>Feature sequence001 3214 2426 gene locus_tag LOCUS_00010 3214 2426 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250673.1 protein_id gnl|my_center|LOCUS_00010 5655 3211 gene locus_tag LOCUS_00020 5655 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 7351 5660 gene locus_tag LOCUS_00030 7351 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 9884 7335 gene locus_tag LOCUS_00040 9884 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 10633 9905 gene locus_tag LOCUS_00050 10633 9905 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081034.1 protein_id gnl|my_center|LOCUS_00050 11852 10596 gene locus_tag LOCUS_00060 11852 10596 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980417.1 protein_id gnl|my_center|LOCUS_00060 13579 11843 gene locus_tag LOCUS_00070 13579 11843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 14496 13576 gene locus_tag LOCUS_00080 14496 13576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 15964 14486 gene locus_tag LOCUS_00090 15964 14486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 17115 15961 gene locus_tag LOCUS_00100 17115 15961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 18266 17106 gene locus_tag LOCUS_00110 18266 17106 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021199.1 protein_id gnl|my_center|LOCUS_00110 18791 18357 gene locus_tag LOCUS_00120 18791 18357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 <20315 19308 gene locus_tag LOCUS_00130 <20315 19308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250796.1:DUF58 domain-containing protein >Feature sequence002 52 222 gene locus_tag LOCUS_00140 52 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 867 316 gene locus_tag LOCUS_00150 867 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 2405 1659 gene locus_tag LOCUS_00160 2405 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 3649 2396 gene locus_tag LOCUS_00170 3649 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 7005 3655 gene locus_tag LOCUS_00180 7005 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 7730 7059 gene locus_tag LOCUS_00190 7730 7059 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964808.1 protein_id gnl|my_center|LOCUS_00190 8824 7727 gene locus_tag LOCUS_00200 8824 7727 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085033.1 protein_id gnl|my_center|LOCUS_00200 9780 9250 gene locus_tag LOCUS_00210 9780 9250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 10872 9802 gene locus_tag LOCUS_00220 10872 9802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 >Feature sequence003 487 305 gene locus_tag LOCUS_00230 487 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 2194 1436 gene locus_tag LOCUS_00240 2194 1436 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860724.1 protein_id gnl|my_center|LOCUS_00240 2348 3568 gene locus_tag LOCUS_00250 2348 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 4843 3623 gene locus_tag LOCUS_00260 4843 3623 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749132.1 protein_id gnl|my_center|LOCUS_00260 4958 5716 gene locus_tag LOCUS_00270 4958 5716 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976173.1 protein_id gnl|my_center|LOCUS_00270 5723 6706 gene locus_tag LOCUS_00280 5723 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978822.1 protein_id gnl|my_center|LOCUS_00280 7115 8047 gene locus_tag LOCUS_00290 gene rbsK 7115 8047 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_00290 8447 8788 gene locus_tag LOCUS_00300 8447 8788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 8785 9150 gene locus_tag LOCUS_00310 8785 9150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 9333 9572 gene locus_tag LOCUS_00320 9333 9572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 >Feature sequence004 447 256 gene locus_tag LOCUS_00330 447 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 599 420 gene locus_tag LOCUS_00340 599 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 1293 2891 gene locus_tag LOCUS_00350 1293 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 2919 3791 gene locus_tag LOCUS_00360 2919 3791 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082985.1 protein_id gnl|my_center|LOCUS_00360 3799 4626 gene locus_tag LOCUS_00370 3799 4626 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253348.1 protein_id gnl|my_center|LOCUS_00370 4623 6023 gene locus_tag LOCUS_00380 4623 6023 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080611.1 protein_id gnl|my_center|LOCUS_00380 6095 7492 gene locus_tag LOCUS_00390 6095 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 8938 7511 gene locus_tag LOCUS_00400 gene xylB 8938 7511 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_00400 >Feature sequence005 636 1286 gene locus_tag LOCUS_00410 636 1286 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_00410 1498 2325 gene locus_tag LOCUS_00420 1498 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00420 3730 2342 gene locus_tag LOCUS_00430 3730 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 4593 3799 gene locus_tag LOCUS_00440 4593 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 4737 6578 gene locus_tag LOCUS_00450 4737 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 6658 7692 gene locus_tag LOCUS_00460 6658 7692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 8276 7689 gene locus_tag LOCUS_00470 8276 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 8957 9184 gene locus_tag LOCUS_00480 8957 9184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 >Feature sequence006 364 534 gene locus_tag LOCUS_00490 364 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 757 2121 gene locus_tag LOCUS_00500 757 2121 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846351.1 protein_id gnl|my_center|LOCUS_00500 2227 2454 gene locus_tag LOCUS_00510 2227 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 2779 4299 gene locus_tag LOCUS_00520 2779 4299 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762758.1 protein_id gnl|my_center|LOCUS_00520 5275 4619 gene locus_tag LOCUS_00530 5275 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 6427 8076 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaattccctctatatgggatttttctctgaaac 8435 8719 gene locus_tag LOCUS_00540 8435 8719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 >Feature sequence007 3038 1884 gene locus_tag LOCUS_00550 3038 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 3905 3360 gene locus_tag LOCUS_00560 3905 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 4868 4302 gene locus_tag LOCUS_00570 4868 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 4976 5509 gene locus_tag LOCUS_00580 4976 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 5510 5878 gene locus_tag LOCUS_00590 5510 5878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 6331 5900 gene locus_tag LOCUS_00600 6331 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 6554 7021 gene locus_tag LOCUS_00610 6554 7021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 7140 7877 gene locus_tag LOCUS_00620 7140 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 8161 8475 gene locus_tag LOCUS_00630 8161 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 >Feature sequence008 467 78 gene locus_tag LOCUS_00640 467 78 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081696.1 protein_id gnl|my_center|LOCUS_00640 1739 471 gene locus_tag LOCUS_00650 1739 471 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209476615.1 protein_id gnl|my_center|LOCUS_00650 3543 1732 gene locus_tag LOCUS_00660 3543 1732 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865341.1 protein_id gnl|my_center|LOCUS_00660 4707 3544 gene locus_tag LOCUS_00670 4707 3544 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878368.1 protein_id gnl|my_center|LOCUS_00670 6056 4701 gene locus_tag LOCUS_00680 6056 4701 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878369.1 protein_id gnl|my_center|LOCUS_00680 7711 6119 gene locus_tag LOCUS_00690 7711 6119 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878367.1 protein_id gnl|my_center|LOCUS_00690 8288 7962 gene locus_tag LOCUS_00700 8288 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00700 >Feature sequence009 1366 635 gene locus_tag LOCUS_00710 1366 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00710 3252 1528 gene locus_tag LOCUS_00720 3252 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 4341 3376 gene locus_tag LOCUS_00730 4341 3376 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529215.1 protein_id gnl|my_center|LOCUS_00730 4476 5540 gene locus_tag LOCUS_00740 4476 5540 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043445520.1 protein_id gnl|my_center|LOCUS_00740 5593 6606 gene locus_tag LOCUS_00750 gene fgd 5593 6606 CDS product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892203.1 protein_id gnl|my_center|LOCUS_00750 6607 6942 gene locus_tag LOCUS_00760 6607 6942 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868508.1 protein_id gnl|my_center|LOCUS_00760 8261 7230 gene locus_tag LOCUS_00770 8261 7230 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_00770 >Feature sequence010 756 604 gene locus_tag LOCUS_00780 756 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 749 1246 gene locus_tag LOCUS_00790 749 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 4020 2272 gene locus_tag LOCUS_00800 4020 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 6514 4025 gene locus_tag LOCUS_00810 6514 4025 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014855724.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00810 7138 6572 gene locus_tag LOCUS_00820 7138 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 7319 7107 gene locus_tag LOCUS_00830 7319 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 >Feature sequence011 5079 595 gene locus_tag LOCUS_00840 5079 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 7054 5084 gene locus_tag LOCUS_00850 7054 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 >Feature sequence012 2 148 gene locus_tag LOCUS_00860 2 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 1667 297 gene locus_tag LOCUS_00870 1667 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 2125 4170 gene locus_tag LOCUS_00880 2125 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 5018 4206 gene locus_tag LOCUS_00890 5018 4206 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584151.1 protein_id gnl|my_center|LOCUS_00890 5797 5018 gene locus_tag LOCUS_00900 5797 5018 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584152.1 protein_id gnl|my_center|LOCUS_00900 7271 5895 gene locus_tag LOCUS_00910 7271 5895 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776637.1 protein_id gnl|my_center|LOCUS_00910 >Feature sequence013 736 2331 gene locus_tag LOCUS_00920 736 2331 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082994.1 protein_id gnl|my_center|LOCUS_00920 3048 2425 gene locus_tag LOCUS_00930 3048 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 3658 2996 gene locus_tag LOCUS_00940 3658 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 4264 3731 gene locus_tag LOCUS_00950 4264 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 5149 4466 gene locus_tag LOCUS_00960 gene rpe 5149 4466 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545731.1 protein_id gnl|my_center|LOCUS_00960 5416 5595 gene locus_tag LOCUS_00970 5416 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 6202 5651 gene locus_tag LOCUS_00980 6202 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 7446 6559 gene locus_tag LOCUS_00990 7446 6559 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_00990 >Feature sequence014 1122 283 gene locus_tag LOCUS_01000 gene trpA 1122 283 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881005.1 protein_id gnl|my_center|LOCUS_01000 2177 1119 gene locus_tag LOCUS_01010 gene trpB 2177 1119 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482634.1 protein_id gnl|my_center|LOCUS_01010 3010 2174 gene locus_tag LOCUS_01020 gene trpA 3010 2174 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481690.1 protein_id gnl|my_center|LOCUS_01020 4044 3007 gene locus_tag LOCUS_01030 4044 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 4354 4049 gene locus_tag LOCUS_01040 4354 4049 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723158.1 protein_id gnl|my_center|LOCUS_01040 5648 4368 gene locus_tag LOCUS_01050 5648 4368 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722022.1 protein_id gnl|my_center|LOCUS_01050 5788 6291 gene locus_tag LOCUS_01060 5788 6291 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530220.1 protein_id gnl|my_center|LOCUS_01060 6288 6458 gene locus_tag LOCUS_01070 6288 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 <7594 6968 gene locus_tag LOCUS_01080 <7594 6968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250501.1:asparagine synthetase A >Feature sequence015 165 611 gene locus_tag LOCUS_01090 165 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 2297 615 gene locus_tag LOCUS_01100 2297 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 2619 3212 gene locus_tag LOCUS_01110 2619 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 4857 3460 gene locus_tag LOCUS_01120 4857 3460 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004069588.1 protein_id gnl|my_center|LOCUS_01120 5045 4884 gene locus_tag LOCUS_01130 5045 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 6332 5223 gene locus_tag LOCUS_01140 6332 5223 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250252.1 protein_id gnl|my_center|LOCUS_01140 7079 6732 gene locus_tag LOCUS_01150 7079 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 7395 7207 gene locus_tag LOCUS_01160 7395 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 >Feature sequence016 412 1233 gene locus_tag LOCUS_01170 412 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 1230 2018 gene locus_tag LOCUS_01180 1230 2018 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_01180 2313 2083 gene locus_tag LOCUS_01190 2313 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 2460 3023 gene locus_tag LOCUS_01200 2460 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 4052 3063 gene locus_tag LOCUS_01210 4052 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 4829 4152 gene locus_tag LOCUS_01220 4829 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 5511 4852 gene locus_tag LOCUS_01230 gene rnhB 5511 4852 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867642.1 protein_id gnl|my_center|LOCUS_01230 6178 5537 gene locus_tag LOCUS_01240 6178 5537 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871083.1 protein_id gnl|my_center|LOCUS_01240 6591 6124 gene locus_tag LOCUS_01250 gene pyrI 6591 6124 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868441.1 protein_id gnl|my_center|LOCUS_01250 >Feature sequence017 3176 1743 gene locus_tag LOCUS_01260 3176 1743 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 protein_id gnl|my_center|LOCUS_01260 5138 4149 gene locus_tag LOCUS_01270 5138 4149 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250707.1 protein_id gnl|my_center|LOCUS_01270 6134 5145 gene locus_tag LOCUS_01280 6134 5145 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_01280 7003 6131 gene locus_tag LOCUS_01290 7003 6131 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868060.1 protein_id gnl|my_center|LOCUS_01290 >Feature sequence018 67 642 gene locus_tag LOCUS_01300 67 642 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435816.1 protein_id gnl|my_center|LOCUS_01300 1911 1303 gene locus_tag LOCUS_01310 1911 1303 CDS product KaiC associated regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064643.1 protein_id gnl|my_center|LOCUS_01310 2767 1916 gene locus_tag LOCUS_01320 2767 1916 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878298.1 protein_id gnl|my_center|LOCUS_01320 2870 3148 gene locus_tag LOCUS_01330 2870 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 3582 3307 gene locus_tag LOCUS_01340 3582 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 4227 4511 gene locus_tag LOCUS_01350 4227 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 4456 4734 gene locus_tag LOCUS_01360 4456 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 5446 5084 gene locus_tag LOCUS_01370 5446 5084 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485784.1 protein_id gnl|my_center|LOCUS_01370 5590 5835 gene locus_tag LOCUS_01380 5590 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 6237 7169 gene locus_tag LOCUS_01390 6237 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 >Feature sequence019 622 840 gene locus_tag LOCUS_01400 622 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 1008 1406 gene locus_tag LOCUS_01410 1008 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 2104 1547 gene locus_tag LOCUS_01420 gene dps 2104 1547 CDS product DNA protection during starvation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250010.1 protein_id gnl|my_center|LOCUS_01420 3073 2330 gene locus_tag LOCUS_01430 3073 2330 CDS product BPL-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336892.1 protein_id gnl|my_center|LOCUS_01430 3822 3142 gene locus_tag LOCUS_01440 3822 3142 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064926.1 protein_id gnl|my_center|LOCUS_01440 4407 3850 gene locus_tag LOCUS_01450 4407 3850 CDS product DUF996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867948.1 protein_id gnl|my_center|LOCUS_01450 4612 5118 gene locus_tag LOCUS_01460 4612 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 5915 5127 gene locus_tag LOCUS_01470 5915 5127 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250696.1 protein_id gnl|my_center|LOCUS_01470 6239 6898 gene locus_tag LOCUS_01480 6239 6898 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065619.1 protein_id gnl|my_center|LOCUS_01480 >Feature sequence020 2643 1126 gene locus_tag LOCUS_01490 2643 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 4141 2651 gene locus_tag LOCUS_01500 4141 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 4565 4146 gene locus_tag LOCUS_01510 4565 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 5509 5988 gene locus_tag LOCUS_01520 5509 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 6142 6324 gene locus_tag LOCUS_01530 6142 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 >Feature sequence021 389 1198 gene locus_tag LOCUS_01540 389 1198 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967715.1 protein_id gnl|my_center|LOCUS_01540 1220 2347 gene locus_tag LOCUS_01550 1220 2347 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210025.1 protein_id gnl|my_center|LOCUS_01550 3445 2354 gene locus_tag LOCUS_01560 3445 2354 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867312.1 protein_id gnl|my_center|LOCUS_01560 4543 3455 gene locus_tag LOCUS_01570 gene ugpC 4543 3455 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867305.1 protein_id gnl|my_center|LOCUS_01570 5430 4546 gene locus_tag LOCUS_01580 5430 4546 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082987.1 protein_id gnl|my_center|LOCUS_01580 6344 5439 gene locus_tag LOCUS_01590 6344 5439 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525322.1 protein_id gnl|my_center|LOCUS_01590 >Feature sequence022 523 1128 gene locus_tag LOCUS_01600 523 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 4090 1175 gene locus_tag LOCUS_01610 4090 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 >Feature sequence023 841 377 gene locus_tag LOCUS_01620 841 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 1075 1884 gene locus_tag LOCUS_01630 1075 1884 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382903.1 protein_id gnl|my_center|LOCUS_01630 2002 3375 gene locus_tag LOCUS_01640 2002 3375 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250375.1 protein_id gnl|my_center|LOCUS_01640 3440 4849 gene locus_tag LOCUS_01650 3440 4849 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250375.1 protein_id gnl|my_center|LOCUS_01650 4968 5396 gene locus_tag LOCUS_01660 4968 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 5393 5821 gene locus_tag LOCUS_01670 5393 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 <6517 5856 gene locus_tag LOCUS_01680 <6517 5856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902854.1:N-acetylglucosamine-6-phosphate deacetylase >Feature sequence024 335 1186 gene locus_tag LOCUS_01690 gene araQ 335 1186 CDS product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 protein_id gnl|my_center|LOCUS_01690 1426 2700 gene locus_tag LOCUS_01700 1426 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 3409 2999 gene locus_tag LOCUS_01710 3409 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 4587 3784 gene locus_tag LOCUS_01720 4587 3784 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817305.1 protein_id gnl|my_center|LOCUS_01720 5495 4587 gene locus_tag LOCUS_01730 5495 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 5742 5572 gene locus_tag LOCUS_01740 5742 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 >Feature sequence025 2072 198 gene locus_tag LOCUS_01750 2072 198 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250121.1 protein_id gnl|my_center|LOCUS_01750 2562 2347 gene locus_tag LOCUS_01760 2562 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 3615 2689 gene locus_tag LOCUS_01770 3615 2689 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909057.1 protein_id gnl|my_center|LOCUS_01770 3772 4056 gene locus_tag LOCUS_01780 3772 4056 CDS product 30S ribosomal protein S26e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762572.1 protein_id gnl|my_center|LOCUS_01780 4669 4088 gene locus_tag LOCUS_01790 gene pgsA 4669 4088 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868695.1 protein_id gnl|my_center|LOCUS_01790 5632 4739 gene locus_tag LOCUS_01800 5632 4739 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496419.1 protein_id gnl|my_center|LOCUS_01800 6341 5655 gene locus_tag LOCUS_01810 gene tpiA 6341 5655 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868855.1 protein_id gnl|my_center|LOCUS_01810 >Feature sequence026 1225 281 gene locus_tag LOCUS_01820 1225 281 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761587.1 protein_id gnl|my_center|LOCUS_01820 2161 1229 gene locus_tag LOCUS_01830 2161 1229 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258329.1 protein_id gnl|my_center|LOCUS_01830 3939 2164 gene locus_tag LOCUS_01840 3939 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 4083 5021 gene locus_tag LOCUS_01850 4083 5021 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762863.1 protein_id gnl|my_center|LOCUS_01850 5027 6256 gene locus_tag LOCUS_01860 5027 6256 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357242.1 protein_id gnl|my_center|LOCUS_01860 >Feature sequence027 <1 1015 gene locus_tag LOCUS_01870 <1 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060770.1:ferrous iron transport protein B 1063 1983 gene locus_tag LOCUS_01880 gene mtrH 1063 1983 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876780.1 protein_id gnl|my_center|LOCUS_01880 2052 2471 gene locus_tag LOCUS_01890 2052 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 2617 3552 gene locus_tag LOCUS_01900 gene nadA 2617 3552 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146454.1 protein_id gnl|my_center|LOCUS_01900 3923 4576 gene locus_tag LOCUS_01910 3923 4576 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250883.1 protein_id gnl|my_center|LOCUS_01910 4609 5175 gene locus_tag LOCUS_01920 4609 5175 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867177.1 protein_id gnl|my_center|LOCUS_01920 5190 5522 gene locus_tag LOCUS_01930 5190 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 5919 5503 gene locus_tag LOCUS_01940 5919 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 >Feature sequence028 1029 757 gene locus_tag LOCUS_01950 1029 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 3138 4850 gene locus_tag LOCUS_01960 3138 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 >Feature sequence029 328 561 gene locus_tag LOCUS_01970 328 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 1520 579 gene locus_tag LOCUS_01980 1520 579 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_01980 2361 1498 gene locus_tag LOCUS_01990 2361 1498 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_01990 3715 2687 gene locus_tag LOCUS_02000 3715 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 4211 4960 gene locus_tag LOCUS_02010 4211 4960 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_02010 5062 5559 gene locus_tag LOCUS_02020 5062 5559 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392242.1 protein_id gnl|my_center|LOCUS_02020 >Feature sequence030 <1 2118 gene locus_tag LOCUS_02030 <1 2118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978227.1:DNA-directed RNA polymerase subunit B 2119 5958 gene locus_tag LOCUS_02040 2119 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 >Feature sequence031 1025 219 gene locus_tag LOCUS_02050 1025 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 2444 1197 gene locus_tag LOCUS_02060 2444 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 2926 2576 gene locus_tag LOCUS_02070 2926 2576 CDS product DUF2095 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249981.1 protein_id gnl|my_center|LOCUS_02070 3640 4926 gene locus_tag LOCUS_02080 3640 4926 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877197.1 protein_id gnl|my_center|LOCUS_02080 5122 5559 gene locus_tag LOCUS_02090 5122 5559 CDS product Lsm family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846267.1 protein_id gnl|my_center|LOCUS_02090 >Feature sequence032 316 1137 gene locus_tag LOCUS_02100 316 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 1189 1815 gene locus_tag LOCUS_02110 1189 1815 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061295.1 protein_id gnl|my_center|LOCUS_02110 2338 2676 gene locus_tag LOCUS_02120 2338 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 2767 2976 gene locus_tag LOCUS_02130 2767 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 >Feature sequence033 1695 718 gene locus_tag LOCUS_02140 1695 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 2567 1692 gene locus_tag LOCUS_02150 2567 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 2718 2870 gene locus_tag LOCUS_02160 2718 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 3394 3032 gene locus_tag LOCUS_02170 3394 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 3846 3415 gene locus_tag LOCUS_02180 3846 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 3954 4511 gene locus_tag LOCUS_02190 3954 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 >Feature sequence034 <1 630 gene locus_tag LOCUS_02200 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979837.1:ABC transporter permease 1058 816 gene locus_tag LOCUS_02210 1058 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 2075 1125 gene locus_tag LOCUS_02220 2075 1125 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080192.1 protein_id