl|my_center|LOCUS_01540 6388 6936 gene locus_tag LOCUS_01550 6388 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 7570 6884 gene locus_tag LOCUS_01560 7570 6884 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496768.1 protein_id gnl|my_center|LOCUS_01560 7622 8542 gene locus_tag LOCUS_01570 7622 8542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 8943 8557 gene locus_tag LOCUS_01580 8943 8557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 9211 9429 gene locus_tag LOCUS_01590 9211 9429 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295846.1 protein_id gnl|my_center|LOCUS_01590 9450 9638 gene locus_tag LOCUS_01600 9450 9638 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869590.1 protein_id gnl|my_center|LOCUS_01600 9643 10365 gene locus_tag LOCUS_01610 9643 10365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 >Feature sequence011 1045 308 gene locus_tag LOCUS_01620 1045 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 3065 1074 gene locus_tag LOCUS_01630 3065 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 5866 3131 gene locus_tag LOCUS_01640 gene alaS 5866 3131 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250518.1 protein_id gnl|my_center|LOCUS_01640 7002 5863 gene locus_tag LOCUS_01650 7002 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 7077 8252 gene locus_tag LOCUS_01660 7077 8252 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_01660 8256 9113 gene locus_tag LOCUS_01670 8256 9113 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538869.1 protein_id gnl|my_center|LOCUS_01670 9094 9864 gene locus_tag LOCUS_01680 9094 9864 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_01680 >Feature sequence012 70 381 gene locus_tag LOCUS_01690 gene eif1A 70 381 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876635.1 protein_id gnl|my_center|LOCUS_01690 398 1168 gene locus_tag LOCUS_01700 398 1168 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060945.1 protein_id gnl|my_center|LOCUS_01700 1169 1729 gene locus_tag LOCUS_01710 1169 1729 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867717.1 protein_id gnl|my_center|LOCUS_01710 1749 3530 gene locus_tag LOCUS_01720 gene top6B 1749 3530 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249750.1 protein_id gnl|my_center|LOCUS_01720 3490 4575 gene locus_tag LOCUS_01730 3490 4575 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867719.1 protein_id gnl|my_center|LOCUS_01730 4585 5013 gene locus_tag LOCUS_01740 4585 5013 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064389.1 protein_id gnl|my_center|LOCUS_01740 5015 5728 gene locus_tag LOCUS_01750 5015 5728 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064937.1 protein_id gnl|my_center|LOCUS_01750 5950 7266 gene locus_tag LOCUS_01760 5950 7266 CDS product bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880881.1 protein_id gnl|my_center|LOCUS_01760 8134 7235 gene locus_tag LOCUS_01770 8134 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 8634 8206 gene locus_tag LOCUS_01780 gene ribH 8634 8206 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877002.1 protein_id gnl|my_center|LOCUS_01780 8706 9974 gene locus_tag LOCUS_01790 gene thiC 8706 9974 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979932.1 protein_id gnl|my_center|LOCUS_01790 >Feature sequence013 136 1047 gene locus_tag LOCUS_01800 136 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 2145 1033 gene locus_tag LOCUS_01810 2145 1033 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289408.1 protein_id gnl|my_center|LOCUS_01810 2506 2150 gene locus_tag LOCUS_01820 2506 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 2567 3598 gene locus_tag LOCUS_01830 2567 3598 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064350.1 protein_id gnl|my_center|LOCUS_01830 3600 3749 gene locus_tag LOCUS_01840 3600 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 3811 3972 gene locus_tag LOCUS_01850 3811 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 4001 4684 gene locus_tag LOCUS_01860 4001 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 4685 5479 gene locus_tag LOCUS_01870 4685 5479 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762797.1 protein_id gnl|my_center|LOCUS_01870 5454 6626 gene locus_tag LOCUS_01880 gene lysA 5454 6626 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_01880 6628 7563 gene locus_tag LOCUS_01890 6628 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 7569 7952 gene locus_tag LOCUS_01900 7569 7952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 8425 7949 gene locus_tag LOCUS_01910 8425 7949 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061166.1 protein_id gnl|my_center|LOCUS_01910 8946 8422 gene locus_tag LOCUS_01920 8946 8422 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878302.1 protein_id gnl|my_center|LOCUS_01920 9241 8948 gene locus_tag LOCUS_01930 9241 8948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 >Feature sequence014 1004 837 gene locus_tag LOCUS_01940 1004 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 1070 1360 gene locus_tag LOCUS_01950 1070 1360 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868393.1 protein_id gnl|my_center|LOCUS_01950 1511 2653 gene locus_tag LOCUS_01960 1511 2653 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289408.1 protein_id gnl|my_center|LOCUS_01960 2703 3854 gene locus_tag LOCUS_01970 2703 3854 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064350.1 protein_id gnl|my_center|LOCUS_01970 3866 4774 gene locus_tag LOCUS_01980 3866 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 4826 5941 gene locus_tag LOCUS_01990 4826 5941 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870204.1 protein_id gnl|my_center|LOCUS_01990 5946 6758 gene locus_tag LOCUS_02000 5946 6758 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060939.1 protein_id gnl|my_center|LOCUS_02000 6772 8454 gene locus_tag LOCUS_02010 gene glyS 6772 8454 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867676.1 protein_id gnl|my_center|LOCUS_02010 >Feature sequence015 2574 1384 gene locus_tag LOCUS_02020 gene prf1 2574 1384 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_02020 3886 2642 gene locus_tag LOCUS_02030 gene pan 3886 2642 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879468.1 protein_id gnl|my_center|LOCUS_02030 3986 4471 gene locus_tag LOCUS_02040 3986 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 4476 4889 gene locus_tag LOCUS_02050 4476 4889 CDS product DUF2209 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869587.1 protein_id gnl|my_center|LOCUS_02050 4855 6102 gene locus_tag LOCUS_02060 gene hflX 4855 6102 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755955.1 protein_id gnl|my_center|LOCUS_02060 6105 8570 gene locus_tag LOCUS_02070 6105 8570 CDS product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867178.1 protein_id gnl|my_center|LOCUS_02070 9368 8583 gene locus_tag LOCUS_02080 9368 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 >Feature sequence016 834 472 gene locus_tag LOCUS_02090 834 472 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978412.1 protein_id gnl|my_center|LOCUS_02090 1088 831 gene locus_tag LOCUS_02100 gene pcc1 1088 831 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146522.1 protein_id gnl|my_center|LOCUS_02100 1602 1066 gene locus_tag LOCUS_02110 1602 1066 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249568.1 protein_id gnl|my_center|LOCUS_02110 1736 1599 gene locus_tag LOCUS_02120 1736 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 2008 1733 gene locus_tag LOCUS_02130 2008 1733 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867396.1 protein_id gnl|my_center|LOCUS_02130 2828 2010 gene locus_tag LOCUS_02140 gene rrp42 2828 2010 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250584.1 protein_id gnl|my_center|LOCUS_02140 3585 2830 gene locus_tag LOCUS_02150 gene rrp41 3585 2830 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867734.1 protein_id gnl|my_center|LOCUS_02150 4375 3521 gene locus_tag LOCUS_02160 gene rrp4 4375 3521 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876323.1 protein_id gnl|my_center|LOCUS_02160 4980 4267 gene locus_tag LOCUS_02170 4980 4267 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877998.1 protein_id gnl|my_center|LOCUS_02170 5709 4981 gene locus_tag LOCUS_02180 gene psmA 5709 4981 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876325.1 protein_id gnl|my_center|LOCUS_02180 6047 5709 gene locus_tag LOCUS_02190 6047 5709 CDS product ribonuclease P protein component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146610.1 protein_id gnl|my_center|LOCUS_02190 6620 6051 gene locus_tag LOCUS_02200 6620 6051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 6984 6610 gene locus_tag LOCUS_02210 6984 6610 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879807.1 protein_id gnl|my_center|LOCUS_02210 7563 6988 gene locus_tag LOCUS_02220 7563 6988 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867981.1 protein_id gnl|my_center|LOCUS_02220 8458 7556 gene locus_tag LOCUS_02230 8458 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 <9249 8463 gene locus_tag LOCUS_02240 <9249 8463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496963.1:redox-regulated ATPase YchF >Feature sequence017 981 292 gene locus_tag LOCUS_02250 981 292 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147245.1 protein_id gnl|my_center|LOCUS_02250 3148 989 gene locus_tag LOCUS_02260 3148 989 CDS product hydrophobe/amphiphile efflux-3 (HAE3) family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868797.1 protein_id gnl|my_center|LOCUS_02260 4981 3161 gene locus_tag LOCUS_02270 4981 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 5406 5059 gene locus_tag LOCUS_02280 5406 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 5600 7024 gene locus_tag LOCUS_02290 5600 7024 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064511.1 protein_id gnl|my_center|LOCUS_02290 8212 7004 gene locus_tag LOCUS_02300 8212 7004 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787649.1 protein_id gnl|my_center|LOCUS_02300 9062 8214 gene locus_tag LOCUS_02310 9062 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 >Feature sequence018 572 646 gene locus_tag LOCUS_t00050 572 646 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1423 662 gene locus_tag LOCUS_02320 1423 662 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318933.1 protein_id gnl|my_center|LOCUS_02320 2929 1424 gene locus_tag LOCUS_02330 2929 1424 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_02330 3150 4307 gene locus_tag LOCUS_02340 gene thiI 3150 4307 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249323.1 protein_id gnl|my_center|LOCUS_02340 4353 4910 gene locus_tag LOCUS_02350 4353 4910 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393578.1 protein_id gnl|my_center|LOCUS_02350 5364 4888 gene locus_tag LOCUS_02360 5364 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 5423 6325 gene locus_tag LOCUS_02370 5423 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 6591 6322 gene locus_tag LOCUS_02380 6591 6322 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249517.1 protein_id gnl|my_center|LOCUS_02380 7367 6738 gene locus_tag LOCUS_02390 7367 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 >Feature sequence019 1029 442 gene locus_tag LOCUS_02400 1029 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 1821 1048 gene locus_tag LOCUS_02410 1821 1048 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868514.1 protein_id gnl|my_center|LOCUS_02410 1907 2773 gene locus_tag LOCUS_02420 gene cyoE 1907 2773 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879528.1 protein_id gnl|my_center|LOCUS_02420 2799 3074 gene locus_tag LOCUS_02430 2799 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 3967 3116 gene locus_tag LOCUS_02440 3967 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 4321 4118 gene locus_tag LOCUS_02450 gene hpkB 4321 4118 CDS product archaeal histone HpkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251239.1 protein_id gnl|my_center|LOCUS_02450 4425 4631 gene locus_tag LOCUS_02460 4425 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 4543 5316 gene locus_tag LOCUS_02470 4543 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 6498 5359 gene locus_tag LOCUS_02480 6498 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258901.1 protein_id gnl|my_center|LOCUS_02480 8388 6499 gene locus_tag LOCUS_02490 8388 6499 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_02490 >Feature sequence020 569 420 gene locus_tag LOCUS_02500 569 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 778 593 gene locus_tag LOCUS_02510 778 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 1956 1869 gene locus_tag LOCUS_t00060 1956 1869 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3423 2080 gene locus_tag LOCUS_02520 3423 2080 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147232.1 protein_id gnl|my_center|LOCUS_02520 4320 3511 gene locus_tag LOCUS_02530 4320 3511 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879771.1 protein_id gnl|my_center|LOCUS_02530 4712 4320 gene locus_tag LOCUS_02540 4712 4320 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250455.1 protein_id gnl|my_center|LOCUS_02540 5235 4717 gene locus_tag LOCUS_02550 5235 4717 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250456.1 protein_id gnl|my_center|LOCUS_02550 5731 5273 gene locus_tag LOCUS_02560 5731 5273 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869684.1 protein_id gnl|my_center|LOCUS_02560 5835 5750 gene locus_tag LOCUS_t00070 5835 5750 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7245 5896 gene locus_tag LOCUS_02570 gene ctpM 7245 5896 CDS product radical SAM/SPASM domain Clo7bot peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948312.1 protein_id gnl|my_center|LOCUS_02570 7503 7249 gene locus_tag LOCUS_02580 7503 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 8199 7606 gene locus_tag LOCUS_02590 8199 7606 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867650.1 protein_id gnl|my_center|LOCUS_02590 >Feature sequence021 688 293 gene locus_tag LOCUS_02600 gene eif5A 688 293 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876502.1 protein_id gnl|my_center|LOCUS_02600 716 1489 gene locus_tag LOCUS_02610 716 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 1482 2315 gene locus_tag LOCUS_02620 1482 2315 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876505.1 protein_id gnl|my_center|LOCUS_02620 2312 2851 gene locus_tag LOCUS_02630 2312 2851 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249292.1 protein_id gnl|my_center|LOCUS_02630 2826 3401 gene locus_tag LOCUS_02640 2826 3401 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022488.1 protein_id gnl|my_center|LOCUS_02640 4370 3387 gene locus_tag LOCUS_02650 4370 3387 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876885.1 protein_id gnl|my_center|LOCUS_02650 5511 4372 gene locus_tag LOCUS_02660 5511 4372 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251072.1 protein_id gnl|my_center|LOCUS_02660 5975 5487 gene locus_tag LOCUS_02670 5975 5487 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084126250.1 protein_id gnl|my_center|LOCUS_02670 6010 6726 gene locus_tag LOCUS_02680 6010 6726 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146572.1 protein_id gnl|my_center|LOCUS_02680 7035 6712 gene locus_tag LOCUS_02690 7035 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 <8336 7047 gene locus_tag LOCUS_02700 <8336 7047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878793.1:CDC48 family AAA ATPase >Feature sequence022 374 784 gene locus_tag LOCUS_02710 374 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 778 1320 gene locus_tag LOCUS_02720 778 1320 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060754.1 protein_id gnl|my_center|LOCUS_02720 2605 1352 gene locus_tag LOCUS_02730 2605 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 4021 2978 gene locus_tag LOCUS_02740 gene ftsZ 4021 2978 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496560.1 protein_id gnl|my_center|LOCUS_02740 4215 4036 gene locus_tag LOCUS_02750 4215 4036 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868406.1 protein_id gnl|my_center|LOCUS_02750 5380 4643 gene locus_tag LOCUS_02760 5380 4643 CDS product GTP cyclohydrolase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869640.1 protein_id gnl|my_center|LOCUS_02760 5431 6657 gene locus_tag LOCUS_02770 5431 6657 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868848.1 protein_id gnl|my_center|LOCUS_02770 6650 7525 gene locus_tag LOCUS_02780 6650 7525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 7544 7729 gene locus_tag LOCUS_02790 7544 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 >Feature sequence023 2062 575 gene locus_tag LOCUS_02800 2062 575 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876381.1 protein_id gnl|my_center|LOCUS_02800 2525 1944 gene locus_tag LOCUS_02810 2525 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 3027 2518 gene locus_tag LOCUS_02820 3027 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 3058 4194 gene locus_tag LOCUS_02830 3058 4194 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978258.1 protein_id gnl|my_center|LOCUS_02830 4325 5038 gene locus_tag LOCUS_02840 4325 5038 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_02840 5095 5619 gene locus_tag LOCUS_02850 5095 5619 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_02850 5612 6376 gene locus_tag LOCUS_02860 5612 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 7501 6296 gene locus_tag LOCUS_02870 7501 6296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 8179 7502 gene locus_tag LOCUS_02880 8179 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 >Feature sequence024 67 702 gene locus_tag LOCUS_02890 gene psmB 67 702 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870749.1 protein_id gnl|my_center|LOCUS_02890 704 2641 gene locus_tag LOCUS_02900 704 2641 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146646.1 protein_id gnl|my_center|LOCUS_02900 3054 2650 gene locus_tag LOCUS_02910 3054 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 3133 3681 gene locus_tag LOCUS_02920 3133 3681 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909135.1 protein_id gnl|my_center|LOCUS_02920 3713 4045 gene locus_tag LOCUS_02930 3713 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 4047 4376 gene locus_tag LOCUS_02940 4047 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 4407 5198 gene locus_tag LOCUS_02950 4407 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 5668 5192 gene locus_tag LOCUS_02960 5668 5192 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876288.1 protein_id gnl|my_center|LOCUS_02960 5739 6470 gene locus_tag LOCUS_02970 5739 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 6581 6494 gene locus_tag LOCUS_t00080 6581 6494 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7035 6841 gene locus_tag LOCUS_02980 7035 6841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 7568 7113 gene locus_tag LOCUS_02990 7568 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 7997 7740 gene locus_tag LOCUS_03000 7997 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 >Feature sequence025 1423 2454 gene locus_tag LOCUS_03010 gene hypE 1423 2454 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870181.1 