>Feature sequence001 2366 111 gene locus_tag LOCUS_00010 2366 111 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228863.1 protein_id gnl|my_center|LOCUS_00010 2472 3428 gene locus_tag LOCUS_00020 2472 3428 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889178.1 protein_id gnl|my_center|LOCUS_00020 4905 3430 gene locus_tag LOCUS_00030 4905 3430 CDS product DUF3084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227936.1 protein_id gnl|my_center|LOCUS_00030 5710 4943 gene locus_tag LOCUS_00040 gene lptB 5710 4943 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172528.1 protein_id gnl|my_center|LOCUS_00040 5768 7252 gene locus_tag LOCUS_00050 gene gltX 5768 7252 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227935.1 protein_id gnl|my_center|LOCUS_00050 9172 7247 gene locus_tag LOCUS_00060 9172 7247 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228569.1 protein_id gnl|my_center|LOCUS_00060 10099 9236 gene locus_tag LOCUS_00070 10099 9236 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384824.1 protein_id gnl|my_center|LOCUS_00070 10808 10131 gene locus_tag LOCUS_00080 10808 10131 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173343.1 protein_id gnl|my_center|LOCUS_00080 11331 10861 gene locus_tag LOCUS_00090 11331 10861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11522 11319 gene locus_tag LOCUS_00100 11522 11319 CDS product DUF3248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173341.1 protein_id gnl|my_center|LOCUS_00100 11585 12298 gene locus_tag LOCUS_00110 11585 12298 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227758.1 protein_id gnl|my_center|LOCUS_00110 12305 12844 gene locus_tag LOCUS_00120 12305 12844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174164.1 protein_id gnl|my_center|LOCUS_00120 12915 14021 gene locus_tag LOCUS_00130 12915 14021 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173990.1 protein_id gnl|my_center|LOCUS_00130 14142 15395 gene locus_tag LOCUS_00140 14142 15395 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228096.1 protein_id gnl|my_center|LOCUS_00140 15392 16540 gene locus_tag LOCUS_00150 15392 16540 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926821.1 protein_id gnl|my_center|LOCUS_00150 16549 17646 gene locus_tag LOCUS_00160 16549 17646 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 protein_id gnl|my_center|LOCUS_00160 17648 18826 gene locus_tag LOCUS_00170 17648 18826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18823 19959 gene locus_tag LOCUS_00180 18823 19959 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202471.1 protein_id gnl|my_center|LOCUS_00180 19959 21110 gene locus_tag LOCUS_00190 19959 21110 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392196.1 protein_id gnl|my_center|LOCUS_00190 21123 22061 gene locus_tag LOCUS_00200 21123 22061 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356585.1 protein_id gnl|my_center|LOCUS_00200 22063 22866 gene locus_tag LOCUS_00210 22063 22866 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887404.1 protein_id gnl|my_center|LOCUS_00210 22979 23368 gene locus_tag LOCUS_00220 22979 23368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 23472 24569 gene locus_tag LOCUS_00230 23472 24569 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 protein_id gnl|my_center|LOCUS_00230 25535 24579 gene locus_tag LOCUS_00240 25535 24579 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926009.1 protein_id gnl|my_center|LOCUS_00240 25806 25594 gene locus_tag LOCUS_00250 25806 25594 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227652.1 protein_id gnl|my_center|LOCUS_00250 25874 26278 gene locus_tag LOCUS_00260 25874 26278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 26290 28623 gene locus_tag LOCUS_00270 26290 28623 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926008.1 protein_id gnl|my_center|LOCUS_00270 29177 28620 gene locus_tag LOCUS_00280 gene pth 29177 28620 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173630.1 protein_id gnl|my_center|LOCUS_00280 29855 29235 gene locus_tag LOCUS_00290 29855 29235 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173631.1 protein_id gnl|my_center|LOCUS_00290 30622 29927 gene locus_tag LOCUS_00300 30622 29927 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245334.1 protein_id gnl|my_center|LOCUS_00300 31080 30733 gene locus_tag LOCUS_00310 gene nirD 31080 30733 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 protein_id gnl|my_center|LOCUS_00310 33593 31077 gene locus_tag LOCUS_00320 gene nirB 33593 31077 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197731.1 protein_id gnl|my_center|LOCUS_00320 34497 33679 gene locus_tag LOCUS_00330 34497 33679 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141569.1 protein_id gnl|my_center|LOCUS_00330 35330 34518 gene locus_tag LOCUS_00340 gene ntrB 35330 34518 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967199.1 protein_id gnl|my_center|LOCUS_00340 36612 35377 gene locus_tag LOCUS_00350 36612 35377 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530457.1 protein_id gnl|my_center|LOCUS_00350 37436 36615 gene locus_tag LOCUS_00360 gene cobA 37436 36615 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256583.1 protein_id gnl|my_center|LOCUS_00360 38125 37433 gene locus_tag LOCUS_00370 38125 37433 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256584.1 protein_id gnl|my_center|LOCUS_00370 40214 38139 gene locus_tag LOCUS_00380 40214 38139 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223026.1 protein_id gnl|my_center|LOCUS_00380 40603 40678 gene locus_tag LOCUS_t00010 40603 40678 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 40681 40756 gene locus_tag LOCUS_t00020 40681 40756 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 40871 41299 gene locus_tag LOCUS_00390 40871 41299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 41296 41844 gene locus_tag LOCUS_00400 41296 41844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227742.1 protein_id gnl|my_center|LOCUS_00400 41826 42116 gene locus_tag LOCUS_00410 41826 42116 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174185.1 protein_id gnl|my_center|LOCUS_00410 43328 42123 gene locus_tag LOCUS_00420 gene tgt 43328 42123 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227845.1 protein_id gnl|my_center|LOCUS_00420 44491 43325 gene locus_tag LOCUS_00430 44491 43325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 44988 44488 gene locus_tag LOCUS_00440 44988 44488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 45020 45442 gene locus_tag LOCUS_00450 gene crcB 45020 45442 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227866.1 protein_id gnl|my_center|LOCUS_00450 45576 45725 gene locus_tag LOCUS_00460 45576 45725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00460 45774 46247 gene locus_tag LOCUS_00470 45774 46247 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174302.1 protein_id gnl|my_center|LOCUS_00470 47131 46226 gene locus_tag LOCUS_00480 47131 46226 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393325.1 protein_id gnl|my_center|LOCUS_00480 47332 48774 gene locus_tag LOCUS_00490 47332 48774 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228233.1 protein_id gnl|my_center|LOCUS_00490 48797 49105 gene locus_tag LOCUS_00500 48797 49105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 49118 49777 gene locus_tag LOCUS_00510 49118 49777 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172930.1 protein_id gnl|my_center|LOCUS_00510 49774 50115 gene locus_tag LOCUS_00520 49774 50115 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930603.1 protein_id gnl|my_center|LOCUS_00520 50115 50459 gene locus_tag LOCUS_00530 50115 50459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00530 50450 51214 gene locus_tag LOCUS_00540 50450 51214 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228232.1 protein_id gnl|my_center|LOCUS_00540 52053 51220 gene locus_tag LOCUS_00550 52053 51220 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083944.1 protein_id gnl|my_center|LOCUS_00550 53298 52063 gene locus_tag LOCUS_00560 53298 52063 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005186.1 protein_id gnl|my_center|LOCUS_00560 53328 54332 gene locus_tag LOCUS_00570 gene galE 53328 54332 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_00570 56179 54329 gene locus_tag LOCUS_00580 56179 54329 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926065.1 protein_id gnl|my_center|LOCUS_00580 56253 56819 gene locus_tag LOCUS_00590 56253 56819 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172902.1 protein_id gnl|my_center|LOCUS_00590 56854 58740 gene locus_tag LOCUS_00600 56854 58740 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567324.1 protein_id gnl|my_center|LOCUS_00600 58831 59154 gene locus_tag LOCUS_00610 58831 59154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 59174 59656 gene locus_tag LOCUS_00620 59174 59656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 59669 60328 gene locus_tag LOCUS_00630 59669 60328 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118816.1 protein_id gnl|my_center|LOCUS_00630 60315 61553 gene locus_tag LOCUS_00640 60315 61553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 61546 62193 gene locus_tag LOCUS_00650 61546 62193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 62281 63717 gene locus_tag LOCUS_00660 62281 63717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 63853 65304 gene locus_tag LOCUS_00670 63853 65304 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298365.1 protein_id gnl|my_center|LOCUS_00670 65332 66789 gene locus_tag LOCUS_00680 65332 66789 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972091.1 protein_id gnl|my_center|LOCUS_00680 66821 68194 gene locus_tag LOCUS_00690 66821 68194 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969775.1 protein_id gnl|my_center|LOCUS_00690 68256 69026 gene locus_tag LOCUS_00700 68256 69026 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 protein_id gnl|my_center|LOCUS_00700 >Feature sequence002 946 446 gene locus_tag LOCUS_00710 946 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 1470 955 gene locus_tag LOCUS_00720 1470 955 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479804.1 protein_id gnl|my_center|LOCUS_00720 1651 2214 gene locus_tag LOCUS_00730 gene sbtR 1651 2214 CDS product TetR/AcrR family transcriptional regulator SbtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174174.1 protein_id gnl|my_center|LOCUS_00730 2211 2705 gene locus_tag LOCUS_00740 2211 2705 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227752.1 protein_id gnl|my_center|LOCUS_00740 2749 3591 gene locus_tag LOCUS_00750 2749 3591 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888626.1 protein_id gnl|my_center|LOCUS_00750 4535 3588 gene locus_tag LOCUS_00760 gene rbsK 4535 3588 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 protein_id gnl|my_center|LOCUS_00760 4764 4546 gene locus_tag LOCUS_00770 4764 4546 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228586.1 protein_id gnl|my_center|LOCUS_00770 5871 4801 gene locus_tag LOCUS_00780 5871 4801 CDS product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228894.1 protein_id gnl|my_center|LOCUS_00780 6001 6240 gene locus_tag LOCUS_00790 6001 6240 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630832.1 protein_id gnl|my_center|LOCUS_00790 7247 6291 gene locus_tag LOCUS_00800 7247 6291 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926019.1 protein_id gnl|my_center|LOCUS_00800 8097 7300 gene locus_tag LOCUS_00810 8097 7300 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446277.1 protein_id gnl|my_center|LOCUS_00810 8364 9860 gene locus_tag LOCUS_00820 8364 9860 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973850.1 protein_id gnl|my_center|LOCUS_00820 9932 10879 gene locus_tag LOCUS_00830 9932 10879 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_00830 10872 11708 gene locus_tag LOCUS_00840 10872 11708 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537951.1 protein_id gnl|my_center|LOCUS_00840 11732 12523 gene locus_tag LOCUS_00850 11732 12523 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222024.1 protein_id gnl|my_center|LOCUS_00850 12612 13445 gene locus_tag LOCUS_00860 12612 13445 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228942.1 protein_id gnl|my_center|LOCUS_00860 13483 14277 gene locus_tag LOCUS_00870 13483 14277 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173899.1 protein_id gnl|my_center|LOCUS_00870 14359 15558 gene locus_tag LOCUS_00880 14359 15558 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228979.1 protein_id gnl|my_center|LOCUS_00880 15677 16873 gene locus_tag LOCUS_00890 15677 16873 