gnl|my_center|LOCUS_02220 2574 2176 gene locus_tag LOCUS_02230 2574 2176 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582844.1 protein_id gnl|my_center|LOCUS_02230 4162 3380 gene locus_tag LOCUS_02240 4162 3380 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065132.1 protein_id gnl|my_center|LOCUS_02240 4432 4710 gene locus_tag LOCUS_02250 4432 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 5025 5438 gene locus_tag LOCUS_02260 gene tsaA 5025 5438 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877399.1 protein_id gnl|my_center|LOCUS_02260 >Feature sequence035 <1 726 gene locus_tag LOCUS_02270 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158908668.1:HsdR family type I site-specific deoxyribonuclease 862 1467 gene locus_tag LOCUS_02280 862 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 1775 1966 gene locus_tag LOCUS_02290 1775 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 1963 5280 gene locus_tag LOCUS_02300 1963 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 5210 5413 gene locus_tag LOCUS_02310 5210 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 >Feature sequence036 2269 2090 gene locus_tag LOCUS_02320 2269 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 2486 2698 gene locus_tag LOCUS_02330 2486 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 2751 3500 gene locus_tag LOCUS_02340 2751 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 3797 3946 gene locus_tag LOCUS_02350 3797 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 5055 4243 gene locus_tag LOCUS_02360 5055 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 5597 5373 gene locus_tag LOCUS_02370 5597 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 >Feature sequence037 3254 3033 gene locus_tag LOCUS_02380 3254 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 3501 3914 gene locus_tag LOCUS_02390 3501 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 3911 4174 gene locus_tag LOCUS_02400 3911 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 4180 4377 gene locus_tag LOCUS_02410 4180 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 4364 5011 gene locus_tag LOCUS_02420 4364 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 >Feature sequence038 1508 2467 gene locus_tag LOCUS_02430 1508 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 3245 2439 gene locus_tag LOCUS_02440 3245 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 >Feature sequence039 1812 808 gene locus_tag LOCUS_02450 1812 808 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020910.1 protein_id gnl|my_center|LOCUS_02450 1974 3500 gene locus_tag LOCUS_02460 1974 3500 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870207.1 protein_id gnl|my_center|LOCUS_02460 4744 3503 gene locus_tag LOCUS_02470 4744 3503 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250852.1 protein_id gnl|my_center|LOCUS_02470 >Feature sequence040 149 1045 gene locus_tag LOCUS_02480 149 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 1310 1086 gene locus_tag LOCUS_02490 1310 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 1400 1561 gene locus_tag LOCUS_02500 1400 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 1608 2543 gene locus_tag LOCUS_02510 1608 2543 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250927.1 protein_id gnl|my_center|LOCUS_02510 2815 2636 gene locus_tag LOCUS_02520 2815 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 3222 2941 gene locus_tag LOCUS_02530 3222 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 3891 5141 gene locus_tag LOCUS_02540 3891 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 >Feature sequence041 1057 449 gene locus_tag LOCUS_02550 1057 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 1175 1906 gene locus_tag LOCUS_02560 1175 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 2190 1915 gene locus_tag LOCUS_02570 2190 1915 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_02570 2457 3842 gene locus_tag LOCUS_02580 2457 3842 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887822.1 protein_id gnl|my_center|LOCUS_02580 3889 4188 gene locus_tag LOCUS_02590 gene gatB 3889 4188 CDS product PTS galactitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824293.1 protein_id gnl|my_center|LOCUS_02590 4190 4681 gene locus_tag LOCUS_02600 4190 4681 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892531.1 protein_id gnl|my_center|LOCUS_02600 >Feature sequence042 625 840 gene locus_tag LOCUS_02610 625 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 3683 1110 gene locus_tag LOCUS_02620 3683 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 3802 4239 gene locus_tag LOCUS_02630 3802 4239 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_02630 5338 4250 gene locus_tag LOCUS_02640 5338 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 >Feature sequence043 155 1354 gene locus_tag LOCUS_02650 155 1354 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583903.1 protein_id gnl|my_center|LOCUS_02650 1372 2769 gene locus_tag LOCUS_02660 1372 2769 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802003.1 protein_id gnl|my_center|LOCUS_02660 3699 2773 gene locus_tag LOCUS_02670 3699 2773 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932656.1 protein_id gnl|my_center|LOCUS_02670 3865 4383 gene locus_tag LOCUS_02680 3865 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 >Feature sequence044 <1 1281 gene locus_tag LOCUS_02690 <1 1281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_224065207.1:helicase-related protein 1278 1889 gene locus_tag LOCUS_02700 1278 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 1895 4615 gene locus_tag LOCUS_02710 1895 4615 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228378.1 protein_id gnl|my_center|LOCUS_02710 >Feature sequence045 552 1211 gene locus_tag LOCUS_02720 552 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 1228 1785 gene locus_tag LOCUS_02730 gene endA 1228 1785 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978320.1 protein_id gnl|my_center|LOCUS_02730 1927 2499 gene locus_tag LOCUS_02740 1927 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 2706 2975 gene locus_tag LOCUS_02750 2706 2975 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055429980.1 protein_id gnl|my_center|LOCUS_02750 5159 2988 gene locus_tag LOCUS_02760 5159 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 >Feature sequence046 1973 1038 gene locus_tag LOCUS_02770 gene nadA 1973 1038 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146454.1 protein_id gnl|my_center|LOCUS_02770 2542 2123 gene locus_tag LOCUS_02780 2542 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 3536 2613 gene locus_tag LOCUS_02790 gene mtrH 3536 2613 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876780.1 protein_id gnl|my_center|LOCUS_02790 5213 3582 gene locus_tag LOCUS_02800 gene feoB 5213 3582 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060770.1 protein_id gnl|my_center|LOCUS_02800 >Feature sequence047 1313 480 gene locus_tag LOCUS_02810 1313 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02810 2176 1310 gene locus_tag LOCUS_02820 2176 1310 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867495.1 protein_id gnl|my_center|LOCUS_02820 2251 3156 gene locus_tag LOCUS_02830 2251 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 3185 4072 gene locus_tag LOCUS_02840 3185 4072 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249696.1 protein_id gnl|my_center|LOCUS_02840 4329 4102 gene locus_tag LOCUS_02850 4329 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 5022 4342 gene locus_tag LOCUS_02860 5022 4342 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454478.1 protein_id gnl|my_center|LOCUS_02860 >Feature sequence048 299 1321 gene locus_tag LOCUS_02870 299 1321 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_02870 1516 2127 gene locus_tag LOCUS_02880 1516 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 2823 2155 gene locus_tag LOCUS_02890 2823 2155 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020976.1 protein_id gnl|my_center|LOCUS_02890 3566 2814 gene locus_tag LOCUS_02900 gene cobS 3566 2814 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496830.1 protein_id gnl|my_center|LOCUS_02900 4674 3574 gene locus_tag LOCUS_02910 4674 3574 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061048.1 protein_id gnl|my_center|LOCUS_02910 <5182 4671 gene locus_tag LOCUS_02920 <5182 4671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546873.1:diphthine--ammonia ligase >Feature sequence049 1522 1301 gene locus_tag LOCUS_02930 1522 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 1714 1872 gene locus_tag LOCUS_02940 1714 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 2113 2358 gene locus_tag LOCUS_02950 2113 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 2342 3328 gene locus_tag LOCUS_02960 2342 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 3935 4522 gene locus_tag LOCUS_02970 3935 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 >Feature sequence050 196 729 gene locus_tag LOCUS_02980 196 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 729 1577 gene locus_tag LOCUS_02990 729 1577 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_02990 2601 1582 gene locus_tag LOCUS_03000 2601 1582 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972764.1 protein_id gnl|my_center|LOCUS_03000 3595 2618 gene locus_tag LOCUS_03010 3595 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 3739 3906 gene locus_tag LOCUS_03020 3739 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 4053 4910 gene locus_tag LOCUS_03030 4053 4910 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015265.1 protein_id gnl|my_center|LOCUS_03030 >Feature sequence051 1778 1128 gene locus_tag LOCUS_03040 1778 1128 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949054.1 protein_id gnl|my_center|LOCUS_03040 2141 3181 gene locus_tag LOCUS_03050 2141 3181 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868854.1 protein_id gnl|my_center|LOCUS_03050 4770 3673 gene locus_tag LOCUS_03060 4770 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 >Feature sequence052 610 1572 gene locus_tag LOCUS_03070 gene speB 610 1572 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978315.1 protein_id gnl|my_center|LOCUS_03070 2673 1486 gene locus_tag LOCUS_03080 gene norA 2673 1486 CDS product multidrug efflux MFS transporter NorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458987.1 protein_id gnl|my_center|LOCUS_03080 2808 3551 gene locus_tag LOCUS_03090 gene sufC 2808 3551 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876773.1 protein_id gnl|my_center|LOCUS_03090 3512 4711 gene locus_tag LOCUS_03100 3512 4711 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583903.1 protein_id gnl|my_center|LOCUS_03100 >Feature sequence053 3453 1930 gene locus_tag LOCUS_03110 3453 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 4267 4115 gene locus_tag LOCUS_03120 4267 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 4764 4552 gene locus_tag LOCUS_03130 4764 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 >Feature sequence054 394 3513 gene locus_tag LOCUS_03140 394 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 4611 4204 gene locus_tag LOCUS_03150 4611 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 >Feature sequence055 247 1254 gene locus_tag LOCUS_03160 247 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 1389 2249 gene locus_tag LOCUS_03170 1389 2249 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552729.1 protein_id gnl|my_center|LOCUS_03170 2249 3073 gene locus_tag LOCUS_03180 2249 3073 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931047.1 protein_id gnl|my_center|LOCUS_03180 3077 3403 gene locus_tag LOCUS_03190 3077 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 3410 4516 gene locus_tag LOCUS_03200 gene ugpC 3410 4516 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867305.1 protein_id gnl|my_center|LOCUS_03200 >Feature sequence056 917 2110 gene locus_tag LOCUS_03210 gene gdhA 917 2110 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080520.1 protein_id gnl|my_center|LOCUS_03210 2343 2543 gene locus_tag LOCUS_03220 2343 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 2772 3971 gene locus_tag LOCUS_03230 2772 3971 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_03230 4397 3984 gene locus_tag LOCUS_03240 4397 3984 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197463606.1 protein_id gnl|my_center|LOCUS_03240 >Feature sequence057 685 374 gene locus_tag LOCUS_03250 685 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 864 2315 gene locus_tag LOCUS_03260 864 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 2637 2320 gene locus_tag LOCUS_03270 2637 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03270 3127 2603 gene locus_tag LOCUS_03280 3127 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03280 3303 3151 gene locus_tag LOCUS_03290 3303 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 3440 4087 gene locus_tag LOCUS_03300 3440 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 4163 4726 gene locus_tag LOCUS_03310 4163 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 >Feature sequence058 1712 369 gene locus_tag LOCUS_03320 1712 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 3969 2041 gene locus_tag LOCUS_03330 3969 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 >Feature sequence059 <1 917 gene locus_tag LOCUS_03340 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903175.1:hydroxymethylglutaryl-CoA synthase 2305 1196 gene locus_tag LOCUS_03350 2305 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 2394 2513 gene locus_tag LOCUS_03360 2394 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 3135 2557 gene locus_tag LOCUS_03370 3135 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 4712 3252 gene locus_tag LOCUS_03380 gene gatA 4712 3252 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_03380 >Feature sequence060 175 990 gene locus_tag LOCUS_03390 175 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 3780 2695 gene locus_tag LOCUS_03400 3780 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 >Feature sequence061 1251 418 gene locus_tag LOCUS_03410 1251 418 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933215.1 protein_id gnl|my_center|LOCUS_03410 1335 2393 gene locus_tag LOCUS_03420 1335 2393 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583627.1 protein_id gnl|my_center|LOCUS_03420 2523 3662 gene locus_tag LOCUS_03430 2523 3662 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870473.1 protein_id gnl|my_center|LOCUS_03430 >Feature sequence062 94 1575 gene locus_tag LOCUS_03440 94 1575 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867393.1 protein_id gnl|my_center|LOCUS_03440 1583 2839 gene locus_tag LOCUS_03450 1583 2839 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867394.1 protein_id gnl|my_center|LOCUS_03450 2836 3231 gene locus_tag LOCUS_03460 2836 3231 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081696.1 protein_id gnl|my_center|LOCUS_03460 3845 4141 gene locus_tag LOCUS_03470 3845 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 4148 4414 gene locus_tag LOCUS_03480 4148 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 4438 4632 gene locus_tag LOCUS_03490 4438 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 >Feature sequence063 208 2238 gene locus_tag LOCUS_03500 208 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 2238 3332 gene locus_tag LOCUS_03510 2238 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 >Feature sequence064 646 485 gene locus_tag LOCUS_03520 646 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 941 1288 gene locus_tag LOCUS_03530 941 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03530 1647 2885 gene locus_tag LOCUS_03540 1647 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 3350 3685 gene locus_tag LOCUS_03550 3350 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 3960 3697 gene locus_tag LOCUS_03560 3960 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 4378 4109 gene locus_tag LOCUS_03570 4378 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 >Feature sequence065 2685 463 gene locus_tag LOCUS_03580 2685 463 CDS product STT3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762186.1 protein_id gnl|my_center|LOCUS_03580 2931 3980 gene locus_tag LOCUS_03590 2931 3980 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_03590 4274 4122 gene locus_tag LOCUS_03600 4274 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 >Feature sequence066 150 1769 gene locus_tag LOCUS_03610 150 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 2436 1933 gene locus_tag LOCUS_03620 2436 1933 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231060.1 protein_id gnl|my_center|LOCUS_03620 2687 3139 gene locus_tag LOCUS_03630 2687 3139 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878749.1 protein_id gnl|my_center|LOCUS_03630 3737 3570 gene locus_tag LOCUS_03640 3737 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 3757 4443 gene locus_tag LOCUS_03650 3757 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence067 61 579 gene locus_tag LOCUS_03660 61 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 603 1976 gene locus_tag LOCUS_03670 603 1976 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921498.1 protein_id gnl|my_center|LOCUS_03670 2094 3269 gene locus_tag LOCUS_03680 2094 3269 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_03680 3266 4366 gene locus_tag LOCUS_03690 3266 4366 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583847.1 protein_id gnl|my_center|LOCUS_03690 >Feature sequence068 350 1768 gene locus_tag LOCUS_03700 350 1768 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064354.1 protein_id gnl|my_center|LOCUS_03700 1732 2745 gene locus_tag LOCUS_03710 1732 2745 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_03710 3254 2751 gene locus_tag LOCUS_03720 3254 2751 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867730.1 protein_id gnl|my_center|LOCUS_03720 4655 3561 gene locus_tag LOCUS_03730 4655 3561 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879595.1 protein_id gnl|my_center|LOCUS_03730 >Feature sequence069 2124 1051 gene locus_tag LOCUS_03740 2124 1051 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 protein_id gnl|my_center|LOCUS_03740 2285 2407 gene locus_tag LOCUS_03750 2285 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 2499 3614 gene locus_tag LOCUS_03760 gene dgoD 2499 3614 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_03760 3702 4574 gene locus_tag LOCUS_03770 3702 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 >Feature sequence070 2296 245 gene locus_tag LOCUS_03780 2296 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 3296 2778 gene locus_tag LOCUS_03790 3296 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 <4633 3416 gene locus_tag LOCUS_03800 <4633 3416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766599.1:glycoside hydrolase family 38 C-terminal domain-containing protein >Feature sequence071 1456 476 gene locus_tag LOCUS_03810 gene cas7b 1456 476 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_03810 3246 1456 gene locus_tag LOCUS_03820 3246 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 4027 3296 gene locus_tag LOCUS_03830 gene cas6 4027 3296 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545251.1 protein_id gnl|my_center|LOCUS_03830 >Feature sequence072 450 872 gene locus_tag LOCUS_03840 450 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03840 869 2902 gene locus_tag LOCUS_03850 869 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 2972 3694 gene locus_tag LOCUS_03860 2972 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 3725 4240 gene locus_tag LOCUS_03870 3725 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 >Feature sequence073 113 4195 gene locus_tag LOCUS_03880 113 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 >Feature sequence074 364 438 gene locus_tag LOCUS_t00010 364 438 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1360 419 gene locus_tag LOCUS_03890 1360 419 CDS product LAGLIDADG family homing endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011011400.1 protein_id gnl|my_center|LOCUS_03890 1473 1643 gene locus_tag LOCUS_03900 1473 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 3081 2350 gene locus_tag LOCUS_03910 3081 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 >Feature sequence075 400 1296 gene locus_tag LOCUS_03920 gene ilvE 400 1296 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005486.1 protein_id gnl|my_center|LOCUS_03920 1405 2067 gene locus_tag LOCUS_03930 1405 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762167.1 protein_id gnl|my_center|LOCUS_03930 3364 2108 gene locus_tag LOCUS_03940 3364 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 3663 4457 gene locus_tag LOCUS_03950 3663 4457 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870188.1 protein_id gnl|my_center|LOCUS_03950 >Feature sequence076 <1 1105 gene locus_tag LOCUS_03960 <1 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021549.1:NEW3 domain-containing protein 1211 1534 gene locus_tag LOCUS_03970 1211 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 1678 1818 gene locus_tag LOCUS_03980 1678 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 3255 2308 gene locus_tag LOCUS_03990 3255 2308 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937460.1 protein_id gnl|my_center|LOCUS_03990 3513 3301 gene locus_tag LOCUS_04000 3513 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 >Feature sequence077 240 986 gene locus_tag LOCUS_04010 240 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 1386 1646 gene locus_tag LOCUS_04020 1386 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04020 1697 2536 gene locus_tag LOCUS_04030 1697 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 2777 3940 gene locus_tag LOCUS_04040 2777 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122044.1 protein_id gnl|my_center|LOCUS_04040 >Feature sequence078 273 1217 gene locus_tag LOCUS_04050 273 1217 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496774.1 protein_id gnl|my_center|LOCUS_04050 1219 2298 gene locus_tag LOCUS_04060 1219 2298 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870783.1 protein_id gnl|my_center|LOCUS_04060 2362 3639 gene locus_tag LOCUS_04070 2362 3639 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240264.1 protein_id gnl|my_center|LOCUS_04070 3680 4453 gene locus_tag LOCUS_04080 3680 4453 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496773.1 protein_id gnl|my_center|LOCUS_04080 >Feature sequence079 934 539 gene locus_tag LOCUS_04090 934 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 1420 986 gene locus_tag LOCUS_04100 1420 986 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876409.1 protein_id gnl|my_center|LOCUS_04100 2119 1460 gene locus_tag LOCUS_04110 2119 1460 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496597.1 protein_id gnl|my_center|LOCUS_04110 2848 2126 gene locus_tag LOCUS_04120 gene sfsA 2848 2126 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249730.1 protein_id gnl|my_center|LOCUS_04120 2978 4177 gene locus_tag LOCUS_04130 2978 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 >Feature sequence080 1728 721 gene locus_tag LOCUS_04140 1728 721 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903967.1 protein_id gnl|my_center|LOCUS_04140 2626 1796 gene locus_tag LOCUS_04150 gene menA 2626 1796 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081897.1 protein_id gnl|my_center|LOCUS_04150 3531 2785 gene locus_tag LOCUS_04160 3531 2785 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860724.1 protein_id gnl|my_center|LOCUS_04160 4407 3595 gene locus_tag LOCUS_04170 4407 3595 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584151.1 protein_id gnl|my_center|LOCUS_04170 >Feature sequence081 773 1975 gene locus_tag LOCUS_04180 773 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 2671 3660 gene locus_tag LOCUS_04190 2671 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 3665 3907 gene locus_tag LOCUS_04200 3665 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 >Feature sequence082 1165 374 gene locus_tag LOCUS_04210 1165 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 1977 1165 gene locus_tag LOCUS_04220 1977 1165 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020491.1 protein_id gnl|my_center|LOCUS_04220 2079 2870 gene locus_tag LOCUS_04230 2079 2870 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_04230 4163 4303 gene locus_tag LOCUS_04240 4163 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 >Feature sequence083 133 513 gene locus_tag LOCUS_04250 133 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 538 1578 gene locus_tag LOCUS_04260 gene galT 538 1578 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_04260 1754 2047 gene locus_tag LOCUS_04270 1754 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 2032 3978 gene locus_tag LOCUS_04280 gene feoB 2032 3978 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060770.1 protein_id gnl|my_center|LOCUS_04280 4027 4338 gene locus_tag LOCUS_04290 4027 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 >Feature sequence084 292 1056 gene locus_tag LOCUS_04300 gene psmA 292 1056 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867731.1 protein_id gnl|my_center|LOCUS_04300 1016 1714 gene locus_tag LOCUS_04310 1016 1714 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867732.1 protein_id gnl|my_center|LOCUS_04310 1732 2427 gene locus_tag LOCUS_04320 gene rrp4 1732 2427 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250586.1 protein_id gnl|my_center|LOCUS_04320 2429 3169 gene locus_tag LOCUS_04330 gene rrp41 2429 3169 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867734.1 protein_id gnl|my_center|LOCUS_04330 3166 3966 gene locus_tag LOCUS_04340 gene rrp42 3166 3966 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867735.1 protein_id gnl|my_center|LOCUS_04340 3963 4229 gene locus_tag LOCUS_04350 3963 4229 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249566.1 protein_id gnl|my_center|LOCUS_04350 >Feature sequence085 2869 599 gene locus_tag LOCUS_04360 2869 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 3467 2859 gene locus_tag LOCUS_04370 3467 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 3603 3674 gene locus_tag LOCUS_t00020 3603 3674 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence086 1310 321 gene locus_tag LOCUS_04380 1310 321 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_04380 1701 1627 gene locus_tag LOCUS_t00030 1701 1627 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2729 1947 gene locus_tag LOCUS_04390 2729 1947 CDS product DUF3782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763642.1 protein_id gnl|my_center|LOCUS_04390 3393 3316 gene locus_tag LOCUS_t00040 3393 3316 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence087 357 488 gene locus_tag LOCUS_04400 357 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 