protein_id gnl|my_center|LOCUS_03010 2601 2677 gene locus_tag LOCUS_t00090 2601 2677 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3262 2822 gene locus_tag LOCUS_03020 3262 2822 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921211.1 protein_id gnl|my_center|LOCUS_03020 3252 4547 gene locus_tag LOCUS_03030 3252 4547 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978992.1 protein_id gnl|my_center|LOCUS_03030 5208 4531 gene locus_tag LOCUS_03040 5208 4531 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249248.1 protein_id gnl|my_center|LOCUS_03040 7040 5205 gene locus_tag LOCUS_03050 7040 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 7702 7088 gene locus_tag LOCUS_03060 gene tmk 7702 7088 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 protein_id gnl|my_center|LOCUS_03060 >Feature sequence026 540 244 gene locus_tag LOCUS_03070 540 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 2065 626 gene locus_tag LOCUS_03080 2065 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 2275 2075 gene locus_tag LOCUS_03090 2275 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 2572 2330 gene locus_tag LOCUS_03100 2572 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 2929 2582 gene locus_tag LOCUS_03110 2929 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 3129 2926 gene locus_tag LOCUS_03120 3129 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 3462 3142 gene locus_tag LOCUS_03130 3462 3142 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064265.1 protein_id gnl|my_center|LOCUS_03130 4072 3422 gene locus_tag LOCUS_03140 4072 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 4842 4069 gene locus_tag LOCUS_03150 4842 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 5644 4922 gene locus_tag LOCUS_03160 5644 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 6098 5625 gene locus_tag LOCUS_03170 6098 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 6819 6082 gene locus_tag LOCUS_03180 6819 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 7755 6904 gene locus_tag LOCUS_03190 7755 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 7930 7760 gene locus_tag LOCUS_03200 7930 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 >Feature sequence027 2 946 gene locus_tag LOCUS_03210 2 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 943 2328 gene locus_tag LOCUS_03220 gene purB 943 2328 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496668.1 protein_id gnl|my_center|LOCUS_03220 2361 2690 gene locus_tag LOCUS_03230 2361 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 3399 5405 gene locus_tag LOCUS_03240 3399 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 6556 5402 gene locus_tag LOCUS_03250 gene amrS 6556 5402 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249844.1 protein_id gnl|my_center|LOCUS_03250 >Feature sequence028 5345 2460 gene locus_tag LOCUS_03260 5345 2460 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890482.1 protein_id gnl|my_center|LOCUS_03260 5507 5959 gene locus_tag LOCUS_03270 5507 5959 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879842.1 protein_id gnl|my_center|LOCUS_03270 5956 7041 gene locus_tag LOCUS_03280 5956 7041 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978090.1 protein_id gnl|my_center|LOCUS_03280 7052 7681 gene locus_tag LOCUS_03290 7052 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 >Feature sequence029 693 46 gene locus_tag LOCUS_03300 693 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 1640 699 gene locus_tag LOCUS_03310 1640 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 2599 1706 gene locus_tag LOCUS_03320 2599 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 2781 3668 gene locus_tag LOCUS_03330 2781 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978174.1 protein_id gnl|my_center|LOCUS_03330 4659 3652 gene locus_tag LOCUS_03340 4659 3652 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_03340 4998 4777 gene locus_tag LOCUS_03350 4998 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 6682 5036 gene locus_tag LOCUS_03360 gene thsB 6682 5036 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867141.1 protein_id gnl|my_center|LOCUS_03360 7111 6950 gene locus_tag LOCUS_03370 7111 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 7418 7089 gene locus_tag LOCUS_03380 7418 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 >Feature sequence030 15 926 gene locus_tag LOCUS_03390 15 926 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868784.1 protein_id gnl|my_center|LOCUS_03390 1460 927 gene locus_tag LOCUS_03400 1460 927 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881202.1 protein_id gnl|my_center|LOCUS_03400 1887 1462 gene locus_tag LOCUS_03410 1887 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 2307 1939 gene locus_tag LOCUS_03420 2307 1939 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881204.1 protein_id gnl|my_center|LOCUS_03420 2363 2725 gene locus_tag LOCUS_03430 2363 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 2719 3237 gene locus_tag LOCUS_03440 2719 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 5121 3238 gene locus_tag LOCUS_03450 gene metG 5121 3238 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876226.1 protein_id gnl|my_center|LOCUS_03450 5300 6571 gene locus_tag LOCUS_03460 gene dadD 5300 6571 CDS product multifunctional 5'-deoxyadenosine/S-adenosyl-L-homocysteine/5'-methylthioadenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871065.1 protein_id gnl|my_center|LOCUS_03460 >Feature sequence031 71 373 gene locus_tag LOCUS_03470 71 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 366 620 gene locus_tag LOCUS_03480 366 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 1484 621 gene locus_tag LOCUS_03490 gene sucD 1484 621 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879674.1 protein_id gnl|my_center|LOCUS_03490 2595 1468 gene locus_tag LOCUS_03500 gene sucC 2595 1468 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876667.1 protein_id gnl|my_center|LOCUS_03500 2652 3521 gene locus_tag LOCUS_03510 2652 3521 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877341.1 protein_id gnl|my_center|LOCUS_03510 3518 4114 gene locus_tag LOCUS_03520 3518 4114 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240327.1 protein_id gnl|my_center|LOCUS_03520 4111 5412 gene locus_tag LOCUS_03530 4111 5412 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763469.1 protein_id gnl|my_center|LOCUS_03530 5484 5942 gene locus_tag LOCUS_03540 5484 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 5924 6289 gene locus_tag LOCUS_03550 5924 6289 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320028.1 protein_id gnl|my_center|LOCUS_03550 6871 6251 gene locus_tag LOCUS_03560 6871 6251 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249090.1 protein_id gnl|my_center|LOCUS_03560 <7589 6855 gene locus_tag LOCUS_03570 <7589 6855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249091.1:indolepyruvate ferredoxin oxidoreductase subunit alpha >Feature sequence032 554 826 gene locus_tag LOCUS_03580 554 826 CDS product HgcAB-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877983.1 protein_id gnl|my_center|LOCUS_03580 2085 937 gene locus_tag LOCUS_03590 2085 937 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249077.1 protein_id gnl|my_center|LOCUS_03590 2363 2088 gene locus_tag LOCUS_03600 2363 2088 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064609.1 protein_id gnl|my_center|LOCUS_03600 2812 2360 gene locus_tag LOCUS_03610 2812 2360 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867435.1 protein_id gnl|my_center|LOCUS_03610 4378 2813 gene locus_tag LOCUS_03620 4378 2813 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877784.1 protein_id gnl|my_center|LOCUS_03620 4427 4990 gene locus_tag LOCUS_03630 4427 4990 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978946.1 protein_id gnl|my_center|LOCUS_03630 4968 5372 gene locus_tag LOCUS_03640 4968 5372 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146774.1 protein_id gnl|my_center|LOCUS_03640 5374 6099 gene locus_tag LOCUS_03650 5374 6099 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496786.1 protein_id gnl|my_center|LOCUS_03650 >Feature sequence033 2430 1105 gene locus_tag LOCUS_03660 2430 1105 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582949.1 protein_id gnl|my_center|LOCUS_03660 2502 3005 gene locus_tag LOCUS_03670 2502 3005 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064733.1 protein_id gnl|my_center|LOCUS_03670 3891 3031 gene locus_tag LOCUS_03680 3891 3031 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496419.1 protein_id gnl|my_center|LOCUS_03680 4793 3888 gene locus_tag LOCUS_03690 4793 3888 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485794.1 protein_id gnl|my_center|LOCUS_03690 4960 5973 gene locus_tag LOCUS_03700 4960 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 6429 5950 gene locus_tag LOCUS_03710 6429 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 7214 6432 gene locus_tag LOCUS_03720 7214 6432 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086076.1 protein_id gnl|my_center|LOCUS_03720 >Feature sequence034 1313 1014 gene locus_tag LOCUS_03730 1313 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 1433 3622 gene locus_tag LOCUS_03740 1433 3622 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060960.1 protein_id gnl|my_center|LOCUS_03740 3619 3870 gene locus_tag LOCUS_03750 3619 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 4570 3908 gene locus_tag LOCUS_03760 4570 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 5705 4680 gene locus_tag LOCUS_03770 5705 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 >Feature sequence035 952 398 gene locus_tag LOCUS_03780 952 398 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250217.1 protein_id gnl|my_center|LOCUS_03780 1037 2230 gene locus_tag LOCUS_03790 1037 2230 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146541.1 protein_id gnl|my_center|LOCUS_03790 2404 2757 gene locus_tag LOCUS_03800 2404 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 3955 2726 gene locus_tag LOCUS_03810 gene hisS 3955 2726 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496694.1 protein_id gnl|my_center|LOCUS_03810 5105 3930 gene locus_tag LOCUS_03820 5105 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 5275 6348 gene locus_tag LOCUS_03830 5275 6348 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257445.1 protein_id gnl|my_center|LOCUS_03830 >Feature sequence036 2963 366 gene locus_tag LOCUS_03840 2963 366 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073096256.1 protein_id gnl|my_center|LOCUS_03840 3951 2977 gene locus_tag LOCUS_03850 gene sppA 3951 2977 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250115.1 protein_id gnl|my_center|LOCUS_03850 5030 3951 gene locus_tag LOCUS_03860 5030 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 6422 5079 gene locus_tag LOCUS_03870 6422 5079 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878912.1 protein_id gnl|my_center|LOCUS_03870 <7046 6419 gene locus_tag LOCUS_03880 <7046 6419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023750.1:bifunctional oligoribonuclease/PAP phosphatase NrnA >Feature sequence037 >Feature sequence038 87 1193 gene locus_tag LOCUS_03890 gene ftsZ 87 1193 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250372.1 protein_id gnl|my_center|LOCUS_03890 4156 1190 gene locus_tag LOCUS_03900 4156 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 4378 4641 gene locus_tag LOCUS_03910 4378 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 4651 5130 gene locus_tag LOCUS_03920 4651 5130 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867126.1 protein_id gnl|my_center|LOCUS_03920 5158 5652 gene locus_tag LOCUS_03930 5158 5652 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869872.1 protein_id gnl|my_center|LOCUS_03930 5659 6306 gene locus_tag LOCUS_03940 5659 6306 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250368.1 protein_id gnl|my_center|LOCUS_03940 >Feature sequence039 <1 613 gene locus_tag LOCUS_03950 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879850.1:ABC transporter ATP-binding protein 582 1661 gene locus_tag LOCUS_03960 582 1661 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096393.1 protein_id gnl|my_center|LOCUS_03960 1708 1941 gene locus_tag LOCUS_03970 1708 1941 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251002.1 protein_id gnl|my_center|LOCUS_03970 1947 2636 gene locus_tag LOCUS_03980 1947 2636 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867184.1 protein_id gnl|my_center|LOCUS_03980 2681 3577 gene locus_tag LOCUS_03990 2681 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 3632 4390 gene locus_tag LOCUS_04000 3632 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 4667 4392 gene locus_tag LOCUS_04010 4667 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 5443 4829 gene locus_tag LOCUS_04020 5443 4829 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024048.1 protein_id gnl|my_center|LOCUS_04020 6836 5400 gene locus_tag LOCUS_04030 6836 5400 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064680.1 protein_id gnl|my_center|LOCUS_04030 >Feature sequence040 398 1723 gene locus_tag LOCUS_04040 gene cdr 398 1723 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068576671.1 protein_id gnl|my_center|LOCUS_04040 1850 2506 gene locus_tag LOCUS_04050 1850 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 3464 2571 gene locus_tag LOCUS_04060 3464 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 4546 3476 gene locus_tag LOCUS_04070 4546 3476 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978607.1 protein_id gnl|my_center|LOCUS_04070 5268 4543 gene locus_tag LOCUS_04080 5268 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 5375 6937 gene locus_tag LOCUS_04090 gene mgtE 5375 6937 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228410.1 protein_id gnl|my_center|LOCUS_04090 >Feature sequence041 <1 504 gene locus_tag LOCUS_04100 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060774.1:cyclic 2,3-diphosphoglycerate synthase 474 1385 gene locus_tag LOCUS_04110 474 1385 CDS product 2-phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877485.1 protein_id gnl|my_center|LOCUS_04110 2511 2002 gene locus_tag LOCUS_04120 2511 2002 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868523.1 protein_id gnl|my_center|LOCUS_04120 2597 2890 gene locus_tag LOCUS_04130 2597 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 2892 4019 gene locus_tag LOCUS_04140 2892 4019 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869774.1 protein_id gnl|my_center|LOCUS_04140 4041 4880 gene locus_tag LOCUS_04150 4041 4880 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870041.1 protein_id gnl|my_center|LOCUS_04150 4862 5410 gene locus_tag LOCUS_04160 4862 5410 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496537.1 protein_id gnl|my_center|LOCUS_04160 >Feature sequence042 1628 132 gene locus_tag LOCUS_04170 gene hutH 1628 132 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017128.1 protein_id gnl|my_center|LOCUS_04170 2344 1637 gene locus_tag LOCUS_04180 2344 1637 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240277.1 protein_id gnl|my_center|LOCUS_04180 2407 3633 gene locus_tag LOCUS_04190 gene hutI 2407 3633 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887529.1 protein_id gnl|my_center|LOCUS_04190 4497 3625 gene locus_tag LOCUS_04200 4497 3625 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867708.1 protein_id gnl|my_center|LOCUS_04200 5359 4502 gene locus_tag LOCUS_04210 5359 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 5777 5373 gene locus_tag LOCUS_04220 5777 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 6550 5783 gene locus_tag LOCUS_04230 6550 5783 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867913.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence043 327 827 gene locus_tag LOCUS_04240 327 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 1837 851 gene locus_tag LOCUS_04250 1837 851 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496935.1 protein_id gnl|my_center|LOCUS_04250 2419 1856 gene locus_tag LOCUS_04260 2419 1856 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249145.1 protein_id gnl|my_center|LOCUS_04260 2484 2777 gene locus_tag LOCUS_04270 2484 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762039.1 protein_id gnl|my_center|LOCUS_04270 2774 4489 gene locus_tag LOCUS_04280 2774 4489 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870748.1 protein_id gnl|my_center|LOCUS_04280 4491 6374 gene locus_tag LOCUS_04290 4491 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 <6841 6339 gene locus_tag LOCUS_04300 <6841 6339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010884438.1:UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase >Feature sequence044 <1 1005 gene locus_tag LOCUS_04310 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249838.1:TIGR00375 family protein 1024 1194 gene locus_tag LOCUS_04320 1024 1194 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065133.1 protein_id gnl|my_center|LOCUS_04320 1196 2368 gene locus_tag LOCUS_04330 1196 2368 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064241.1 protein_id gnl|my_center|LOCUS_04330 2860 2369 gene locus_tag LOCUS_04340 2860 2369 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871125.1 protein_id gnl|my_center|LOCUS_04340 2919 4502 gene locus_tag LOCUS_04350 2919 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 4516 5013 gene locus_tag LOCUS_04360 4516 5013 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061315.1 protein_id gnl|my_center|LOCUS_04360 5833 5045 gene locus_tag LOCUS_04370 5833 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 5937 6281 gene locus_tag LOCUS_04380 5937 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 >Feature sequence045 <1 1486 gene locus_tag LOCUS_04390 <1 1486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944054.1:NADH-quinone oxidoreductase subunit B/C/D 1483 2460 gene locus_tag LOCUS_04400 gene nuoH 1483 2460 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573431.1 protein_id gnl|my_center|LOCUS_04400 2453 3058 gene locus_tag LOCUS_04410 2453 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 3055 3522 gene locus_tag LOCUS_04420 3055 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 3519 3827 gene locus_tag LOCUS_04430 gene nuoK 3519 3827 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902440.1 protein_id gnl|my_center|LOCUS_04430 3824 5530 gene locus_tag LOCUS_04440 gene nuoL 3824 5530 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142593.