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229029.1 protein_id gnl|my_center|LOCUS_00890 17238 16870 gene locus_tag LOCUS_00900 17238 16870 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229099.1 protein_id gnl|my_center|LOCUS_00900 18527 17235 gene locus_tag LOCUS_00910 18527 17235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 20839 18524 gene locus_tag LOCUS_00920 gene metE 20839 18524 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918370.1 protein_id gnl|my_center|LOCUS_00920 22953 20875 gene locus_tag LOCUS_00930 gene nrdE 22953 20875 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215839.1 protein_id gnl|my_center|LOCUS_00930 23317 22940 gene locus_tag LOCUS_00940 gene nrdI 23317 22940 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231758.1 protein_id gnl|my_center|LOCUS_00940 26617 23720 gene locus_tag LOCUS_00950 26617 23720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 28357 26840 gene locus_tag LOCUS_00960 28357 26840 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228766.1 protein_id gnl|my_center|LOCUS_00960 28445 28651 gene locus_tag LOCUS_00970 28445 28651 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173995.1 protein_id gnl|my_center|LOCUS_00970 28730 29767 gene locus_tag LOCUS_00980 28730 29767 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661226.1 protein_id gnl|my_center|LOCUS_00980 29803 30567 gene locus_tag LOCUS_00990 gene surE 29803 30567 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889023.1 protein_id gnl|my_center|LOCUS_00990 32025 30559 gene locus_tag LOCUS_01000 32025 30559 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228722.1 protein_id gnl|my_center|LOCUS_01000 32018 32920 gene locus_tag LOCUS_01010 gene cbiB 32018 32920 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174539.1 protein_id gnl|my_center|LOCUS_01010 32936 33949 gene locus_tag LOCUS_01020 32936 33949 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926108.1 protein_id gnl|my_center|LOCUS_01020 36342 33964 gene locus_tag LOCUS_01030 gene lon 36342 33964 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172865.1 protein_id gnl|my_center|LOCUS_01030 37254 36802 gene locus_tag LOCUS_01040 gene rplI 37254 36802 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227802.1 protein_id gnl|my_center|LOCUS_01040 37544 37266 gene locus_tag LOCUS_01050 gene rpsR 37544 37266 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630522.1 protein_id gnl|my_center|LOCUS_01050 38353 37541 gene locus_tag LOCUS_01060 38353 37541 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227803.1 protein_id gnl|my_center|LOCUS_01060 38728 38417 gene locus_tag LOCUS_01070 gene rpsF 38728 38417 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886746.1 protein_id gnl|my_center|LOCUS_01070 39523 38834 gene locus_tag LOCUS_01080 39523 38834 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227680.1 protein_id gnl|my_center|LOCUS_01080 39570 39974 gene locus_tag LOCUS_01090 39570 39974 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531694.1 protein_id gnl|my_center|LOCUS_01090 39971 41413 gene locus_tag LOCUS_01100 39971 41413 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227710.1 protein_id gnl|my_center|LOCUS_01100 44030 41415 gene locus_tag LOCUS_01110 44030 41415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228862.1 protein_id gnl|my_center|LOCUS_01110 44281 45441 gene locus_tag LOCUS_01120 gene lysA 44281 45441 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888393.1 protein_id gnl|my_center|LOCUS_01120 47240 45447 gene locus_tag LOCUS_01130 47240 45447 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228742.1 protein_id gnl|my_center|LOCUS_01130 47594 49381 gene locus_tag LOCUS_01140 gene typA 47594 49381 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887841.1 protein_id gnl|my_center|LOCUS_01140 49440 51467 gene locus_tag LOCUS_01150 49440 51467 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888294.1 protein_id gnl|my_center|LOCUS_01150 54274 51515 gene locus_tag LOCUS_01160 54274 51515 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228992.1 protein_id gnl|my_center|LOCUS_01160 54868 56682 gene locus_tag LOCUS_01170 gene glmS 54868 56682 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228994.1 protein_id gnl|my_center|LOCUS_01170 57016 56690 gene locus_tag LOCUS_01180 57016 56690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 57651 57013 gene locus_tag LOCUS_01190 57651 57013 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338452.1 protein_id gnl|my_center|LOCUS_01190 57780 59447 gene locus_tag LOCUS_01200 57780 59447 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495579.1 protein_id gnl|my_center|LOCUS_01200 59517 60431 gene locus_tag LOCUS_01210 59517 60431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 60728 62674 gene locus_tag LOCUS_01220 60728 62674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 63257 62667 gene locus_tag LOCUS_01230 63257 62667 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258297.1 protein_id gnl|my_center|LOCUS_01230 63655 63290 gene locus_tag LOCUS_01240 63655 63290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 66122 63657 gene locus_tag LOCUS_01250 66122 63657 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889078.1 protein_id gnl|my_center|LOCUS_01250 66491 66207 gene locus_tag LOCUS_01260 gene csoR 66491 66207 CDS product metal-sensitive transcriptional regulator CsoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173741.1 protein_id gnl|my_center|LOCUS_01260 66690 66493 gene locus_tag LOCUS_01270 66690 66493 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228864.1 protein_id gnl|my_center|LOCUS_01270 >Feature sequence003 <1 656 gene locus_tag LOCUS_01280 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011174292.1:MFS transporter 935 660 gene locus_tag LOCUS_01290 935 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 2276 945 gene locus_tag LOCUS_01300 gene pgi 2276 945 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227825.1 protein_id gnl|my_center|LOCUS_01300 2536 4965 gene locus_tag LOCUS_01310 gene topA 2536 4965 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227691.1 protein_id gnl|my_center|LOCUS_01310 4966 5238 gene locus_tag LOCUS_01320 4966 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174283.1 protein_id gnl|my_center|LOCUS_01320 5331 5876 gene locus_tag LOCUS_01330 5331 5876 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174153.1 protein_id gnl|my_center|LOCUS_01330 6992 5877 gene locus_tag LOCUS_01340 6992 5877 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015900.1 protein_id gnl|my_center|LOCUS_01340 7079 7756 gene locus_tag LOCUS_01350 gene lipB 7079 7756 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_01350 7753 8724 gene locus_tag LOCUS_01360 gene lipA 7753 8724 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174105.1 protein_id gnl|my_center|LOCUS_01360 8721 9110 gene locus_tag LOCUS_01370 8721 9110 CDS product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227800.1 protein_id gnl|my_center|LOCUS_01370 9207 9605 gene locus_tag LOCUS_01380 9207 9605 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174007.1 protein_id gnl|my_center|LOCUS_01380 10468 9602 gene locus_tag LOCUS_01390 10468 9602 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258072.1 protein_id gnl|my_center|LOCUS_01390 11115 10465 gene locus_tag LOCUS_01400 11115 10465 CDS product DUF5639 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227685.1 protein_id gnl|my_center|LOCUS_01400 12669 11140 gene locus_tag LOCUS_01410 12669 11140 CDS product polyhydroxybutyrate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227772.1 protein_id gnl|my_center|LOCUS_01410 12821 13744 gene locus_tag LOCUS_01420 12821 13744 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257709.1 protein_id gnl|my_center|LOCUS_01420 14631 13747 gene locus_tag LOCUS_01430 gene lgt 14631 13747 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227898.1 protein_id gnl|my_center|LOCUS_01430 14854 14612 gene locus_tag LOCUS_01440 14854 14612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 15360 14881 gene locus_tag LOCUS_01450 15360 14881 CDS product DUF456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227896.1 protein_id gnl|my_center|LOCUS_01450 16566 15394 gene locus_tag LOCUS_01460 16566 15394 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225440.1 protein_id gnl|my_center|LOCUS_01460 17774 16575 gene locus_tag LOCUS_01470 17774 16575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 20000 17841 gene locus_tag LOCUS_01480 20000 17841 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227649.1 protein_id gnl|my_center|LOCUS_01480 20090 21331 gene locus_tag LOCUS_01490 gene glgC 20090 21331 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227648.1 protein_id gnl|my_center|LOCUS_01490 21364 22053 gene locus_tag LOCUS_01500 21364 22053 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174327.1 protein_id gnl|my_center|LOCUS_01500 22053 22454 gene locus_tag LOCUS_01510 22053 22454 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227646.1 protein_id gnl|my_center|LOCUS_01510 22793 22473 gene locus_tag LOCUS_01520 22793 22473 CDS product DUF3208 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227682.1 protein_id gnl|my_center|LOCUS_01520 23967 22864 gene locus_tag LOCUS_01530 gene alr 23967 22864 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065216.1 protein_id gnl|my_center|LOCUS_01530 24538 24014 gene locus_tag LOCUS_01540 24538 24014 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080594.1 protein_id gnl|my_center|LOCUS_01540 27176 24597 gene locus_tag LOCUS_01550 27176 24597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 27370 28803 gene locus_tag LOCUS_01560 gene proS 27370 28803 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227720.1 protein_id gnl|my_center|LOCUS_01560 28806 29498 gene locus_tag LOCUS_01570 gene nth 28806 29498 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227718.1 protein_id gnl|my_center|LOCUS_01570 29746 29516 gene locus_tag LOCUS_01580 29746 29516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 30194 29781 gene locus_tag LOCUS_01590 30194 29781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 30335 31357 gene locus_tag LOCUS_01600 30335 31357 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227073.1 protein_id gnl|my_center|LOCUS_01600 31492 33198 gene locus_tag LOCUS_01610 31492 33198 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775805.1 protein_id gnl|my_center|LOCUS_01610 33295 34296 gene locus_tag LOCUS_01620 33295 34296 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775804.1 protein_id gnl|my_center|LOCUS_01620 34293 35132 gene locus_tag LOCUS_01630 34293 35132 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775803.1 protein_id gnl|my_center|LOCUS_01630 35132 36112 gene locus_tag LOCUS_01640 35132 36112 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257039.1 protein_id gnl|my_center|LOCUS_01640 36109 36873 gene locus_tag LOCUS_01650 36109 36873 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082480.1 protein_id gnl|my_center|LOCUS_01650 36942 38156 gene locus_tag LOCUS_01660 36942 38156 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266545.1 protein_id gnl|my_center|LOCUS_01660 38159 40459 gene locus_tag LOCUS_01670 38159 40459 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_01670 41599 40433 gene locus_tag LOCUS_01680 gene ogl 41599 40433 CDS product oligogalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816209.1 protein_id gnl|my_center|LOCUS_01680 41928 41596 gene locus_tag LOCUS_01690 41928 41596 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338257.1 protein_id gnl|my_center|LOCUS_01690 42873 41935 gene locus_tag LOCUS_01700 42873 41935 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527149.1 protein_id gnl|my_center|LOCUS_01700 43517 42870 gene locus_tag LOCUS_01710 gene eda 43517 42870 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230732.1 protein_id gnl|my_center|LOCUS_01710 44314 43529 gene locus_tag LOCUS_01720 gene kduD 44314 43529 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_01720 45115 44318 gene locus_tag LOCUS_01730 gene iolB 45115 44318 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583016.1 protein_id gnl|my_center|LOCUS_01730 46665 45118 gene locus_tag LOCUS_01740 46665 45118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 47548 46679 gene locus_tag LOCUS_01750 47548 46679 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_01750 48463 47558 gene locus_tag LOCUS_01760 48463 47558 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_01760 49482 48460 gene locus_tag LOCUS_01770 49482 48460 