797 979 gene locus_tag LOCUS_04410 797 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 3376 2255 gene locus_tag LOCUS_04420 3376 2255 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022158.1 protein_id gnl|my_center|LOCUS_04420 4310 3456 gene locus_tag LOCUS_04430 4310 3456 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878124.1 protein_id gnl|my_center|LOCUS_04430 >Feature sequence088 159 653 gene locus_tag LOCUS_04440 159 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 670 1494 gene locus_tag LOCUS_04450 670 1494 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606040.1 protein_id gnl|my_center|LOCUS_04450 1501 2589 gene locus_tag LOCUS_04460 1501 2589 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867147.1 protein_id gnl|my_center|LOCUS_04460 2594 3682 gene locus_tag LOCUS_04470 gene ugpC 2594 3682 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_04470 >Feature sequence089 383 255 gene locus_tag LOCUS_04480 383 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 857 3367 gene locus_tag LOCUS_04490 857 3367 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204437144.1 protein_id gnl|my_center|LOCUS_04490 3438 3719 gene locus_tag LOCUS_04500 3438 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 >Feature sequence090 218 1528 gene locus_tag LOCUS_04510 218 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 1604 2284 gene locus_tag LOCUS_04520 1604 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 2693 2295 gene locus_tag LOCUS_04530 2693 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 2790 3884 gene locus_tag LOCUS_04540 2790 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 >Feature sequence091 611 1507 gene locus_tag LOCUS_04550 611 1507 CDS product 7,8-dihydropterin-6-methyl-4-(beta-D-ribofuranosyl)-aminobenzene-5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869799.1 protein_id gnl|my_center|LOCUS_04550 2713 1781 gene locus_tag LOCUS_04560 2713 1781 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146545.1 protein_id gnl|my_center|LOCUS_04560 2908 2985 gene locus_tag LOCUS_t00050 2908 2985 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence092 <1 576 gene locus_tag LOCUS_04570 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868867.1:ABC transporter ATP-binding protein 578 1552 gene locus_tag LOCUS_04580 578 1552 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250707.1 protein_id gnl|my_center|LOCUS_04580 2824 1949 gene locus_tag LOCUS_04590 2824 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 2929 4263 gene locus_tag LOCUS_04600 2929 4263 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496374.1 protein_id gnl|my_center|LOCUS_04600 >Feature sequence093 1416 262 gene locus_tag LOCUS_04610 1416 262 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 protein_id gnl|my_center|LOCUS_04610 1545 2717 gene locus_tag LOCUS_04620 1545 2717 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867899.1 protein_id gnl|my_center|LOCUS_04620 2764 3684 gene locus_tag LOCUS_04630 2764 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 >Feature sequence094 1055 3319 gene locus_tag LOCUS_04640 1055 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201942.1 protein_id gnl|my_center|LOCUS_04640 3923 3846 gene locus_tag LOCUS_t00060 3923 3846 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence095 <1 548 gene locus_tag LOCUS_04650 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003144052.1:aryl-sulfate sulfotransferase 1152 688 gene locus_tag LOCUS_04660 1152 688 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846698.1 protein_id gnl|my_center|LOCUS_04660 1354 1112 gene locus_tag LOCUS_04670 1354 1112 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980069.1 protein_id gnl|my_center|LOCUS_04670 1792 2088 gene locus_tag LOCUS_04680 1792 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 2103 3509 gene locus_tag LOCUS_04690 2103 3509 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004068250.1 protein_id gnl|my_center|LOCUS_04690 3827 3540 gene locus_tag LOCUS_04700 3827 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 >Feature sequence096 1052 180 gene locus_tag LOCUS_04710 1052 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 2251 1136 gene locus_tag LOCUS_04720 gene dgoD 2251 1136 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_04720 2592 3785 gene locus_tag LOCUS_04730 2592 3785 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257569.1 protein_id gnl|my_center|LOCUS_04730 4175 3993 gene locus_tag LOCUS_04740 4175 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 >Feature sequence097 208 372 gene locus_tag LOCUS_04750 208 372 CDS product 30S ribosomal protein S30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763628.1 protein_id gnl|my_center|LOCUS_04750 595 1413 gene locus_tag LOCUS_04760 595 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 1426 3246 gene locus_tag LOCUS_04770 1426 3246 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545213.1 protein_id gnl|my_center|LOCUS_04770 3404 3523 gene locus_tag LOCUS_04780 3404 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 3589 3963 gene locus_tag LOCUS_04790 gene rplX 3589 3963 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250481.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence098 483 2156 gene locus_tag LOCUS_04800 483 2156 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392090.1 protein_id gnl|my_center|LOCUS_04800 2292 3284 gene locus_tag LOCUS_04810 2292 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 <4255 3278 gene locus_tag LOCUS_04820 <4255 3278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227894.1:aldehyde ferredoxin oxidoreductase family protein >Feature sequence099 578 1171 gene locus_tag LOCUS_04830 578 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 >Feature sequence100 2506 1472 gene locus_tag LOCUS_04840 gene fen 2506 1472 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250232.1 protein_id gnl|my_center|LOCUS_04840 2699 3502 gene locus_tag LOCUS_04850 2699 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 >Feature sequence101 2554 2414 gene locus_tag LOCUS_04860 2554 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 2684 3718 gene locus_tag LOCUS_04870 2684 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 >Feature sequence102 389 207 gene locus_tag LOCUS_04880 389 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 2037 466 gene locus_tag LOCUS_04890 2037 466 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021549.1 protein_id gnl|my_center|LOCUS_04890 3892 2108 gene locus_tag LOCUS_04900 3892 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 4020 4145 gene locus_tag LOCUS_04910 4020 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 >Feature sequence103 415 1359 gene locus_tag LOCUS_04920 415 1359 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761587.1 protein_id gnl|my_center|LOCUS_04920 1405 2100 gene locus_tag LOCUS_04930 1405 2100 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627596.1 protein_id gnl|my_center|LOCUS_04930 2104 3375 gene locus_tag LOCUS_04940 2104 3375 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173254066.1 protein_id gnl|my_center|LOCUS_04940 >Feature sequence104 280 3738 gene locus_tag LOCUS_04950 280 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 >Feature sequence105 482 1840 gene locus_tag LOCUS_04960 gene pelF 482 1840 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964052.1 protein_id gnl|my_center|LOCUS_04960 1837 2553 gene locus_tag LOCUS_04970 1837 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 3671 2817 gene locus_tag LOCUS_04980 3671 2817 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868060.1 protein_id gnl|my_center|LOCUS_04980 <4199 3672 gene locus_tag LOCUS_04990 <4199 3672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582577.1:ABC transporter permease >Feature sequence106 350 147 gene locus_tag LOCUS_05000 350 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05000 1632 2099 gene locus_tag LOCUS_05010 1632 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 2099 2578 gene locus_tag LOCUS_05020 2099 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 2591 2788 gene locus_tag LOCUS_05030 2591 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 2960 2883 gene locus_tag LOCUS_t00070 2960 2883 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence107 <1 810 gene locus_tag LOCUS_05040 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762209.1:tryptophan--tRNA ligase 849 924 gene locus_tag LOCUS_t00080 849 924 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1839 1210 gene locus_tag LOCUS_05050 1839 1210 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025306754.1 protein_id gnl|my_center|LOCUS_05050 1979 2209 gene locus_tag LOCUS_05060 1979 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 2289 2606 gene locus_tag LOCUS_05070 2289 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 2683 2871 gene locus_tag LOCUS_05080 2683 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 3088 3414 gene locus_tag LOCUS_05090 3088 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 3414 3779 gene locus_tag LOCUS_05100 3414 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 >Feature sequence108 403 858 gene locus_tag LOCUS_05110 403 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 2047 1238 gene locus_tag LOCUS_05120 2047 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 2295 2059 gene locus_tag LOCUS_05130 2295 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 4008 3667 gene locus_tag LOCUS_05140 4008 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence109 139 1146 gene locus_tag LOCUS_05150 gene norA 139 1146 CDS product multidrug efflux MFS transporter NorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458987.1 protein_id gnl|my_center|LOCUS_05150 2025 1147 gene locus_tag LOCUS_05160 gene speB 2025 1147 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978315.1 protein_id gnl|my_center|LOCUS_05160 3683 2412 gene locus_tag LOCUS_05170 3683 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 >Feature sequence110 1871 1095 gene locus_tag LOCUS_05180 1871 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 3589 2546 gene locus_tag LOCUS_05190 3589 2546 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096185.1 protein_id gnl|my_center|LOCUS_05190 4068 3586 gene locus_tag LOCUS_05200 4068 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 >Feature sequence111 <1 609 gene locus_tag LOCUS_05210 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878196.1:type B DNA-directed DNA polymerase 1013 1159 gene locus_tag LOCUS_05220 1013 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 2931 1285 gene locus_tag LOCUS_05230 2931 1285 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051765.1 protein_id gnl|my_center|LOCUS_05230 3477 3343 gene locus_tag LOCUS_05240 3477 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 3634 3464 gene locus_tag LOCUS_05250 3634 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 3956 3690 gene locus_tag LOCUS_05260 3956 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 >Feature sequence112 <1 621 gene locus_tag LOCUS_05270 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393453.1:pyridoxal phosphate-dependent aminotransferase 1335 640 gene locus_tag LOCUS_05280 1335 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 2985 1426 gene locus_tag LOCUS_05290 2985 1426 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980182.1 protein_id gnl|my_center|LOCUS_05290 3768 3055 gene locus_tag LOCUS_05300 3768 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 >Feature sequence113 1448 2011 gene locus_tag LOCUS_05310 1448 2011 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496569.1 protein_id gnl|my_center|LOCUS_05310 <4144 2525 gene locus_tag LOCUS_05320 <4144 2525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979014.1:alpha-mannosidase >Feature sequence114 1090 1218 gene locus_tag LOCUS_05330 1090 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 1696 1364 gene locus_tag LOCUS_05340 1696 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 2370 1969 gene locus_tag LOCUS_05350 2370 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 2667 2374 gene locus_tag LOCUS_05360 2667 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 2807 2670 gene locus_tag LOCUS_05370 2807 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 2889 3479 gene locus_tag LOCUS_05380 2889 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 >Feature sequence115 <1 1948 gene locus_tag LOCUS_05390 <1 1948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972694.1:alginate lyase 2164 2493 gene locus_tag LOCUS_05400 2164 2493 CDS product 30S ribosomal protein S25e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762560.1 protein_id gnl|my_center|LOCUS_05400 2581 3174 gene locus_tag LOCUS_05410 2581 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 3538 3164 gene locus_tag LOCUS_05420 3538 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence116 745 173 gene locus_tag LOCUS_05430 745 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 850 1665 gene locus_tag LOCUS_05440 gene nucS 850 1665 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496427.1 protein_id gnl|my_center|LOCUS_05440 1889 1659 gene locus_tag LOCUS_05450 1889 1659 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251242.1 protein_id gnl|my_center|LOCUS_05450 2062 2277 gene locus_tag LOCUS_05460 2062 2277 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869663.1 protein_id gnl|my_center|LOCUS_05460 2804 3817 gene locus_tag LOCUS_05470 2804 3817 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867543.1 protein_id gnl|my_center|LOCUS_05470 >Feature sequence117 525 662 gene locus_tag LOCUS_05480 525 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 1125 1000 gene locus_tag LOCUS_05490 1125 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 1206 1517 gene locus_tag LOCUS_05500 1206 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 1600 1758 gene locus_tag LOCUS_05510 1600 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 1893 2168 gene locus_tag LOCUS_05520 1893 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 2209 2781 gene locus_tag LOCUS_05530 2209 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 3895 3407 gene locus_tag LOCUS_05540 3895 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 >Feature sequence118 39 124 gene locus_tag LOCUS_t00090 39 124 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1406 972 gene locus_tag LOCUS_05550 1406 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 1730 1527 gene locus_tag LOCUS_05560 1730 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 1666 2352 gene locus_tag LOCUS_05570 1666 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 2857 2366 gene locus_tag LOCUS_05580 2857 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 3222 3755 gene locus_tag LOCUS_05590 3222 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 >Feature sequence119 1473 823 gene locus_tag LOCUS_05600 1473 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 2895 1537 gene locus_tag LOCUS_05610 gene pelF 2895 1537 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964052.1 protein_id gnl|my_center|LOCUS_05610 3845 2892 gene locus_tag LOCUS_05620 3845 2892 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_05620 >Feature sequence120 1720 695 gene locus_tag LOCUS_05630 1720 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 3667 2348 gene locus_tag LOCUS_05640 3667 2348 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065465.1 protein_id gnl|my_center|LOCUS_05640 >Feature sequence121 873 211 gene locus_tag LOCUS_05650 873 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 1941 919 gene locus_tag LOCUS_05660 1941 919 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_05660 2742 3581 gene locus_tag LOCUS_05670 2742 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 >Feature sequence122 210 1445 gene locus_tag LOCUS_05680 210 1445 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_05680 2736 1783 gene locus_tag LOCUS_05690 2736 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 3376 3230 gene locus_tag LOCUS_05700 3376 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 <4052 3471 gene locus_tag LOCUS_05710 <4052 3471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005461090.1:6-phospho-beta-glucosidase >Feature sequence123 675 1364 gene locus_tag LOCUS_05720 675 1364 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082992.1 protein_id gnl|my_center|LOCUS_05720 1581 3368 gene locus_tag LOCUS_05730 1581 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 >Feature sequence124 538 1161 gene locus_tag LOCUS_05740 538 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 1234 1437 gene locus_tag LOCUS_05750 1234 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 2039 1725 gene locus_tag LOCUS_05760 2039 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 3319 2339 gene locus_tag LOCUS_05770 3319 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 <4046 3413 gene locus_tag LOCUS_05780 <4046 3413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922506.1:polysaccharide deacetylase family protein >Feature sequence125 1169 1819 gene locus_tag LOCUS_05790 1169 1819 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024284.1 protein_id gnl|my_center|LOCUS_05790 1905 2711 gene locus_tag LOCUS_05800 1905 2711 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978323.1 protein_id gnl|my_center|LOCUS_05800 3549 2716 gene locus_tag LOCUS_05810 gene mobB 3549 2716 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249885.1 protein_id gnl|my_center|LOCUS_05810 >Feature sequence126 956 525 gene locus_tag LOCUS_05820 956 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 1810 953 gene locus_tag LOCUS_05830 1810 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 3791 1833 gene locus_tag LOCUS_05840 3791 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 >Feature sequence127 341 156 gene locus_tag LOCUS_05850 341 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 2821 836 gene locus_tag LOCUS_05860 2821 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 3423 2884 gene locus_tag LOCUS_05870 3423 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 >Feature sequence128 <1 2857 gene locus_tag LOCUS_05880 <1 2857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230035.1:DEAD/DEAH box helicase >Feature sequence129 88 1566 gene locus_tag LOCUS_05890 88 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 2372 3646 gene locus_tag LOCUS_05900 2372 3646 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876486.1 protein_id gnl|my_center|LOCUS_05900 >Feature sequence130 <1 885 gene locus_tag LOCUS_05910 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066007.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA 1055 1627 gene locus_tag LOCUS_05920 1055 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 3740 2373 gene locus_tag LOCUS_05930 gene hmgB 3740 2373 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_05930 >Feature sequence131 1506 670 gene locus_tag LOCUS_05940 1506 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 1873 1664 gene locus_tag LOCUS_05950 1873 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 2205 2615 gene locus_tag LOCUS_05960 2205 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 3863 2622 gene locus_tag LOCUS_05970 gene rhaI 3863 2622 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582814.1 protein_id gnl|my_center|LOCUS_05970 >Feature sequence132 527 452 gene locus_tag LOCUS_t00100 527 452 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1701 565 gene locus_tag LOCUS_05980 1701 565 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762209.1 protein_id gnl|my_center|LOCUS_05980 2929 1787 gene locus_tag LOCUS_05990 gene cdvC 2929 1787 CDS product cell division protein CdvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979234.1 protein_id gnl|my_center|LOCUS_05990 3765 2926 gene locus_tag LOCUS_06000 3765 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 >Feature sequence133 <1 1576 gene locus_tag LOCUS_06010 <1 1576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943547.1:ATP-binding protein 1858 1589 gene locus_tag LOCUS_06020 1858 1589 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055429980.1 protein_id gnl|my_center|LOCUS_06020 2634 2062 gene locus_tag LOCUS_06030 2634 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 3330 2773 gene locus_tag LOCUS_06040 gene endA 3330 2773 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978320.1 protein_id gnl|my_center|LOCUS_06040 >Feature sequence134 1309 2271 gene locus_tag LOCUS_06050 1309 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 <3924 2308 gene locus_tag LOCUS_06060 <3924 2308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002369316.1:alpha-mannosidase >Feature sequence135 2151 736 gene locus_tag LOCUS_06070 2151 736 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 protein_id gnl|my_center|LOCUS_06070 2428 3384 gene locus_tag LOCUS_06080 2428 3384 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256874.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence136 480 1100 gene locus_tag LOCUS_06090 480 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 1334 1191 gene locus_tag LOCUS_06100 1334 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 1988 2278 gene locus_tag LOCUS_06110 1988 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 2789 3034 gene locus_tag LOCUS_06120 2789 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 >Feature sequence137 183 1052 gene locus_tag LOCUS_06130 183 1052 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 protein_id gnl|my_center|LOCUS_06130 1049 1867 gene locus_tag LOCUS_06140 1049 1867 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525321.1 protein_id gnl|my_center|LOCUS_06140 2997 1990 gene locus_tag LOCUS_06150 gene pta 2997 1990 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943344.1 protein_id gnl|my_center|LOCUS_06150 3184 2966 gene locus_tag LOCUS_06160 3184 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 >Feature sequence138 700 50 gene locus_tag LOCUS_06170 700 50 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319832.1 protein_id gnl|my_center|LOCUS_06170 984 1727 gene locus_tag LOCUS_06180 984 1727 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020689.1 protein_id gnl|my_center|LOCUS_06180 1873 2886 gene locus_tag LOCUS_06190 1873 2886 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869671.1 protein_id gnl|my_center|LOCUS_06190 2898 3695 gene locus_tag LOCUS_06200 gene rpl4p 2898 3695 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250492.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence139 504 911 gene locus_tag LOCUS_06210 504 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 2467 3441 gene locus_tag LOCUS_06220 2467 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 >Feature sequence140 1304 243 gene locus_tag LOCUS_06230 1304 243 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163820.1 protein_id gnl|my_center|LOCUS_06230 1452 3329 gene locus_tag LOCUS_06240 1452 3329 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence141 481 1710 gene locus_tag LOCUS_06250 481 1710 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_06250 1901 3331 gene locus_tag LOCUS_06260 1901 3331 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876362.1 protein_id gnl|my_center|LOCUS_06260 >Feature sequence142 247 2589 gene locus_tag LOCUS_06270 247 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 2871 2695 gene locus_tag LOCUS_06280 2871 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 3030 2890 gene locus_tag LOCUS_06290 3030 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 3222 3070 gene locus_tag LOCUS_06300 3222 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 >Feature sequence143 1223 1900 gene locus_tag LOCUS_06310 1223 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 2101 2496 gene locus_tag LOCUS_06320 2101 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 2999 3334 gene locus_tag LOCUS_06330 2999 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 3609 3346 gene locus_tag LOCUS_06340 3609 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 >Feature sequence144 1116 610 gene locus_tag LOCUS_06350 1116 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06350 1730 1158 gene locus_tag LOCUS_06360 1730 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06360 2075 2359 gene locus_tag LOCUS_06370 2075 2359 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978435.1 protein_id gnl|my_center|LOCUS_06370 2435 2908 gene locus_tag LOCUS_06380 2435 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 2968 3366 gene locus_tag LOCUS_06390 2968 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 3462 3839 gene locus_tag LOCUS_06400 3462 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence145 1019 150 gene locus_tag LOCUS_06410 gene trm5b 1019 150 CDS product tRNA (guanine(37)-N1)-methyltransferase Trm5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867861.1 protein_id gnl|my_center|LOCUS_06410 1277 2128 gene locus_tag LOCUS_06420 1277 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 2138 2347 gene locus_tag LOCUS_06430 2138 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 2438 3694 gene locus_tag LOCUS_06440 gene ahcY 2438 3694 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978302.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence146 1089 727 gene locus_tag LOCUS_06450 1089 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 1342 3219 gene locus_tag LOCUS_06460 1342 3219 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877524.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence147 221 583 gene locus_tag LOCUS_06470 221 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 647 1546 gene locus_tag LOCUS_06480 647 1546 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171047034.1 protein_id gnl|my_center|LOCUS_06480 1603 2268 gene locus_tag LOCUS_06490 1603 2268 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867133.1 protein_id gnl|my_center|LOCUS_06490 3350 2286 gene locus_tag LOCUS_06500 gene pepQ 3350 2286 CDS product Xaa-Pro dipeptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146836.1 protein_id gnl|my_center|LOCUS_06500 >Feature sequence148 1031 87 gene locus_tag LOCUS_06510 1031 87 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_06510 1190 1765 gene locus_tag LOCUS_06520 1190 1765 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878945.1 protein_id gnl|my_center|LOCUS_06520 2013 3377 gene locus_tag LOCUS_06530 2013 3377 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064511.