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence046 4667 792 gene locus_tag LOCUS_04450 4667 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 5005 5835 gene locus_tag LOCUS_04460 5005 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 5819 6061 gene locus_tag LOCUS_04470 5819 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 6066 6425 gene locus_tag LOCUS_04480 gene hypA 6066 6425 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060898.1 protein_id gnl|my_center|LOCUS_04480 >Feature sequence047 1551 472 gene locus_tag LOCUS_04490 gene fni 1551 472 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064552.1 protein_id gnl|my_center|LOCUS_04490 2189 1530 gene locus_tag LOCUS_04500 2189 1530 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867666.1 protein_id gnl|my_center|LOCUS_04500 3204 2182 gene locus_tag LOCUS_04510 3204 2182 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867665.1 protein_id gnl|my_center|LOCUS_04510 4043 3201 gene locus_tag LOCUS_04520 gene amrB 4043 3201 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869902.1 protein_id gnl|my_center|LOCUS_04520 4657 4052 gene locus_tag LOCUS_04530 gene rpsB 4657 4052 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867661.1 protein_id gnl|my_center|LOCUS_04530 5916 4663 gene locus_tag LOCUS_04540 gene eno 5916 4663 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875683.1 protein_id gnl|my_center|LOCUS_04540 6005 5930 gene locus_tag LOCUS_t00100 6005 5930 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence048 1375 2676 gene locus_tag LOCUS_04550 1375 2676 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877086.1 protein_id gnl|my_center|LOCUS_04550 3694 2660 gene locus_tag LOCUS_04560 3694 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 4857 3721 gene locus_tag LOCUS_04570 gene gntC 4857 3721 CDS product guanitoxin biosynthesis PLP-dependent (S)-gamma-hydroxy-L-arginine cyclodehydratase GntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061335.1 protein_id gnl|my_center|LOCUS_04570 >Feature sequence049 432 31 gene locus_tag LOCUS_04580 432 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 628 1575 gene locus_tag LOCUS_04590 628 1575 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867489.1 protein_id gnl|my_center|LOCUS_04590 1579 2142 gene locus_tag LOCUS_04600 1579 2142 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064451.1 protein_id gnl|my_center|LOCUS_04600 2195 3106 gene locus_tag LOCUS_04610 2195 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 3107 4255 gene locus_tag LOCUS_04620 3107 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 4559 4771 gene locus_tag LOCUS_04630 4559 4771 CDS product archaeal histone A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867469.1 protein_id gnl|my_center|LOCUS_04630 5203 4790 gene locus_tag LOCUS_04640 5203 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 6162 5209 gene locus_tag LOCUS_04650 6162 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 >Feature sequence050 168 725 gene locus_tag LOCUS_04660 168 725 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876692.1 protein_id gnl|my_center|LOCUS_04660 691 945 gene locus_tag LOCUS_04670 691 945 CDS product 50S ribosomal protein L35ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867507.1 protein_id gnl|my_center|LOCUS_04670 863 2044 gene locus_tag LOCUS_04680 863 2044 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146544.1 protein_id gnl|my_center|LOCUS_04680 2660 2046 gene locus_tag LOCUS_04690 gene rrmJ 2660 2046 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870893.1 protein_id gnl|my_center|LOCUS_04690 3682 2660 gene locus_tag LOCUS_04700 3682 2660 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876518.1 protein_id gnl|my_center|LOCUS_04700 3882 3694 gene locus_tag LOCUS_04710 3882 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 4602 3961 gene locus_tag LOCUS_04720 4602 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 4851 6080 gene locus_tag LOCUS_04730 4851 6080 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899806.1 protein_id gnl|my_center|LOCUS_04730 >Feature sequence051 625 819 gene locus_tag LOCUS_04740 625 819 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868406.1 protein_id gnl|my_center|LOCUS_04740 1464 862 gene locus_tag LOCUS_04750 1464 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868040.1 protein_id gnl|my_center|LOCUS_04750 4487 1461 gene locus_tag LOCUS_04760 gene ileS 4487 1461 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868042.1 protein_id gnl|my_center|LOCUS_04760 4608 5168 gene locus_tag LOCUS_04770 4608 5168 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878134.1 protein_id gnl|my_center|LOCUS_04770 6055 5165 gene locus_tag LOCUS_04780 6055 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 >Feature sequence052 1962 496 gene locus_tag LOCUS_04790 1962 496 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020198.1 protein_id gnl|my_center|LOCUS_04790 2810 1959 gene locus_tag LOCUS_04800 2810 1959 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870766.1 protein_id gnl|my_center|LOCUS_04800 2922 3848 gene locus_tag LOCUS_04810 gene pyrB 2922 3848 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_04810 3849 4334 gene locus_tag LOCUS_04820 gene pyrI 3849 4334 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846971.1 protein_id gnl|my_center|LOCUS_04820 4820 4560 gene locus_tag LOCUS_04830 4820 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 <6051 4886 gene locus_tag LOCUS_04840 <6051 4886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461425.1:cell wall-binding repeat-containing protein >Feature sequence053 429 1892 gene locus_tag LOCUS_04850 429 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 2712 1867 gene locus_tag LOCUS_04860 2712 1867 CDS product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249465.1 protein_id gnl|my_center|LOCUS_04860 2775 3542 gene locus_tag LOCUS_04870 gene pyrF 2775 3542 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583920.1 protein_id gnl|my_center|LOCUS_04870 4099 3521 gene locus_tag LOCUS_04880 4099 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251102.1 protein_id gnl|my_center|LOCUS_04880 4290 5006 gene locus_tag LOCUS_04890 4290 5006 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964706.1 protein_id gnl|my_center|LOCUS_04890 5240 4986 gene locus_tag LOCUS_04900 5240 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 5523 5233 gene locus_tag LOCUS_04910 5523 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 5495 6028 gene locus_tag LOCUS_04920 5495 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 >Feature sequence054 <1 2415 gene locus_tag LOCUS_04930 <1 2415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022533.1:BatD family protein 2463 3317 gene locus_tag LOCUS_04940 2463 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 4368 3280 gene locus_tag LOCUS_04950 4368 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249139.1 protein_id gnl|my_center|LOCUS_04950 4390 5280 gene locus_tag LOCUS_04960 4390 5280 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878248.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence055 4861 1544 gene locus_tag LOCUS_04970 4861 1544 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867738.1 protein_id gnl|my_center|LOCUS_04970 5293 4868 gene locus_tag LOCUS_04980 5293 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 5390 5316 gene locus_tag LOCUS_t00110 5390 5316 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5485 5408 gene locus_tag LOCUS_t00120 5485 5408 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5608 5492 gene locus_tag LOCUS_r00010 5608 5492 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5996 5691 gene locus_tag LOCUS_04990 5996 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 >Feature sequence056 <1 1536 gene locus_tag LOCUS_05000 <1 1536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_091304903.1:DUF11 domain-containing protein 1570 1920 gene locus_tag LOCUS_05010 gene pth2 1570 1920 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320039.1 protein_id gnl|my_center|LOCUS_05010 1917 3116 gene locus_tag LOCUS_05020 gene truD 1917 3116 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_05020 4416 3127 gene locus_tag LOCUS_05030 gene aspS 4416 3127 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496866.1 protein_id gnl|my_center|LOCUS_05030 4932 4426 gene locus_tag LOCUS_05040 4932 4426 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868454.1 protein_id gnl|my_center|LOCUS_05040 5292 5017 gene locus_tag LOCUS_05050 gene albA 5292 5017 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249515.1 protein_id gnl|my_center|LOCUS_05050 5397 5774 gene locus_tag LOCUS_05060 5397 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 >Feature sequence057 891 1328 gene locus_tag LOCUS_05070 891 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 1414 3969 gene locus_tag LOCUS_05080 1414 3969 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228376.1 protein_id gnl|my_center|LOCUS_05080 4054 5085 gene locus_tag LOCUS_05090 4054 5085 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978090.1 protein_id gnl|my_center|LOCUS_05090 5123 5692 gene locus_tag LOCUS_05100 5123 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 >Feature sequence058 72 263 gene locus_tag LOCUS_05110 72 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 230 406 gene locus_tag LOCUS_05120 230 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 2854 512 gene locus_tag LOCUS_05130 2854 512 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020506622.1 protein_id gnl|my_center|LOCUS_05130 3024 2857 gene locus_tag LOCUS_05140 3024 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 4105 3194 gene locus_tag LOCUS_05150 4105 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 >Feature sequence059 133 1323 gene locus_tag LOCUS_05160 gene larC 133 1323 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_05160 1301 2092 gene locus_tag LOCUS_05170 gene larB 1301 2092 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080597.1 protein_id gnl|my_center|LOCUS_05170 2157 3560 gene locus_tag LOCUS_05180 2157 3560 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146589.1 protein_id gnl|my_center|LOCUS_05180 3561 4922 gene locus_tag LOCUS_05190 3561 4922 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249454.1 protein_id gnl|my_center|LOCUS_05190 <5764 4919 gene locus_tag LOCUS_05200 <5764 4919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762155.1:FAD-dependent oxidoreductase >Feature sequence060 62 970 gene locus_tag LOCUS_05210 gene hutG 62 970 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399848.1 protein_id gnl|my_center|LOCUS_05210 1881 988 gene locus_tag LOCUS_05220 1881 988 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867617.1 protein_id gnl|my_center|LOCUS_05220 3086 1878 gene locus_tag LOCUS_05230 3086 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 3149 3856 gene locus_tag LOCUS_05240 3149 3856 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249896.1 protein_id gnl|my_center|LOCUS_05240 3837 5483 gene locus_tag LOCUS_05250 gene lysS 3837 5483 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061081.1 protein_id gnl|my_center|LOCUS_05250 >Feature sequence061 251 484 gene locus_tag LOCUS_05260 251 484 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250282.1 protein_id gnl|my_center|LOCUS_05260 1138 515 gene locus_tag LOCUS_05270 1138 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 2510 1122 gene locus_tag LOCUS_05280 2510 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 3607 2507 gene locus_tag LOCUS_05290 3607 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 3701 5107 gene locus_tag LOCUS_05300 3701 5107 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868782.1 protein_id gnl|my_center|LOCUS_05300 >Feature sequence062 713 1636 gene locus_tag LOCUS_05310 713 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 1759 2370 gene locus_tag LOCUS_05320 1759 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 3744 2371 gene locus_tag LOCUS_05330 3744 2371 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391671.1 protein_id gnl|my_center|LOCUS_05330 4162 4704 gene locus_tag LOCUS_05340 4162 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 5354 4926 gene locus_tag LOCUS_05350 5354 4926 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867539.1 protein_id gnl|my_center|LOCUS_05350 >Feature sequence063 3369 3533 gene locus_tag LOCUS_05360 3369 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 3533 3832 gene locus_tag LOCUS_05370 3533 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 4841 3948 gene locus_tag LOCUS_05380 4841 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 >Feature sequence064 1512 538 gene locus_tag LOCUS_05390 gene priL 1512 538 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_05390 2255 1509 gene locus_tag LOCUS_05400 2255 1509 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868494.1 protein_id gnl|my_center|LOCUS_05400 2577 2257 gene locus_tag LOCUS_05410 2577 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 2752 2516 gene locus_tag LOCUS_05420 2752 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 3087 2755 gene locus_tag LOCUS_05430 3087 2755 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249488.1 protein_id gnl|my_center|LOCUS_05430 3503 3105 gene locus_tag LOCUS_05440 3503 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 4014 3496 gene locus_tag LOCUS_05450 4014 3496 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868568.1 protein_id gnl|my_center|LOCUS_05450 4537 3992 gene locus_tag LOCUS_05460 4537 3992 CDS product DUF531 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868567.1 protein_id gnl|my_center|LOCUS_05460 5153 4497 gene locus_tag LOCUS_05470 5153 4497 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061023.1 protein_id gnl|my_center|LOCUS_05470 5376 5110 gene locus_tag LOCUS_05480 5376 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 >Feature sequence065 <1 582 gene locus_tag LOCUS_05490 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061038.1:H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA 536 952 gene locus_tag LOCUS_05500 536 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 949 1881 gene locus_tag LOCUS_05510 949 1881 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_05510 1865 3277 gene locus_tag LOCUS_05520 1865 3277 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_05520 3287 3778 gene locus_tag LOCUS_05530 3287 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 3753 4136 gene locus_tag LOCUS_05540 3753 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 4142 4915 gene locus_tag LOCUS_05550 gene hdrB 4142 4915 CDS product methylene tetrahydrofolate reductase subunit B HdrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392709.1 protein_id gnl|my_center|LOCUS_05550 >Feature sequence066 794 1096 gene locus_tag LOCUS_05560 794 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 1791 1093 gene locus_tag LOCUS_05570 1791 1093 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021463.1 protein_id gnl|my_center|LOCUS_05570 2222 1788 gene locus_tag LOCUS_05580 2222 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 2369 2635 gene locus_tag LOCUS_05590 2369 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 >Feature sequence067 32 123 gene locus_tag LOCUS_t00130 32 123 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 426 124 gene locus_tag LOCUS_05600 426 124 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980193.1 protein_id gnl|my_center|LOCUS_05600 734 441 gene locus_tag LOCUS_05610 734 441 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546546.1 protein_id gnl|my_center|LOCUS_05610 975 1772 gene locus_tag LOCUS_05620 975 1772 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249303.1 protein_id gnl|my_center|LOCUS_05620 2561 1758 gene locus_tag LOCUS_05630 gene speB 2561 1758 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876501.1 protein_id gnl|my_center|LOCUS_05630 3384 2545 gene locus_tag LOCUS_05640 gene speE 3384 2545 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869811.1 protein_id gnl|my_center|LOCUS_05640 3740 3381 gene locus_tag LOCUS_05650 gene speD 3740 3381 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081137.1 protein_id gnl|my_center|LOCUS_05650 4216 3746 gene locus_tag LOCUS_05660 4216 3746 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869814.1 protein_id gnl|my_center|LOCUS_05660 5433 4405 gene locus_tag LOCUS_05670 5433 4405 CDS product bis-aminopropyl spermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870786.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence068 1584 43 gene locus_tag LOCUS_05680 1584 43 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_05680 1870 2829 gene locus_tag LOCUS_05690 1870 2829 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_05690 2831 4009 gene locus_tag LOCUS_05700 2831 4009 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251169.1 protein_id gnl|my_center|LOCUS_05700 4014 5108 gene locus_tag LOCUS_05710 gene fbp 4014 5108 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878939.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence069 858 1322 gene locus_tag LOCUS_05720 858 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 1405 1893 gene locus_tag LOCUS_05730 1405 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 2072 2683 gene locus_tag LOCUS_05740 2072 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2748 3881 gene locus_tag LOCUS_05750 2748 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 >Feature sequence070 <1 791 gene locus_tag LOCUS_05760 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250566.1:RNA 3'-terminal phosphate cyclase 941 868 gene locus_tag LOCUS_t00140 941 868 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2188 1247 gene locus_tag LOCUS_05770 2188 1247 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392274.1 protein_id gnl|my_center|LOCUS_05770 2415 2176 gene locus_tag LOCUS_05780 2415 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 2765 2421 gene locus_tag LOCUS_05790 2765 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 2875 3768 gene locus_tag LOCUS_05800 2875 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 3853 3777 gene locus_tag LOCUS_t00150 3853 3777 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3999 4358 gene locus_tag LOCUS_05810 3999 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 >Feature sequence071 818 162 gene locus_tag LOCUS_05820 818 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 2338 827 gene locus_tag LOCUS_05830 2338 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 2811 2344 gene locus_tag LOCUS_05840 2811 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 3778 2813 gene locus_tag LOCUS_05850 3778 2813 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978295.1 protein_id gnl|my_center|LOCUS_05850 4998 3775 gene locus_tag LOCUS_05860 4998 3775 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871137.