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_01770 49581 50201 gene locus_tag LOCUS_01780 49581 50201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 50198 51616 gene locus_tag LOCUS_01790 50198 51616 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228083.1 protein_id gnl|my_center|LOCUS_01790 51626 52843 gene locus_tag LOCUS_01800 51626 52843 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228085.1 protein_id gnl|my_center|LOCUS_01800 53622 52840 gene locus_tag LOCUS_01810 53622 52840 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228495.1 protein_id gnl|my_center|LOCUS_01810 54061 53609 gene locus_tag LOCUS_01820 54061 53609 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173248.1 protein_id gnl|my_center|LOCUS_01820 55647 54058 gene locus_tag LOCUS_01830 55647 54058 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227966.1 protein_id gnl|my_center|LOCUS_01830 57562 55655 gene locus_tag LOCUS_01840 57562 55655 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887578.1 protein_id gnl|my_center|LOCUS_01840 58576 57599 gene locus_tag LOCUS_01850 58576 57599 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729196.1 protein_id gnl|my_center|LOCUS_01850 59334 58570 gene locus_tag LOCUS_01860 59334 58570 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067241.1 protein_id gnl|my_center|LOCUS_01860 60353 59346 gene locus_tag LOCUS_01870 60353 59346 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892758.1 protein_id gnl|my_center|LOCUS_01870 61168 60350 gene locus_tag LOCUS_01880 61168 60350 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387628.1 protein_id gnl|my_center|LOCUS_01880 62064 61165 gene locus_tag LOCUS_01890 62064 61165 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550807.1 protein_id gnl|my_center|LOCUS_01890 63468 62164 gene locus_tag LOCUS_01900 63468 62164 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197580.1 protein_id gnl|my_center|LOCUS_01900 64267 63518 gene locus_tag LOCUS_01910 64267 63518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 >Feature sequence004 147 1205 gene locus_tag LOCUS_01920 147 1205 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227928.1 protein_id gnl|my_center|LOCUS_01920 1198 1782 gene locus_tag LOCUS_01930 gene hisB 1198 1782 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227929.1 protein_id gnl|my_center|LOCUS_01930 1779 2375 gene locus_tag LOCUS_01940 gene hisH 1779 2375 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172519.1 protein_id gnl|my_center|LOCUS_01940 2432 2920 gene locus_tag LOCUS_01950 2432 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229036.1 protein_id gnl|my_center|LOCUS_01950 2970 3326 gene locus_tag LOCUS_01960 2970 3326 CDS product S-adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172919.1 protein_id gnl|my_center|LOCUS_01960 3396 4331 gene locus_tag LOCUS_01970 gene speE 3396 4331 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172918.1 protein_id gnl|my_center|LOCUS_01970 4379 5065 gene locus_tag LOCUS_01980 4379 5065 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228223.1 protein_id gnl|my_center|LOCUS_01980 5105 5539 gene locus_tag LOCUS_01990 5105 5539 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_01990 5536 6138 gene locus_tag LOCUS_02000 5536 6138 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480348.1 protein_id gnl|my_center|LOCUS_02000 6140 6316 gene locus_tag LOCUS_02010 6140 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 7348 6362 gene locus_tag LOCUS_02020 7348 6362 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886913.1 protein_id gnl|my_center|LOCUS_02020 7712 7485 gene locus_tag LOCUS_02030 7712 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 7759 8490 gene locus_tag LOCUS_02040 7759 8490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 8547 11255 gene locus_tag LOCUS_02050 8547 11255 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227836.1 protein_id gnl|my_center|LOCUS_02050 11304 12485 gene locus_tag LOCUS_02060 gene odhB 11304 12485 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227835.1 protein_id gnl|my_center|LOCUS_02060 12563 13897 gene locus_tag LOCUS_02070 gene lpdA 12563 13897 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227834.1 protein_id gnl|my_center|LOCUS_02070 13939 14205 gene locus_tag LOCUS_02080 13939 14205 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631905.1 protein_id gnl|my_center|LOCUS_02080 14230 15537 gene locus_tag LOCUS_02090 gene tyrS 14230 15537 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173450.1 protein_id gnl|my_center|LOCUS_02090 15534 16526 gene locus_tag LOCUS_02100 15534 16526 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_02100 16571 17332 gene locus_tag LOCUS_02110 16571 17332 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228197.1 protein_id gnl|my_center|LOCUS_02110 17615 20989 gene locus_tag LOCUS_02120 17615 20989 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228935.1 protein_id gnl|my_center|LOCUS_02120 21022 25602 gene locus_tag LOCUS_02130 gene rpoC 21022 25602 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228934.1 protein_id gnl|my_center|LOCUS_02130 25647 26270 gene locus_tag LOCUS_02140 25647 26270 CDS product fuculose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173835.1 protein_id gnl|my_center|LOCUS_02140 26251 26490 gene locus_tag LOCUS_02150 26251 26490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228933.1 protein_id gnl|my_center|LOCUS_02150 26474 27334 gene locus_tag LOCUS_02160 26474 27334 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228932.1 protein_id gnl|my_center|LOCUS_02160 27744 27397 gene locus_tag LOCUS_02170 gene rplT 27744 27397 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172639.1 protein_id gnl|my_center|LOCUS_02170 27955 27755 gene locus_tag LOCUS_02180 gene rpmI 27955 27755 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172638.1 protein_id gnl|my_center|LOCUS_02180 28474 28061 gene locus_tag LOCUS_02190 28474 28061 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632741.1 protein_id gnl|my_center|LOCUS_02190 29188 28571 gene locus_tag LOCUS_02200 29188 28571 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228420.1 protein_id gnl|my_center|LOCUS_02200 30165 29185 gene locus_tag LOCUS_02210 gene mtnA 30165 29185 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228421.1 protein_id gnl|my_center|LOCUS_02210 30327 31613 gene locus_tag LOCUS_02220 30327 31613 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173996.1 protein_id gnl|my_center|LOCUS_02220 31670 32545 gene locus_tag LOCUS_02230 31670 32545 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 protein_id gnl|my_center|LOCUS_02230 32542 33384 gene locus_tag LOCUS_02240 32542 33384 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173998.1 protein_id gnl|my_center|LOCUS_02240 33464 35743 gene locus_tag LOCUS_02250 33464 35743 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140201.1 protein_id gnl|my_center|LOCUS_02250 35785 37290 gene locus_tag LOCUS_02260 35785 37290 CDS product thermostable carboxypeptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174078.1 protein_id gnl|my_center|LOCUS_02260 38519 37278 gene locus_tag LOCUS_02270 38519 37278 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926086.1 protein_id gnl|my_center|LOCUS_02270 38488 39483 gene locus_tag LOCUS_02280 38488 39483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227854.1 protein_id gnl|my_center|LOCUS_02280 39953 39480 gene locus_tag LOCUS_02290 39953 39480 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943199.1 protein_id gnl|my_center|LOCUS_02290 41483 39978 gene locus_tag LOCUS_02300 41483 39978 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259263.1 protein_id gnl|my_center|LOCUS_02300 43220 41556 gene locus_tag LOCUS_02310 gene ilvD 43220 41556 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228538.1 protein_id gnl|my_center|LOCUS_02310 44383 43331 gene locus_tag LOCUS_02320 gene leuB 44383 43331 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228534.1 protein_id gnl|my_center|LOCUS_02320 44996 44394 gene locus_tag LOCUS_02330 gene leuD 44996 44394 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228533.1 protein_id gnl|my_center|LOCUS_02330 45224 45018 gene locus_tag LOCUS_02340 45224 45018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 46676 45255 gene locus_tag LOCUS_02350 gene leuC 46676 45255 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173294.1 protein_id gnl|my_center|LOCUS_02350 46911 48776 gene locus_tag LOCUS_02360 gene ppk1 46911 48776 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870306.1 protein_id gnl|my_center|LOCUS_02360 48786 49553 gene locus_tag LOCUS_02370 48786 49553 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228020.1 protein_id gnl|my_center|LOCUS_02370 49930 49556 gene locus_tag LOCUS_02380 49930 49556 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480250.1 protein_id gnl|my_center|LOCUS_02380 50234 49938 gene locus_tag LOCUS_02390 50234 49938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 50620 50243 gene locus_tag LOCUS_02400 50620 50243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 51330 50617 gene locus_tag LOCUS_02410 51330 50617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 51523 51344 gene locus_tag LOCUS_02420 51523 51344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 53371 51590 gene locus_tag LOCUS_02430 53371 51590 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228959.1 protein_id gnl|my_center|LOCUS_02430 53433 54293 gene locus_tag LOCUS_02440 53433 54293 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228418.1 protein_id gnl|my_center|LOCUS_02440 54320 55558 gene locus_tag LOCUS_02450 54320 55558 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228419.1 protein_id gnl|my_center|LOCUS_02450 56040 55555 gene locus_tag LOCUS_02460 56040 55555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229049.1 protein_id gnl|my_center|LOCUS_02460 58455 56101 gene locus_tag LOCUS_02470 gene pheT 58455 56101 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229047.1 protein_id gnl|my_center|LOCUS_02470 59542 58478 gene locus_tag LOCUS_02480 gene pheS 59542 58478 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229046.1 protein_id gnl|my_center|LOCUS_02480 59855 59682 gene locus_tag LOCUS_02490 59855 59682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 59893 60276 gene locus_tag LOCUS_02500 59893 60276 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227791.1 protein_id gnl|my_center|LOCUS_02500 61526 60333 gene locus_tag LOCUS_02510 61526 60333 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228285.1 protein_id gnl|my_center|LOCUS_02510 62532 61537 gene locus_tag LOCUS_02520 gene gap 62532 61537 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228284.1 protein_id gnl|my_center|LOCUS_02520 >Feature sequence005 1297 503 gene locus_tag LOCUS_02530 1297 503 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172542.1 protein_id gnl|my_center|LOCUS_02530 2067 1297 gene locus_tag LOCUS_02540 2067 1297 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227948.1 protein_id gnl|my_center|LOCUS_02540 3610 2207 gene locus_tag LOCUS_02550 3610 2207 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941596.1 protein_id gnl|my_center|LOCUS_02550 5085 3607 gene locus_tag LOCUS_02560 5085 3607 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941595.1 protein_id gnl|my_center|LOCUS_02560 5579 5160 gene locus_tag LOCUS_02570 5579 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 6257 5652 gene locus_tag LOCUS_02580 6257 5652 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172643.1 protein_id gnl|my_center|LOCUS_02580 7724 6327 gene locus_tag LOCUS_02590 gene fumC 7724 6327 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889251.1 protein_id gnl|my_center|LOCUS_02590 8952 7732 gene locus_tag LOCUS_02600 8952 7732 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530124.1 protein_id gnl|my_center|LOCUS_02600 9052 9498 gene locus_tag LOCUS_02610 9052 9498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 9566 10567 gene locus_tag LOCUS_02620 9566 10567 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228521.1 protein_id gnl|my_center|LOCUS_02620 10710 10619 gene locus_tag LOCUS_t00030 10710 10619 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12311 10749 gene locus_tag LOCUS_02630 gene tilS 12311 10749 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228750.1 protein_id gnl|my_center|LOCUS_02630 12330 13409 gene locus_tag LOCUS_02640 12330 13409 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228739.1 protein_id gnl|my_center|LOCUS_02640 13466 13957 gene locus_tag LOCUS_02650 13466 13957 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228460.1 