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence149 158 319 gene locus_tag LOCUS_06540 158 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 565 927 gene locus_tag LOCUS_06550 565 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 1037 1219 gene locus_tag LOCUS_06560 1037 1219 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877934.1 protein_id gnl|my_center|LOCUS_06560 2301 1234 gene locus_tag LOCUS_06570 2301 1234 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877642.1 protein_id gnl|my_center|LOCUS_06570 2421 3791 gene locus_tag LOCUS_06580 gene purB 2421 3791 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249516.1 protein_id gnl|my_center|LOCUS_06580 >Feature sequence150 2293 431 gene locus_tag LOCUS_06590 2293 431 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868460.1 protein_id gnl|my_center|LOCUS_06590 3304 2321 gene locus_tag LOCUS_06600 3304 2321 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903967.1 protein_id gnl|my_center|LOCUS_06600 3444 3776 gene locus_tag LOCUS_06610 3444 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 >Feature sequence151 1245 691 gene locus_tag LOCUS_06620 gene yjjX 1245 691 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250698.1 protein_id gnl|my_center|LOCUS_06620 2383 1613 gene locus_tag LOCUS_06630 2383 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 2533 3492 gene locus_tag LOCUS_06640 2533 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence152 <1 668 gene locus_tag LOCUS_06650 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868707.1:Kae1-associated kinase Bud32 716 2029 gene locus_tag LOCUS_06660 716 2029 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060924.1 protein_id gnl|my_center|LOCUS_06660 2091 2834 gene locus_tag LOCUS_06670 2091 2834 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250279.1 protein_id gnl|my_center|LOCUS_06670 2910 3506 gene locus_tag LOCUS_06680 2910 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 >Feature sequence153 459 635 gene locus_tag LOCUS_06690 459 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06690 823 632 gene locus_tag LOCUS_06700 823 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 876 1268 gene locus_tag LOCUS_06710 876 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06710 2351 1326 gene locus_tag LOCUS_06720 2351 1326 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144622.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence154 1675 641 gene locus_tag LOCUS_06730 1675 641 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903967.1 protein_id gnl|my_center|LOCUS_06730 3261 1849 gene locus_tag LOCUS_06740 gene secY 3261 1849 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250469.1 protein_id gnl|my_center|LOCUS_06740 3719 3264 gene locus_tag LOCUS_06750 3719 3264 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762714.1 protein_id gnl|my_center|LOCUS_06750 >Feature sequence155 1297 686 gene locus_tag LOCUS_06760 1297 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 1780 1631 gene locus_tag LOCUS_06770 1780 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 3103 1799 gene locus_tag LOCUS_06780 gene asnS 3103 1799 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867347.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence156 297 1451 gene locus_tag LOCUS_06790 297 1451 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891591.1 protein_id gnl|my_center|LOCUS_06790 1507 2088 gene locus_tag LOCUS_06800 1507 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 >Feature sequence157 751 257 gene locus_tag LOCUS_06810 751 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 847 1902 gene locus_tag LOCUS_06820 847 1902 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583427.1 protein_id gnl|my_center|LOCUS_06820 1899 3299 gene locus_tag LOCUS_06830 1899 3299 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583426.1 protein_id gnl|my_center|LOCUS_06830 >Feature sequence158 <1 755 gene locus_tag LOCUS_06840 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583690.1:rhomboid family intramembrane serine protease 1159 752 gene locus_tag LOCUS_06850 1159 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 1360 2154 gene locus_tag LOCUS_06860 1360 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 2130 2339 gene locus_tag LOCUS_06870 2130 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 3047 2643 gene locus_tag LOCUS_06880 3047 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 3442 3005 gene locus_tag LOCUS_06890 3442 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 >Feature sequence159 <1 722 gene locus_tag LOCUS_06900 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064511.1:radical SAM protein 766 1479 gene locus_tag LOCUS_06910 766 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 1861 1481 gene locus_tag LOCUS_06920 1861 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 2561 1941 gene locus_tag LOCUS_06930 2561 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 <3744 2662 gene locus_tag LOCUS_06940 <3744 2662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878496.1:type II/IV secretion system ATPase subunit >Feature sequence160 >Feature sequence161 <3732 1087 gene locus_tag LOCUS_06950 <3732 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002247530.1:MacB family efflux pump subunit >Feature sequence162 2037 2876 gene locus_tag LOCUS_06960 2037 2876 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867255.1 protein_id gnl|my_center|LOCUS_06960 >Feature sequence163 47 1012 gene locus_tag LOCUS_06970 gene nuoH 47 1012 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193328865.1 protein_id gnl|my_center|LOCUS_06970 1485 1024 gene locus_tag LOCUS_06980 1485 1024 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958021.1 protein_id gnl|my_center|LOCUS_06980 1660 1980 gene locus_tag LOCUS_06990 1660 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 2091 3023 gene locus_tag LOCUS_07000 2091 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 <3710 3016 gene locus_tag LOCUS_07010 <3710 3016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869273.1:V-type ATPase 116kDa subunit family protein >Feature sequence164 1324 2412 gene locus_tag LOCUS_07020 1324 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 3685 2729 gene locus_tag LOCUS_07030 3685 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 >Feature sequence165 1371 655 gene locus_tag LOCUS_07040 1371 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 2125 2262 gene locus_tag LOCUS_07050 2125 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 2679 2918 gene locus_tag LOCUS_07060 2679 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 2908 3327 gene locus_tag LOCUS_07070 2908 3327 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979747.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence166 176 643 gene locus_tag LOCUS_07080 176 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 2183 2749 gene locus_tag LOCUS_07090 2183 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 2759 3373 gene locus_tag LOCUS_07100 2759 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 >Feature sequence167 139 285 gene locus_tag LOCUS_07110 139 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 531 1328 gene locus_tag LOCUS_07120 531 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 2527 1382 gene locus_tag LOCUS_07130 2527 1382 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803849.1 protein_id gnl|my_center|LOCUS_07130 2736 2858 gene locus_tag LOCUS_07140 2736 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 2987 3166 gene locus_tag LOCUS_07150 2987 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07150 3203 3502 gene locus_tag LOCUS_07160 3203 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07160 >Feature sequence168 1107 2432 gene locus_tag LOCUS_07170 1107 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 3188 2919 gene locus_tag LOCUS_07180 3188 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 >Feature sequence169 344 523 gene locus_tag LOCUS_07190 344 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 578 1501 gene locus_tag LOCUS_07200 578 1501 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876013.1 protein_id gnl|my_center|LOCUS_07200 1774 2577 gene locus_tag LOCUS_07210 1774 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 2580 3329 gene locus_tag LOCUS_07220 2580 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 >Feature sequence170 1703 432 gene locus_tag LOCUS_07230 1703 432 CDS product actin/actin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762638.1 protein_id gnl|my_center|LOCUS_07230 2350 1700 gene locus_tag LOCUS_07240 2350 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 3158 2793 gene locus_tag LOCUS_07250 3158 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence171 310 143 gene locus_tag LOCUS_07260 310 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 2597 474 gene locus_tag LOCUS_07270 2597 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 2778 2605 gene locus_tag LOCUS_07280 2778 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 >Feature sequence172 31 1155 gene locus_tag LOCUS_07290 31 1155 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867958.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence173 <1 552 gene locus_tag LOCUS_07300 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880314.1:ADP-ribosylglycohydrolase family protein 633 1277 gene locus_tag LOCUS_07310 633 1277 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762559.1 protein_id gnl|my_center|LOCUS_07310 2631 1735 gene locus_tag LOCUS_07320 gene rbsK 2631 1735 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_07320 <3652 3083 gene locus_tag LOCUS_07330 <3652 3083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004523896.1:ABC transporter permease >Feature sequence174 803 1174 gene locus_tag LOCUS_07340 803 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 1625 1155 gene locus_tag LOCUS_07350 1625 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 2085 2447 gene locus_tag LOCUS_07360 2085 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence175 244 417 gene locus_tag LOCUS_07370 244 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 2211 2846 gene locus_tag LOCUS_07380 2211 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 3331 3597 gene locus_tag LOCUS_07390 3331 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 >Feature sequence176 1428 2552 gene locus_tag LOCUS_07400 1428 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 2584 2703 gene locus_tag LOCUS_07410 2584 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 2998 3306 gene locus_tag LOCUS_07420 2998 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 >Feature sequence177 887 498 gene locus_tag LOCUS_07430 887 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 1021 1788 gene locus_tag LOCUS_07440 1021 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence178 988 1377 gene locus_tag LOCUS_07450 988 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 1664 1374 gene locus_tag LOCUS_07460 1664 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 1907 2617 gene locus_tag LOCUS_07470 1907 2617 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 protein_id gnl|my_center|LOCUS_07470 2652 3305 gene locus_tag LOCUS_07480 2652 3305 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868122.1 protein_id gnl|my_center|LOCUS_07480 >Feature sequence179 826 3435 gene locus_tag LOCUS_07490 826 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 >Feature sequence180 356 1822 gene locus_tag LOCUS_07500 gene bgaS 356 1822 CDS product beta-galactosidase BgaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868057.1 protein_id gnl|my_center|LOCUS_07500 3276 1900 gene locus_tag LOCUS_07510 3276 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 >Feature sequence181 1471 1677 gene locus_tag LOCUS_07520 1471 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 1674 3581 gene locus_tag LOCUS_07530 1674 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 >Feature sequence182 <1 500 gene locus_tag LOCUS_07540 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878366.1:alpha/beta fold hydrolase 666 1406 gene locus_tag LOCUS_07550 666 1406 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867382.1 protein_id gnl|my_center|LOCUS_07550 1403 1933 gene locus_tag LOCUS_07560 1403 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062371128.1 protein_id gnl|my_center|LOCUS_07560 2008 2412 gene locus_tag LOCUS_07570 2008 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 2491 3135 gene locus_tag LOCUS_07580 2491 3135 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191776298.1 protein_id gnl|my_center|LOCUS_07580 3622 3137 gene locus_tag LOCUS_07590 3622 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 >Feature sequence183 <1 574 gene locus_tag LOCUS_07600 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964173.1:HAD family hydrolase 592 1245 gene locus_tag LOCUS_07610 592 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 1267 1812 gene locus_tag LOCUS_07620 1267 1812 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147117.1 protein_id gnl|my_center|LOCUS_07620 <3618 1840 gene locus_tag LOCUS_07630 <3618 1840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582581.1:glycosyl hydrolase >Feature sequence184 42 434 gene locus_tag LOCUS_07640 42 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 621 3419 gene locus_tag LOCUS_07650 621 3419 CDS product calcium-transporting P-type ATPase, PMR1-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272458.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence185 286 1680 gene locus_tag LOCUS_07660 286 1680 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_07660 2701 1685 gene locus_tag LOCUS_07670 gene ilvC 2701 1685 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496863.1 protein_id gnl|my_center|LOCUS_07670 2843 3379 gene locus_tag LOCUS_07680 2843 3379 CDS product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375133.1 protein_id gnl|my_center|LOCUS_07680 >Feature sequence186 220 1443 gene locus_tag LOCUS_07690 220 1443 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146489.1 protein_id gnl|my_center|LOCUS_07690 1510 2433 gene locus_tag LOCUS_07700 1510 2433 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256099.1 protein_id gnl|my_center|LOCUS_07700 <3597 2437 gene locus_tag LOCUS_07710 <3597 2437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878920.1:HD domain-containing protein >Feature sequence187 905 2059 gene locus_tag LOCUS_07720 905 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 3206 2124 gene locus_tag LOCUS_07730 3206 2124 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_07730 >Feature sequence188 812 321 gene locus_tag LOCUS_07740 812 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 1502 864 gene locus_tag LOCUS_07750 1502 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 2556 2032 gene locus_tag LOCUS_07760 2556 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 >Feature sequence189 >Feature sequence190 1102 1917 gene locus_tag LOCUS_07770 1102 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 1826 2758 gene locus_tag LOCUS_07780 1826 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 2849 3118 gene locus_tag LOCUS_07790 2849 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 >Feature sequence191 19 1707 gene locus_tag LOCUS_07800 19 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 2042 2314 gene locus_tag LOCUS_07810 2042 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 2625 2416 gene locus_tag LOCUS_07820 2625 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 2871 3047 gene locus_tag LOCUS_07830 2871 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 3067 3255 gene locus_tag LOCUS_07840 3067 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 >Feature sequence192 <1 1539 gene locus_tag LOCUS_07850 <1 1539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_202319085.1:aldehyde ferredoxin oxidoreductase family protein 1819 2010 gene locus_tag LOCUS_07860 1819 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 2039 2839 gene locus_tag LOCUS_07870 2039 2839 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871021.1 protein_id gnl|my_center|LOCUS_07870 3392 2823 gene locus_tag LOCUS_07880 3392 2823 CDS product type II restriction endonuclease MjaV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871023.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence193 216 4 gene locus_tag LOCUS_07890 216 4 CDS product antitoxin VapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878978.1 protein_id gnl|my_center|LOCUS_07890 566 880 gene locus_tag LOCUS_07900 566 880 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868508.1 protein_id gnl|my_center|LOCUS_07900 1989 889 gene locus_tag LOCUS_07910 gene wecB 1989 889 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250181.1 protein_id gnl|my_center|LOCUS_07910 3284 1986 gene locus_tag LOCUS_07920 3284 1986 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867672.1 protein_id gnl|my_center|LOCUS_07920 >Feature sequence194 1738 431 gene locus_tag LOCUS_07930 1738 431 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804146.1 protein_id gnl|my_center|LOCUS_07930 2574 1831 gene locus_tag LOCUS_07940 2574 1831 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878032.1 protein_id gnl|my_center|LOCUS_07940 3507 3046 gene locus_tag LOCUS_07950 3507 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 >Feature sequence195 997 1542 gene locus_tag LOCUS_07960 997 1542 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240266.1 protein_id gnl|my_center|LOCUS_07960 2073 1516 gene locus_tag LOCUS_07970 2073 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 3104 2136 gene locus_tag LOCUS_07980 gene htpX 3104 2136 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980430.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence196 1007 129 gene locus_tag LOCUS_07990 1007 129 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763234.1 protein_id gnl|my_center|LOCUS_07990 1840 1082 gene locus_tag LOCUS_08000 1840 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 >Feature sequence197 310 543 gene locus_tag LOCUS_08010 310 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence198 1175 780 gene locus_tag LOCUS_08020 1175 780 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 protein_id gnl|my_center|LOCUS_08020 2043 1555 gene locus_tag LOCUS_08030 2043 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 2714 2049 gene locus_tag LOCUS_08040 2714 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 2938 3336 gene locus_tag LOCUS_08050 2938 3336 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250286.1 protein_id gnl|my_center|LOCUS_08050 >Feature sequence199 <1 884 gene locus_tag LOCUS_08060 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875688.1:type 2 isopentenyl-diphosphate Delta-isomerase 881 1969 gene locus_tag LOCUS_08070 881 1969 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250419.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence200 1632 853 gene locus_tag LOCUS_08080 1632 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 2200 2331 gene locus_tag LOCUS_08090 2200 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 2467 2616 gene locus_tag LOCUS_08100 2467 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence201 776 18 gene locus_tag LOCUS_08110 776 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 1012 1341 gene locus_tag LOCUS_08120 1012 1341 CDS product 30S ribosomal protein S25e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762560.1 protein_id gnl|my_center|LOCUS_08120 1430 2026 gene locus_tag LOCUS_08130 1430 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 2384 2013 gene locus_tag LOCUS_08140 2384 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 >Feature sequence202 1606 317 gene locus_tag LOCUS_08150 1606 317 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_08150 1758 2198 gene locus_tag LOCUS_08160 1758 2198 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978373.1 protein_id gnl|my_center|LOCUS_08160 2292 2633 gene locus_tag LOCUS_08170 2292 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 2777 3523 gene locus_tag LOCUS_08180 2777 3523 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250541.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence203 <3526 576 gene locus_tag LOCUS_08190 <3526 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_224065207.1:helicase-related protein >Feature sequence204 1372 653 gene locus_tag LOCUS_08200 1372 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 2278 2060 gene locus_tag LOCUS_08210 2278 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 2457 3455 gene locus_tag LOCUS_08220 2457 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence205 1975 1340 gene locus_tag LOCUS_08230 gene psmB 1975 1340 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876826.1 protein_id gnl|my_center|LOCUS_08230 2230 3231 gene locus_tag LOCUS_08240 2230 3231 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023593.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence206 786 55 gene locus_tag LOCUS_08250 786 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 1989 1150 gene locus_tag LOCUS_08260 1989 1150 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876218.1 protein_id gnl|my_center|LOCUS_08260 <3517 2018 gene locus_tag LOCUS_08270 <3517 2018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_170324985.1:xylulokinase >Feature sequence207 602 300 gene locus_tag LOCUS_08280 602 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 1060 602 gene locus_tag LOCUS_08290 1060 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 2150 1167 gene locus_tag LOCUS_08300 2150 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 2860 2489 gene locus_tag LOCUS_08310 2860 2489 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870773.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence208 647 1771 gene locus_tag LOCUS_08320 647 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence209 1349 1594 gene locus_tag LOCUS_08330 1349 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 2226 2041 gene locus_tag LOCUS_08340 2226 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 2694 2371 gene locus_tag LOCUS_08350 2694 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence210 398 2446 gene locus_tag LOCUS_08360 398 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence211 1152 106 gene locus_tag LOCUS_08370 1152 106 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249740.1 protein_id gnl|my_center|LOCUS_08370 1360 1995 gene locus_tag LOCUS_08380 gene psmB 1360 1995 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876826.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence212 341 2851 gene locus_tag LOCUS_08390 341 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence213 1279 2 gene locus_tag LOCUS_08400 1279 2 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240264.1 protein_id gnl|my_center|LOCUS_08400 2422 1343 gene locus_tag LOCUS_08410 2422 1343 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870783.1 protein_id gnl|my_center|LOCUS_08410 3368 2424 gene locus_tag LOCUS_08420 3368 2424 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496774.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence214 1272 1925 gene locus_tag LOCUS_08430 1272 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1912 2418 gene locus_tag LOCUS_08440 1912 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 2585 2427 gene locus_tag LOCUS_08450 2585 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 >Feature sequence215 357 1208 gene locus_tag LOCUS_08460 357 1208 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250367.1 protein_id gnl|my_center|LOCUS_08460 2346 1528 gene locus_tag LOCUS_08470 2346 1528 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867130.1 protein_id gnl|my_center|LOCUS_08470 2624 2391 gene locus_tag LOCUS_08480 2624 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 2851 2621 gene locus_tag LOCUS_08490 2851 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence216 <3487 221 gene locus_tag LOCUS_08500 <3487 221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053701.1:chromosome segregation protein SMC >Feature sequence217 335 1699 gene locus_tag LOCUS_08510 335 1699 CDS product fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762299.1 protein_id gnl|my_center|LOCUS_08510 2422 1997 gene locus_tag LOCUS_08520 gene trxA 2422 1997 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846557.1 protein_id gnl|my_center|LOCUS_08520 2660 2472 gene locus_tag LOCUS_08530 2660 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 <3476 2794 gene locus_tag LOCUS_08540 <3476 2794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060886.1:thioredoxin-disulfide reductase >Feature sequence218 >Feature sequence219 298 1095 gene locus_tag LOCUS_08550 298 1095 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867222.1 protein_id gnl|my_center|LOCUS_08550 3028 1112 gene locus_tag LOCUS_08560 3028 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence220 450 638 gene locus_tag LOCUS_08570 450 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 675 1850 gene locus_tag LOCUS_08580 675 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 1888 2805 gene locus_tag LOCUS_08590 1888 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence221 444 1316 gene locus_tag LOCUS_08600 444 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1330 3390 gene locus_tag LOCUS_08610 1330 3390 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249027.1 protein_id gnl|my_center|LOCUS_08610 >Feature sequence222 1683 577 gene locus_tag LOCUS_08620 1683 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 3146 1680 gene locus_tag LOCUS_08630 3146 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08630 >Feature sequence223 2540 3223 gene locus_tag LOCUS_08640 2540 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence224 531 815 gene locus_tag LOCUS_08650 531 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 918 1250 gene locus_tag LOCUS_08660 918 1250 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_08660 1256 2284 gene locus_tag LOCUS_08670 1256 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence225 735 442 gene locus_tag LOCUS_08680 735 442 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762401.1 protein_id gnl|my_center|LOCUS_08680 2018 732 gene locus_tag LOCUS_08690 2018 732 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762402.1 protein_id gnl|my_center|LOCUS_08690 2925 2233 gene locus_tag LOCUS_08700 2925 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08700 3350 2931 gene locus_tag LOCUS_08710 3350 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08710 >Feature sequence226 <1 738 gene locus_tag LOCUS_08720 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023637.1:5,10-methylenetetrahydromethanopterin reductase 1726 731 gene locus_tag LOCUS_08730 1726 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 1878 3263 gene locus_tag LOCUS_08740 1878 3263 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807812.