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence072 738 1277 gene locus_tag LOCUS_05870 738 1277 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251241.1 protein_id gnl|my_center|LOCUS_05870 2032 1274 gene locus_tag LOCUS_05880 gene pstB 2032 1274 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_05880 2861 2037 gene locus_tag LOCUS_05890 gene pstA 2861 2037 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407464.1 protein_id gnl|my_center|LOCUS_05890 3493 2834 gene locus_tag LOCUS_05900 3493 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 4850 3723 gene locus_tag LOCUS_05910 gene pstS 4850 3723 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582618.1 protein_id gnl|my_center|LOCUS_05910 >Feature sequence073 1099 1614 gene locus_tag LOCUS_05920 1099 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 1651 2721 gene locus_tag LOCUS_05930 1651 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 2718 3248 gene locus_tag LOCUS_05940 2718 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 3214 4095 gene locus_tag LOCUS_05950 3214 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 >Feature sequence074 1638 76 gene locus_tag LOCUS_05960 gene pyrG 1638 76 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867477.1 protein_id gnl|my_center|LOCUS_05960 2684 1668 gene locus_tag LOCUS_05970 2684 1668 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876254.1 protein_id gnl|my_center|LOCUS_05970 2892 4892 gene locus_tag LOCUS_05980 2892 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 >Feature sequence075 1543 71 gene locus_tag LOCUS_05990 1543 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 1637 2566 gene locus_tag LOCUS_06000 1637 2566 CDS product DUF1152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878281.1 protein_id gnl|my_center|LOCUS_06000 2567 4777 gene locus_tag LOCUS_06010 gene hypF 2567 4777 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868352.1 protein_id gnl|my_center|LOCUS_06010 4996 4769 gene locus_tag LOCUS_06020 4996 4769 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_06020 >Feature sequence076 385 8 gene locus_tag LOCUS_06030 385 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 613 425 gene locus_tag LOCUS_06040 613 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 1281 1205 gene locus_tag LOCUS_t00160 1281 1205 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2480 1272 gene locus_tag LOCUS_06050 gene pgk 2480 1272 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061271.1 protein_id gnl|my_center|LOCUS_06050 3222 2551 gene locus_tag LOCUS_06060 gene tpiA 3222 2551 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868855.1 protein_id gnl|my_center|LOCUS_06060 4259 3216 gene locus_tag LOCUS_06070 4259 3216 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869629.1 protein_id gnl|my_center|LOCUS_06070 4498 4421 gene locus_tag LOCUS_t00170 4498 4421 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4549 4908 gene locus_tag LOCUS_06080 4549 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence077 1507 713 gene locus_tag LOCUS_06090 1507 713 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876849.1 protein_id gnl|my_center|LOCUS_06090 2028 1516 gene locus_tag LOCUS_06100 2028 1516 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876850.1 protein_id gnl|my_center|LOCUS_06100 >Feature sequence078 1755 4 gene locus_tag LOCUS_06110 1755 4 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878662.1 protein_id gnl|my_center|LOCUS_06110 2042 1740 gene locus_tag LOCUS_06120 2042 1740 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024045.1 protein_id gnl|my_center|LOCUS_06120 3066 2044 gene locus_tag LOCUS_06130 3066 2044 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024044.1 protein_id gnl|my_center|LOCUS_06130 3646 3071 gene locus_tag LOCUS_06140 3646 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 3878 3660 gene locus_tag LOCUS_06150 3878 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024042.1 protein_id gnl|my_center|LOCUS_06150 <5011 3920 gene locus_tag LOCUS_06160 <5011 3920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193589509.1:V-type ATP synthase subunit I >Feature sequence079 1549 284 gene locus_tag LOCUS_06170 1549 284 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_06170 2321 1554 gene locus_tag LOCUS_06180 2321 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 3571 2243 gene locus_tag LOCUS_06190 3571 2243 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146938.1 protein_id gnl|my_center|LOCUS_06190 4995 3577 gene locus_tag LOCUS_06200 4995 3577 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249650.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence080 <1 687 gene locus_tag LOCUS_06210 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249823.1:RsmB/NOP family class I SAM-dependent RNA methyltransferase 684 1166 gene locus_tag LOCUS_06220 684 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 1180 2022 gene locus_tag LOCUS_06230 1180 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 2000 2509 gene locus_tag LOCUS_06240 2000 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 4558 2564 gene locus_tag LOCUS_06250 4558 2564 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598715.1 protein_id gnl|my_center|LOCUS_06250 >Feature sequence081 688 269 gene locus_tag LOCUS_06260 688 269 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869516.1 protein_id gnl|my_center|LOCUS_06260 788 703 gene locus_tag LOCUS_t00180 788 703 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1144 833 gene locus_tag LOCUS_06270 gene rpsJ 1144 833 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876685.1 protein_id gnl|my_center|LOCUS_06270 2475 1189 gene locus_tag LOCUS_06280 gene tuf 2475 1189 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878437.1 protein_id gnl|my_center|LOCUS_06280 3086 2487 gene locus_tag LOCUS_06290 gene rpsG 3086 2487 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867744.1 protein_id gnl|my_center|LOCUS_06290 3523 3095 gene locus_tag LOCUS_06300 3523 3095 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867743.1 protein_id gnl|my_center|LOCUS_06300 3965 3534 gene locus_tag LOCUS_06310 3965 3534 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867742.1 protein_id gnl|my_center|LOCUS_06310 4270 3962 gene locus_tag LOCUS_06320 4270 3962 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867741.1 protein_id gnl|my_center|LOCUS_06320 <4980 4263 gene locus_tag LOCUS_06330 <4980 4263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867740.1:DNA-directed RNA polymerase subunit A'' >Feature sequence082 1755 532 gene locus_tag LOCUS_06340 1755 532 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868819.1 protein_id gnl|my_center|LOCUS_06340 3490 1757 gene locus_tag LOCUS_06350 3490 1757 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080010.1 protein_id gnl|my_center|LOCUS_06350 4307 3474 gene locus_tag LOCUS_06360 gene xerA 4307 3474 CDS product tyrosine recombinase XerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867504.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence083 1688 1491 gene locus_tag LOCUS_06370 1688 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 2139 1699 gene locus_tag LOCUS_06380 2139 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 3334 2141 gene locus_tag LOCUS_06390 3334 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 3594 3331 gene locus_tag LOCUS_06400 3594 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 3796 3596 gene locus_tag LOCUS_06410 3796 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 4394 3798 gene locus_tag LOCUS_06420 4394 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 >Feature sequence084 1158 664 gene locus_tag LOCUS_06430 1158 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 1770 1222 gene locus_tag LOCUS_06440 1770 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 <4947 2035 gene locus_tag LOCUS_06450 <4947 2035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082154.1:alpha-amylase family glycosyl hydrolase >Feature sequence085 63 257 gene locus_tag LOCUS_06460 63 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 1132 1329 gene locus_tag LOCUS_06470 1132 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 1392 1520 gene locus_tag LOCUS_06480 1392 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 2589 1558 gene locus_tag LOCUS_06490 2589 1558 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_06490 4377 2590 gene locus_tag LOCUS_06500 4377 2590 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249526.1 protein_id gnl|my_center|LOCUS_06500 >Feature sequence086 1564 32 gene locus_tag LOCUS_06510 1564 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 2925 1561 gene locus_tag LOCUS_06520 2925 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 4146 2950 gene locus_tag LOCUS_06530 4146 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 >Feature sequence087 759 1028 gene locus_tag LOCUS_06540 759 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 1040 2542 gene locus_tag LOCUS_06550 1040 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 2539 3156 gene locus_tag LOCUS_06560 2539 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 3157 3771 gene locus_tag LOCUS_06570 3157 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 3983 4240 gene locus_tag LOCUS_06580 3983 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence088 185 1120 gene locus_tag LOCUS_06590 185 1120 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_06590 2465 1071 gene locus_tag LOCUS_06600 2465 1071 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016558.1 protein_id gnl|my_center|LOCUS_06600 3157 2462 gene locus_tag LOCUS_06610 3157 2462 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496578.1 protein_id gnl|my_center|LOCUS_06610 3558 3154 gene locus_tag LOCUS_06620 3558 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 4245 3589 gene locus_tag LOCUS_06630 4245 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 4295 4534 gene locus_tag LOCUS_06640 4295 4534 CDS product DUF504 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249270.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence089 415 8 gene locus_tag LOCUS_06650 415 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 1625 429 gene locus_tag LOCUS_06660 gene dnaG 1625 429 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867599.1 protein_id gnl|my_center|LOCUS_06660 2635 1631 gene locus_tag LOCUS_06670 2635 1631 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013682815.1 protein_id gnl|my_center|LOCUS_06670 3118 2651 gene locus_tag LOCUS_06680 3118 2651 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023990.1 protein_id gnl|my_center|LOCUS_06680 3369 3761 gene locus_tag LOCUS_06690 3369 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 4445 3741 gene locus_tag LOCUS_06700 4445 3741 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209477179.1 protein_id gnl|my_center|LOCUS_06700 >Feature sequence090 <1 1197 gene locus_tag LOCUS_06710 <1 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879433.1:phosphoribosylformylglycinamidine synthase subunit PurL 1167 1976 gene locus_tag LOCUS_06720 gene purQ 1167 1976 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878755.1 protein_id gnl|my_center|LOCUS_06720 2132 3574 gene locus_tag LOCUS_06730 2132 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 4375 3569 gene locus_tag LOCUS_06740 gene truA 4375 3569 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249878.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence091 785 2476 gene locus_tag LOCUS_06750 785 2476 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867223.1 protein_id gnl|my_center|LOCUS_06750 3179 2427 gene locus_tag LOCUS_06760 3179 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 <4733 3294 gene locus_tag LOCUS_06770 <4733 3294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870333.1:S-layer protein Sla >Feature sequence092 2528 660 gene locus_tag LOCUS_06780 gene gatE 2528 660 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869511.1 protein_id gnl|my_center|LOCUS_06780 3856 2543 gene locus_tag LOCUS_06790 gene gatD 3856 2543 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867819.1 protein_id gnl|my_center|LOCUS_06790 3882 4508 gene locus_tag LOCUS_06800 3882 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 >Feature sequence093 502 1233 gene locus_tag LOCUS_06810 502 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 1214 1969 gene locus_tag LOCUS_06820 1214 1969 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871162.1 protein_id gnl|my_center|LOCUS_06820 3863 1911 gene locus_tag LOCUS_06830 3863 1911 CDS product CGP-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146626.1 protein_id gnl|my_center|LOCUS_06830 4130 3930 gene locus_tag LOCUS_06840 4130 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 >Feature sequence094 <1 1251 gene locus_tag LOCUS_06850 <1 1251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867675.1:radical SAM protein 1387 3651 gene locus_tag LOCUS_06860 1387 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 >Feature sequence095 2370 1630 gene locus_tag LOCUS_06870 2370 1630 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879601.1 protein_id gnl|my_center|LOCUS_06870 3054 2410 gene locus_tag LOCUS_06880 gene pyrH 3054 2410 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496770.1 protein_id gnl|my_center|LOCUS_06880 3147 3073 gene locus_tag LOCUS_t00190 3147 3073 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3410 4429 gene locus_tag LOCUS_06890 3410 4429 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141711.1 protein_id gnl|my_center|LOCUS_06890 >Feature sequence096 1042 44 gene locus_tag LOCUS_06900 1042 44 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015858271.1 protein_id gnl|my_center|LOCUS_06900 1195 3324 gene locus_tag LOCUS_06910 1195 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 4308 3355 gene locus_tag LOCUS_06920 4308 3355 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence097 712 1497 gene locus_tag LOCUS_06930 712 1497 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877968.1 protein_id gnl|my_center|LOCUS_06930 1527 3572 gene locus_tag LOCUS_06940 1527 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 <4532 3605 gene locus_tag LOCUS_06950 <4532 3605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250622.1:4-demethylwyosine synthase TYW1 >Feature sequence098 534 1034 gene locus_tag LOCUS_06960 534 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 1006 1494 gene locus_tag LOCUS_06970 1006 1494 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461633.1 protein_id gnl|my_center|LOCUS_06970 2285 2470 gene locus_tag LOCUS_06980 2285 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 2439 2780 gene locus_tag LOCUS_06990 2439 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 2780 2950 gene locus_tag LOCUS_07000 2780 2950 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_07000 2950 4137 gene locus_tag LOCUS_07010 2950 4137 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584117.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence099 582 1028 gene locus_tag LOCUS_07020 582 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 1382 2140 gene locus_tag LOCUS_07030 1382 2140 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701079.1 protein_id gnl|my_center|LOCUS_07030 2133 2393 gene locus_tag LOCUS_07040 2133 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 2815 3969 gene locus_tag LOCUS_07050 2815 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 4319 3975 gene locus_tag LOCUS_07060 4319 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 >Feature sequence100 393 1430 gene locus_tag LOCUS_07070 393 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 1786 1448 gene locus_tag LOCUS_07080 1786 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07080 2058 1813 gene locus_tag LOCUS_07090 2058 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07090 2167 2033 gene locus_tag LOCUS_07100 2167 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 2732 2358 gene locus_tag LOCUS_07110 2732 2358 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081116.1 protein_id gnl|my_center|LOCUS_07110 3258 2746 gene locus_tag LOCUS_07120 3258 2746 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146717.1 protein_id gnl|my_center|LOCUS_07120 <4387 3454 gene locus_tag LOCUS_07130 <4387 3454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392219.1:thiamine-phosphate synthase family protein >Feature sequence101 <1 913 gene locus_tag LOCUS_07140 <1 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867667.1:ATP-dependent DNA ligase 1802 888 gene locus_tag LOCUS_07150 1802 888 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020797.1 protein_id gnl|my_center|LOCUS_07150 1983 2546 gene locus_tag LOCUS_07160 1983 2546 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096121.1 protein_id gnl|my_center|LOCUS_07160 3474 2548 gene locus_tag LOCUS_07170 3474 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 <4358 3471 gene locus_tag LOCUS_07180 <4358 3471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023510.1:transcriptional regulator >Feature sequence102 1778 2656 gene locus_tag LOCUS_07190 1778 2656 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884438.1 protein_id gnl|my_center|LOCUS_07190 2626 3051 gene locus_tag LOCUS_07200 2626 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 3038 4006 gene locus_tag LOCUS_07210 3038 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence103 303 1451 gene locus_tag LOCUS_07220 303 1451 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930595.1 protein_id gnl|my_center|LOCUS_07220 2062 1493 gene locus_tag LOCUS_07230 2062 1493 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147291.1 protein_id gnl|my_center|LOCUS_07230 3243 2143 gene locus_tag LOCUS_07240 3243 2143 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870691.1 protein_id gnl|my_center|LOCUS_07240 3985 3317 gene locus_tag LOCUS_07250 gene pyrE 3985 3317 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211305.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence104 2060 90 gene locus_tag LOCUS_07260 2060 90 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020139.1 protein_id gnl|my_center|LOCUS_07260 2570 2064 gene locus_tag LOCUS_07270 gene cyaB 2570 2064 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023937.1 protein_id gnl|my_center|LOCUS_07270 3079 2564 gene locus_tag LOCUS_07280 gene cobO 3079 2564 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442279.1 protein_id gnl|my_center|LOCUS_07280 3155 3700 gene locus_tag LOCUS_07290 3155 3700 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_07290 3704 3979 gene locus_tag LOCUS_07300 gene porD 3704 3979 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868479.1 protein_id gnl|my_center|LOCUS_07300 >Feature sequence105 <1 645 gene locus_tag LOCUS_07310 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061103.1:phosphoserine phosphatase SerB 620 1627 gene locus_tag LOCUS_07320 620 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2014 1601 gene locus_tag LOCUS_07330 2014 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 2067 2810 gene locus_tag LOCUS_07340 2067 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 3663 2794 gene locus_tag LOCUS_07350 gene map 3663 2794 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868538.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence106 452 766 gene locus_tag LOCUS_07360 gene rpl12p 452 766 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878989.1 protein_id gnl|my_center|LOCUS_07360 774 1844 gene locus_tag LOCUS_07370 774 1844 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868715.1 protein_id gnl|my_center|LOCUS_07370 >Feature sequence107 <1 1014 gene locus_tag LOCUS_07380 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878362.1:bifunctional hexulose-6-phosphate synthase/ribonuclease regulator 1011 1928 gene locus_tag LOCUS_07390 1011 1928 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879191.