protein_id gnl|my_center|LOCUS_02650 13959 14546 gene locus_tag LOCUS_02660 13959 14546 CDS product ADP-ribosylation factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228461.1 protein_id gnl|my_center|LOCUS_02660 15422 14556 gene locus_tag LOCUS_02670 15422 14556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 15472 16527 gene locus_tag LOCUS_02680 gene gcvT 15472 16527 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228001.1 protein_id gnl|my_center|LOCUS_02680 16587 16973 gene locus_tag LOCUS_02690 gene gcvH 16587 16973 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228002.1 protein_id gnl|my_center|LOCUS_02690 17878 16979 gene locus_tag LOCUS_02700 17878 16979 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173548.1 protein_id gnl|my_center|LOCUS_02700 17943 18920 gene locus_tag LOCUS_02710 gene tsaD 17943 18920 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173315.1 protein_id gnl|my_center|LOCUS_02710 19593 18910 gene locus_tag LOCUS_02720 19593 18910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 21880 19598 gene locus_tag LOCUS_02730 21880 19598 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889332.1 protein_id gnl|my_center|LOCUS_02730 22314 21985 gene locus_tag LOCUS_02740 22314 21985 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889330.1 protein_id gnl|my_center|LOCUS_02740 22430 22861 gene locus_tag LOCUS_02750 22430 22861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 22858 25215 gene locus_tag LOCUS_02760 22858 25215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 25234 25869 gene locus_tag LOCUS_02770 25234 25869 CDS product Rad52/Rad22 family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174275.1 protein_id gnl|my_center|LOCUS_02770 25879 26643 gene locus_tag LOCUS_02780 25879 26643 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174274.1 protein_id gnl|my_center|LOCUS_02780 26640 27446 gene locus_tag LOCUS_02790 gene rsmA 26640 27446 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227698.1 protein_id gnl|my_center|LOCUS_02790 27553 28470 gene locus_tag LOCUS_02800 27553 28470 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227930.1 protein_id gnl|my_center|LOCUS_02800 29633 28482 gene locus_tag LOCUS_02810 29633 28482 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227919.1 protein_id gnl|my_center|LOCUS_02810 29723 30022 gene locus_tag LOCUS_02820 29723 30022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 30067 31047 gene locus_tag LOCUS_02830 gene ruvB 30067 31047 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227913.1 protein_id gnl|my_center|LOCUS_02830 31106 32152 gene locus_tag LOCUS_02840 31106 32152 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172495.1 protein_id gnl|my_center|LOCUS_02840 32203 34767 gene locus_tag LOCUS_02850 gene clpB 32203 34767 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228712.1 protein_id gnl|my_center|LOCUS_02850 34767 35198 gene locus_tag LOCUS_02860 gene trxA 34767 35198 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228708.1 protein_id gnl|my_center|LOCUS_02860 35331 35747 gene locus_tag LOCUS_02870 35331 35747 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173534.1 protein_id gnl|my_center|LOCUS_02870 35810 36430 gene locus_tag LOCUS_02880 35810 36430 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173524.1 protein_id gnl|my_center|LOCUS_02880 36549 36630 gene locus_tag LOCUS_t00040 36549 36630 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 37294 37842 gene locus_tag LOCUS_02890 gene raiA 37294 37842 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632742.1 protein_id gnl|my_center|LOCUS_02890 37892 39034 gene locus_tag LOCUS_02900 gene argJ 37892 39034 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228506.1 protein_id gnl|my_center|LOCUS_02900 39131 39592 gene locus_tag LOCUS_02910 39131 39592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 39613 40263 gene locus_tag LOCUS_02920 39613 40263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228505.1 protein_id gnl|my_center|LOCUS_02920 41334 40279 gene locus_tag LOCUS_02930 41334 40279 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256103.1 protein_id gnl|my_center|LOCUS_02930 42448 41336 gene locus_tag LOCUS_02940 42448 41336 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256104.1 protein_id gnl|my_center|LOCUS_02940 43200 42436 gene locus_tag LOCUS_02950 43200 42436 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678718.1 protein_id gnl|my_center|LOCUS_02950 44117 43197 gene locus_tag LOCUS_02960 44117 43197 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458881.1 protein_id gnl|my_center|LOCUS_02960 44874 44155 gene locus_tag LOCUS_02970 44874 44155 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228173.1 protein_id gnl|my_center|LOCUS_02970 46193 44928 gene locus_tag LOCUS_02980 46193 44928 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227981.1 protein_id gnl|my_center|LOCUS_02980 47493 46204 gene locus_tag LOCUS_02990 gene glcF 47493 46204 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888365.1 protein_id gnl|my_center|LOCUS_02990 48556 47477 gene locus_tag LOCUS_03000 48556 47477 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227985.1 protein_id gnl|my_center|LOCUS_03000 49985 48549 gene locus_tag LOCUS_03010 49985 48549 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227986.1 protein_id gnl|my_center|LOCUS_03010 50131 50904 gene locus_tag LOCUS_03020 50131 50904 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173250.1 protein_id gnl|my_center|LOCUS_03020 50919 52502 gene locus_tag LOCUS_03030 50919 52502 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228496.1 protein_id gnl|my_center|LOCUS_03030 53765 52491 gene locus_tag LOCUS_03040 53765 52491 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887950.1 protein_id gnl|my_center|LOCUS_03040 54503 53817 gene locus_tag LOCUS_03050 54503 53817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 54608 55138 gene locus_tag LOCUS_03060 54608 55138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227712.1 protein_id gnl|my_center|LOCUS_03060 56264 55146 gene locus_tag LOCUS_03070 gene ychF 56264 55146 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228498.1 protein_id gnl|my_center|LOCUS_03070 57473 56316 gene locus_tag LOCUS_03080 57473 56316 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973355.1 protein_id gnl|my_center|LOCUS_03080 57552 58436 gene locus_tag LOCUS_03090 57552 58436 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173402.1 protein_id gnl|my_center|LOCUS_03090 59981 58455 gene locus_tag LOCUS_03100 59981 58455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 60476 59991 gene locus_tag LOCUS_03110 60476 59991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 60358 60633 gene locus_tag LOCUS_03120 60358 60633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 >Feature sequence006 1992 166 gene locus_tag LOCUS_03130 gene lepA 1992 166 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228160.1 protein_id gnl|my_center|LOCUS_03130 2069 2908 gene locus_tag LOCUS_03140 2069 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 2912 3424 gene locus_tag LOCUS_03150 2912 3424 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228737.1 protein_id gnl|my_center|LOCUS_03150 4486 3431 gene locus_tag LOCUS_03160 gene galT 4486 3431 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229184.1 protein_id gnl|my_center|LOCUS_03160 5944 4496 gene locus_tag LOCUS_03170 5944 4496 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229183.1 protein_id gnl|my_center|LOCUS_03170 7888 5948 gene locus_tag LOCUS_03180 7888 5948 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080133.1 protein_id gnl|my_center|LOCUS_03180 8955 7945 gene locus_tag LOCUS_03190 8955 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 9791 8952 gene locus_tag LOCUS_03200 9791 8952 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311850.1 protein_id gnl|my_center|LOCUS_03200 11147 9855 gene locus_tag LOCUS_03210 11147 9855 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530183.1 protein_id gnl|my_center|LOCUS_03210 12118 11288 gene locus_tag LOCUS_03220 12118 11288 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_03220 13476 12115 gene locus_tag LOCUS_03230 13476 12115 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228622.1 protein_id gnl|my_center|LOCUS_03230 14163 13489 gene locus_tag LOCUS_03240 14163 13489 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228621.1 protein_id gnl|my_center|LOCUS_03240 14519 14160 gene locus_tag LOCUS_03250 14519 14160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 14767 15702 gene locus_tag LOCUS_03260 gene argF 14767 15702 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177765.1 protein_id gnl|my_center|LOCUS_03260 15724 16689 gene locus_tag LOCUS_03270 gene argC 15724 16689 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886726.1 protein_id gnl|my_center|LOCUS_03270 16691 17314 gene locus_tag LOCUS_03280 16691 17314 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888961.1 protein_id gnl|my_center|LOCUS_03280 17360 17917 gene locus_tag LOCUS_03290 gene pyrE 17360 17917 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228883.1 protein_id gnl|my_center|LOCUS_03290 17937 18974 gene locus_tag LOCUS_03300 17937 18974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228882.1 protein_id gnl|my_center|LOCUS_03300 18986 20017 gene locus_tag LOCUS_03310 18986 20017 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173761.1 protein_id gnl|my_center|LOCUS_03310 20813 20025 gene locus_tag LOCUS_03320 20813 20025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03320 21643 20771 gene locus_tag LOCUS_03330 21643 20771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03330 22648 21734 gene locus_tag LOCUS_03340 22648 21734 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174516.1 protein_id gnl|my_center|LOCUS_03340 23420 22734 gene locus_tag LOCUS_03350 23420 22734 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173403.1 protein_id gnl|my_center|LOCUS_03350 23608 23533 gene locus_tag LOCUS_t00050 23608 23533 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 23651 25501 gene locus_tag LOCUS_03360 23651 25501 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227877.1 protein_id gnl|my_center|LOCUS_03360 25569 25985 gene locus_tag LOCUS_03370 gene ndk 25569 25985 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227764.1 protein_id gnl|my_center|LOCUS_03370 26082 26645 gene locus_tag LOCUS_03380 26082 26645 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_03380 26649 27098 gene locus_tag LOCUS_03390 26649 27098 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889423.1 protein_id gnl|my_center|LOCUS_03390 27739 27101 gene locus_tag LOCUS_03400 27739 27101 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886921.1 protein_id gnl|my_center|LOCUS_03400 28943 27753 gene locus_tag LOCUS_03410 28943 27753 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228925.1 protein_id gnl|my_center|LOCUS_03410 29066 30283 gene locus_tag LOCUS_03420 29066 30283 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_03420 31826 30306 gene locus_tag LOCUS_03430 31826 30306 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228066.1 protein_id gnl|my_center|LOCUS_03430 33512 31854 gene locus_tag LOCUS_03440 33512 31854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 33550 34212 gene locus_tag LOCUS_03450 33550 34212 CDS product acetoin utilization AcuB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172560.1 protein_id gnl|my_center|LOCUS_03450 34209 35345 gene locus_tag LOCUS_03460 34209 35345 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227961.1 protein_id gnl|my_center|LOCUS_03460 35355 35582 gene locus_tag LOCUS_03470 35355 35582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 36412 35579 gene locus_tag LOCUS_03480 gene prmC 36412 35579 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886891.1 protein_id gnl|my_center|LOCUS_03480 37021 36419 gene locus_tag LOCUS_03490 37021 36419 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227938.1 protein_id gnl|my_center|LOCUS_03490 38472 37096 gene locus_tag LOCUS_03500 38472 37096 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227939.1 protein_id gnl|my_center|LOCUS_03500 38750 38469 gene locus_tag LOCUS_03510 gene yidD 38750 38469 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172533.1 protein_id gnl|my_center|LOCUS_03510 39108 38776 gene locus_tag LOCUS_03520 gene rnpA 39108 38776 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081424933.1 protein_id gnl|my_center|LOCUS_03520 39313 39155 gene locus_tag LOCUS_03530 gene rpmH 39313 39155 