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence227 713 1783 gene locus_tag LOCUS_08750 713 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1911 2426 gene locus_tag LOCUS_08760 1911 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 2427 2918 gene locus_tag LOCUS_08770 2427 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 <3440 2928 gene locus_tag LOCUS_08780 <3440 2928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949068.1:DUF523 domain-containing protein >Feature sequence228 1579 2802 gene locus_tag LOCUS_08790 1579 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 2768 2980 gene locus_tag LOCUS_08800 2768 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 3036 3197 gene locus_tag LOCUS_08810 3036 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence229 <1 1033 gene locus_tag LOCUS_08820 <1 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582864.1:UxaA family hydrolase 2316 1048 gene locus_tag LOCUS_08830 gene larA 2316 1048 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_08830 2389 3282 gene locus_tag LOCUS_08840 2389 3282 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035844551.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence230 >Feature sequence231 409 272 gene locus_tag LOCUS_08850 409 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 2984 1104 gene locus_tag LOCUS_08860 2984 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence232 343 1242 gene locus_tag LOCUS_08870 343 1242 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846481.1 protein_id gnl|my_center|LOCUS_08870 1247 2140 gene locus_tag LOCUS_08880 1247 2140 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973570.1 protein_id gnl|my_center|LOCUS_08880 2157 3245 gene locus_tag LOCUS_08890 2157 3245 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250726.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence233 275 18 gene locus_tag LOCUS_08900 275 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 1078 272 gene locus_tag LOCUS_08910 gene dph5 1078 272 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249061.1 protein_id gnl|my_center|LOCUS_08910 1230 1826 gene locus_tag LOCUS_08920 1230 1826 CDS product MjaI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545491.1 protein_id gnl|my_center|LOCUS_08920 2137 1868 gene locus_tag LOCUS_08930 2137 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 3100 2159 gene locus_tag LOCUS_08940 3100 2159 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870499.1 protein_id gnl|my_center|LOCUS_08940 3275 3117 gene locus_tag LOCUS_08950 3275 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence234 45 320 gene locus_tag LOCUS_08960 45 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 456 605 gene locus_tag LOCUS_08970 456 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 634 861 gene locus_tag LOCUS_08980 634 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 905 1174 gene locus_tag LOCUS_08990 905 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 2052 1804 gene locus_tag LOCUS_09000 2052 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 2703 2975 gene locus_tag LOCUS_09010 2703 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence235 1664 954 gene locus_tag LOCUS_09020 gene alaXM 1664 954 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022008.1 protein_id gnl|my_center|LOCUS_09020 2901 1750 gene locus_tag LOCUS_09030 2901 1750 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_09030 3044 2898 gene locus_tag LOCUS_09040 3044 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence236 480 298 gene locus_tag LOCUS_09050 480 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 615 1214 gene locus_tag LOCUS_09060 615 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1201 1785 gene locus_tag LOCUS_09070 1201 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 >Feature sequence237 144 1832 gene locus_tag LOCUS_09080 144 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 2594 2331 gene locus_tag LOCUS_09090 2594 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 2669 3028 gene locus_tag LOCUS_09100 2669 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 3396 3058 gene locus_tag LOCUS_09110 3396 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence238 70 858 gene locus_tag LOCUS_09120 70 858 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868227.1 protein_id gnl|my_center|LOCUS_09120 851 1183 gene locus_tag LOCUS_09130 851 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence239 229 384 gene locus_tag LOCUS_09140 229 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 381 1307 gene locus_tag LOCUS_09150 381 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1312 2682 gene locus_tag LOCUS_09160 1312 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 3156 2755 gene locus_tag LOCUS_09170 3156 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 >Feature sequence240 1470 712 gene locus_tag LOCUS_09180 1470 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 1581 1721 gene locus_tag LOCUS_09190 1581 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 2755 1718 gene locus_tag LOCUS_09200 2755 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 >Feature sequence241 13 597 gene locus_tag LOCUS_09210 13 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 667 834 gene locus_tag LOCUS_09220 667 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 2354 969 gene locus_tag LOCUS_09230 2354 969 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_09230 2461 2844 gene locus_tag LOCUS_09240 2461 2844 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877165.1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence242 212 361 gene locus_tag LOCUS_09250 212 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 336 506 gene locus_tag LOCUS_09260 336 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 499 735 gene locus_tag LOCUS_09270 499 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 728 2251 gene locus_tag LOCUS_09280 728 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 2259 2381 gene locus_tag LOCUS_09290 2259 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 2492 3259 gene locus_tag LOCUS_09300 2492 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence243 858 1826 gene locus_tag LOCUS_09310 858 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 1981 2871 gene locus_tag LOCUS_09320 1981 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 >Feature sequence244 1164 658 gene locus_tag LOCUS_09330 1164 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1804 1151 gene locus_tag LOCUS_09340 1804 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence245 <1 603 gene locus_tag LOCUS_09350 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878194.1:ASKHA domain-containing protein 2211 754 gene locus_tag LOCUS_09360 gene acsC 2211 754 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877321.1 protein_id gnl|my_center|LOCUS_09360 <3378 2228 gene locus_tag LOCUS_09370 <3378 2228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877884.1:CO dehydrogenase/acetyl-CoA synthase subunit delta >Feature sequence246 2768 636 gene locus_tag LOCUS_09380 2768 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 >Feature sequence247 245 1060 gene locus_tag LOCUS_09390 245 1060 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 protein_id gnl|my_center|LOCUS_09390 1235 2467 gene locus_tag LOCUS_09400 1235 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_09400 2539 2871 gene locus_tag LOCUS_09410 2539 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 >Feature sequence248 1250 195 gene locus_tag LOCUS_09420 1250 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 1853 1293 gene locus_tag LOCUS_09430 1853 1293 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 protein_id gnl|my_center|LOCUS_09430 2563 1952 gene locus_tag LOCUS_09440 2563 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 <3363 2635 gene locus_tag LOCUS_09450 <3363 2635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978333.1:tRNA (adenine-N1)-methyltransferase >Feature sequence249 <1 684 gene locus_tag LOCUS_09460 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_198429779.1:RimK family alpha-L-glutamate ligase 681 1340 gene locus_tag LOCUS_09470 681 1340 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_09470 2055 1297 gene locus_tag LOCUS_09480 gene cofE 2055 1297 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_09480 2694 2125 gene locus_tag LOCUS_09490 2694 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 <3362 2761 gene locus_tag LOCUS_09500 <3362 2761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005801343.1:uroporphyrinogen decarboxylase family protein >Feature sequence250 3301 1679 gene locus_tag LOCUS_09510 3301 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence251 64 2019 gene locus_tag LOCUS_09520 64 2019 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_09520 2944 2012 gene locus_tag LOCUS_09530 2944 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence252 <1 1109 gene locus_tag LOCUS_09540 <1 1109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060924.1:MBL fold metallo-hydrolase 1170 1913 gene locus_tag LOCUS_09550 1170 1913 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250279.1 protein_id gnl|my_center|LOCUS_09550 2009 2590 gene locus_tag LOCUS_09560 2009 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 2687 3247 gene locus_tag LOCUS_09570 2687 3247 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence253 752 1903 gene locus_tag LOCUS_09580 752 1903 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870036.1 protein_id gnl|my_center|LOCUS_09580 <3352 2041 gene locus_tag LOCUS_09590 <3352 2041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064511.1:radical SAM protein >Feature sequence254 431 955 gene locus_tag LOCUS_09600 431 955 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978732.1 protein_id gnl|my_center|LOCUS_09600 1790 984 gene locus_tag LOCUS_09610 gene deoC 1790 984 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_09610 1758 3017 gene locus_tag LOCUS_09620 gene larA 1758 3017 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438088.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence255 630 2186 gene locus_tag LOCUS_09630 630 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 2494 3120 gene locus_tag LOCUS_09640 2494 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence256 165 1220 gene locus_tag LOCUS_09650 165 1220 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583427.1 protein_id gnl|my_center|LOCUS_09650 1227 2624 gene locus_tag LOCUS_09660 1227 2624 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583426.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence257 837 4 gene locus_tag LOCUS_09670 837 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 2022 910 gene locus_tag LOCUS_09680 2022 910 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763625.1 protein_id gnl|my_center|LOCUS_09680 2127 2363 gene locus_tag LOCUS_09690 2127 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence258 2411 591 gene locus_tag LOCUS_09700 2411 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 <3332 2468 gene locus_tag LOCUS_09710 <3332 2468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937687.1:sulfatase >Feature sequence259 1461 673 gene locus_tag LOCUS_09720 1461 673 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723840.1 protein_id gnl|my_center|LOCUS_09720 1620 2510 gene locus_tag LOCUS_09730 1620 2510 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978942.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence260 1352 303 gene locus_tag LOCUS_09740 1352 303 CDS product SPOUT family RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867210.1 protein_id gnl|my_center|LOCUS_09740 1495 2553 gene locus_tag LOCUS_09750 1495 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 2671 2531 gene locus_tag LOCUS_09760 2671 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 >Feature sequence261 1397 2143 gene locus_tag LOCUS_09770 gene fabG 1397 2143 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence262 <1 1035 gene locus_tag LOCUS_09780 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244156.1:sorbitol dehydrogenase 1286 2659 gene locus_tag LOCUS_09790 gene aglA 1286 2659 CDS product alpha-glucosidase AglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865414.1 protein_id gnl|my_center|LOCUS_09790 <3320 2669 gene locus_tag LOCUS_09800 <3320 2669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878151.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence263 274 95 gene locus_tag LOCUS_09810 274 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 611 1348 gene locus_tag LOCUS_09820 gene mobB 611 1348 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249885.1 protein_id gnl|my_center|LOCUS_09820 1478 1738 gene locus_tag LOCUS_09830 1478 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 1735 1998 gene locus_tag LOCUS_09840 1735 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 2005 2319 gene locus_tag LOCUS_09850 2005 2319 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146633.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence264 94 927 gene locus_tag LOCUS_09860 94 927 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867130.1 protein_id gnl|my_center|LOCUS_09860 1022 1810 gene locus_tag LOCUS_09870 1022 1810 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583927.1 protein_id gnl|my_center|LOCUS_09870 2685 1834 gene locus_tag LOCUS_09880 2685 1834 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250367.1 protein_id gnl|my_center|LOCUS_09880 3315 2698 gene locus_tag LOCUS_09890 3315 2698 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061119.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence265 951 3125 gene locus_tag LOCUS_09900 951 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence266 876 61 gene locus_tag LOCUS_09910 gene hisF 876 61 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869910.1 protein_id gnl|my_center|LOCUS_09910 1618 896 gene locus_tag LOCUS_09920 gene hisA 1618 896 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228483.1 protein_id gnl|my_center|LOCUS_09920 2224 1625 gene locus_tag LOCUS_09930 gene hisH 2224 1625 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_09930 2801 2226 gene locus_tag LOCUS_09940 gene hisB 2801 2226 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061060.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence267 599 474 gene locus_tag LOCUS_09950 599 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 870 1397 gene locus_tag LOCUS_09960 870 1397 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048408.1 protein_id gnl|my_center|LOCUS_09960 1451 1939 gene locus_tag LOCUS_09970 1451 1939 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063706.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence268 198 926 gene locus_tag LOCUS_09980 198 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 911 1939 gene locus_tag LOCUS_09990 911 1939 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250104.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence269 2230 887 gene locus_tag LOCUS_10000 2230 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 <3295 2375 gene locus_tag LOCUS_10010 <3295 2375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583619.1:TrpB-like pyridoxal phosphate-dependent enzyme >Feature sequence270 22 162 gene locus_tag LOCUS_10020 22 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 1622 180 gene locus_tag LOCUS_10030 1622 180 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 protein_id gnl|my_center|LOCUS_10030 <3271 1725 gene locus_tag LOCUS_10040 <3271 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023138.1:ATP-dependent DNA helicase >Feature sequence271 534 190 gene locus_tag LOCUS_10050 534 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10050 884 609 gene locus_tag LOCUS_10060 884 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1465 1331 gene locus_tag LOCUS_10070 1465 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1767 3101 gene locus_tag LOCUS_10080 1767 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence272 <1 521 gene locus_tag LOCUS_10090 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978133.1:[LysW]-aminoadipate/[LysW]-glutamate kinase 588 764 gene locus_tag LOCUS_10100 gene lysW/argW 588 764 CDS product alpha-aminoadipate/glutamate carrier protein LysW/ArgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978131.1 protein_id gnl|my_center|LOCUS_10100 941 2218 gene locus_tag LOCUS_10110 941 2218 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876486.1 protein_id gnl|my_center|LOCUS_10110 2941 2504 gene locus_tag LOCUS_10120 2941 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 3263 3009 gene locus_tag LOCUS_10130 3263 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence273 157 783 gene locus_tag LOCUS_10140 157 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 820 1428 gene locus_tag LOCUS_10150 820 1428 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870563.1 protein_id gnl|my_center|LOCUS_10150 2400 1459 gene locus_tag LOCUS_10160 2400 1459 CDS product NADP-dependent methylenetetrahydromethanopterin/methylenetetrahydrofolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122705.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence274 685 1377 gene locus_tag LOCUS_10170 685 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1485 1327 gene locus_tag LOCUS_10180 1485 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1463 2869 gene locus_tag LOCUS_10190 1463 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence275 2865 583 gene locus_tag LOCUS_10200 2865 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence276 3238 458 gene locus_tag LOCUS_10210 gene alaS 3238 458 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250518.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence277 2413 332 gene locus_tag LOCUS_10220 2413 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence278 1575 598 gene locus_tag LOCUS_10230 1575 598 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_10230 2724 1726 gene locus_tag LOCUS_10240 2724 1726 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_10240 <3249 2721 gene locus_tag LOCUS_10250 <3249 2721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868867.1:ABC transporter ATP-binding protein >Feature sequence279 1603 1421 gene locus_tag LOCUS_10260 1603 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1885 1742 gene locus_tag LOCUS_10270 1885 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence280 27 1037 gene locus_tag LOCUS_10280 27 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1190 1597 gene locus_tag LOCUS_10290 1190 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1701 2471 gene locus_tag LOCUS_10300 1701 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 2782 2606 gene locus_tag LOCUS_10310 2782 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence281 953 2533 gene locus_tag LOCUS_10320 953 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence282 2061 1894 gene locus_tag LOCUS_10330 2061 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 2826 2200 gene locus_tag LOCUS_10340 2826 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 >Feature sequence283 663 893 gene locus_tag LOCUS_10350 663 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1746 958 gene locus_tag LOCUS_10360 1746 958 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867253.1 protein_id gnl|my_center|LOCUS_10360 2564 1743 gene locus_tag LOCUS_10370 2564 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 <3226 2561 gene locus_tag LOCUS_10380 <3226 2561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867495.1:ATP-binding cassette domain-containing protein >Feature sequence284 3 1028 gene locus_tag LOCUS_10390 3 1028 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258119.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence285 311 1105 gene locus_tag LOCUS_10400 311 1105 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876722.1 protein_id gnl|my_center|LOCUS_10400 1849 1127 gene locus_tag LOCUS_10410 1849 1127 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546217.1 protein_id gnl|my_center|LOCUS_10410 2600 1842 gene locus_tag LOCUS_10420 2600 1842 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762347.1 protein_id gnl|my_center|LOCUS_10420 <3224 2634 gene locus_tag LOCUS_10430 <3224 2634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053240264.1:ABC transporter substrate-binding protein >Feature sequence286 281 1555 gene locus_tag LOCUS_10440 281 1555 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437980.1 protein_id gnl|my_center|LOCUS_10440 1557 1778 gene locus_tag LOCUS_10450 1557 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 2843 2766 gene locus_tag LOCUS_t00110 2843 2766 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2999 3074 gene locus_tag LOCUS_t00120 2999 3074 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence287 660 496 gene locus_tag LOCUS_10460 660 496 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868406.1 protein_id gnl|my_center|LOCUS_10460 925 2226 gene locus_tag LOCUS_10470 925 2226 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251014.1 protein_id gnl|my_center|LOCUS_10470 2223 3185 gene locus_tag LOCUS_10480 2223 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 >Feature sequence288 2295 187 gene locus_tag LOCUS_10490 2295 187 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064995.1 protein_id gnl|my_center|LOCUS_10490 2601 2347 gene locus_tag LOCUS_10500 2601 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence289 47 172 gene locus_tag LOCUS_10510 47 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 193 807 gene locus_tag LOCUS_10520 193 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1204 725 gene locus_tag LOCUS_10530 1204 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1499 1197 gene locus_tag LOCUS_10540 1499 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 2025 1585 gene locus_tag LOCUS_10550 2025 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2732 1977 gene locus_tag LOCUS_10560 2732 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10560 >Feature sequence290 2054 1008 gene locus_tag LOCUS_10570 2054 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 2605 2162 gene locus_tag LOCUS_10580 2605 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence291 676 1725 gene locus_tag LOCUS_10590 676 1725 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_10590 2934 2569 gene locus_tag LOCUS_10600 2934 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence292 92 919 gene locus_tag LOCUS_10610 92 919 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053679.1 protein_id gnl|my_center|LOCUS_10610 916 1776 gene locus_tag LOCUS_10620 916 1776 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249652.1 protein_id gnl|my_center|LOCUS_10620 1899 2774 gene locus_tag LOCUS_10630 1899 2774 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876243.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence293 1001 2278 gene locus_tag LOCUS_10640 1001 2278 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876437.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence294 892 95 gene locus_tag LOCUS_10650 892 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1518 2699 gene locus_tag LOCUS_10660 1518 2699 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227995.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence295 >Feature sequence296 355 1704 gene locus_tag LOCUS_10670 355 1704 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969766.1 protein_id gnl|my_center|LOCUS_10670 1753 2103 gene locus_tag LOCUS_10680 1753 2103 CDS product DUF2095 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249981.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence297 944 336 gene locus_tag LOCUS_10690 944 336 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240327.1 protein_id gnl|my_center|LOCUS_10690 1909 950 gene locus_tag LOCUS_10700 1909 950 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250915.1 protein_id gnl|my_center|LOCUS_10700 1932 2900 gene locus_tag LOCUS_10710 gene radA 1932 2900 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146514.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence298 624 926 gene locus_tag LOCUS_10720 624 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence299 1019 234 gene locus_tag LOCUS_10730 gene mtnP 1019 234 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868192.1 protein_id gnl|my_center|LOCUS_10730 2211 1000 gene locus_tag LOCUS_10740 2211 1000 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147160.1 protein_id gnl|my_center|LOCUS_10740 3154 2315 gene locus_tag LOCUS_10750 3154 2315 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867255.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence300 <1 545 gene locus_tag LOCUS_10760 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583777.1:phosphoribosyltransferase 699 1814 gene locus_tag LOCUS_10770 699 1814 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596611.1 protein_id gnl|my_center|LOCUS_10770 1826 2797 gene locus_tag LOCUS_10780 1826 2797 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392152.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence301 71 289 gene locus_tag LOCUS_10790 71 289 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978233.1 protein_id gnl|my_center|LOCUS_10790 332 529 gene locus_tag LOCUS_10800 332 529 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978232.1 protein_id gnl|my_center|LOCUS_10800 851 585 gene locus_tag LOCUS_10810 851 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1091 969 gene locus_tag LOCUS_10820 1091 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1987 1148 gene locus_tag LOCUS_10830 1987 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 <3176 2518 gene locus_tag LOCUS_10840 <3176 2518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081432771.1:magnesium transporter >Feature sequence302 55 801 gene locus_tag LOCUS_10850 55 801 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860724.1 protein_id gnl|my_center|LOCUS_10850 950 1798 gene locus_tag LOCUS_10860 950 1798 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968370.1 protein_id gnl|my_center|LOCUS_10860 1852 2859 gene locus_tag LOCUS_10870 1852 2859 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903967.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence303 670 14 gene locus_tag LOCUS_10880 670 14 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867971.1 protein_id gnl|my_center|LOCUS_10880 1793 879 gene locus_tag LOCUS_10890 1793 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 2133 2987 gene locus_tag LOCUS_10900 2133 2987 CDS product 7,8-dihydropterin-6-methyl-4-(beta-D-ribofuranosyl)-aminobenzene-5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869799.