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence108 1458 358 gene locus_tag LOCUS_07400 1458 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 2513 2875 gene locus_tag LOCUS_07410 2513 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence109 1133 777 gene locus_tag LOCUS_07420 1133 777 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868534.1 protein_id gnl|my_center|LOCUS_07420 1207 1494 gene locus_tag LOCUS_07430 1207 1494 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250807.1 protein_id gnl|my_center|LOCUS_07430 2038 1463 gene locus_tag LOCUS_07440 2038 1463 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876823.1 protein_id gnl|my_center|LOCUS_07440 2567 1998 gene locus_tag LOCUS_07450 gene serK 2567 1998 CDS product L-serine kinase SerK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868633.1 protein_id gnl|my_center|LOCUS_07450 3466 2564 gene locus_tag LOCUS_07460 gene porB 3466 2564 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877344.1 protein_id gnl|my_center|LOCUS_07460 <4123 3472 gene locus_tag LOCUS_07470 <4123 3472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877345.1:pyruvate synthase subunit PorA >Feature sequence110 <1 657 gene locus_tag LOCUS_07480 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496752.1:threonine--tRNA ligase 1215 652 gene locus_tag LOCUS_07490 gene pdxT 1215 652 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228136.1 protein_id gnl|my_center|LOCUS_07490 2101 1217 gene locus_tag LOCUS_07500 gene pdxS 2101 1217 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583836.1 protein_id gnl|my_center|LOCUS_07500 2279 2911 gene locus_tag LOCUS_07510 2279 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 3085 3573 gene locus_tag LOCUS_07520 3085 3573 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870034.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence111 1062 2069 gene locus_tag LOCUS_07530 1062 2069 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145123.1 protein_id gnl|my_center|LOCUS_07530 2409 2921 gene locus_tag LOCUS_07540 2409 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 >Feature sequence112 2548 230 gene locus_tag LOCUS_07550 2548 230 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878004.1 protein_id gnl|my_center|LOCUS_07550 2619 2843 gene locus_tag LOCUS_07560 2619 2843 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878376.1 protein_id gnl|my_center|LOCUS_07560 3134 2844 gene locus_tag LOCUS_07570 3134 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 >Feature sequence113 1241 375 gene locus_tag LOCUS_07580 1241 375 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079210.1 protein_id gnl|my_center|LOCUS_07580 1775 1590 gene locus_tag LOCUS_07590 1775 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 1879 2388 gene locus_tag LOCUS_07600 1879 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 >Feature sequence114 1027 734 gene locus_tag LOCUS_07610 1027 734 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868107.1 protein_id gnl|my_center|LOCUS_07610 1446 1039 gene locus_tag LOCUS_07620 1446 1039 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877371.1 protein_id gnl|my_center|LOCUS_07620 2074 1448 gene locus_tag LOCUS_07630 2074 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496892.1 protein_id gnl|my_center|LOCUS_07630 2662 2084 gene locus_tag LOCUS_07640 2662 2084 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877235.1 protein_id gnl|my_center|LOCUS_07640 2958 3521 gene locus_tag LOCUS_07650 2958 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 >Feature sequence115 417 31 gene locus_tag LOCUS_07660 417 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 929 414 gene locus_tag LOCUS_07670 929 414 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937739.1 protein_id gnl|my_center|LOCUS_07670 1769 930 gene locus_tag LOCUS_07680 1769 930 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937740.1 protein_id gnl|my_center|LOCUS_07680 3622 1769 gene locus_tag LOCUS_07690 3622 1769 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937741.1 protein_id gnl|my_center|LOCUS_07690 >Feature sequence116 307 1047 gene locus_tag LOCUS_07700 307 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 >Feature sequence117 2644 1886 gene locus_tag LOCUS_07710 2644 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 3758 2637 gene locus_tag LOCUS_07720 3758 2637 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582952.1 protein_id gnl|my_center|LOCUS_07720 3890 3977 gene locus_tag LOCUS_t00200 3890 3977 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence118 1087 350 gene locus_tag LOCUS_07730 1087 350 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763194.1 protein_id gnl|my_center|LOCUS_07730 1865 1089 gene locus_tag LOCUS_07740 1865 1089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582660.1 protein_id gnl|my_center|LOCUS_07740 2889 1846 gene locus_tag LOCUS_07750 2889 1846 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065044.1 protein_id gnl|my_center|LOCUS_07750 <3961 2928 gene locus_tag LOCUS_07760 <3961 2928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249816.1:ABC transporter substrate-binding protein >Feature sequence119 1459 644 gene locus_tag LOCUS_07770 1459 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 2457 1453 gene locus_tag LOCUS_07780 2457 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence120 3400 2531 gene locus_tag LOCUS_07790 3400 2531 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870891.1 protein_id gnl|my_center|LOCUS_07790 <3917 3400 gene locus_tag LOCUS_07800 <3917 3400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496592.1:ribosome biogenesis/translation initiation ATPase RLI >Feature sequence121 1343 489 gene locus_tag LOCUS_07810 1343 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 1442 1365 gene locus_tag LOCUS_t00210 1442 1365 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2089 1487 gene locus_tag LOCUS_07820 2089 1487 CDS product KaiC associated regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064643.1 protein_id gnl|my_center|LOCUS_07820 2970 2119 gene locus_tag LOCUS_07830 2970 2119 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878298.1 protein_id gnl|my_center|LOCUS_07830 3189 3830 gene locus_tag LOCUS_07840 gene rpiA 3189 3830 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060856.1 protein_id gnl|my_center|LOCUS_07840 3821 3912 gene locus_tag LOCUS_t00220 3821 3912 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence122 1197 31 gene locus_tag LOCUS_07850 1197 31 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879903.1 protein_id gnl|my_center|LOCUS_07850 2251 1208 gene locus_tag LOCUS_07860 2251 1208 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871070.1 protein_id gnl|my_center|LOCUS_07860 2527 3774 gene locus_tag LOCUS_07870 gene cca 2527 3774 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876223.1 protein_id gnl|my_center|LOCUS_07870 >Feature sequence123 2221 1823 gene locus_tag LOCUS_07880 2221 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 2523 2188 gene locus_tag LOCUS_07890 2523 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 2739 2539 gene locus_tag LOCUS_07900 2739 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 3017 2754 gene locus_tag LOCUS_07910 3017 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 3211 3032 gene locus_tag LOCUS_07920 3211 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 3559 3221 gene locus_tag LOCUS_07930 3559 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 3864 3556 gene locus_tag LOCUS_07940 3864 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 >Feature sequence124 <1 741 gene locus_tag LOCUS_07950 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010884713.1:cell wall-binding repeat-containing protein 746 916 gene locus_tag LOCUS_07960 746 916 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867153.1 protein_id gnl|my_center|LOCUS_07960 931 1200 gene locus_tag LOCUS_07970 931 1200 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877307.1 protein_id gnl|my_center|LOCUS_07970 1210 2229 gene locus_tag LOCUS_07980 gene fen 1210 2229 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250232.1 protein_id gnl|my_center|LOCUS_07980 2296 2484 gene locus_tag LOCUS_07990 2296 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 2874 2455 gene locus_tag LOCUS_08000 2874 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 >Feature sequence125 1510 8 gene locus_tag LOCUS_08010 1510 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 1580 3526 gene locus_tag LOCUS_08020 1580 3526 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_08020 >Feature sequence126 <1 1562 gene locus_tag LOCUS_08030 <1 1562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250359.1:glutamate--tRNA ligase <3880 1581 gene locus_tag LOCUS_08040 <3880 1581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583674.1:pyruvate, phosphate dikinase >Feature sequence127 <1 2649 gene locus_tag LOCUS_08050 <1 2649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020807.1:DEAD/DEAH box helicase >Feature sequence128 <1 535 gene locus_tag LOCUS_08060 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142531.1:NuoM family protein 535 1824 gene locus_tag LOCUS_08070 gene fpoN 535 1824 CDS product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_08070 1930 2565 gene locus_tag LOCUS_08080 1930 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 3226 2567 gene locus_tag LOCUS_08090 3226 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 3420 3283 gene locus_tag LOCUS_08100 3420 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 3529 3606 gene locus_tag LOCUS_t00230 3529 3606 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence129 907 2133 gene locus_tag LOCUS_08110 907 2133 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867356.1 protein_id gnl|my_center|LOCUS_08110 2130 2435 gene locus_tag LOCUS_08120 2130 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence130 221 1654 gene locus_tag LOCUS_08130 gene proS 221 1654 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023782.1 protein_id gnl|my_center|LOCUS_08130 1606 1944 gene locus_tag LOCUS_08140 1606 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 1988 2434 gene locus_tag LOCUS_08150 1988 2434 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868429.1 protein_id gnl|my_center|LOCUS_08150 2391 2996 gene locus_tag LOCUS_08160 2391 2996 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867133.1 protein_id gnl|my_center|LOCUS_08160 3001 3510 gene locus_tag LOCUS_08170 3001 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence131 776 354 gene locus_tag LOCUS_08180 776 354 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879219.1 protein_id gnl|my_center|LOCUS_08180 2956 965 gene locus_tag LOCUS_08190 gene feoB 2956 965 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582918.1 protein_id gnl|my_center|LOCUS_08190 3195 2956 gene locus_tag LOCUS_08200 3195 2956 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053694.1 protein_id gnl|my_center|LOCUS_08200 <3743 3180 gene locus_tag LOCUS_08210 <3743 3180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582916.1:DtxR family transcriptional regulator >Feature sequence132 594 52 gene locus_tag LOCUS_08220 594 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 2105 669 gene locus_tag LOCUS_08230 2105 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 3019 2117 gene locus_tag LOCUS_08240 gene ilvE 3019 2117 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878433.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence133 1279 134 gene locus_tag LOCUS_08250 1279 134 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879038.1 protein_id gnl|my_center|LOCUS_08250 >Feature sequence134 1653 1009 gene locus_tag LOCUS_08260 1653 1009 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868022.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence135 246 620 gene locus_tag LOCUS_08270 246 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 700 1866 gene locus_tag LOCUS_08280 gene coaBC 700 1866 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867837.1 protein_id gnl|my_center|LOCUS_08280 1863 2714 gene locus_tag LOCUS_08290 1863 2714 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892274.1 protein_id gnl|my_center|LOCUS_08290 2711 3466 gene locus_tag LOCUS_08300 2711 3466 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867813.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence136 1074 199 gene locus_tag LOCUS_08310 gene cas1 1074 199 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879371.1 protein_id gnl|my_center|LOCUS_08310 2138 1245 gene locus_tag LOCUS_08320 gene cas4a 2138 1245 CDS product type I-A CRISPR-associated protein Cas4/Csa1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879372.1 protein_id gnl|my_center|LOCUS_08320 2455 2177 gene locus_tag LOCUS_08330 gene cas2 2455 2177 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879369.1 protein_id gnl|my_center|LOCUS_08330 2600 3490 gene locus_tag LOCUS_08340 2600 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879352.1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence137 7 168 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaattatcttttgattgcttc 1021 1536 gene locus_tag LOCUS_08350 1021 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 1539 2582 gene locus_tag LOCUS_08360 gene cas7a 1539 2582 CDS product type I-A CRISPR-associated protein Cas7/Csa2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147281.1 protein_id gnl|my_center|LOCUS_08360 2564 3478 gene locus_tag LOCUS_08370 2564 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 >Feature sequence138 <1 563 gene locus_tag LOCUS_08380 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867269.1:ABC transporter ATP-binding protein 544 1500 gene locus_tag LOCUS_08390 544 1500 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080230.1 protein_id gnl|my_center|LOCUS_08390 1577 1502 gene locus_tag LOCUS_t00240 1577 1502 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3088 1727 gene locus_tag LOCUS_08400 3088 1727 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250133.1 protein_id gnl|my_center|LOCUS_08400 3087 3521 gene locus_tag LOCUS_08410 3087 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence139 >Feature sequence140 <1 1641 gene locus_tag LOCUS_08420 <1 1641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973095.1:sulfate ABC transporter permease subunit CysT 1648 2754 gene locus_tag LOCUS_08430 gene potA 1648 2754 CDS product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005253.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence141 899 579 gene locus_tag LOCUS_08440 899 579 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867761.1 protein_id gnl|my_center|LOCUS_08440 1720 872 gene locus_tag LOCUS_08450 1720 872 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060988.1 protein_id gnl|my_center|LOCUS_08450 2823 1693 gene locus_tag LOCUS_08460 2823 1693 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871044.1 protein_id gnl|my_center|LOCUS_08460 3415 2966 gene locus_tag LOCUS_08470 3415 2966 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197463606.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence142 470 1435 gene locus_tag LOCUS_08480 470 1435 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_08480 1395 2399 gene locus_tag LOCUS_08490 1395 2399 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_08490 2560 2796 gene locus_tag LOCUS_08500 2560 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 >Feature sequence143 380 664 gene locus_tag LOCUS_08510 380 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 1302 3110 gene locus_tag LOCUS_08520 1302 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence144 1481 2113 gene locus_tag LOCUS_08530 gene phoU 1481 2113 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020935.1 protein_id gnl|my_center|LOCUS_08530 2188 2264 gene locus_tag LOCUS_t00250 2188 2264 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3231 2266 gene locus_tag LOCUS_08540 3231 2266 CDS product potassium channel protein MjK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869633.1 protein_id gnl|my_center|LOCUS_08540 >Feature sequence145 327 1331 gene locus_tag LOCUS_08550 327 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 1431 1267 gene locus_tag LOCUS_08560 1431 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence146 1230 508 gene locus_tag LOCUS_08570 1230 508 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813519.1 protein_id gnl|my_center|LOCUS_08570 2547 1327 gene locus_tag LOCUS_08580 2547 1327 CDS product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821473.1 protein_id gnl|my_center|LOCUS_08580 2680 3222 gene locus_tag LOCUS_08590 2680 3222 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence147 326 1060 gene locus_tag LOCUS_08600 326 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1845 1057 gene locus_tag LOCUS_08610 1845 1057 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064408.1 protein_id gnl|my_center|LOCUS_08610 2582 1842 gene locus_tag LOCUS_08620 2582 1842 CDS product DUF432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879042.1 protein_id gnl|my_center|LOCUS_08620 3310 2627 gene locus_tag LOCUS_08630 3310 2627 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080855.1 protein_id gnl|my_center|LOCUS_08630 >Feature sequence148 >Feature sequence149 183 953 gene locus_tag LOCUS_08640 183 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 1260 913 gene locus_tag LOCUS_08650 1260 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 2960 1248 gene locus_tag LOCUS_08660 2960 1248 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867369.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence150 <1 1674 gene locus_tag LOCUS_08670 <1 1674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000086363.1:heavy metal translocating P-type ATPase 3299 1671 gene locus_tag LOCUS_08680 gene pruA 3299 1671 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_08680 >Feature sequence151 <1 587 gene locus_tag LOCUS_08690 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763529.1:S8 family peptidase 584 1942 gene locus_tag LOCUS_08700 584 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 1953 2303 gene locus_tag LOCUS_08710 1953 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 2313 2666 gene locus_tag LOCUS_08720 2313 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 2663 3070 gene locus_tag LOCUS_08730 2663 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 >Feature sequence152 140 343 gene locus_tag LOCUS_08740 140 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 340 1080 gene locus_tag LOCUS_08750 340 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1074 1460 gene locus_tag LOCUS_08760 1074 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 >Feature sequence153 1671 1321 gene locus_tag LOCUS_08770 1671 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 2789 2322 gene locus_tag LOCUS_08780 2789 2322 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880961.1 protein_id gnl|my_center|LOCUS_08780 >Feature sequence154 1777 1040 gene locus_tag LOCUS_08790 1777 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1799 2722 gene locus_tag LOCUS_08800 1799 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence155 >Feature sequence156 2324 1545 gene locus_tag LOCUS_08810 2324 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence157 763 1527 gene locus_tag LOCUS_08820 763 1527 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289098.1 protein_id gnl|my_center|LOCUS_08820 <3288 1545 gene locus_tag LOCUS_08830 <3288 1545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868773.1:phosphoenolpyruvate carboxykinase (GTP) >Feature sequence158 692 183 gene locus_tag LOCUS_08840 gene endA 692 183 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060780.1 protein_id gnl|my_center|LOCUS_08840 859 1515 gene locus_tag LOCUS_08850 859 1515 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868180.1 protein_id gnl|my_center|LOCUS_08850 1959 1501 gene locus_tag LOCUS_08860 1959 1501 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_08860 2022 2243 gene locus_tag LOCUS_08870 2022 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 2246 2977 gene locus_tag LOCUS_08880 2246 2977 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_08880 3217 2990 gene locus_tag LOCUS_08890 3217 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence159 <1 885 gene locus_tag LOCUS_08900 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879530.1:ribosome rescue protein RqcH 834 2726 gene locus_tag LOCUS_08910 834 2726 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249735.