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888783.1 protein_id gnl|my_center|LOCUS_03530 40401 39397 gene locus_tag LOCUS_03540 40401 39397 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256958.1 protein_id gnl|my_center|LOCUS_03540 40487 42343 gene locus_tag LOCUS_03550 40487 42343 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258194.1 protein_id gnl|my_center|LOCUS_03550 43368 42340 gene locus_tag LOCUS_03560 gene folE2 43368 42340 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722743.1 protein_id gnl|my_center|LOCUS_03560 44279 43566 gene locus_tag LOCUS_03570 gene tmpR 44279 43566 CDS product bifunctional dihydropteridine reductase/dihydrofolate reductase TmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172549.1 protein_id gnl|my_center|LOCUS_03570 44683 44276 gene locus_tag LOCUS_03580 44683 44276 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172548.1 protein_id gnl|my_center|LOCUS_03580 45411 44692 gene locus_tag LOCUS_03590 gene irrE 45411 44692 CDS product metallo-endopeptidase IrrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886813.1 protein_id gnl|my_center|LOCUS_03590 45889 45422 gene locus_tag LOCUS_03600 45889 45422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 46300 45908 gene locus_tag LOCUS_03610 46300 45908 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480093.1 protein_id gnl|my_center|LOCUS_03610 47645 46698 gene locus_tag LOCUS_03620 47645 46698 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227819.1 protein_id gnl|my_center|LOCUS_03620 47787 49304 gene locus_tag LOCUS_03630 gene mmsA 47787 49304 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 protein_id gnl|my_center|LOCUS_03630 50010 49306 gene locus_tag LOCUS_03640 gene deoD 50010 49306 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479926.1 protein_id gnl|my_center|LOCUS_03640 50088 51206 gene locus_tag LOCUS_03650 50088 51206 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926069.1 protein_id gnl|my_center|LOCUS_03650 51203 51679 gene locus_tag LOCUS_03660 51203 51679 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228850.1 protein_id gnl|my_center|LOCUS_03660 51725 52348 gene locus_tag LOCUS_03670 51725 52348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888027.1 protein_id gnl|my_center|LOCUS_03670 52352 53932 gene locus_tag LOCUS_03680 52352 53932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228228.1 protein_id gnl|my_center|LOCUS_03680 53929 55062 gene locus_tag LOCUS_03690 53929 55062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 55109 56209 gene locus_tag LOCUS_03700 55109 56209 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017302733.1 protein_id gnl|my_center|LOCUS_03700 59248 56222 gene locus_tag LOCUS_03710 59248 56222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 <60232 59347 gene locus_tag LOCUS_03720 <60232 59347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886741.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence007 2458 1298 gene locus_tag LOCUS_03730 gene xylA 2458 1298 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_03730 3600 2458 gene locus_tag LOCUS_03740 3600 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 5613 3721 gene locus_tag LOCUS_03750 gene speA 5613 3721 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926066.1 protein_id gnl|my_center|LOCUS_03750 6235 5714 gene locus_tag LOCUS_03760 6235 5714 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351055.1 protein_id gnl|my_center|LOCUS_03760 6534 6232 gene locus_tag LOCUS_03770 6534 6232 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225986.1 protein_id gnl|my_center|LOCUS_03770 6877 6518 gene locus_tag LOCUS_03780 6877 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 7570 7049 gene locus_tag LOCUS_03790 7570 7049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 9882 7732 gene locus_tag LOCUS_03800 9882 7732 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480377.1 protein_id gnl|my_center|LOCUS_03800 10155 10880 gene locus_tag LOCUS_03810 10155 10880 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_03810 10877 11890 gene locus_tag LOCUS_03820 10877 11890 CDS product bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141659.1 protein_id gnl|my_center|LOCUS_03820 11887 13278 gene locus_tag LOCUS_03830 11887 13278 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886939.1 protein_id gnl|my_center|LOCUS_03830 14423 13275 gene locus_tag LOCUS_03840 14423 13275 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227861.1 protein_id gnl|my_center|LOCUS_03840 15359 14466 gene locus_tag LOCUS_03850 15359 14466 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880380.1 protein_id gnl|my_center|LOCUS_03850 15447 16436 gene locus_tag LOCUS_03860 gene glpX 15447 16436 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938831.1 protein_id gnl|my_center|LOCUS_03860 16447 17901 gene locus_tag LOCUS_03870 16447 17901 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975100.1 protein_id gnl|my_center|LOCUS_03870 17915 18337 gene locus_tag LOCUS_03880 17915 18337 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532057.1 protein_id gnl|my_center|LOCUS_03880 18396 19301 gene locus_tag LOCUS_03890 gene cbbX 18396 19301 CDS product CbbX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532058.1 protein_id gnl|my_center|LOCUS_03890 19291 20259 gene locus_tag LOCUS_03900 19291 20259 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144407.1 protein_id gnl|my_center|LOCUS_03900 20252 20926 gene locus_tag LOCUS_03910 gene rpe 20252 20926 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174250.1 protein_id gnl|my_center|LOCUS_03910 20907 21830 gene locus_tag LOCUS_03920 gene fba 20907 21830 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888228.1 protein_id gnl|my_center|LOCUS_03920 21827 22306 gene locus_tag LOCUS_03930 21827 22306 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228213.1 protein_id gnl|my_center|LOCUS_03930 22459 22869 gene locus_tag LOCUS_03940 gene cycA 22459 22869 CDS product cytochrome C-552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228671.1 protein_id gnl|my_center|LOCUS_03940 23367 22912 gene locus_tag LOCUS_03950 23367 22912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 23392 23517 gene locus_tag LOCUS_03960 23392 23517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 23572 24249 gene locus_tag LOCUS_03970 gene bshB1 23572 24249 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228508.1 protein_id gnl|my_center|LOCUS_03970 24332 25525 gene locus_tag LOCUS_03980 24332 25525 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926091.1 protein_id gnl|my_center|LOCUS_03980 25550 26785 gene locus_tag LOCUS_03990 25550 26785 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926040.1 protein_id gnl|my_center|LOCUS_03990 26868 27992 gene locus_tag LOCUS_04000 26868 27992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 27989 28801 gene locus_tag LOCUS_04010 27989 28801 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172776.1 protein_id gnl|my_center|LOCUS_04010 28842 29357 gene locus_tag LOCUS_04020 28842 29357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633771.1 protein_id gnl|my_center|LOCUS_04020 30306 29401 gene locus_tag LOCUS_04030 30306 29401 CDS product HrcA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227679.1 protein_id gnl|my_center|LOCUS_04030 30527 31888 gene locus_tag LOCUS_04040 30527 31888 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227678.1 protein_id gnl|my_center|LOCUS_04040 31898 32248 gene locus_tag LOCUS_04050 31898 32248 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631113.1 protein_id gnl|my_center|LOCUS_04050 32515 32291 gene locus_tag LOCUS_04060 32515 32291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 32690 33901 gene locus_tag LOCUS_04070 32690 33901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 34917 33937 gene locus_tag LOCUS_04080 34917 33937 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228513.1 protein_id gnl|my_center|LOCUS_04080 34977 35606 gene locus_tag LOCUS_04090 gene pdxH 34977 35606 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222336.1 protein_id gnl|my_center|LOCUS_04090 36248 35607 gene locus_tag LOCUS_04100 36248 35607 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444597.1 protein_id gnl|my_center|LOCUS_04100 36708 36274 gene locus_tag LOCUS_04110 36708 36274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 37300 36761 gene locus_tag LOCUS_04120 37300 36761 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173971.1 protein_id gnl|my_center|LOCUS_04120 37430 38254 gene locus_tag LOCUS_04130 37430 38254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228373.1 protein_id gnl|my_center|LOCUS_04130 38251 38904 gene locus_tag LOCUS_04140 38251 38904 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228374.1 protein_id gnl|my_center|LOCUS_04140 40236 38917 gene locus_tag LOCUS_04150 40236 38917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 40400 41269 gene locus_tag LOCUS_04160 40400 41269 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227640.1 protein_id gnl|my_center|LOCUS_04160 43287 41272 gene locus_tag LOCUS_04170 43287 41272 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227773.1 protein_id gnl|my_center|LOCUS_04170 44191 43310 gene locus_tag LOCUS_04180 gene pdxY 44191 43310 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_04180 44400 44858 gene locus_tag LOCUS_04190 44400 44858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 46146 44902 gene locus_tag LOCUS_04200 46146 44902 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404919.1 protein_id gnl|my_center|LOCUS_04200 46838 46143 gene locus_tag LOCUS_04210 46838 46143 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481692.1 protein_id gnl|my_center|LOCUS_04210 48029 46842 gene locus_tag LOCUS_04220 48029 46842 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214102.1 protein_id gnl|my_center|LOCUS_04220 48653 48039 gene locus_tag LOCUS_04230 48653 48039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 48731 49138 gene locus_tag LOCUS_04240 gene mgsA 48731 49138 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228922.1 protein_id gnl|my_center|LOCUS_04240 49191 49415 gene locus_tag LOCUS_04250 49191 49415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 49640 51328 gene locus_tag LOCUS_04260 49640 51328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 52526 51333 gene locus_tag LOCUS_04270 52526 51333 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909598.1 protein_id gnl|my_center|LOCUS_04270 52760 53920 gene locus_tag LOCUS_04280 52760 53920 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257690.1 protein_id gnl|my_center|LOCUS_04280 >Feature sequence008 112 2634 gene locus_tag LOCUS_04290 112 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 2650 3027 gene locus_tag LOCUS_04300 2650 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 3056 3250 gene locus_tag LOCUS_04310 3056 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 3416 4213 gene locus_tag LOCUS_04320 3416 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 4306 4446 gene locus_tag LOCUS_04330 4306 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 4456 5031 gene locus_tag LOCUS_04340 4456 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 5120 5806 gene locus_tag LOCUS_04350 5120 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 5962 7716 gene locus_tag LOCUS_04360 gene aspS 5962 7716 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172809.1 protein_id gnl|my_center|LOCUS_04360 7735 8637 gene locus_tag LOCUS_04370 7735 8637 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172808.1 protein_id gnl|my_center|LOCUS_04370 8634 9446 gene locus_tag LOCUS_04380 8634 9446 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228138.1 protein_id gnl|my_center|LOCUS_04380 10705 9521 gene locus_tag LOCUS_04390 10705 9521 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228133.1 protein_id gnl|my_center|LOCUS_04390 12145 10799 gene locus_tag LOCUS_04400 gene rho 12145 10799 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173142.1 protein_id gnl|my_center|LOCUS_04400 12805 12155 gene locus_tag LOCUS_04410 gene fsa 12805 12155 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228415.1 protein_id gnl|my_center|LOCUS_04410 13232 16513 gene locus_tag LOCUS_04420 gene ileS 13232 16513 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887976.1 protein_id gnl|my_center|LOCUS_04420 16676 17110 gene locus_tag LOCUS_04430 16676 17110 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632164.1 protein_id gnl|my_center|LOCUS_04430 17113 17904 gene locus_tag LOCUS_04440 17113 17904 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227823.1 protein_id