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence304 822 2210 gene locus_tag LOCUS_10910 822 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence305 818 96 gene locus_tag LOCUS_10920 gene sfsA 818 96 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249730.1 protein_id gnl|my_center|LOCUS_10920 1052 867 gene locus_tag LOCUS_10930 1052 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1568 3001 gene locus_tag LOCUS_10940 gene cysS 1568 3001 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence306 628 164 gene locus_tag LOCUS_10950 628 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1823 732 gene locus_tag LOCUS_10960 1823 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 2454 1975 gene locus_tag LOCUS_10970 2454 1975 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762273.1 protein_id gnl|my_center|LOCUS_10970 <3164 2451 gene locus_tag LOCUS_10980 <3164 2451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250541.1:KaiC domain-containing protein >Feature sequence307 998 2026 gene locus_tag LOCUS_10990 998 2026 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582709.1 protein_id gnl|my_center|LOCUS_10990 2850 2032 gene locus_tag LOCUS_11000 gene purQ 2850 2032 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878755.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence308 360 1460 gene locus_tag LOCUS_11010 360 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1457 3094 gene locus_tag LOCUS_11020 1457 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence309 <1 822 gene locus_tag LOCUS_11030 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003646028.1:phosphoenolpyruvate synthase 950 1951 gene locus_tag LOCUS_11040 gene dph2 950 1951 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 protein_id gnl|my_center|LOCUS_11040 2649 1957 gene locus_tag LOCUS_11050 gene rpiA 2649 1957 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021687.1 protein_id gnl|my_center|LOCUS_11050 >Feature sequence310 2315 633 gene locus_tag LOCUS_11060 2315 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence311 <1 856 gene locus_tag LOCUS_11070 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249663.1:MBL fold metallo-hydrolase 980 2236 gene locus_tag LOCUS_11080 980 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 2856 2248 gene locus_tag LOCUS_11090 2856 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence312 <1 594 gene locus_tag LOCUS_11100 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393433.1:galactose-1-phosphate uridylyltransferase 1251 910 gene locus_tag LOCUS_11110 1251 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1553 1711 gene locus_tag LOCUS_11120 1553 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 2340 2660 gene locus_tag LOCUS_11130 2340 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence313 795 1259 gene locus_tag LOCUS_11140 795 1259 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978789.1 protein_id gnl|my_center|LOCUS_11140 1243 1581 gene locus_tag LOCUS_11150 1243 1581 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846412.1 protein_id gnl|my_center|LOCUS_11150 1667 2053 gene locus_tag LOCUS_11160 1667 2053 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978742.1 protein_id gnl|my_center|LOCUS_11160 2061 2360 gene locus_tag LOCUS_11170 2061 2360 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978645.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence314 <1 2376 gene locus_tag LOCUS_11180 <1 2376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162013074.1:PKD domain-containing protein >Feature sequence315 481 1218 gene locus_tag LOCUS_11190 481 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1508 1236 gene locus_tag LOCUS_11200 1508 1236 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_11200 1626 2300 gene locus_tag LOCUS_11210 gene rpe 1626 2300 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431138.1 protein_id gnl|my_center|LOCUS_11210 2590 2297 gene locus_tag LOCUS_11220 gene gatB 2590 2297 CDS product PTS galactitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823270.1 protein_id gnl|my_center|LOCUS_11220 <3130 2622 gene locus_tag LOCUS_11230 <3130 2622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674984.1:PTS galactitol transporter subunit IIC >Feature sequence316 1166 2263 gene locus_tag LOCUS_11240 1166 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 <3128 2273 gene locus_tag LOCUS_11250 <3128 2273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974707.1:M20 family metallopeptidase >Feature sequence317 1785 2330 gene locus_tag LOCUS_11260 1785 2330 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240266.1 protein_id gnl|my_center|LOCUS_11260 2861 2304 gene locus_tag LOCUS_11270 2861 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence318 164 364 gene locus_tag LOCUS_11280 164 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 620 1819 gene locus_tag LOCUS_11290 620 1819 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_11290 2275 1832 gene locus_tag LOCUS_11300 2275 1832 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197463606.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence319 176 988 gene locus_tag LOCUS_11310 176 988 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888478.1 protein_id gnl|my_center|LOCUS_11310 1041 1883 gene locus_tag LOCUS_11320 1041 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence320 223 1725 gene locus_tag LOCUS_11330 gene aglA 223 1725 CDS product alpha-glucosidase AglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865414.1 protein_id gnl|my_center|LOCUS_11330 2358 2029 gene locus_tag LOCUS_11340 2358 2029 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122463.1 protein_id gnl|my_center|LOCUS_11340 2909 2391 gene locus_tag LOCUS_11350 2909 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence321 921 1295 gene locus_tag LOCUS_11360 921 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1349 1627 gene locus_tag LOCUS_11370 1349 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1994 2116 gene locus_tag LOCUS_11380 1994 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence322 2455 944 gene locus_tag LOCUS_11390 2455 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 2974 2765 gene locus_tag LOCUS_11400 2974 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence323 499 1197 gene locus_tag LOCUS_11410 499 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence324 740 591 gene locus_tag LOCUS_11420 740 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 847 1107 gene locus_tag LOCUS_11430 847 1107 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846132.1 protein_id gnl|my_center|LOCUS_11430 1085 1537 gene locus_tag LOCUS_11440 1085 1537 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977969.1 protein_id gnl|my_center|LOCUS_11440 2026 2253 gene locus_tag LOCUS_11450 2026 2253 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879845.1 protein_id gnl|my_center|LOCUS_11450 2250 2660 gene locus_tag LOCUS_11460 2250 2660 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879846.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence325 1174 341 gene locus_tag LOCUS_11470 1174 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 3023 2733 gene locus_tag LOCUS_11480 3023 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence326 20 1798 gene locus_tag LOCUS_11490 20 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence327 <3091 813 gene locus_tag LOCUS_11500 <3091 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946472.1:DEAD/DEAH box helicase >Feature sequence328 425 141 gene locus_tag LOCUS_11510 425 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1592 642 gene locus_tag LOCUS_11520 gene cofD 1592 642 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_11520 2233 1565 gene locus_tag LOCUS_11530 2233 1565 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259451.1 protein_id gnl|my_center|LOCUS_11530 2987 2289 gene locus_tag LOCUS_11540 2987 2289 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319512.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence329 <1 584 gene locus_tag LOCUS_11550 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053240328.1:aldehyde ferredoxin oxidoreductase family protein 852 613 gene locus_tag LOCUS_11560 852 613 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_11560 972 1133 gene locus_tag LOCUS_11570 972 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1094 1246 gene locus_tag LOCUS_11580 1094 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1246 1731 gene locus_tag LOCUS_11590 1246 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence330 1213 515 gene locus_tag LOCUS_11600 1213 515 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762156.1 protein_id gnl|my_center|LOCUS_11600 2421 1210 gene locus_tag LOCUS_11610 2421 1210 CDS product C/D box methylation guide ribonucleoprotein complex aNOP56 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014546.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence331 1799 2302 gene locus_tag LOCUS_11620 1799 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902921.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence332 <1 717 gene locus_tag LOCUS_11630 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146977.1:ketol-acid reductoisomerase 743 2011 gene locus_tag LOCUS_11640 gene hacA 743 2011 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_11640 2008 2511 gene locus_tag LOCUS_11650 gene leuD 2008 2511 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence333 1444 200 gene locus_tag LOCUS_11660 1444 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 2179 2102 gene locus_tag LOCUS_t00130 2179 2102 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2295 2909 gene locus_tag LOCUS_11670 2295 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence334 134 328 gene locus_tag LOCUS_11680 134 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1312 371 gene locus_tag LOCUS_11690 1312 371 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249654.1 protein_id gnl|my_center|LOCUS_11690 1907 1335 gene locus_tag LOCUS_11700 1907 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 2036 2341 gene locus_tag LOCUS_11710 2036 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 2688 2383 gene locus_tag LOCUS_11720 2688 2383 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393974.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence335 1732 839 gene locus_tag LOCUS_11730 1732 839 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250428.1 protein_id gnl|my_center|LOCUS_11730 1812 2021 gene locus_tag LOCUS_11740 1812 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 2089 2274 gene locus_tag LOCUS_11750 2089 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 2219 2500 gene locus_tag LOCUS_11760 2219 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 <3047 2515 gene locus_tag LOCUS_11770 <3047 2515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023186.1:alanine dehydrogenase >Feature sequence336 248 490 gene locus_tag LOCUS_11780 248 490 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023401.1 protein_id gnl|my_center|LOCUS_11780 487 726 gene locus_tag LOCUS_11790 487 726 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249666.1 protein_id gnl|my_center|LOCUS_11790 723 1424 gene locus_tag LOCUS_11800 723 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11800 1421 2734 gene locus_tag LOCUS_11810 1421 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11810 >Feature sequence337 327 1382 gene locus_tag LOCUS_11820 327 1382 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404488.1 protein_id gnl|my_center|LOCUS_11820 2415 1429 gene locus_tag LOCUS_11830 2415 1429 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761782.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence338 222 1607 gene locus_tag LOCUS_11840 222 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1909 2457 gene locus_tag LOCUS_11850 1909 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 2848 2639 gene locus_tag LOCUS_11860 2848 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence339 815 728 gene locus_tag LOCUS_t00140 815 728 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 926 1123 gene locus_tag LOCUS_11870 926 1123 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867153.1 protein_id gnl|my_center|LOCUS_11870 1133 1408 gene locus_tag LOCUS_11880 1133 1408 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978151.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence340 1312 2691 gene locus_tag LOCUS_11890 1312 2691 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028108.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence341 177 90 gene locus_tag LOCUS_t00150 177 90 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 452 255 gene locus_tag LOCUS_11900 452 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 819 433 gene locus_tag LOCUS_11910 819 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1010 819 gene locus_tag LOCUS_11920 1010 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence342 1661 483 gene locus_tag LOCUS_11930 1661 483 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877033.1 protein_id gnl|my_center|LOCUS_11930 2074 1661 gene locus_tag LOCUS_11940 2074 1661 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020302.1 protein_id gnl|my_center|LOCUS_11940 2507 2118 gene locus_tag LOCUS_11950 2507 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 >Feature sequence343 14 913 gene locus_tag LOCUS_11960 14 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 913 2961 gene locus_tag LOCUS_11970 913 2961 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869226.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence344 <1 1308 gene locus_tag LOCUS_11980 <1 1308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870191.1:DUF262 domain-containing protein 1694 1353 gene locus_tag LOCUS_11990 1694 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 2135 1815 gene locus_tag LOCUS_12000 2135 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 2376 2185 gene locus_tag LOCUS_12010 2376 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 <3024 2388 gene locus_tag LOCUS_12020 <3024 2388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932589.1:AAA family ATPase >Feature sequence345 2397 1645 gene locus_tag LOCUS_12030 2397 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2813 2490 gene locus_tag LOCUS_12040 2813 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence346 1132 1302 gene locus_tag LOCUS_12050 1132 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 2753 1779 gene locus_tag LOCUS_12060 2753 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence347 1829 81 gene locus_tag LOCUS_12070 1829 81 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867608.1 protein_id gnl|my_center|LOCUS_12070 2948 1860 gene locus_tag LOCUS_12080 2948 1860 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250419.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence348 457 1407 gene locus_tag LOCUS_12090 457 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 2459 2055 gene locus_tag LOCUS_12100 2459 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence349 674 970 gene locus_tag LOCUS_12110 674 970 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750452.1 protein_id gnl|my_center|LOCUS_12110 1020 2096 gene locus_tag LOCUS_12120 gene wecB 1020 2096 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence350 334 1185 gene locus_tag LOCUS_12130 334 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1204 2019 gene locus_tag LOCUS_12140 gene coaW 1204 2019 CDS product type II pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442504.1 protein_id gnl|my_center|LOCUS_12140 2670 2029 gene locus_tag LOCUS_12150 2670 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence351 324 1319 gene locus_tag LOCUS_12160 324 1319 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966215.1 protein_id gnl|my_center|LOCUS_12160 1316 2617 gene locus_tag LOCUS_12170 1316 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence352 869 366 gene locus_tag LOCUS_12180 gene rimI 869 366 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978207.1 protein_id gnl|my_center|LOCUS_12180 2191 941 gene locus_tag LOCUS_12190 gene larA 2191 941 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_12190 <2994 2216 gene locus_tag LOCUS_12200 <2994 2216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081620.1:hydroxypyruvate reductase >Feature sequence353 601 470 gene locus_tag LOCUS_12210 601 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1961 633 gene locus_tag LOCUS_12220 1961 633 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867786.1 protein_id gnl|my_center|LOCUS_12220 2395 2637 gene locus_tag LOCUS_12230 2395 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 2748 2960 gene locus_tag LOCUS_12240 2748 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence354 529 71 gene locus_tag LOCUS_12250 529 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 645 1307 gene locus_tag LOCUS_12260 645 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1998 1603 gene locus_tag LOCUS_12270 1998 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence355 >Feature sequence356 1137 1391 gene locus_tag LOCUS_12280 1137 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1391 2080 gene locus_tag LOCUS_12290 1391 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 2417 2229 gene locus_tag LOCUS_12300 2417 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 >Feature sequence357 353 1462 gene locus_tag LOCUS_12310 353 1462 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704678.1 protein_id gnl|my_center|LOCUS_12310 1648 2295 gene locus_tag LOCUS_12320 gene cdvB1/B2 1648 2295 CDS product cell division protein CdvB1/B2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence358 1621 1418 gene locus_tag LOCUS_12330 1621 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 2647 1652 gene locus_tag LOCUS_12340 2647 1652 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871127.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence359 1994 735 gene locus_tag LOCUS_12350 1994 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence360 <1 767 gene locus_tag LOCUS_12360 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867626.1:signal recognition particle-docking protein FtsY 1006 1125 gene locus_tag LOCUS_12370 1006 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1138 1509 gene locus_tag LOCUS_12380 1138 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 2136 1972 gene locus_tag LOCUS_12390 2136 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence361 2755 1118 gene locus_tag LOCUS_12400 2755 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence362 1579 146 gene locus_tag LOCUS_12410 1579 146 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066694.1 protein_id gnl|my_center|LOCUS_12410 1808 2125 gene locus_tag LOCUS_12420 1808 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence363 841 539 gene locus_tag LOCUS_12430 841 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1228 857 gene locus_tag LOCUS_12440 1228 857 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762583.1 protein_id gnl|my_center|LOCUS_12440 1495 1319 gene locus_tag LOCUS_12450 1495 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 2423 1974 gene locus_tag LOCUS_12460 2423 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence364 <1 840 gene locus_tag LOCUS_12470 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762601.1:Clp1/GlmU family protein 1485 814 gene locus_tag LOCUS_12480 1485 814 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867788.1 protein_id gnl|my_center|LOCUS_12480 1766 2551 gene locus_tag LOCUS_12490 gene hpaI 1766 2551 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211075.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence365 1247 1969 gene locus_tag LOCUS_12500 1247 1969 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978111.1 protein_id gnl|my_center|LOCUS_12500 2017 2922 gene locus_tag LOCUS_12510 2017 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence366 >Feature sequence367 784 614 gene locus_tag LOCUS_12520 784 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1190 801 gene locus_tag LOCUS_12530 1190 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 2247 1915 gene locus_tag LOCUS_12540 2247 1915 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250874.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence368 155 787 gene locus_tag LOCUS_12550 155 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 831 2360 gene locus_tag LOCUS_12560 831 2360 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877491.1 protein_id gnl|my_center|LOCUS_12560 <2963 2409 gene locus_tag LOCUS_12570 <2963 2409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878796.1:transcription initiation factor IIB >Feature sequence369 2408 1167 gene locus_tag LOCUS_12580 2408 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence370 1007 561 gene locus_tag LOCUS_12590 1007 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1334 1089 gene locus_tag LOCUS_12600 1334 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12600 1651 1421 gene locus_tag LOCUS_12610 1651 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1897 1736 gene locus_tag LOCUS_12620 1897 1736 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978144.1 protein_id gnl|my_center|LOCUS_12620 2039 2317 gene locus_tag LOCUS_12630 gene albA 2039 2317 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249515.1 protein_id gnl|my_center|LOCUS_12630 2388 2954 gene locus_tag LOCUS_12640 2388 2954 CDS product transcription elongation factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978145.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence371 <1 515 gene locus_tag LOCUS_12650 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868222.1:orotate phosphoribosyltransferase 601 2574 gene locus_tag LOCUS_12660 601 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence372 1427 2104 gene locus_tag LOCUS_12670 1427 2104 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979556.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence373 220 753 gene locus_tag LOCUS_12680 220 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 747 1868 gene locus_tag LOCUS_12690 747 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence374 <1 509 gene locus_tag LOCUS_12700 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066535.1:DUF2961 domain-containing protein 792 953 gene locus_tag LOCUS_12710 792 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 950 1777 gene locus_tag LOCUS_12720 950 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1905 2327 gene locus_tag LOCUS_12730 1905 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2401 2601 gene locus_tag LOCUS_12740 2401 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 >Feature sequence375 807 1127 gene locus_tag LOCUS_12750 807 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1953 1138 gene locus_tag LOCUS_12760 gene dppA 1953 1138 CDS product D-aminopeptidase DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245814.1 protein_id gnl|my_center|LOCUS_12760 2031 2702 gene locus_tag LOCUS_12770 2031 2702 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249637.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence376 1394 249 gene locus_tag LOCUS_12780 1394 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 2392 1391 gene locus_tag LOCUS_12790 2392 1391 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256753.1 protein_id gnl|my_center|LOCUS_12790 2561 2367 gene locus_tag LOCUS_12800 2561 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence377 866 96 gene locus_tag LOCUS_12810 866 96 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867800.1 protein_id gnl|my_center|LOCUS_12810 1143 859 gene locus_tag LOCUS_12820 1143 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1844 1233 gene locus_tag LOCUS_12830 1844 1233 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762154.1 protein_id gnl|my_center|LOCUS_12830 2355 1855 gene locus_tag LOCUS_12840 2355 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 <2941 2352 gene locus_tag LOCUS_12850 <2941 2352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867440.1:preprotein translocase subunit SecY >Feature sequence378 1401 184 gene locus_tag LOCUS_12860 1401 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 2578 1574 gene locus_tag LOCUS_12870 2578 1574 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870770.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence379 543 665 gene locus_tag LOCUS_12880 543 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1306 1118 gene locus_tag LOCUS_12890 1306 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 2931 1975 gene locus_tag LOCUS_12900 2931 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence380 1409 447 gene locus_tag LOCUS_12910 1409 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1823 1584 gene locus_tag LOCUS_12920 1823 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 2644 2267 gene locus_tag LOCUS_12930 2644 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence381 1742 384 gene locus_tag LOCUS_12940 1742 384 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_12940 2012 2446 gene locus_tag LOCUS_12950 2012 2446 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878568.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence382 >Feature sequence383 500 709 gene locus_tag LOCUS_12960 500 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 2219 762 gene locus_tag LOCUS_12970 2219 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence384 621 1748 gene locus_tag LOCUS_12980 621 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2523 1759 gene locus_tag LOCUS_12990 2523 1759 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922506.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence385 1171 356 gene locus_tag LOCUS_13000 1171 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1327 1806 gene locus_tag LOCUS_13010 1327 1806 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061166.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence386 2262 673 gene locus_tag LOCUS_13020 2262 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence387 39 124 gene locus_tag LOCUS_t00160 39 124 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 699 307 gene locus_tag LOCUS_13030 699 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 2051 702 gene locus_tag LOCUS_13040 2051 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence388 1154 2017 gene locus_tag LOCUS_13050 1154 2017 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082985.1 protein_id gnl|my_center|LOCUS_13050 2010 2867 gene locus_tag LOCUS_13060 2010 2867 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532185.