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence160 246 581 gene locus_tag LOCUS_08920 246 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 574 846 gene locus_tag LOCUS_08930 574 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 1264 806 gene locus_tag LOCUS_08940 1264 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 2701 1502 gene locus_tag LOCUS_08950 2701 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence161 >Feature sequence162 1708 620 gene locus_tag LOCUS_08960 gene pepQ 1708 620 CDS product Xaa-Pro dipeptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146836.1 protein_id gnl|my_center|LOCUS_08960 2491 1709 gene locus_tag LOCUS_08970 2491 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 >Feature sequence163 25 315 gene locus_tag LOCUS_08980 25 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 942 328 gene locus_tag LOCUS_08990 942 328 CDS product NAAT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871201.1 protein_id gnl|my_center|LOCUS_08990 <3183 955 gene locus_tag LOCUS_09000 <3183 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867994.1:leucine--tRNA ligase >Feature sequence164 <1 909 gene locus_tag LOCUS_09010 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060894.1:DHH family phosphoesterase 1536 868 gene locus_tag LOCUS_09020 gene rhaD 1536 868 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080415.1 protein_id gnl|my_center|LOCUS_09020 1820 1506 gene locus_tag LOCUS_09030 gene cutA 1820 1506 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545706.1 protein_id gnl|my_center|LOCUS_09030 1879 2235 gene locus_tag LOCUS_09040 1879 2235 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251233.1 protein_id gnl|my_center|LOCUS_09040 2459 3109 gene locus_tag LOCUS_09050 2459 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence165 1552 1475 gene locus_tag LOCUS_t00260 1552 1475 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1928 2677 gene locus_tag LOCUS_09060 1928 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence166 1428 154 gene locus_tag LOCUS_09070 1428 154 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979547.1 protein_id gnl|my_center|LOCUS_09070 2806 1433 gene locus_tag LOCUS_09080 gene purF 2806 1433 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060868.1 protein_id gnl|my_center|LOCUS_09080 3042 2803 gene locus_tag LOCUS_09090 gene purS 3042 2803 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879434.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence167 1368 202 gene locus_tag LOCUS_09100 1368 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 1576 3138 gene locus_tag LOCUS_09110 1576 3138 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249525.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence168 300 386 gene locus_tag LOCUS_t00270 300 386 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 933 349 gene locus_tag LOCUS_09120 933 349 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146494.1 protein_id gnl|my_center|LOCUS_09120 950 1249 gene locus_tag LOCUS_09130 950 1249 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878674.1 protein_id gnl|my_center|LOCUS_09130 3055 1922 gene locus_tag LOCUS_09140 3055 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 >Feature sequence169 471 956 gene locus_tag LOCUS_09150 471 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 959 1228 gene locus_tag LOCUS_09160 959 1228 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868833.1 protein_id gnl|my_center|LOCUS_09160 1234 1428 gene locus_tag LOCUS_09170 1234 1428 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978936.1 protein_id gnl|my_center|LOCUS_09170 1434 2225 gene locus_tag LOCUS_09180 1434 2225 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061020.1 protein_id gnl|my_center|LOCUS_09180 2226 2399 gene locus_tag LOCUS_09190 2226 2399 CDS product RNA-protein complex protein Nop10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867970.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence170 58 948 gene locus_tag LOCUS_09200 58 948 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249628.1 protein_id gnl|my_center|LOCUS_09200 999 1628 gene locus_tag LOCUS_09210 999 1628 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_09210 1939 1646 gene locus_tag LOCUS_09220 1939 1646 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877331.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence171 96 1571 gene locus_tag LOCUS_09230 gene proS 96 1571 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979486.1 protein_id gnl|my_center|LOCUS_09230 1583 1792 gene locus_tag LOCUS_09240 1583 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 2184 1789 gene locus_tag LOCUS_09250 2184 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 2935 2195 gene locus_tag LOCUS_09260 2935 2195 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867960.1 protein_id gnl|my_center|LOCUS_09260 3080 2995 gene locus_tag LOCUS_t00280 3080 2995 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence172 2655 1468 gene locus_tag LOCUS_09270 2655 1468 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496851.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence173 975 820 gene locus_tag LOCUS_09280 975 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1246 944 gene locus_tag LOCUS_09290 1246 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1327 1608 gene locus_tag LOCUS_09300 1327 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1892 1632 gene locus_tag LOCUS_09310 1892 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 2347 1904 gene locus_tag LOCUS_09320 2347 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 2585 2352 gene locus_tag LOCUS_09330 2585 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 2940 2587 gene locus_tag LOCUS_09340 2940 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence174 2255 1179 gene locus_tag LOCUS_09350 2255 1179 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846769.1 protein_id gnl|my_center|LOCUS_09350 2248 2508 gene locus_tag LOCUS_09360 2248 2508 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846589.1 protein_id gnl|my_center|LOCUS_09360 >Feature sequence175 <1 1543 gene locus_tag LOCUS_09370 <1 1543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083774548.1:formylmethanofuran dehydrogenase subunit B >Feature sequence176 1124 180 gene locus_tag LOCUS_09380 1124 180 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948945.1 protein_id gnl|my_center|LOCUS_09380 2001 1102 gene locus_tag LOCUS_09390 2001 1102 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583782.1 protein_id gnl|my_center|LOCUS_09390 2700 2257 gene locus_tag LOCUS_09400 2700 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence177 1269 337 gene locus_tag LOCUS_09410 1269 337 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_09410 1318 1812 gene locus_tag LOCUS_09420 1318 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence178 <1 2253 gene locus_tag LOCUS_09430 <1 2253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082594.1:glycoside hydrolase family 3 N-terminal domain-containing protein 2639 2773 gene locus_tag LOCUS_09440 2639 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 >Feature sequence179 439 212 gene locus_tag LOCUS_09450 439 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 451 1512 gene locus_tag LOCUS_09460 451 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 1460 2029 gene locus_tag LOCUS_09470 1460 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 2091 2300 gene locus_tag LOCUS_09480 2091 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 2314 2478 gene locus_tag LOCUS_09490 2314 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence180 1166 2380 gene locus_tag LOCUS_09500 1166 2380 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867899.1 protein_id gnl|my_center|LOCUS_09500 <2990 2364 gene locus_tag LOCUS_09510 <2990 2364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876891.1:MBL fold metallo-hydrolase >Feature sequence181 <1 768 gene locus_tag LOCUS_09520 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878238.1:DHH family phosphoesterase 761 1042 gene locus_tag LOCUS_09530 761 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1008 1574 gene locus_tag LOCUS_09540 1008 1574 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147211.1 protein_id gnl|my_center|LOCUS_09540 1571 2605 gene locus_tag LOCUS_09550 1571 2605 CDS product SPOUT family RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867210.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence182 1995 1219 gene locus_tag LOCUS_09560 gene tatC 1995 1219 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545000.1 protein_id gnl|my_center|LOCUS_09560 2845 1988 gene locus_tag LOCUS_09570 2845 1988 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869948.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence183 >Feature sequence184 613 230 gene locus_tag LOCUS_09580 613 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 2036 2815 gene locus_tag LOCUS_09590 2036 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence185 828 625 gene locus_tag LOCUS_09600 828 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1378 878 gene locus_tag LOCUS_09610 1378 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 1824 1375 gene locus_tag LOCUS_09620 1824 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2099 1821 gene locus_tag LOCUS_09630 2099 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 2271 2077 gene locus_tag LOCUS_09640 2271 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence186 1372 2052 gene locus_tag LOCUS_09650 gene xpf 1372 2052 CDS product 3'-flap repair endonuclease Xpf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978411.1 protein_id gnl|my_center|LOCUS_09650 2049 2831 gene locus_tag LOCUS_09660 2049 2831 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869661.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence187 485 1765 gene locus_tag LOCUS_09670 485 1765 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545534.1 protein_id gnl|my_center|LOCUS_09670 2159 1833 gene locus_tag LOCUS_09680 2159 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 2618 2175 gene locus_tag LOCUS_09690 2618 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09690 2918 2670 gene locus_tag LOCUS_09700 2918 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09700 >Feature sequence188 >Feature sequence189 1102 185 gene locus_tag LOCUS_09710 1102 185 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980384.1 protein_id gnl|my_center|LOCUS_09710 <2905 1092 gene locus_tag LOCUS_09720 <2905 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980386.1:2-oxoacid:ferredoxin oxidoreductase subunit alpha >Feature sequence190 1262 504 gene locus_tag LOCUS_09730 1262 504 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868648.1 protein_id gnl|my_center|LOCUS_09730 1257 2303 gene locus_tag LOCUS_09740 1257 2303 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_09740 2381 2305 gene locus_tag LOCUS_t00290 2381 2305 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2893 2543 gene locus_tag LOCUS_09750 2893 2543 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196772272.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence191 885 82 gene locus_tag LOCUS_09760 885 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 2642 888 gene locus_tag LOCUS_09770 2642 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence192 2464 908 gene locus_tag LOCUS_09780 2464 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence193 >Feature sequence194 <1 762 gene locus_tag LOCUS_09790 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064301.1:RtcB family protein 759 1580 gene locus_tag LOCUS_09800 759 1580 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250494.1 protein_id gnl|my_center|LOCUS_09800 1573 2589 gene locus_tag LOCUS_09810 1573 2589 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250493.1 protein_id gnl|my_center|LOCUS_09810 >Feature sequence195 1573 1190 gene locus_tag LOCUS_09820 1573 1190 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879641.1 protein_id gnl|my_center|LOCUS_09820 2098 1586 gene locus_tag LOCUS_09830 2098 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2738 2079 gene locus_tag LOCUS_09840 2738 2079 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249969.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence196 2560 1589 gene locus_tag LOCUS_09850 2560 1589 CDS product CGP-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249524.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence197 468 938 gene locus_tag LOCUS_09860 468 938 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023392.1 protein_id gnl|my_center|LOCUS_09860 1960 1112 gene locus_tag LOCUS_09870 1960 1112 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024284.1 protein_id gnl|my_center|LOCUS_09870 2600 1962 gene locus_tag LOCUS_09880 2600 1962 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024284.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence198 128 262 gene locus_tag LOCUS_09890 128 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 356 1936 gene locus_tag LOCUS_09900 356 1936 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527926.1 protein_id gnl|my_center|LOCUS_09900 <2832 2018 gene locus_tag LOCUS_09910 <2832 2018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003536336.1:ABC transporter substrate-binding protein >Feature sequence199 59 322 gene locus_tag LOCUS_09920 59 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 316 591 gene locus_tag LOCUS_09930 316 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 598 912 gene locus_tag LOCUS_09940 598 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence200 311 117 gene locus_tag LOCUS_09950 311 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1967 918 gene locus_tag LOCUS_09960 1967 918 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878029.1 protein_id gnl|my_center|LOCUS_09960 1985 2446 gene locus_tag LOCUS_09970 1985 2446 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880961.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence201 1877 1802 gene locus_tag LOCUS_t00300 1877 1802 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2239 2315 gene locus_tag LOCUS_t00310 2239 2315 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence202 1925 1008 gene locus_tag LOCUS_09980 1925 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence203 >Feature sequence204 1112 936 gene locus_tag LOCUS_09990 1112 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1285 1109 gene locus_tag LOCUS_10000 1285 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1429 1968 gene locus_tag LOCUS_10010 1429 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 >Feature sequence205 543 121 gene locus_tag LOCUS_10020 543 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10020 991 533 gene locus_tag LOCUS_10030 991 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1640 1056 gene locus_tag LOCUS_10040 1640 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 2010 1696 gene locus_tag LOCUS_10050 2010 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence206 716 2470 gene locus_tag LOCUS_10060 716 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence207 619 1674 gene locus_tag LOCUS_10070 619 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1676 2278 gene locus_tag LOCUS_10080 1676 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 2283 2471 gene locus_tag LOCUS_10090 2283 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence208 1264 236 gene locus_tag LOCUS_10100 1264 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1826 1266 gene locus_tag LOCUS_10110 1826 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 2410 1826 gene locus_tag LOCUS_10120 2410 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence209 659 369 gene locus_tag LOCUS_10130 659 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1242 637 gene locus_tag LOCUS_10140 1242 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1311 2003 gene locus_tag LOCUS_10150 1311 2003 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867423.1 protein_id gnl|my_center|LOCUS_10150 2005 2277 gene locus_tag LOCUS_10160 2005 2277 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250221.