gnl|my_center|LOCUS_04440 18883 17897 gene locus_tag LOCUS_04450 18883 17897 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173595.1 protein_id gnl|my_center|LOCUS_04450 21381 18943 gene locus_tag LOCUS_04460 gene lon 21381 18943 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228447.1 protein_id gnl|my_center|LOCUS_04460 21523 22449 gene locus_tag LOCUS_04470 21523 22449 CDS product DUF1517 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228448.1 protein_id gnl|my_center|LOCUS_04470 22900 22418 gene locus_tag LOCUS_04480 22900 22418 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_04480 23029 25362 gene locus_tag LOCUS_04490 23029 25362 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815004.1 protein_id gnl|my_center|LOCUS_04490 25359 26123 gene locus_tag LOCUS_04500 25359 26123 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_04500 26124 26609 gene locus_tag LOCUS_04510 26124 26609 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815019.1 protein_id gnl|my_center|LOCUS_04510 26606 27436 gene locus_tag LOCUS_04520 26606 27436 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815000.1 protein_id gnl|my_center|LOCUS_04520 27437 28618 gene locus_tag LOCUS_04530 27437 28618 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064927.1 protein_id gnl|my_center|LOCUS_04530 28647 30263 gene locus_tag LOCUS_04540 28647 30263 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814996.1 protein_id gnl|my_center|LOCUS_04540 30266 30673 gene locus_tag LOCUS_04550 30266 30673 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_04550 30683 31912 gene locus_tag LOCUS_04560 gene kynU 30683 31912 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338098.1 protein_id gnl|my_center|LOCUS_04560 31912 32736 gene locus_tag LOCUS_04570 gene kynA 31912 32736 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889598.1 protein_id gnl|my_center|LOCUS_04570 32777 33943 gene locus_tag LOCUS_04580 32777 33943 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040565.1 protein_id gnl|my_center|LOCUS_04580 33947 34867 gene locus_tag LOCUS_04590 33947 34867 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815013.1 protein_id gnl|my_center|LOCUS_04590 34878 35789 gene locus_tag LOCUS_04600 34878 35789 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040564.1 protein_id gnl|my_center|LOCUS_04600 35786 36538 gene locus_tag LOCUS_04610 35786 36538 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_04610 36535 37245 gene locus_tag LOCUS_04620 36535 37245 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_04620 37242 38054 gene locus_tag LOCUS_04630 37242 38054 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870818.1 protein_id gnl|my_center|LOCUS_04630 39939 38056 gene locus_tag LOCUS_04640 gene acs 39939 38056 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228547.1 protein_id gnl|my_center|LOCUS_04640 42601 39950 gene locus_tag LOCUS_04650 42601 39950 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228546.1 protein_id gnl|my_center|LOCUS_04650 42828 44774 gene locus_tag LOCUS_04660 gene acs 42828 44774 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228545.1 protein_id gnl|my_center|LOCUS_04660 44835 45485 gene locus_tag LOCUS_04670 44835 45485 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228340.1 protein_id gnl|my_center|LOCUS_04670 45644 46171 gene locus_tag LOCUS_04680 45644 46171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 46649 46176 gene locus_tag LOCUS_04690 gene hpaR 46649 46176 CDS product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085755.1 protein_id gnl|my_center|LOCUS_04690 46765 47706 gene locus_tag LOCUS_04700 gene hpaI 46765 47706 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228326.1 protein_id gnl|my_center|LOCUS_04700 47716 48510 gene locus_tag LOCUS_04710 47716 48510 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889485.1 protein_id gnl|my_center|LOCUS_04710 48507 50024 gene locus_tag LOCUS_04720 gene hpaE 48507 50024 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173038.1 protein_id gnl|my_center|LOCUS_04720 50037 51494 gene locus_tag LOCUS_04730 gene hpaB 50037 51494 CDS product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228328.1 protein_id gnl|my_center|LOCUS_04730 51498 51983 gene locus_tag LOCUS_04740 51498 51983 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228329.1 protein_id gnl|my_center|LOCUS_04740 51980 52948 gene locus_tag LOCUS_04750 gene hpaD 51980 52948 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479777.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence009 2497 2105 gene locus_tag LOCUS_04760 2497 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 2685 2612 gene locus_tag LOCUS_t00060 2685 2612 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3700 2735 gene locus_tag LOCUS_04770 3700 2735 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227902.1 protein_id gnl|my_center|LOCUS_04770 4798 3719 gene locus_tag LOCUS_04780 4798 3719 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227901.1 protein_id gnl|my_center|LOCUS_04780 5589 4837 gene locus_tag LOCUS_04790 gene tatC 5589 4837 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227900.1 protein_id gnl|my_center|LOCUS_04790 5847 5593 gene locus_tag LOCUS_04800 gene tatA 5847 5593 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631606.1 protein_id gnl|my_center|LOCUS_04800 7300 5870 gene locus_tag LOCUS_04810 gene glmU 7300 5870 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119056.1 protein_id gnl|my_center|LOCUS_04810 7403 7969 gene locus_tag LOCUS_04820 7403 7969 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228051.1 protein_id gnl|my_center|LOCUS_04820 8204 8019 gene locus_tag LOCUS_04830 8204 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 8527 8452 gene locus_tag LOCUS_t00070 8527 8452 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8945 8565 gene locus_tag LOCUS_04840 8945 8565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227697.1 protein_id gnl|my_center|LOCUS_04840 10433 9063 gene locus_tag LOCUS_04850 10433 9063 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227779.1 protein_id gnl|my_center|LOCUS_04850 10745 10452 gene locus_tag LOCUS_04860 10745 10452 CDS product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 protein_id gnl|my_center|LOCUS_04860 11872 10745 gene locus_tag LOCUS_04870 11872 10745 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_04870 12011 12907 gene locus_tag LOCUS_04880 12011 12907 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926022.1 protein_id gnl|my_center|LOCUS_04880 12937 13755 gene locus_tag LOCUS_04890 12937 13755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 13794 15020 gene locus_tag LOCUS_04900 13794 15020 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227721.1 protein_id gnl|my_center|LOCUS_04900 16194 15022 gene locus_tag LOCUS_04910 16194 15022 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174284.1 protein_id gnl|my_center|LOCUS_04910 16862 16236 gene locus_tag LOCUS_04920 gene trmH 16862 16236 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888841.1 protein_id gnl|my_center|LOCUS_04920 16895 17863 gene locus_tag LOCUS_04930 16895 17863 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644043.1 protein_id gnl|my_center|LOCUS_04930 18501 17860 gene locus_tag LOCUS_04940 gene hisG 18501 17860 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174220.1 protein_id gnl|my_center|LOCUS_04940 20455 18908 gene locus_tag LOCUS_04950 20455 18908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 20804 20391 gene locus_tag LOCUS_04960 20804 20391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 21845 20889 gene locus_tag LOCUS_04970 21845 20889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 22684 22163 gene locus_tag LOCUS_04980 22684 22163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 23124 22738 gene locus_tag LOCUS_04990 23124 22738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 23436 23765 gene locus_tag LOCUS_05000 23436 23765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 23788 25008 gene locus_tag LOCUS_05010 23788 25008 CDS product putative peptide maturation dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053194.1 protein_id gnl|my_center|LOCUS_05010 25040 25945 gene locus_tag LOCUS_05020 25040 25945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227226.1 protein_id gnl|my_center|LOCUS_05020 25917 26636 gene locus_tag LOCUS_05030 25917 26636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 26674 28341 gene locus_tag LOCUS_05040 26674 28341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 28724 28338 gene locus_tag LOCUS_05050 28724 28338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 29091 28834 gene locus_tag LOCUS_05060 29091 28834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 29953 29183 gene locus_tag LOCUS_05070 29953 29183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 30882 29932 gene locus_tag LOCUS_05080 30882 29932 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173018.1 protein_id gnl|my_center|LOCUS_05080 32572 30905 gene locus_tag LOCUS_05090 32572 30905 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350502.1 protein_id gnl|my_center|LOCUS_05090 33275 32679 gene locus_tag LOCUS_05100 33275 32679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 33509 33649 gene locus_tag LOCUS_05110 33509 33649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 35234 33630 gene locus_tag LOCUS_05120 35234 33630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384484.1 protein_id gnl|my_center|LOCUS_05120 35699 35265 gene locus_tag LOCUS_05130 35699 35265 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633600.1 protein_id gnl|my_center|LOCUS_05130 35944 35699 gene locus_tag LOCUS_05140 35944 35699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 37477 35987 gene locus_tag LOCUS_05150 37477 35987 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174141.1 protein_id gnl|my_center|LOCUS_05150 37537 37806 gene locus_tag LOCUS_05160 37537 37806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174054.1 protein_id gnl|my_center|LOCUS_05160 37803 38705 gene locus_tag LOCUS_05170 37803 38705 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174053.1 protein_id gnl|my_center|LOCUS_05170 38814 39020 gene locus_tag LOCUS_05180 38814 39020 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888716.1 protein_id gnl|my_center|LOCUS_05180 40876 39038 gene locus_tag LOCUS_05190 40876 39038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228185.1 protein_id gnl|my_center|LOCUS_05190 41196 42398 gene locus_tag LOCUS_05200 41196 42398 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174122.1 protein_id gnl|my_center|LOCUS_05200 43522 42395 gene locus_tag LOCUS_05210 43522 42395 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174133.1 protein_id gnl|my_center|LOCUS_05210 44005 43568 gene locus_tag LOCUS_05220 44005 43568 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174132.1 protein_id gnl|my_center|LOCUS_05220 45955 44357 gene locus_tag LOCUS_05230 45955 44357 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227781.1 protein_id gnl|my_center|LOCUS_05230 46289 45948 gene locus_tag LOCUS_05240 46289 45948 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227782.1 protein_id gnl|my_center|LOCUS_05240 47033 46380 gene locus_tag LOCUS_05250 47033 46380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 47751 47071 gene locus_tag LOCUS_05260 47751 47071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 >Feature sequence010 3243 2029 gene locus_tag LOCUS_05270 gene tig 3243 2029 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228070.1 protein_id gnl|my_center|LOCUS_05270 3368 4534 gene locus_tag LOCUS_05280 3368 4534 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227775.1 protein_id gnl|my_center|LOCUS_05280 4579 6900 gene locus_tag LOCUS_05290 4579 6900 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176758209.1 protein_id gnl|my_center|LOCUS_05290 7442 7008 gene locus_tag LOCUS_05300 7442 7008 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227792.1 protein_id gnl|my_center|LOCUS_05300 7673 8782 gene locus_tag LOCUS_05310 7673 8782 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227793.1 protein_id gnl|my_center|LOCUS_05310 8793 9767 gene locus_tag LOCUS_05320 8793 9767 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227794.1 protein_id gnl|my_center|LOCUS_05320 9777 11156 gene locus_tag LOCUS_05330 9777 11156 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227796.1 protein_id gnl|my_center|LOCUS_05330 11212 12606 gene locus_tag LOCUS_05340 gene lpdA 11212 12606 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118855.1 protein_id gnl|my_center|LOCUS_05340 12630 13184 