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence389 <1 855 gene locus_tag LOCUS_13070 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877321.1:acetyl-CoA decarbonylase/synthase complex subunit gamma 2297 900 gene locus_tag LOCUS_13080 2297 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 <2905 2395 gene locus_tag LOCUS_13090 <2905 2395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878194.1:ASKHA domain-containing protein >Feature sequence390 884 1003 gene locus_tag LOCUS_13100 884 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 2075 2815 gene locus_tag LOCUS_13110 2075 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence391 >Feature sequence392 2677 776 gene locus_tag LOCUS_13120 2677 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence393 185 262 gene locus_tag LOCUS_t00170 185 262 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 501 713 gene locus_tag LOCUS_13130 501 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1068 1235 gene locus_tag LOCUS_13140 1068 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 2517 1690 gene locus_tag LOCUS_13150 2517 1690 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876218.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence394 985 53 gene locus_tag LOCUS_13160 985 53 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_13160 1389 2330 gene locus_tag LOCUS_13170 1389 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence395 587 99 gene locus_tag LOCUS_13180 587 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 865 1515 gene locus_tag LOCUS_13190 865 1515 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319832.1 protein_id gnl|my_center|LOCUS_13190 1585 2136 gene locus_tag LOCUS_13200 1585 2136 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546732.1 protein_id gnl|my_center|LOCUS_13200 2701 2141 gene locus_tag LOCUS_13210 2701 2141 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877414.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence396 <1 556 gene locus_tag LOCUS_13220 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876722.1:UbiA family prenyltransferase 942 736 gene locus_tag LOCUS_13230 942 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1061 930 gene locus_tag LOCUS_13240 1061 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1456 2094 gene locus_tag LOCUS_13250 1456 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762167.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence397 1046 765 gene locus_tag LOCUS_13260 1046 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1146 1625 gene locus_tag LOCUS_13270 1146 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2226 1606 gene locus_tag LOCUS_13280 2226 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence398 116 2269 gene locus_tag LOCUS_13290 116 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 <2890 2372 gene locus_tag LOCUS_13300 <2890 2372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001072162.1:Fic family protein >Feature sequence399 252 1124 gene locus_tag LOCUS_13310 252 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 >Feature sequence400 194 9 gene locus_tag LOCUS_13320 194 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 223 555 gene locus_tag LOCUS_13330 223 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 875 543 gene locus_tag LOCUS_13340 875 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 1768 998 gene locus_tag LOCUS_13350 1768 998 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867800.1 protein_id gnl|my_center|LOCUS_13350 2045 1761 gene locus_tag LOCUS_13360 2045 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13360 2748 2149 gene locus_tag LOCUS_13370 2748 2149 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762154.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence401 <1 666 gene locus_tag LOCUS_13380 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272458.1:calcium-transporting P-type ATPase, PMR1-type 1966 707 gene locus_tag LOCUS_13390 gene larA 1966 707 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438088.1 protein_id gnl|my_center|LOCUS_13390 2028 2723 gene locus_tag LOCUS_13400 gene deoC 2028 2723 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_13400 2885 2709 gene locus_tag LOCUS_13410 2885 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence402 825 211 gene locus_tag LOCUS_13420 825 211 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 protein_id gnl|my_center|LOCUS_13420 1905 1555 gene locus_tag LOCUS_13430 1905 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 >Feature sequence403 1985 324 gene locus_tag LOCUS_13440 1985 324 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869775.1 protein_id gnl|my_center|LOCUS_13440 2081 2740 gene locus_tag LOCUS_13450 2081 2740 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867788.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence404 1100 21 gene locus_tag LOCUS_13460 gene trm5b 1100 21 CDS product tRNA (guanine(37)-N1)-methyltransferase Trm5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867861.1 protein_id gnl|my_center|LOCUS_13460 2129 1125 gene locus_tag LOCUS_13470 2129 1125 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140504.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence405 1068 394 gene locus_tag LOCUS_13480 1068 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1865 1671 gene locus_tag LOCUS_13490 1865 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence406 1701 1279 gene locus_tag LOCUS_13500 1701 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1781 1936 gene locus_tag LOCUS_13510 1781 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1982 2113 gene locus_tag LOCUS_13520 1982 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 2143 2349 gene locus_tag LOCUS_13530 2143 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 2330 2461 gene locus_tag LOCUS_13540 2330 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 >Feature sequence407 924 70 gene locus_tag LOCUS_13550 924 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13550 1768 902 gene locus_tag LOCUS_13560 1768 902 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867495.1 protein_id gnl|my_center|LOCUS_13560 2578 1775 gene locus_tag LOCUS_13570 2578 1775 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392229.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence408 1476 898 gene locus_tag LOCUS_13580 gene trmY 1476 898 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871164.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence409 112 339 gene locus_tag LOCUS_13590 112 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 515 1267 gene locus_tag LOCUS_13600 515 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1269 2747 gene locus_tag LOCUS_13610 1269 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 >Feature sequence410 <1 798 gene locus_tag LOCUS_13620 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146489.1:ORC1-type DNA replication protein 795 1130 gene locus_tag LOCUS_13630 795 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1168 1365 gene locus_tag LOCUS_13640 1168 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 2568 1510 gene locus_tag LOCUS_13650 2568 1510 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence411 <1 1011 gene locus_tag LOCUS_13660 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867591.1:translation initiation factor IF-2 subunit gamma 2544 1027 gene locus_tag LOCUS_13670 2544 1027 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868688.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence412 1006 743 gene locus_tag LOCUS_13680 1006 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1227 1003 gene locus_tag LOCUS_13690 1227 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1396 1989 gene locus_tag LOCUS_13700 1396 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 2563 1949 gene locus_tag LOCUS_13710 2563 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence413 <2847 311 gene locus_tag LOCUS_13720 <2847 311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158298054.1:Eco57I restriction-modification methylase domain-containing protein >Feature sequence414 2188 1223 gene locus_tag LOCUS_13730 2188 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence415 <1 1322 gene locus_tag LOCUS_13740 <1 1322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763469.1:acetyl ornithine aminotransferase family protein 1616 1338 gene locus_tag LOCUS_13750 1616 1338 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978937.1 protein_id gnl|my_center|LOCUS_13750 1704 1904 gene locus_tag LOCUS_13760 1704 1904 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012981369.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence416 655 1521 gene locus_tag LOCUS_13770 655 1521 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496786.1 protein_id gnl|my_center|LOCUS_13770 2180 1566 gene locus_tag LOCUS_13780 gene psmB 2180 1566 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762506.1 protein_id gnl|my_center|LOCUS_13780 2619 2263 gene locus_tag LOCUS_13790 2619 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence417 359 48 gene locus_tag LOCUS_13800 gene rpsJ 359 48 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878438.1 protein_id gnl|my_center|LOCUS_13800 499 1053 gene locus_tag LOCUS_13810 499 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1050 1556 gene locus_tag LOCUS_13820 1050 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 2713 1553 gene locus_tag LOCUS_13830 gene blt 2713 1553 CDS product multidrug efflux MFS transporter Blt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229880.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence418 1163 555 gene locus_tag LOCUS_13840 1163 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 2131 1232 gene locus_tag LOCUS_13850 2131 1232 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319540.1 protein_id gnl|my_center|LOCUS_13850 <2834 2121 gene locus_tag LOCUS_13860 <2834 2121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876042.1:formylmethanofuran--tetrahydromethanopterin N-formyltransferase >Feature sequence419 620 1039 gene locus_tag LOCUS_13870 620 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1223 1507 gene locus_tag LOCUS_13880 1223 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1504 1755 gene locus_tag LOCUS_13890 1504 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1783 2076 gene locus_tag LOCUS_13900 1783 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence420 181 1623 gene locus_tag LOCUS_13910 181 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence421 655 732 gene locus_tag LOCUS_t00180 655 732 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2784 1267 gene locus_tag LOCUS_13920 2784 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence422 1814 747 gene locus_tag LOCUS_13930 1814 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 2209 1868 gene locus_tag LOCUS_13940 2209 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence423 1548 2492 gene locus_tag LOCUS_13950 1548 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 >Feature sequence424 >Feature sequence425 305 493 gene locus_tag LOCUS_13960 305 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 493 1158 gene locus_tag LOCUS_13970 493 1158 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868780.1 protein_id gnl|my_center|LOCUS_13970 1892 1152 gene locus_tag LOCUS_13980 1892 1152 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978306.1 protein_id gnl|my_center|LOCUS_13980 2022 2690 gene locus_tag LOCUS_13990 gene psmB 2022 2690 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094873.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence426 2799 1378 gene locus_tag LOCUS_14000 2799 1378 CDS product ADP-dependent glucokinase/phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023476.1 protein_id gnl|my_center|LOCUS_14000 >Feature sequence427 <1 951 gene locus_tag LOCUS_14010 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001207525.1:pyrimidine-specific ribonucleoside hydrolase RihA 954 1715 gene locus_tag LOCUS_14020 gene udp 954 1715 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250430.1 protein_id gnl|my_center|LOCUS_14020 2138 1962 gene locus_tag LOCUS_14030 2138 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 >Feature sequence428 988 416 gene locus_tag LOCUS_14040 988 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 1807 1202 gene locus_tag LOCUS_14050 1807 1202 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763591.1 protein_id gnl|my_center|LOCUS_14050 2260 1808 gene locus_tag LOCUS_14060 2260 1808 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867445.1 protein_id gnl|my_center|LOCUS_14060 2700 2272 gene locus_tag LOCUS_14070 2700 2272 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867446.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence429 989 1993 gene locus_tag LOCUS_14080 989 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence430 401 2095 gene locus_tag LOCUS_14090 401 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 2621 2307 gene locus_tag LOCUS_14100 2621 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence431 326 490 gene locus_tag LOCUS_14110 326 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 583 1161 gene locus_tag LOCUS_14120 583 1161 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867500.1 protein_id gnl|my_center|LOCUS_14120 1209 2111 gene locus_tag LOCUS_14130 gene rsmA 1209 2111 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990848.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence432 908 699 gene locus_tag LOCUS_14140 908 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1770 931 gene locus_tag LOCUS_14150 1770 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence433 >Feature sequence434 837 61 gene locus_tag LOCUS_14160 837 61 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403106.1 protein_id gnl|my_center|LOCUS_14160 2323 1208 gene locus_tag LOCUS_14170 2323 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 2760 2320 gene locus_tag LOCUS_14180 2760 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence435 1717 1887 gene locus_tag LOCUS_14190 1717 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 2449 1994 gene locus_tag LOCUS_14200 2449 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 2681 2424 gene locus_tag LOCUS_14210 2681 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence436 <1 531 gene locus_tag LOCUS_14220 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249523.1:tyrosine--tRNA ligase 766 1128 gene locus_tag LOCUS_14230 766 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14230 1197 1496 gene locus_tag LOCUS_14240 1197 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14240 >Feature sequence437 2480 153 gene locus_tag LOCUS_14250 2480 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence438 <1 899 gene locus_tag LOCUS_14260 <1 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902924.1:GTPase HflX 859 1404 gene locus_tag LOCUS_14270 859 1404 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061280.1 protein_id gnl|my_center|LOCUS_14270 1475 1981 gene locus_tag LOCUS_14280 gene tfe 1475 1981 CDS product transcription factor E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250974.1 protein_id gnl|my_center|LOCUS_14280 1978 2517 gene locus_tag LOCUS_14290 1978 2517 CDS product TIGR00295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870283.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence439 <1 1116 gene locus_tag LOCUS_14300 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392408.1:LL-diaminopimelate aminotransferase 1181 2572 gene locus_tag LOCUS_14310 1181 2572 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924859.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence440 447 836 gene locus_tag LOCUS_14320 447 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1366 1217 gene locus_tag LOCUS_14330 1366 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 2285 1548 gene locus_tag LOCUS_14340 gene pyrF 2285 1548 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496436.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence441 1019 2242 gene locus_tag LOCUS_14350 1019 2242 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence442 290 102 gene locus_tag LOCUS_14360 290 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1214 297 gene locus_tag LOCUS_14370 1214 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 2776 1217 gene locus_tag LOCUS_14380 2776 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence443 867 358 gene locus_tag LOCUS_14390 867 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 2548 878 gene locus_tag LOCUS_14400 2548 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence444 1170 229 gene locus_tag LOCUS_14410 1170 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence445 38 220 gene locus_tag LOCUS_14420 38 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 2042 369 gene locus_tag LOCUS_14430 2042 369 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 protein_id gnl|my_center|LOCUS_14430 2441 2653 gene locus_tag LOCUS_14440 2441 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence446 <1 1883 gene locus_tag LOCUS_14450 <1 1883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878757.1:FAD-dependent oxidoreductase 2651 1890 gene locus_tag LOCUS_14460 2651 1890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065164.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence447 >Feature sequence448 258 530 gene locus_tag LOCUS_14470 258 530 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439843.1 protein_id gnl|my_center|LOCUS_14470 1429 992 gene locus_tag LOCUS_14480 1429 992 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978777.1 protein_id gnl|my_center|LOCUS_14480 1643 1395 gene locus_tag LOCUS_14490 1643 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 2359 1841 gene locus_tag LOCUS_14500 2359 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 >Feature sequence449 31 447 gene locus_tag LOCUS_14510 31 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 444 566 gene locus_tag LOCUS_14520 444 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 944 1216 gene locus_tag LOCUS_14530 944 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 1217 2248 gene locus_tag LOCUS_14540 1217 2248 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496549.1 protein_id gnl|my_center|LOCUS_14540 2497 2421 gene locus_tag LOCUS_t00190 2497 2421 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence450 881 30 gene locus_tag LOCUS_14550 gene dapF 881 30 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768322.1 protein_id gnl|my_center|LOCUS_14550 975 2393 gene locus_tag LOCUS_14560 975 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence451 634 113 gene locus_tag LOCUS_14570 634 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 687 854 gene locus_tag LOCUS_14580 687 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1708 1241 gene locus_tag LOCUS_14590 1708 1241 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846620.1 protein_id gnl|my_center|LOCUS_14590 1899 1669 gene locus_tag LOCUS_14600 1899 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2471 2190 gene locus_tag LOCUS_14610 2471 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 >Feature sequence452 366 2558 gene locus_tag LOCUS_14620 366 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence453 <1 897 gene locus_tag LOCUS_14630 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010917973.1:lysine--tRNA ligase 967 2001 gene locus_tag LOCUS_14640 gene rtcA 967 2001 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762505.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence454 595 122 gene locus_tag LOCUS_14650 595 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1716 643 gene locus_tag LOCUS_14660 1716 643 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404219.1 protein_id gnl|my_center|LOCUS_14660 <2754 1728 gene locus_tag LOCUS_14670 <2754 1728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250726.1:ABC transporter ATP-binding protein >Feature sequence455 763 254 gene locus_tag LOCUS_14680 763 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 1120 2310 gene locus_tag LOCUS_14690 1120 2310 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence456 94 1086 gene locus_tag LOCUS_14700 94 1086 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966670.1 protein_id gnl|my_center|LOCUS_14700 1168 2217 gene locus_tag LOCUS_14710 1168 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 2514 2735 gene locus_tag LOCUS_14720 2514 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence457 330 151 gene locus_tag LOCUS_14730 330 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 582 911 gene locus_tag LOCUS_14740 582 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1551 1697 gene locus_tag LOCUS_14750 1551 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 2507 1920 gene locus_tag LOCUS_14760 2507 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence458 1059 550 gene locus_tag LOCUS_14770 1059 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2133 1102 gene locus_tag LOCUS_14780 gene amrS 2133 1102 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879767.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence459 2443 1319 gene locus_tag LOCUS_14790 2443 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence460 1623 421 gene locus_tag LOCUS_14800 1623 421 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 protein_id gnl|my_center|LOCUS_14800 2422 1616 gene locus_tag LOCUS_14810 2422 1616 CDS product [LysW]-aminoadipate/[LysW]-glutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978133.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence461 2339 327 gene locus_tag LOCUS_14820 2339 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 2608 2342 gene locus_tag LOCUS_14830 2608 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence462 759 971 gene locus_tag LOCUS_14840 759 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 1260 1685 gene locus_tag LOCUS_14850 1260 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 2338 2493 gene locus_tag LOCUS_14860 2338 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence463 350 126 gene locus_tag LOCUS_14870 350 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 532 693 gene locus_tag LOCUS_14880 532 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 781 2421 gene locus_tag LOCUS_14890 781 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence464 672 484 gene locus_tag LOCUS_14900 672 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence465 1079 591 gene locus_tag LOCUS_14910 1079 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1117 1539 gene locus_tag LOCUS_14920 1117 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence466 472 729 gene locus_tag LOCUS_14930 472 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1901 1026 gene locus_tag LOCUS_14940 1901 1026 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879714.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence467 1609 401 gene locus_tag LOCUS_14950 1609 401 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256214.1 protein_id gnl|my_center|LOCUS_14950 2055 1771 gene locus_tag LOCUS_14960 2055 1771 CDS product 30S ribosomal protein S26e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762572.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence468 1447 731 gene locus_tag LOCUS_14970 1447 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 2717 2268 gene locus_tag LOCUS_14980 2717 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence469 135 281 gene locus_tag LOCUS_14990 135 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 260 403 gene locus_tag LOCUS_15000 260 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence470 188 487 gene locus_tag LOCUS_15010 188 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 484 1371 gene locus_tag LOCUS_15020 484 1371 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980408.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence471 1874 195 gene locus_tag LOCUS_15030 1874 195 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819869.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence472 <1 527 gene locus_tag LOCUS_15040 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979256.1:cell division protein CdvB1/B2 695 1078 gene locus_tag LOCUS_15050 695 1078 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081748.1 protein_id gnl|my_center|LOCUS_15050 2244 1222 gene locus_tag LOCUS_15060 2244 1222 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence473 479 658 gene locus_tag LOCUS_15070 479 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 701 985 gene locus_tag LOCUS_15080 701 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 972 1286 gene locus_tag LOCUS_15090 972 1286 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146633.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence474 78 1091 gene locus_tag LOCUS_15100 78 1091 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762492.1 protein_id gnl|my_center|LOCUS_15100 1150 1713 gene locus_tag LOCUS_15110 1150 1713 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146494.1 protein_id gnl|my_center|LOCUS_15110 <2707 1720 gene locus_tag LOCUS_15120 <2707 1720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930557.1:endopeptidase La >Feature sequence475 145 657 gene locus_tag LOCUS_15130 145 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 1677 694 gene locus_tag LOCUS_15140 1677 694 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence476 6 1040 gene locus_tag LOCUS_15150 6 1040 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024146.1 protein_id gnl|my_center|LOCUS_15150 1424 1044 gene locus_tag LOCUS_15160 1424 1044 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081563.1 protein_id gnl|my_center|LOCUS_15160 2244 1447 gene locus_tag LOCUS_15170 2244 1447 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919263.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence477 2604 472 gene locus_tag LOCUS_15180 2604 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence478 <1 886 gene locus_tag LOCUS_15190 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392001.1:adenine deaminase 1207 2175 gene locus_tag LOCUS_15200 1207 2175 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence479 1648 434 gene locus_tag LOCUS_15210 1648 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 >Feature sequence480 1438 614 gene locus_tag LOCUS_15220 1438 614 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370925.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence481 2407 1562 gene locus_tag LOCUS_15230 2407 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence482 318 887 gene locus_tag LOCUS_15240 318 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1863 880 gene locus_tag LOCUS_15250 1863 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 2300 1941 gene locus_tag LOCUS_15260 2300 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence483 <1 984 gene locus_tag LOCUS_15270 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250059.1:phosphoglucosamine mutase 1259 1017 gene locus_tag LOCUS_15280 1259 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 >Feature sequence484 791 150 gene locus_tag LOCUS_15290 791 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 2046 1090 gene locus_tag LOCUS_15300 2046 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 2306 2043 gene locus_tag LOCUS_15310 2306 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence485 69 1091 gene locus_tag LOCUS_15320 69 1091 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_15320 1137 1802 gene locus_tag LOCUS_15330 1137 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 2469 1921 gene locus_tag LOCUS_15340 2469 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15340 >Feature sequence486 950 135 gene locus_tag LOCUS_15350 950 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 2029 1019 gene locus_tag LOCUS_15360 2029 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence487 121 897 gene locus_tag LOCUS_15370 121 897 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_15370 898 1710 gene locus_tag LOCUS_15380 898 1710 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_15380 1837 1712 gene locus_tag LOCUS_15390 1837 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 2106 2633 gene locus_tag LOCUS_15400 2106 2633 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048408.