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence210 460 897 gene locus_tag LOCUS_10170 460 897 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978373.1 protein_id gnl|my_center|LOCUS_10170 1742 927 gene locus_tag LOCUS_10180 1742 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 2116 1739 gene locus_tag LOCUS_10190 2116 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 2437 2129 gene locus_tag LOCUS_10200 2437 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence211 896 1459 gene locus_tag LOCUS_10210 896 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1574 1933 gene locus_tag LOCUS_10220 1574 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence212 227 478 gene locus_tag LOCUS_10230 227 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 742 818 gene locus_tag LOCUS_t00320 742 818 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence213 194 469 gene locus_tag LOCUS_10240 194 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 473 787 gene locus_tag LOCUS_10250 473 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence214 1955 297 gene locus_tag LOCUS_10260 1955 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence215 771 301 gene locus_tag LOCUS_10270 771 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1774 758 gene locus_tag LOCUS_10280 1774 758 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867916.1 protein_id gnl|my_center|LOCUS_10280 >Feature sequence216 226 1146 gene locus_tag LOCUS_10290 226 1146 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876848.1 protein_id gnl|my_center|LOCUS_10290 1157 1909 gene locus_tag LOCUS_10300 1157 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 <2659 1978 gene locus_tag LOCUS_10310 <2659 1978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061314.1:alanine--glyoxylate aminotransferase family protein >Feature sequence217 42 2567 gene locus_tag LOCUS_10320 42 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence218 19 138 gene locus_tag LOCUS_10330 19 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 223 537 gene locus_tag LOCUS_10340 223 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 542 850 gene locus_tag LOCUS_10350 542 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 847 1185 gene locus_tag LOCUS_10360 847 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1195 1386 gene locus_tag LOCUS_10370 1195 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1389 1652 gene locus_tag LOCUS_10380 1389 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1667 1867 gene locus_tag LOCUS_10390 1667 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1883 2218 gene locus_tag LOCUS_10400 1883 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 2185 2583 gene locus_tag LOCUS_10410 2185 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence219 600 364 gene locus_tag LOCUS_10420 600 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1052 1264 gene locus_tag LOCUS_10430 1052 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1594 1298 gene locus_tag LOCUS_10440 1594 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 2222 2034 gene locus_tag LOCUS_10450 2222 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence220 <1 577 gene locus_tag LOCUS_10460 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876013.1:glycosyltransferase family 2 protein 587 1954 gene locus_tag LOCUS_10470 587 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence221 <1 1860 gene locus_tag LOCUS_10480 <1 1860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016360.1:ABC transporter substrate-binding protein >Feature sequence222 1173 343 gene locus_tag LOCUS_10490 1173 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence223 1507 110 gene locus_tag LOCUS_10500 1507 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1950 1669 gene locus_tag LOCUS_10510 1950 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence224 65 508 gene locus_tag LOCUS_10520 65 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 450 815 gene locus_tag LOCUS_10530 450 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1293 727 gene locus_tag LOCUS_10540 1293 727 CDS product DUF4443 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868435.1 protein_id gnl|my_center|LOCUS_10540 2344 1484 gene locus_tag LOCUS_10550 2344 1484 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867401.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence225 1095 298 gene locus_tag LOCUS_10560 1095 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1883 1092 gene locus_tag LOCUS_10570 1883 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 <2596 1893 gene locus_tag LOCUS_10580 <2596 1893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250976.1:daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein >Feature sequence226 706 963 gene locus_tag LOCUS_10590 706 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1534 989 gene locus_tag LOCUS_10600 1534 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 1609 2163 gene locus_tag LOCUS_10610 1609 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 >Feature sequence227 126 1616 gene locus_tag LOCUS_10620 126 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 >Feature sequence228 1178 294 gene locus_tag LOCUS_10630 gene larE 1178 294 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584116.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence229 >Feature sequence230 1422 754 gene locus_tag LOCUS_10640 1422 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1921 1412 gene locus_tag LOCUS_10650 1921 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 2471 2118 gene locus_tag LOCUS_10660 2471 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 >Feature sequence231 379 65 gene locus_tag LOCUS_10670 379 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1860 472 gene locus_tag LOCUS_10680 1860 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 2486 1860 gene locus_tag LOCUS_10690 2486 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence232 533 279 gene locus_tag LOCUS_10700 533 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 2110 530 gene locus_tag LOCUS_10710 2110 530 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865397.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence233 3 365 gene locus_tag LOCUS_10720 3 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 296 1015 gene locus_tag LOCUS_10730 296 1015 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978111.1 protein_id gnl|my_center|LOCUS_10730 993 1676 gene locus_tag LOCUS_10740 gene rnhB 993 1676 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867642.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence234 1977 304 gene locus_tag LOCUS_10750 1977 304 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 protein_id gnl|my_center|LOCUS_10750 2213 2076 gene locus_tag LOCUS_10760 2213 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence235 1875 562 gene locus_tag LOCUS_10770 1875 562 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083500625.1 protein_id gnl|my_center|LOCUS_10770 <2524 1847 gene locus_tag LOCUS_10780 <2524 1847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060928.1:N-6 DNA methylase >Feature sequence236 1735 1439 gene locus_tag LOCUS_10790 1735 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence237 922 1908 gene locus_tag LOCUS_10800 922 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence238 825 214 gene locus_tag LOCUS_10810 825 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1739 822 gene locus_tag LOCUS_10820 1739 822 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876013.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence239 75 698 gene locus_tag LOCUS_10830 75 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 819 1274 gene locus_tag LOCUS_10840 819 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1280 1888 gene locus_tag LOCUS_10850 1280 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1889 2029 gene locus_tag LOCUS_10860 1889 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 2181 2372 gene locus_tag LOCUS_10870 2181 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence240 3 896 gene locus_tag LOCUS_10880 3 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 898 1305 gene locus_tag LOCUS_10890 898 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1290 1598 gene locus_tag LOCUS_10900 1290 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1603 2472 gene locus_tag LOCUS_10910 gene sdhB 1603 2472 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878185.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence241 737 1237 gene locus_tag LOCUS_10920 737 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1243 1629 gene locus_tag LOCUS_10930 1243 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1634 1990 gene locus_tag LOCUS_10940 1634 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1980 2177 gene locus_tag LOCUS_10950 1980 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence242 1213 716 gene locus_tag LOCUS_10960 gene purE 1213 716 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870121.1 protein_id gnl|my_center|LOCUS_10960 <2466 1210 gene locus_tag LOCUS_10970 <2466 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979548.1:phosphoribosylamine--glycine ligase >Feature sequence243 246 638 gene locus_tag LOCUS_10980 246 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 655 1341 gene locus_tag LOCUS_10990 655 1341 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436912.1 protein_id gnl|my_center|LOCUS_10990 1355 2281 gene locus_tag LOCUS_11000 1355 2281 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence244 1390 2175 gene locus_tag LOCUS_11010 1390 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 2434 2180 gene locus_tag LOCUS_11020 2434 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence245 >Feature sequence246 >Feature sequence247 1591 446 gene locus_tag LOCUS_11030 1591 446 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250237.1 protein_id gnl|my_center|LOCUS_11030 2182 1607 gene locus_tag LOCUS_11040 2182 1607 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867555.1 protein_id gnl|my_center|LOCUS_11040 >Feature sequence248 >Feature sequence249 1117 731 gene locus_tag LOCUS_11050 1117 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 2105 2335 gene locus_tag LOCUS_11060 2105 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence250 1043 831 gene locus_tag LOCUS_11070 1043 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1941 1135 gene locus_tag LOCUS_11080 1941 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence251 697 8 gene locus_tag LOCUS_11090 697 8 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762350.1 protein_id gnl|my_center|LOCUS_11090 861 700 gene locus_tag LOCUS_11100 861 700 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868406.1 protein_id gnl|my_center|LOCUS_11100 938 1480 gene locus_tag LOCUS_11110 gene endA 938 1480 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762644.1 protein_id gnl|my_center|LOCUS_11110 2382 1663 gene locus_tag LOCUS_11120 2382 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence252 670 1941 gene locus_tag LOCUS_11130 670 1941 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762144.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence253 673 434 gene locus_tag LOCUS_11140 673 434 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496448.1 protein_id gnl|my_center|LOCUS_11140 1057 674 gene locus_tag LOCUS_11150 1057 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1416 1709 gene locus_tag LOCUS_11160 1416 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 >Feature sequence254 1977 568 gene locus_tag LOCUS_11170 gene thrC 1977 568 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867870.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence255 315 22 gene locus_tag LOCUS_11180 315 22 CDS product YunC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066065.1 protein_id gnl|my_center|LOCUS_11180 409 1008 gene locus_tag LOCUS_11190 gene pgsA 409 1008 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868695.1 protein_id gnl|my_center|LOCUS_11190 1355 2272 gene locus_tag LOCUS_11200 1355 2272 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence256 1223 621 gene locus_tag LOCUS_11210 1223 621 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868704.1 protein_id gnl|my_center|LOCUS_11210 1237 1950 gene locus_tag LOCUS_11220 1237 1950 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061014.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence257 20 1114 gene locus_tag LOCUS_11230 20 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1128 1424 gene locus_tag LOCUS_11240 1128 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1429 1620 gene locus_tag LOCUS_11250 1429 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1610 2296 gene locus_tag LOCUS_11260 1610 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence258 <1 502 gene locus_tag LOCUS_11270 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867393.1:NAD(P)/FAD-dependent oxidoreductase 510 1766 gene locus_tag LOCUS_11280 510 1766 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867394.1 protein_id gnl|my_center|LOCUS_11280 1763 2158 gene locus_tag LOCUS_11290 1763 2158 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081696.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence259 179 2005 gene locus_tag LOCUS_11300 179 2005 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870191.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence260 471 319 gene locus_tag LOCUS_11310 471 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 765 2315 gene locus_tag LOCUS_11320 765 2315 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846406.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence261 70 465 gene locus_tag LOCUS_11330 70 465 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979318.1 protein_id gnl|my_center|LOCUS_11330 1269 550 gene locus_tag LOCUS_11340 1269 550 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876071.1 protein_id gnl|my_center|LOCUS_11340 1310 2320 gene locus_tag LOCUS_11350 gene pdxS 1310 2320 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867914.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence262 423 1040 gene locus_tag LOCUS_11360 423 1040 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878677.1 protein_id gnl|my_center|LOCUS_11360 1046 1414 gene locus_tag LOCUS_11370 1046 1414 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289500.1 protein_id gnl|my_center|LOCUS_11370 2335 1415 gene locus_tag LOCUS_11380 gene guaA 2335 1415 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249148.1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence263 2336 1197 gene locus_tag LOCUS_11390 2336 1197 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence264 458 288 gene locus_tag LOCUS_11400 458 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 648 448 gene locus_tag LOCUS_11410 648 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 845 2164 gene locus_tag LOCUS_11420 845 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 >Feature sequence265 >Feature sequence266 2290 509 gene locus_tag LOCUS_11430 2290 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence267 482 775 gene locus_tag LOCUS_11440 482 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1831 2082 gene locus_tag LOCUS_11450 1831 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 2088 2164 gene locus_tag LOCUS_t00330 2088 2164 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2190 2282 gene locus_tag LOCUS_t00340 2190 2282 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence268 1827 286 gene locus_tag LOCUS_11460 gene thsB 1827 286 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251253.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence269 >Feature sequence270 804 1781 gene locus_tag LOCUS_11470 804 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 2231 1785 gene locus_tag LOCUS_11480 2231 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence271 220 975 gene locus_tag LOCUS_11490 220 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 981 1370 gene locus_tag LOCUS_11500 981 1370 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066255.1 protein_id gnl|my_center|LOCUS_11500 <2321 1338 gene locus_tag LOCUS_11510 <2321 1338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061314.1:alanine--glyoxylate aminotransferase family protein >Feature sequence272 898 236 gene locus_tag LOCUS_11520 898 236 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879811.1 protein_id gnl|my_center|LOCUS_11520 1525 908 gene locus_tag LOCUS_11530 1525 908 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876461.1 protein_id gnl|my_center|LOCUS_11530 1547 1972 gene locus_tag LOCUS_11540 1547 1972 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878568.1 protein_id gnl|my_center|LOCUS_11540 2051 1977 gene locus_tag LOCUS_t00350 2051 1977 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence273 411 911 gene locus_tag LOCUS_11550 411 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 961 1164 gene locus_tag LOCUS_11560 961 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1161 2177 gene locus_tag LOCUS_11570 1161 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence274 1453 734 gene locus_tag LOCUS_11580 1453 734 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902476.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence275 679 5 gene locus_tag LOCUS_11590 679 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1804 689 gene locus_tag LOCUS_11600 1804 689 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978090.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence276 607 59 gene locus_tag LOCUS_11610 607 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 866 591 gene locus_tag LOCUS_11620 866 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1197 2105 gene locus_tag LOCUS_11630 gene amrB 1197 2105 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980136.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence277 992 1186 gene locus_tag LOCUS_11640 992 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1660 1223 gene locus_tag LOCUS_11650 1660 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1792 2214 gene locus_tag LOCUS_11660 1792 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence278 >Feature sequence279 1440 1132 gene locus_tag LOCUS_11670 1440 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1719 1444 gene locus_tag LOCUS_11680 1719 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1975 1706 gene locus_tag LOCUS_11690 1975 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 2161 1982 gene locus_tag LOCUS_11700 2161 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 >Feature sequence280 403 478 gene locus_tag LOCUS_t00360 403 478 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1558 482 gene locus_tag LOCUS_11710 1558 482 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230624.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence281 2 169 gene locus_tag LOCUS_11720 2 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 378 166 gene locus_tag LOCUS_11730 378 166 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869714.1 protein_id gnl|my_center|LOCUS_11730 1069 341 gene locus_tag LOCUS_11740 1069 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 2136 1075 gene locus_tag LOCUS_11750 2136 1075 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250076.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence282 <1 998 gene locus_tag LOCUS_11760 <1 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880570.1:DUF72 domain-containing protein <2298 1050 gene locus_tag LOCUS_11770 <2298 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878196.1:type B DNA-directed DNA polymerase >Feature sequence283 619 1638 gene locus_tag LOCUS_11780 619 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence284 25 501 gene locus_tag LOCUS_11790 25 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1583 891 gene locus_tag LOCUS_11800 1583 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence285 1824 454 gene locus_tag LOCUS_11810 1824 454 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876469.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence286 1 990 gene locus_tag LOCUS_11820 1 990 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867147.1 protein_id gnl|my_center|LOCUS_11820 1088 2074 gene locus_tag LOCUS_11830 gene iolG 1088 2074 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence287 983 411 gene locus_tag LOCUS_11840 983 411 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877880.1 protein_id gnl|my_center|LOCUS_11840 1104 1886 gene locus_tag LOCUS_11850 1104 1886 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762787.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence288 >Feature sequence289 1579 221 gene locus_tag LOCUS_11860 1579 221 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763152.1 protein_id gnl|my_center|LOCUS_11860 2165 1608 gene locus_tag LOCUS_11870 2165 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 >Feature sequence290 1771 722 gene locus_tag LOCUS_11880 1771 722 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090310.