gene locus_tag LOCUS_05350 12630 13184 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228504.1 protein_id gnl|my_center|LOCUS_05350 14404 13181 gene locus_tag LOCUS_05360 14404 13181 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397312.1 protein_id gnl|my_center|LOCUS_05360 14488 15339 gene locus_tag LOCUS_05370 14488 15339 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173573.1 protein_id gnl|my_center|LOCUS_05370 15655 15341 gene locus_tag LOCUS_05380 15655 15341 CDS product FUN14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926073.1 protein_id gnl|my_center|LOCUS_05380 16535 15687 gene locus_tag LOCUS_05390 16535 15687 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097527.1 protein_id gnl|my_center|LOCUS_05390 17156 16596 gene locus_tag LOCUS_05400 17156 16596 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_05400 17221 17712 gene locus_tag LOCUS_05410 gene ispF 17221 17712 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228919.1 protein_id gnl|my_center|LOCUS_05410 17812 18180 gene locus_tag LOCUS_05420 17812 18180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632112.1 protein_id gnl|my_center|LOCUS_05420 18222 18839 gene locus_tag LOCUS_05430 18222 18839 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228142.1 protein_id gnl|my_center|LOCUS_05430 18836 19741 gene locus_tag LOCUS_05440 18836 19741 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764892.1 protein_id gnl|my_center|LOCUS_05440 21239 19731 gene locus_tag LOCUS_05450 gene purH 21239 19731 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479694.1 protein_id gnl|my_center|LOCUS_05450 21280 21675 gene locus_tag LOCUS_05460 21280 21675 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172957.1 protein_id gnl|my_center|LOCUS_05460 22390 22824 gene locus_tag LOCUS_05470 gene mraZ 22390 22824 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632499.1 protein_id gnl|my_center|LOCUS_05470 22861 23709 gene locus_tag LOCUS_05480 gene rsmH 22861 23709 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228422.1 protein_id gnl|my_center|LOCUS_05480 23706 23966 gene locus_tag LOCUS_05490 23706 23966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 24023 25369 gene locus_tag LOCUS_05500 24023 25369 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173152.1 protein_id gnl|my_center|LOCUS_05500 25425 26699 gene locus_tag LOCUS_05510 25425 26699 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228423.1 protein_id gnl|my_center|LOCUS_05510 26696 27457 gene locus_tag LOCUS_05520 26696 27457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 27454 28323 gene locus_tag LOCUS_05530 27454 28323 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228425.1 protein_id gnl|my_center|LOCUS_05530 28320 29594 gene locus_tag LOCUS_05540 gene murD 28320 29594 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173156.1 protein_id gnl|my_center|LOCUS_05540 29569 30687 gene locus_tag LOCUS_05550 29569 30687 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228426.1 protein_id gnl|my_center|LOCUS_05550 30684 31730 gene locus_tag LOCUS_05560 gene murG 30684 31730 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103107.1 protein_id gnl|my_center|LOCUS_05560 31727 33100 gene locus_tag LOCUS_05570 gene murC 31727 33100 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228428.1 protein_id gnl|my_center|LOCUS_05570 33097 33930 gene locus_tag LOCUS_05580 33097 33930 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228429.1 protein_id gnl|my_center|LOCUS_05580 33927 34580 gene locus_tag LOCUS_05590 33927 34580 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632515.1 protein_id gnl|my_center|LOCUS_05590 34577 35839 gene locus_tag LOCUS_05600 gene ftsA 34577 35839 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228430.1 protein_id gnl|my_center|LOCUS_05600 35850 36914 gene locus_tag LOCUS_05610 gene ftsZ 35850 36914 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173163.1 protein_id gnl|my_center|LOCUS_05610 36950 37444 gene locus_tag LOCUS_05620 gene ruvC 36950 37444 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173164.1 protein_id gnl|my_center|LOCUS_05620 37472 38845 gene locus_tag LOCUS_05630 37472 38845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 38856 39416 gene locus_tag LOCUS_05640 38856 39416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 39470 39772 gene locus_tag LOCUS_05650 gene clpS 39470 39772 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479522.1 protein_id gnl|my_center|LOCUS_05650 39827 42064 gene locus_tag LOCUS_05660 gene clpA 39827 42064 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975287.1 protein_id gnl|my_center|LOCUS_05660 42596 42057 gene locus_tag LOCUS_05670 gene infC 42596 42057 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014629997.1 protein_id gnl|my_center|LOCUS_05670 43662 42691 gene locus_tag LOCUS_05680 43662 42691 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228819.1 protein_id gnl|my_center|LOCUS_05680 44005 43679 gene locus_tag LOCUS_05690 44005 43679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 >Feature sequence011 693 1136 gene locus_tag LOCUS_05700 693 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 1582 1148 gene locus_tag LOCUS_05710 1582 1148 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227839.1 protein_id gnl|my_center|LOCUS_05710 1741 2850 gene locus_tag LOCUS_05720 1741 2850 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228908.1 protein_id gnl|my_center|LOCUS_05720 2922 4322 gene locus_tag LOCUS_05730 2922 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 4801 4325 gene locus_tag LOCUS_05740 4801 4325 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173948.1 protein_id gnl|my_center|LOCUS_05740 5902 4820 gene locus_tag LOCUS_05750 gene prfA 5902 4820 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173949.1 protein_id gnl|my_center|LOCUS_05750 6131 6697 gene locus_tag LOCUS_05760 6131 6697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 8067 6694 gene locus_tag LOCUS_05770 8067 6694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 7741 7647 gene locus_tag LOCUS_t00080 7741 7647 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9506 8241 gene locus_tag LOCUS_05780 gene bshA 9506 8241 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618804.1 protein_id gnl|my_center|LOCUS_05780 11136 9637 gene locus_tag LOCUS_05790 11136 9637 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228916.1 protein_id gnl|my_center|LOCUS_05790 12609 11182 gene locus_tag LOCUS_05800 12609 11182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 13290 12613 gene locus_tag LOCUS_05810 13290 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 14881 13349 gene locus_tag LOCUS_05820 14881 13349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 16453 14945 gene locus_tag LOCUS_05830 16453 14945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 16925 16461 gene locus_tag LOCUS_05840 16925 16461 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780691.1 protein_id gnl|my_center|LOCUS_05840 17050 19641 gene locus_tag LOCUS_05850 17050 19641 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926106.1 protein_id gnl|my_center|LOCUS_05850 19658 20851 gene locus_tag LOCUS_05860 19658 20851 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227876.1 protein_id gnl|my_center|LOCUS_05860 20889 21215 gene locus_tag LOCUS_05870 20889 21215 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118710.1 protein_id gnl|my_center|LOCUS_05870 21648 21217 gene locus_tag LOCUS_05880 21648 21217 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633255.1 protein_id gnl|my_center|LOCUS_05880 21729 22271 gene locus_tag LOCUS_05890 21729 22271 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633254.1 protein_id gnl|my_center|LOCUS_05890 22326 22862 gene locus_tag LOCUS_05900 22326 22862 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173652.1 protein_id gnl|my_center|LOCUS_05900 23509 22859 gene locus_tag LOCUS_05910 23509 22859 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037937.1 protein_id gnl|my_center|LOCUS_05910 25161 23536 gene locus_tag LOCUS_05920 25161 23536 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228394.1 protein_id gnl|my_center|LOCUS_05920 27181 25307 gene locus_tag LOCUS_05930 27181 25307 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227708.1 protein_id gnl|my_center|LOCUS_05930 27671 27174 gene locus_tag LOCUS_05940 27671 27174 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227870.1 protein_id gnl|my_center|LOCUS_05940 27712 28311 gene locus_tag LOCUS_05950 27712 28311 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173825.1 protein_id gnl|my_center|LOCUS_05950 28927 28301 gene locus_tag LOCUS_05960 28927 28301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 28990 29853 gene locus_tag LOCUS_05970 28990 29853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 29859 30719 gene locus_tag LOCUS_05980 gene purU 29859 30719 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228594.1 protein_id gnl|my_center|LOCUS_05980 30778 32016 gene locus_tag LOCUS_05990 30778 32016 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228593.1 protein_id gnl|my_center|LOCUS_05990 32022 32804 gene locus_tag LOCUS_06000 32022 32804 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888014.1 protein_id gnl|my_center|LOCUS_06000 32826 33119 gene locus_tag LOCUS_06010 32826 33119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 34885 33116 gene locus_tag LOCUS_06020 34885 33116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 35634 34900 gene locus_tag LOCUS_06030 35634 34900 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174522.1 protein_id gnl|my_center|LOCUS_06030 36573 35635 gene locus_tag LOCUS_06040 gene kdgK 36573 35635 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229211.1 protein_id gnl|my_center|LOCUS_06040 37606 36566 gene locus_tag LOCUS_06050 37606 36566 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229212.1 protein_id gnl|my_center|LOCUS_06050 38313 37603 gene locus_tag LOCUS_06060 38313 37603 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229213.1 protein_id gnl|my_center|LOCUS_06060 39664 38390 gene locus_tag LOCUS_06070 39664 38390 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229214.1 protein_id gnl|my_center|LOCUS_06070 40128 39655 gene locus_tag LOCUS_06080 40128 39655 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229215.1 protein_id gnl|my_center|LOCUS_06080 41103 40132 gene locus_tag LOCUS_06090 41103 40132 CDS product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229216.1 protein_id gnl|my_center|LOCUS_06090 41243 42016 gene locus_tag LOCUS_06100 41243 42016 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065249.1 protein_id gnl|my_center|LOCUS_06100 42064 42504 gene locus_tag LOCUS_06110 gene aroQ 42064 42504 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173409.1 protein_id gnl|my_center|LOCUS_06110 42501 42761 gene locus_tag LOCUS_06120 42501 42761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 43329 42733 gene locus_tag LOCUS_06130 43329 42733 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443401.1 protein_id gnl|my_center|LOCUS_06130 <43931 43326 gene locus_tag LOCUS_06140 <43931 43326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227789.1:biotin--[acetyl-CoA-carboxylase] ligase >Feature sequence012 560 1576 gene locus_tag LOCUS_06150 560 1576 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172571.1 protein_id gnl|my_center|LOCUS_06150 1618 2769 gene locus_tag LOCUS_06160 gene aroC 1618 2769 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228640.1 protein_id gnl|my_center|LOCUS_06160 2822 3382 gene locus_tag LOCUS_06170 2822 3382 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632876.1 protein_id gnl|my_center|LOCUS_06170 3363 4424 gene locus_tag LOCUS_06180 3363 4424 CDS product 3-dehydroquinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228641.1 protein_id gnl|my_center|LOCUS_06180 4467 5252 gene locus_tag LOCUS_06190 4467 5252 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633435.1 protein_id gnl|my_center|LOCUS_06190 5281 6657 gene locus_tag LOCUS_06200 5281 6657 CDS product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173723.1 protein_id gnl|my_center|LOCUS_06200 6703 7290 gene locus_tag LOCUS_06210 6703 7290 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173927.1 protein_id gnl|my_center|LOCUS_06210 8083 7307 gene locus_tag LOCUS_06220 gene uppP 8083 7307 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227754.1 protein_id gnl|my_center|LOCUS_06220 8153 8797 gene locus_tag LOCUS_06230 gene ispD 8153 8797 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174170.1 protein_id gnl|my_center|LOCUS_06230 