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence488 >Feature sequence489 1079 642 gene locus_tag LOCUS_15410 1079 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 2686 1316 gene locus_tag LOCUS_15420 2686 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence490 <1 749 gene locus_tag LOCUS_15430 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868207.1:bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase 1860 823 gene locus_tag LOCUS_15440 1860 823 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_15440 2489 1905 gene locus_tag LOCUS_15450 gene trmY 2489 1905 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871164.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence491 <1 750 gene locus_tag LOCUS_15460 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931048.1:ABC transporter ATP-binding protein 753 1988 gene locus_tag LOCUS_15470 753 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454709.1 protein_id gnl|my_center|LOCUS_15470 2459 1998 gene locus_tag LOCUS_15480 2459 1998 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258944.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence492 279 1016 gene locus_tag LOCUS_15490 279 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1306 1034 gene locus_tag LOCUS_15500 1306 1034 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_15500 1425 2099 gene locus_tag LOCUS_15510 gene rpe 1425 2099 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431138.1 protein_id gnl|my_center|LOCUS_15510 2389 2096 gene locus_tag LOCUS_15520 gene gatB 2389 2096 CDS product PTS galactitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823270.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence493 160 29 gene locus_tag LOCUS_15530 160 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 522 166 gene locus_tag LOCUS_15540 522 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 838 515 gene locus_tag LOCUS_15550 838 515 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869727.1 protein_id gnl|my_center|LOCUS_15550 <2683 1266 gene locus_tag LOCUS_15560 <2683 1266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000575935.1:beta-galactosidase >Feature sequence494 510 352 gene locus_tag LOCUS_15570 510 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 607 1506 gene locus_tag LOCUS_15580 607 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 2332 2117 gene locus_tag LOCUS_15590 2332 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence495 <1 1344 gene locus_tag LOCUS_15600 <1 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_202319085.1:aldehyde ferredoxin oxidoreductase family protein >Feature sequence496 806 1993 gene locus_tag LOCUS_15610 806 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence497 1597 863 gene locus_tag LOCUS_15620 1597 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1720 2010 gene locus_tag LOCUS_15630 1720 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence498 45 596 gene locus_tag LOCUS_15640 45 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 593 1969 gene locus_tag LOCUS_15650 593 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence499 990 2006 gene locus_tag LOCUS_15660 990 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2009 2608 gene locus_tag LOCUS_15670 2009 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence500 48 122 gene locus_tag LOCUS_t00200 48 122 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 481 311 gene locus_tag LOCUS_15680 481 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 676 996 gene locus_tag LOCUS_15690 676 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1003 1323 gene locus_tag LOCUS_15700 1003 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 1333 2154 gene locus_tag LOCUS_15710 1333 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 2147 2497 gene locus_tag LOCUS_15720 2147 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence501 533 676 gene locus_tag LOCUS_15730 533 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 757 915 gene locus_tag LOCUS_15740 757 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1601 1227 gene locus_tag LOCUS_15750 1601 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1891 2073 gene locus_tag LOCUS_15760 1891 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 2487 2311 gene locus_tag LOCUS_15770 2487 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence502 325 1287 gene locus_tag LOCUS_15780 325 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 2099 1299 gene locus_tag LOCUS_15790 2099 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 2623 2168 gene locus_tag LOCUS_15800 2623 2168 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250731.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence503 66 1364 gene locus_tag LOCUS_15810 gene tuf 66 1364 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978219.1 protein_id gnl|my_center|LOCUS_15810 1541 2101 gene locus_tag LOCUS_15820 gene pyrH 1541 2101 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223864.1 protein_id gnl|my_center|LOCUS_15820 2618 2277 gene locus_tag LOCUS_15830 2618 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence504 834 634 gene locus_tag LOCUS_15840 834 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 2038 1706 gene locus_tag LOCUS_15850 2038 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 2297 2157 gene locus_tag LOCUS_15860 2297 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence505 2 925 gene locus_tag LOCUS_15870 2 925 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146595.1 protein_id gnl|my_center|LOCUS_15870 903 1730 gene locus_tag LOCUS_15880 903 1730 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870966.1 protein_id gnl|my_center|LOCUS_15880 <2664 1781 gene locus_tag LOCUS_15890 <2664 1781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258550.1:isoleucine--tRNA ligase >Feature sequence506 489 2291 gene locus_tag LOCUS_15900 489 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence507 <1 801 gene locus_tag LOCUS_15910 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250915.1:fumarate hydratase 801 1403 gene locus_tag LOCUS_15920 801 1403 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240327.1 protein_id gnl|my_center|LOCUS_15920 1654 1337 gene locus_tag LOCUS_15930 1654 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 >Feature sequence508 758 312 gene locus_tag LOCUS_15940 758 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1504 755 gene locus_tag LOCUS_15950 1504 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1698 2438 gene locus_tag LOCUS_15960 1698 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence509 322 119 gene locus_tag LOCUS_15970 322 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 637 431 gene locus_tag LOCUS_15980 637 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 718 879 gene locus_tag LOCUS_15990 718 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 1141 1956 gene locus_tag LOCUS_16000 1141 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence510 561 7 gene locus_tag LOCUS_16010 561 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762862.1 protein_id gnl|my_center|LOCUS_16010 2350 563 gene locus_tag LOCUS_16020 2350 563 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762861.1 protein_id gnl|my_center|LOCUS_16020 >Feature sequence511 769 221 gene locus_tag LOCUS_16030 769 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 2456 1071 gene locus_tag LOCUS_16040 2456 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence512 878 138 gene locus_tag LOCUS_16050 878 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 2127 955 gene locus_tag LOCUS_16060 2127 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence513 2279 1674 gene locus_tag LOCUS_16070 gene tmk 2279 1674 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence514 832 224 gene locus_tag LOCUS_16080 gene rrmJ 832 224 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870893.1 protein_id gnl|my_center|LOCUS_16080 1210 833 gene locus_tag LOCUS_16090 1210 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1327 2334 gene locus_tag LOCUS_16100 1327 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16100 >Feature sequence515 968 1867 gene locus_tag LOCUS_16110 gene map 968 1867 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870846.1 protein_id gnl|my_center|LOCUS_16110 2281 1883 gene locus_tag LOCUS_16120 2281 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence516 707 1630 gene locus_tag LOCUS_16130 707 1630 CDS product NADP-dependent methylenetetrahydromethanopterin/methylenetetrahydrofolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122705.1 protein_id gnl|my_center|LOCUS_16130 2280 1657 gene locus_tag LOCUS_16140 2280 1657 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870563.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence517 211 696 gene locus_tag LOCUS_16150 211 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1690 1490 gene locus_tag LOCUS_16160 1690 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence518 1435 1986 gene locus_tag LOCUS_16170 1435 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 2066 2296 gene locus_tag LOCUS_16180 2066 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 2306 2527 gene locus_tag LOCUS_16190 2306 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence519 <1 1445 gene locus_tag LOCUS_16200 <1 1445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530690.1:sulfatase 1884 2402 gene locus_tag LOCUS_16210 1884 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 >Feature sequence520 1743 658 gene locus_tag LOCUS_16220 1743 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876041.1 protein_id gnl|my_center|LOCUS_16220 <2637 1740 gene locus_tag LOCUS_16230 <2637 1740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868755.1:phosphoribosylamine--glycine ligase >Feature sequence521 503 700 gene locus_tag LOCUS_16240 503 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1798 752 gene locus_tag LOCUS_16250 1798 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1973 1812 gene locus_tag LOCUS_16260 1973 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 >Feature sequence522 1398 1249 gene locus_tag LOCUS_16270 1398 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1832 1425 gene locus_tag LOCUS_16280 1832 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 2571 1852 gene locus_tag LOCUS_16290 2571 1852 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064392.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence523 293 604 gene locus_tag LOCUS_16300 293 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1023 2129 gene locus_tag LOCUS_16310 1023 2129 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence524 <1 991 gene locus_tag LOCUS_16320 <1 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876932.1:diphthamide biosynthesis enzyme Dph2 1689 997 gene locus_tag LOCUS_16330 gene rpiA 1689 997 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021687.1 protein_id gnl|my_center|LOCUS_16330 2415 1690 gene locus_tag LOCUS_16340 2415 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence525 362 435 gene locus_tag LOCUS_t00210 362 435 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1392 442 gene locus_tag LOCUS_16350 gene sppA 1392 442 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870156.1 protein_id gnl|my_center|LOCUS_16350 1867 1508 gene locus_tag LOCUS_16360 1867 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16360 >Feature sequence526 804 1469 gene locus_tag LOCUS_16370 804 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762167.1 protein_id gnl|my_center|LOCUS_16370 <2625 1466 gene locus_tag LOCUS_16380 <2625 1466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868093.1:proline--tRNA ligase >Feature sequence527 1311 304 gene locus_tag LOCUS_16390 1311 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1979 1308 gene locus_tag LOCUS_16400 1979 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 2398 2066 gene locus_tag LOCUS_16410 2398 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence528 898 1092 gene locus_tag LOCUS_16420 898 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1139 2335 gene locus_tag LOCUS_16430 1139 2335 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876814.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence529 497 2338 gene locus_tag LOCUS_16440 497 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence530 614 2101 gene locus_tag LOCUS_16450 614 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2526 2113 gene locus_tag LOCUS_16460 gene nikR 2526 2113 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868557.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence531 1080 34 gene locus_tag LOCUS_16470 1080 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1311 1736 gene locus_tag LOCUS_16480 1311 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence532 837 1514 gene locus_tag LOCUS_16490 837 1514 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979556.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence533 1190 99 gene locus_tag LOCUS_16500 1190 99 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250726.1 protein_id gnl|my_center|LOCUS_16500 2286 1183 gene locus_tag LOCUS_16510 2286 1183 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867147.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence534 1401 2198 gene locus_tag LOCUS_16520 1401 2198 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250846.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence535 993 820 gene locus_tag LOCUS_16530 993 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1108 1875 gene locus_tag LOCUS_16540 1108 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence536 623 231 gene locus_tag LOCUS_16550 623 231 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867889.1 protein_id gnl|my_center|LOCUS_16550 768 1610 gene locus_tag LOCUS_16560 768 1610 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876505.1 protein_id gnl|my_center|LOCUS_16560 1612 2214 gene locus_tag LOCUS_16570 1612 2214 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496839.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence537 354 638 gene locus_tag LOCUS_16580 354 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 763 1857 gene locus_tag LOCUS_16590 763 1857 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876639.1 protein_id gnl|my_center|LOCUS_16590 1905 2102 gene locus_tag LOCUS_16600 1905 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence538 646 452 gene locus_tag LOCUS_16610 646 452 CDS product DUF6485 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584058.1 protein_id gnl|my_center|LOCUS_16610 744 1187 gene locus_tag LOCUS_16620 744 1187 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867653.1 protein_id gnl|my_center|LOCUS_16620 1582 1184 gene locus_tag LOCUS_16630 1582 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 1661 2446 gene locus_tag LOCUS_16640 1661 2446 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337312.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence539 655 158 gene locus_tag LOCUS_16650 655 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2082 652 gene locus_tag LOCUS_16660 gene secY 2082 652 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867440.1 protein_id gnl|my_center|LOCUS_16660 2552 2124 gene locus_tag LOCUS_16670 2552 2124 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869978.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence540 178 1167 gene locus_tag LOCUS_16680 178 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 1358 1164 gene locus_tag LOCUS_16690 1358 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1722 1363 gene locus_tag LOCUS_16700 1722 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence541 <1 580 gene locus_tag LOCUS_16710 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877481.1:CoB--CoM heterodisulfide reductase subunit B >Feature sequence542 1805 1080 gene locus_tag LOCUS_16720 1805 1080 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251231.1 protein_id gnl|my_center|LOCUS_16720 1893 2513 gene locus_tag LOCUS_16730 1893 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence543 154 441 gene locus_tag LOCUS_16740 154 441 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249742.1 protein_id gnl|my_center|LOCUS_16740 1323 979 gene locus_tag LOCUS_16750 1323 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1537 1304 gene locus_tag LOCUS_16760 1537 1304 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_16760 1969 2127 gene locus_tag LOCUS_16770 1969 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2197 2463 gene locus_tag LOCUS_16780 2197 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence544 1341 577 gene locus_tag LOCUS_16790 1341 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 <2578 1416 gene locus_tag LOCUS_16800 <2578 1416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867870.1:threonine synthase >Feature sequence545 58 507 gene locus_tag LOCUS_16810 58 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 815 504 gene locus_tag LOCUS_16820 815 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1178 936 gene locus_tag LOCUS_16830 1178 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 1510 1295 gene locus_tag LOCUS_16840 1510 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2074 1619 gene locus_tag LOCUS_16850 2074 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 2279 2043 gene locus_tag LOCUS_16860 2279 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence546 <1 2076 gene locus_tag LOCUS_16870 <1 2076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868544.1:DNA topoisomerase I 2073 2297 gene locus_tag LOCUS_16880 2073 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence547 32 1075 gene locus_tag LOCUS_16890 32 1075 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978901.1 protein_id gnl|my_center|LOCUS_16890 1136 1858 gene locus_tag LOCUS_16900 1136 1858 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064452.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence548 <2572 1520 gene locus_tag LOCUS_16910 <2572 1520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146565.1:ATP-NAD kinase family protein >Feature sequence549 2178 2417 gene locus_tag LOCUS_16920 2178 2417 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence550 671 1348 gene locus_tag LOCUS_16930 671 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762167.1 protein_id gnl|my_center|LOCUS_16930 1839 1390 gene locus_tag LOCUS_16940 1839 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 2480 2187 gene locus_tag LOCUS_16950 2480 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 >Feature sequence551 186 261 gene locus_tag LOCUS_t00220 186 261 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 379 1332 gene locus_tag LOCUS_16960 gene rbsK 379 1332 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419503.1 protein_id gnl|my_center|LOCUS_16960 1334 2206 gene locus_tag LOCUS_16970 1334 2206 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496898.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence552 2163 1480 gene locus_tag LOCUS_16980 2163 1480 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583200.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence553 495 148 gene locus_tag LOCUS_16990 495 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 927 1148 gene locus_tag LOCUS_17000 927 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 1150 1413 gene locus_tag LOCUS_17010 1150 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1414 1728 gene locus_tag LOCUS_17020 1414 1728 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146633.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence554 2213 2091 gene locus_tag LOCUS_17030 2213 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence555 134 889 gene locus_tag LOCUS_17040 134 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 867 1916 gene locus_tag LOCUS_17050 867 1916 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250399.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence556 1398 112 gene locus_tag LOCUS_17060 1398 112 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877197.1 protein_id gnl|my_center|LOCUS_17060 1897 1478 gene locus_tag LOCUS_17070 1897 1478 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582732.1 protein_id gnl|my_center|LOCUS_17070 1967 2089 gene locus_tag LOCUS_17080 1967 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence557 <1 1003 gene locus_tag LOCUS_17090 <1 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010865314.1:ABC transporter ATP-binding protein >Feature sequence558 731 1759 gene locus_tag LOCUS_17100 731 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence559 961 401 gene locus_tag LOCUS_17110 961 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence560 960 298 gene locus_tag LOCUS_17120 960 298 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762102.1 protein_id gnl|my_center|LOCUS_17120 1408 986 gene locus_tag LOCUS_17130 1408 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1498 1821 gene locus_tag LOCUS_17140 1498 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 1829 2158 gene locus_tag LOCUS_17150 1829 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 2435 2361 gene locus_tag LOCUS_t00230 2435 2361 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence561 1869 754 gene locus_tag LOCUS_17160 1869 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 2051 1866 gene locus_tag LOCUS_17170 2051 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence562 >Feature sequence563 439 897 gene locus_tag LOCUS_17180 439 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17180 1055 2491 gene locus_tag LOCUS_17190 1055 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence564 1963 353 gene locus_tag LOCUS_17200 1963 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence565 468 1391 gene locus_tag LOCUS_17210 468 1391 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403526.1 protein_id gnl|my_center|LOCUS_17210 <2534 1395 gene locus_tag LOCUS_17220 <2534 1395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257229.1:sulfatase >Feature sequence566 >Feature sequence567 >Feature sequence568 869 588 gene locus_tag LOCUS_17230 869 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 983 1774 gene locus_tag LOCUS_17240 983 1774 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867222.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence569 944 150 gene locus_tag LOCUS_17250 944 150 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875687.1 protein_id gnl|my_center|LOCUS_17250 1917 934 gene locus_tag LOCUS_17260 1917 934 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867665.1 protein_id gnl|my_center|LOCUS_17260 <2522 2005 gene locus_tag LOCUS_17270 <2522 2005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980137.1:30S ribosomal protein S2 >Feature sequence570 735 911 gene locus_tag LOCUS_17280 735 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 1109 1588 gene locus_tag LOCUS_17290 1109 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1645 1917 gene locus_tag LOCUS_17300 1645 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 2006 2125 gene locus_tag LOCUS_17310 2006 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence571 1000 401 gene locus_tag LOCUS_17320 1000 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 2024 1197 gene locus_tag LOCUS_17330 2024 1197 CDS product LAGLIDADG family homing endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011011400.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence572 1140 469 gene locus_tag LOCUS_17340 1140 469 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868261.1 protein_id gnl|my_center|LOCUS_17340 2501 1137 gene locus_tag LOCUS_17350 2501 1137 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846351.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence573 <1 553 gene locus_tag LOCUS_17360 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957539.1:polyprenyl synthetase family protein >Feature sequence574 >Feature sequence575 <1 1125 gene locus_tag LOCUS_17370 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250853.1:DNA-directed DNA polymerase II small subunit 2370 1129 gene locus_tag LOCUS_17380 2370 1129 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250852.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence576 >Feature sequence577 218 1015 gene locus_tag LOCUS_17390 218 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1100 1771 gene locus_tag LOCUS_17400 1100 1771 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868780.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence578 1184 960 gene locus_tag LOCUS_17410 1184 960 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980138.1 protein_id gnl|my_center|LOCUS_17410 1616 1209 gene locus_tag LOCUS_17420 1616 1209 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 protein_id gnl|my_center|LOCUS_17420 2053 1619 gene locus_tag LOCUS_17430 gene rplM 2053 1619 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250452.1 protein_id gnl|my_center|LOCUS_17430 2436 2068 gene locus_tag LOCUS_17440 2436 2068 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869688.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence579 1396 335 gene locus_tag LOCUS_17450 1396 335 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163820.1 protein_id gnl|my_center|LOCUS_17450 1546 1950 gene locus_tag LOCUS_17460 1546 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17460 >Feature sequence580 <1 549 gene locus_tag LOCUS_17470 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816883.1:ATP-dependent protease LonB 1119 556 gene locus_tag LOCUS_17480 1119 556 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146494.1 protein_id gnl|my_center|LOCUS_17480 2192 1179 gene locus_tag LOCUS_17490 2192 1179 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762492.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence581 <2502 1481 gene locus_tag LOCUS_17500 <2502 1481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015646101.1:zinc-binding dehydrogenase