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence291 >Feature sequence292 <1 885 gene locus_tag LOCUS_11890 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867725.1:radical SAM protein >Feature sequence293 450 151 gene locus_tag LOCUS_11900 450 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 624 1610 gene locus_tag LOCUS_11910 624 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1707 2117 gene locus_tag LOCUS_11920 1707 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence294 1535 1290 gene locus_tag LOCUS_11930 1535 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1771 1532 gene locus_tag LOCUS_11940 1771 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 2199 1930 gene locus_tag LOCUS_11950 2199 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 >Feature sequence295 56 1417 gene locus_tag LOCUS_11960 56 1417 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921696.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence296 1195 650 gene locus_tag LOCUS_11970 1195 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence297 <2230 1036 gene locus_tag LOCUS_11980 <2230 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980417.1:glycosyltransferase family 2 protein >Feature sequence298 1223 858 gene locus_tag LOCUS_11990 1223 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence299 1329 25 gene locus_tag LOCUS_12000 1329 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence300 1072 371 gene locus_tag LOCUS_12010 1072 371 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870074.1 protein_id gnl|my_center|LOCUS_12010 1648 1082 gene locus_tag LOCUS_12020 1648 1082 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence301 261 1262 gene locus_tag LOCUS_12030 261 1262 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878138.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence302 1073 1321 gene locus_tag LOCUS_12040 1073 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence303 185 883 gene locus_tag LOCUS_12050 185 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1079 1333 gene locus_tag LOCUS_12060 1079 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1330 1593 gene locus_tag LOCUS_12070 1330 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1601 1915 gene locus_tag LOCUS_12080 1601 1915 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146633.1 protein_id gnl|my_center|LOCUS_12080 1920 2087 gene locus_tag LOCUS_12090 1920 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence304 548 213 gene locus_tag LOCUS_12100 548 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 1059 2039 gene locus_tag LOCUS_12110 1059 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence305 1002 1160 gene locus_tag LOCUS_12120 1002 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence306 68 1318 gene locus_tag LOCUS_12130 68 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1315 2067 gene locus_tag LOCUS_12140 1315 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence307 686 456 gene locus_tag LOCUS_12150 686 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1020 826 gene locus_tag LOCUS_12160 1020 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence308 1110 2117 gene locus_tag LOCUS_12170 1110 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence309 46 468 gene locus_tag LOCUS_12180 46 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 515 856 gene locus_tag LOCUS_12190 515 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 865 1122 gene locus_tag LOCUS_12200 865 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 >Feature sequence310 488 195 gene locus_tag LOCUS_12210 488 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1491 469 gene locus_tag LOCUS_12220 1491 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1689 1498 gene locus_tag LOCUS_12230 1689 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence311 >Feature sequence312 >Feature sequence313 <1 926 gene locus_tag LOCUS_12240 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_198429806.1:ATP-dependent helicase 907 1650 gene locus_tag LOCUS_12250 907 1650 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878652.1 protein_id gnl|my_center|LOCUS_12250 1707 1780 gene locus_tag LOCUS_t00370 1707 1780 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence314 179 331 gene locus_tag LOCUS_12260 179 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence315 1368 67 gene locus_tag LOCUS_12270 1368 67 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_12270 1768 2028 gene locus_tag LOCUS_12280 1768 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 >Feature sequence316 94 1005 gene locus_tag LOCUS_12290 94 1005 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876013.1 protein_id gnl|my_center|LOCUS_12290 1136 1267 gene locus_tag LOCUS_12300 1136 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1589 1747 gene locus_tag LOCUS_12310 1589 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1833 2147 gene locus_tag LOCUS_12320 1833 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence317 2138 687 gene locus_tag LOCUS_12330 2138 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence318 2 172 gene locus_tag LOCUS_12340 2 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 227 889 gene locus_tag LOCUS_12350 227 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1173 1904 gene locus_tag LOCUS_12360 1173 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 2161 2077 gene locus_tag LOCUS_t00380 2161 2077 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence319 1623 244 gene locus_tag LOCUS_12370 1623 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 >Feature sequence320 1572 421 gene locus_tag LOCUS_12380 1572 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 >Feature sequence321 143 493 gene locus_tag LOCUS_12390 143 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 717 640 gene locus_tag LOCUS_t00390 717 640 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1232 708 gene locus_tag LOCUS_12400 gene rimI 1232 708 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868792.1 protein_id gnl|my_center|LOCUS_12400 1584 1204 gene locus_tag LOCUS_12410 gene hjc 1584 1204 CDS product Holliday junction resolvase Hjc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879457.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence322 795 448 gene locus_tag LOCUS_12420 795 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 881 1408 gene locus_tag LOCUS_12430 881 1408 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980144.1 protein_id gnl|my_center|LOCUS_12430 1932 1405 gene locus_tag LOCUS_12440 1932 1405 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762932.1 protein_id gnl|my_center|LOCUS_12440 >Feature sequence323 354 509 gene locus_tag LOCUS_12450 354 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 612 803 gene locus_tag LOCUS_12460 612 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 997 1383 gene locus_tag LOCUS_12470 997 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence324 <1 634 gene locus_tag LOCUS_12480 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966689.1:methyltransferase domain-containing protein 725 1744 gene locus_tag LOCUS_12490 725 1744 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024333.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence325 1390 710 gene locus_tag LOCUS_12500 1390 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 >Feature sequence326 269 910 gene locus_tag LOCUS_12510 gene pssA 269 910 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_12510 1124 888 gene locus_tag LOCUS_12520 1124 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1733 1134 gene locus_tag LOCUS_12530 1733 1134 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877893.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence327 65 865 gene locus_tag LOCUS_12540 65 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256164.1 protein_id gnl|my_center|LOCUS_12540 878 1528 gene locus_tag LOCUS_12550 878 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence328 713 396 gene locus_tag LOCUS_12560 713 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1614 706 gene locus_tag LOCUS_12570 1614 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence329 >Feature sequence330 1170 643 gene locus_tag LOCUS_12580 1170 643 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256561.1 protein_id gnl|my_center|LOCUS_12580 1528 1157 gene locus_tag LOCUS_12590 1528 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1754 1560 gene locus_tag LOCUS_12600 1754 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence331 1789 635 gene locus_tag LOCUS_12610 1789 635 CDS product DUF1512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979465.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence332 257 105 gene locus_tag LOCUS_12620 257 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1463 1765 gene locus_tag LOCUS_12630 1463 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence333 <2144 506 gene locus_tag LOCUS_12640 <2144 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011761984.1:anaerobic ribonucleoside triphosphate reductase >Feature sequence334 548 1474 gene locus_tag LOCUS_12650 548 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence335 1063 1302 gene locus_tag LOCUS_12660 1063 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence336 859 446 gene locus_tag LOCUS_12670 859 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 >Feature sequence337 996 25 gene locus_tag LOCUS_12680 996 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence338 20 550 gene locus_tag LOCUS_12690 20 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 538 1428 gene locus_tag LOCUS_12700 538 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 2088 1441 gene locus_tag LOCUS_12710 2088 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence339 428 186 gene locus_tag LOCUS_12720 428 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence340 451 1242 gene locus_tag LOCUS_12730 451 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 1686 1219 gene locus_tag LOCUS_12740 1686 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 >Feature sequence341 1201 50 gene locus_tag LOCUS_12750 1201 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 <2128 1188 gene locus_tag LOCUS_12760 <2128 1188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877071.1:oligosaccharide repeat unit polymerase family protein >Feature sequence342 <1 852 gene locus_tag LOCUS_12770 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146653.1:D-2-hydroxyacid dehydrogenase >Feature sequence343 18 452 gene locus_tag LOCUS_12780 18 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1857 433 gene locus_tag LOCUS_12790 1857 433 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867468.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence344 <2124 1130 gene locus_tag LOCUS_12800 <2124 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582961.1:ATP-grasp domain-containing protein >Feature sequence345 >Feature sequence346 >Feature sequence347 677 12 gene locus_tag LOCUS_12810 677 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1815 709 gene locus_tag LOCUS_12820 1815 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence348 1788 865 gene locus_tag LOCUS_12830 1788 865 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence349 445 50 gene locus_tag LOCUS_12840 445 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 596 784 gene locus_tag LOCUS_12850 596 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 781 1083 gene locus_tag LOCUS_12860 781 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 2021 1116 gene locus_tag LOCUS_12870 2021 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence350 6 2072 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaattctcttttaatagagacattctgattg >Feature sequence351 >Feature sequence352 1406 1188 gene locus_tag LOCUS_12880 1406 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1908 1477 gene locus_tag LOCUS_12890 1908 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence353 >Feature sequence354 <2094 462 gene locus_tag LOCUS_12900 <2094 462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_068577330.1:indolepyruvate ferredoxin oxidoreductase subunit alpha >Feature sequence355 400 23 gene locus_tag LOCUS_12910 400 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1064 390 gene locus_tag LOCUS_12920 1064 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence356 676 1275 gene locus_tag LOCUS_12930 676 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1351 1644 gene locus_tag LOCUS_12940 1351 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence357 >Feature sequence358 23 508 gene locus_tag LOCUS_12950 23 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1290 931 gene locus_tag LOCUS_12960 1290 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 1518 1294 gene locus_tag LOCUS_12970 1518 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence359 1054 659 gene locus_tag LOCUS_12980 1054 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1802 1191 gene locus_tag LOCUS_12990 gene udg 1802 1191 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879766.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence360 185 901 gene locus_tag LOCUS_13000 185 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence361 1204 935 gene locus_tag LOCUS_13010 1204 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence362 <1 517 gene locus_tag LOCUS_13020 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546559.1:NADH-quinone oxidoreductase subunit B family protein 514 963 gene locus_tag LOCUS_13030 514 963 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392494.1 protein_id gnl|my_center|LOCUS_13030 978 1535 gene locus_tag LOCUS_13040 978 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13040 >Feature sequence363 612 85 gene locus_tag LOCUS_13050 612 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1841 609 gene locus_tag LOCUS_13060 1841 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence364 1773 481 gene locus_tag LOCUS_13070 1773 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence365 481 1071 gene locus_tag LOCUS_13080 481 1071 CDS product NAAT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879602.1 protein_id gnl|my_center|LOCUS_13080 1068 1661 gene locus_tag LOCUS_13090 gene yjjX 1068 1661 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250698.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence366 1248 253 gene locus_tag LOCUS_13100 1248 253 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence367 646 723 gene locus_tag LOCUS_t00400 646 723 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence368 1063 878 gene locus_tag LOCUS_13110 1063 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1589 1017 gene locus_tag LOCUS_13120 1589 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence369 1829 411 gene locus_tag LOCUS_13130 1829 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence370 272 586 gene locus_tag LOCUS_13140 272 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 601 795 gene locus_tag LOCUS_13150 601 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 854 1135 gene locus_tag LOCUS_13160 854 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1154 1723 gene locus_tag LOCUS_13170 1154 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1789 2052 gene locus_tag LOCUS_13180 1789 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence371 >Feature sequence372 46 849 gene locus_tag LOCUS_13190 46 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 846 1823 gene locus_tag LOCUS_13200 846 1823 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038852.1 protein_id gnl|my_center|LOCUS_13200 1863 2021 gene locus_tag LOCUS_13210 1863 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence373 1898 1743 gene locus_tag LOCUS_13220 1898 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence374 786 499 gene locus_tag LOCUS_13230 786 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1881 790 gene locus_tag LOCUS_13240 1881 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence375 >Feature sequence376 595 359 gene locus_tag LOCUS_13250 595 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 747 619 gene locus_tag LOCUS_13260 747 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 998 723 gene locus_tag LOCUS_13270 998 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2003 1185 gene locus_tag LOCUS_13280 2003 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence377 352 990 gene locus_tag LOCUS_13290 352 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence378 <1 1698 gene locus_tag LOCUS_13300 <1 1698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227894.1:aldehyde ferredoxin oxidoreductase family protein >Feature sequence379 437 559 gene locus_tag LOCUS_13310 437 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 566 916 gene locus_tag LOCUS_13320 566 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1016 1243 gene locus_tag LOCUS_13330 1016 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1961 1194 gene locus_tag LOCUS_13340 1961 1194 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868133.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence380 660 1304 gene locus_tag LOCUS_13350 660 1304 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987052.1 protein_id gnl|my_center|LOCUS_13350 1834 1412 gene locus_tag LOCUS_13360 1834 1412 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391729.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence381 1336 773 gene locus_tag LOCUS_13370 1336 773 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868780.1 protein_id gnl|my_center|LOCUS_13370 1722 1910 gene locus_tag LOCUS_13380 1722 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence382 761 1138 gene locus_tag LOCUS_13390 761 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1172 1309 gene locus_tag LOCUS_13400 1172 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1518 1826 gene locus_tag LOCUS_13410 1518 1826 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879182.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence383 1798 440 gene locus_tag LOCUS_13420 1798 440 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064444.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence384 >Feature sequence385 570 1013 gene locus_tag LOCUS_13430 570 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249897.1 protein_id gnl|my_center|LOCUS_13430 1550 1020 gene locus_tag LOCUS_13440 1550 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence386 >Feature sequence387 664 837 gene locus_tag LOCUS_13450 664 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 834 995 gene locus_tag LOCUS_13460 834 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1316 1906 gene locus_tag LOCUS_13470 1316 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence388 1533 328 gene locus_tag LOCUS_13480 1533 328 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868579.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence389 781 557 gene locus_tag LOCUS_13490 781 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1119 832 gene locus_tag LOCUS_13500 1119 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1295 1116 gene locus_tag LOCUS_13510 1295 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1693 1292 gene locus_tag LOCUS_13520 1693 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence390 >Feature sequence391 871 44 gene locus_tag LOCUS_13530 871 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1232 1786 gene locus_tag LOCUS_13540 1232 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540