8785 9612 gene locus_tag LOCUS_06240 gene ispE 8785 9612 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174171.1 protein_id gnl|my_center|LOCUS_06240 9768 10838 gene locus_tag LOCUS_06250 9768 10838 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228931.1 protein_id gnl|my_center|LOCUS_06250 10848 12446 gene locus_tag LOCUS_06260 10848 12446 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228930.1 protein_id gnl|my_center|LOCUS_06260 13346 12375 gene locus_tag LOCUS_06270 13346 12375 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228696.1 protein_id gnl|my_center|LOCUS_06270 14265 13336 gene locus_tag LOCUS_06280 14265 13336 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228695.1 protein_id gnl|my_center|LOCUS_06280 15417 14275 gene locus_tag LOCUS_06290 15417 14275 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173509.1 protein_id gnl|my_center|LOCUS_06290 15581 16045 gene locus_tag LOCUS_06300 15581 16045 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173658.1 protein_id gnl|my_center|LOCUS_06300 16650 16042 gene locus_tag LOCUS_06310 16650 16042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 17164 16688 gene locus_tag LOCUS_06320 17164 16688 CDS product cytochrome P460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941939.1 protein_id gnl|my_center|LOCUS_06320 17290 18570 gene locus_tag LOCUS_06330 17290 18570 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938462.1 protein_id gnl|my_center|LOCUS_06330 18579 19271 gene locus_tag LOCUS_06340 18579 19271 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228853.1 protein_id gnl|my_center|LOCUS_06340 19926 19261 gene locus_tag LOCUS_06350 19926 19261 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173838.1 protein_id gnl|my_center|LOCUS_06350 21621 19942 gene locus_tag LOCUS_06360 21621 19942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870027.1 protein_id gnl|my_center|LOCUS_06360 22778 21618 gene locus_tag LOCUS_06370 22778 21618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142706.1 protein_id gnl|my_center|LOCUS_06370 23618 22833 gene locus_tag LOCUS_06380 gene lpxA 23618 22833 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925190.1 protein_id gnl|my_center|LOCUS_06380 24079 23615 gene locus_tag LOCUS_06390 gene fabZ 24079 23615 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173839.1 protein_id gnl|my_center|LOCUS_06390 25035 24076 gene locus_tag LOCUS_06400 25035 24076 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140212.1 protein_id gnl|my_center|LOCUS_06400 25876 25106 gene locus_tag LOCUS_06410 gene lpxC 25876 25106 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057627.1 protein_id gnl|my_center|LOCUS_06410 26865 25876 gene locus_tag LOCUS_06420 gene lpxD 26865 25876 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771660.1 protein_id gnl|my_center|LOCUS_06420 26049 25956 gene locus_tag LOCUS_t00090 26049 25956 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27924 26878 gene locus_tag LOCUS_06430 27924 26878 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173840.1 protein_id gnl|my_center|LOCUS_06430 28405 27968 gene locus_tag LOCUS_06440 28405 27968 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228583.1 protein_id gnl|my_center|LOCUS_06440 28633 29607 gene locus_tag LOCUS_06450 28633 29607 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227811.1 protein_id gnl|my_center|LOCUS_06450 29663 30574 gene locus_tag LOCUS_06460 gene pstC 29663 30574 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227812.1 protein_id gnl|my_center|LOCUS_06460 30574 31791 gene locus_tag LOCUS_06470 gene pstA 30574 31791 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018110995.1 protein_id gnl|my_center|LOCUS_06470 31794 32603 gene locus_tag LOCUS_06480 gene pstB 31794 32603 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227814.1 protein_id gnl|my_center|LOCUS_06480 33823 32606 gene locus_tag LOCUS_06490 33823 32606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 33892 35382 gene locus_tag LOCUS_06500 gene glpK 33892 35382 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888563.1 protein_id gnl|my_center|LOCUS_06500 35432 35770 gene locus_tag LOCUS_06510 35432 35770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 36210 35806 gene locus_tag LOCUS_06520 36210 35806 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228279.1 protein_id gnl|my_center|LOCUS_06520 36372 36728 gene locus_tag LOCUS_06530 36372 36728 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479704.1 protein_id gnl|my_center|LOCUS_06530 36730 37197 gene locus_tag LOCUS_06540 36730 37197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 37201 37956 gene locus_tag LOCUS_06550 37201 37956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 37953 40211 gene locus_tag LOCUS_06560 37953 40211 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889613.1 protein_id gnl|my_center|LOCUS_06560 40224 42539 gene locus_tag LOCUS_06570 40224 42539 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889613.1 protein_id gnl|my_center|LOCUS_06570 >Feature sequence013 1520 627 gene locus_tag LOCUS_06580 1520 627 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228102.1 protein_id gnl|my_center|LOCUS_06580 1895 1527 gene locus_tag LOCUS_06590 1895 1527 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173441.1 protein_id gnl|my_center|LOCUS_06590 1914 3287 gene locus_tag LOCUS_06600 gene rsmF 1914 3287 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228642.1 protein_id gnl|my_center|LOCUS_06600 3398 4420 gene locus_tag LOCUS_06610 gene prfB 3398 4420 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509818.1 protein_id gnl|my_center|LOCUS_06610 5963 4440 gene locus_tag LOCUS_06620 5963 4440 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479959.1 protein_id gnl|my_center|LOCUS_06620 6375 8576 gene locus_tag LOCUS_06630 6375 8576 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172629.1 protein_id gnl|my_center|LOCUS_06630 9093 8584 gene locus_tag LOCUS_06640 9093 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 9193 10383 gene locus_tag LOCUS_06650 9193 10383 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884513.1 protein_id gnl|my_center|LOCUS_06650 10420 12675 gene locus_tag LOCUS_06660 10420 12675 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173320.1 protein_id gnl|my_center|LOCUS_06660 12712 14025 gene locus_tag LOCUS_06670 gene mnmE 12712 14025 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228302.1 protein_id gnl|my_center|LOCUS_06670 14029 14541 gene locus_tag LOCUS_06680 14029 14541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 14559 16124 gene locus_tag LOCUS_06690 14559 16124 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228222.1 protein_id gnl|my_center|LOCUS_06690 16809 16141 gene locus_tag LOCUS_06700 gene mnmD 16809 16141 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228263.1 protein_id gnl|my_center|LOCUS_06700 18223 16799 gene locus_tag LOCUS_06710 18223 16799 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_06710 18284 18580 gene locus_tag LOCUS_06720 gene gatC 18284 18580 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_06720 18583 19854 gene locus_tag LOCUS_06730 gene serS 18583 19854 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228260.1 protein_id gnl|my_center|LOCUS_06730 20284 19991 gene locus_tag LOCUS_06740 gene rpsT 20284 19991 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228650.1 protein_id gnl|my_center|LOCUS_06740 21504 20374 gene locus_tag LOCUS_06750 gene wecB 21504 20374 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119483.1 protein_id gnl|my_center|LOCUS_06750 23927 21507 gene locus_tag LOCUS_06760 gene gyrA 23927 21507 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632827.1 protein_id gnl|my_center|LOCUS_06760 24109 25122 gene locus_tag LOCUS_06770 24109 25122 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228184.1 protein_id gnl|my_center|LOCUS_06770 25248 26585 gene locus_tag LOCUS_06780 25248 26585 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_06780 26653 28155 gene locus_tag LOCUS_06790 gene malQ 26653 28155 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173324.1 protein_id gnl|my_center|LOCUS_06790 28165 28599 gene locus_tag LOCUS_06800 28165 28599 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228760.1 protein_id gnl|my_center|LOCUS_06800 28934 28554 gene locus_tag LOCUS_06810 28934 28554 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014629200.1 protein_id gnl|my_center|LOCUS_06810 29425 28940 gene locus_tag LOCUS_06820 29425 28940 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036024.1 protein_id gnl|my_center|LOCUS_06820 30221 29427 gene locus_tag LOCUS_06830 30221 29427 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889254.1 protein_id gnl|my_center|LOCUS_06830 31101 30241 gene locus_tag LOCUS_06840 31101 30241 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228584.1 protein_id gnl|my_center|LOCUS_06840 32449 31127 gene locus_tag LOCUS_06850 gene miaB 32449 31127 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143591337.1 protein_id gnl|my_center|LOCUS_06850 32561 33169 gene locus_tag LOCUS_06860 32561 33169 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525154.1 protein_id gnl|my_center|LOCUS_06860 33172 34173 gene locus_tag LOCUS_06870 33172 34173 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929310.1 protein_id gnl|my_center|LOCUS_06870 34206 34766 gene locus_tag LOCUS_06880 34206 34766 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227762.1 protein_id gnl|my_center|LOCUS_06880 34782 35582 gene locus_tag LOCUS_06890 gene moeB 34782 35582 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228615.1 protein_id gnl|my_center|LOCUS_06890 35630 36772 gene locus_tag LOCUS_06900 35630 36772 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228614.1 protein_id gnl|my_center|LOCUS_06900 37266 36829 gene locus_tag LOCUS_06910 37266 36829 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173262.1 protein_id gnl|my_center|LOCUS_06910 37649 37338 gene locus_tag LOCUS_06920 37649 37338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173263.1 protein_id gnl|my_center|LOCUS_06920 37629 38042 gene locus_tag LOCUS_06930 37629 38042 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227991.1 protein_id gnl|my_center|LOCUS_06930 38883 38224 gene locus_tag LOCUS_06940 38883 38224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 39074 40123 gene locus_tag LOCUS_06950 39074 40123 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228099.1 protein_id gnl|my_center|LOCUS_06950 40131 40751 gene locus_tag LOCUS_06960 40131 40751 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172747.1 protein_id gnl|my_center|LOCUS_06960 40865 41236 gene locus_tag LOCUS_06970 40865 41236 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173351.1 protein_id gnl|my_center|LOCUS_06970 41712 41233 gene locus_tag LOCUS_06980 41712 41233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence014 150 226 gene locus_tag LOCUS_t00100 150 226 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 292 1320 gene locus_tag LOCUS_06990 gene rlmN 292 1320 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229030.1 protein_id gnl|my_center|LOCUS_06990 1335 1826 gene locus_tag LOCUS_07000 1335 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 1863 2702 gene locus_tag LOCUS_07010 gene rapZ 1863 2702 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227857.1 protein_id gnl|my_center|LOCUS_07010 2699 4024 gene locus_tag LOCUS_07020 2699 4024 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174031.1 protein_id gnl|my_center|LOCUS_07020 4021 4707 gene locus_tag LOCUS_07030 4021 4707 CDS product glucodextranase DOMON-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227856.1 protein_id gnl|my_center|LOCUS_07030 5141 4704 gene locus_tag LOCUS_07040 5141 4704 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174003.1 protein_id gnl|my_center|LOCUS_07040 5957 5235 gene locus_tag LOCUS_07050 5957 5235 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228885.1 protein_id gnl|my_center|LOCUS_07050 7595 6000 gene locus_tag LOCUS_07060 7595 6000 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918873.1 protein_id gnl|my_center|LOCUS_07060 8926 7592 gene locus_tag LOCUS_07070 8926 7592 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457391.1 protein_id gnl|my_center|LOCUS_07070 9935 8937 gene locus_tag LOCUS_07080 9935 8937 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082568.1 protein_id gnl|my_center|LOCUS_07080 10856 10017 gene locus_tag LOCUS_07090 10856 10017 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775955.1 protein_id gnl|my_center|LOCUS_07090 11841 10858 gene locus_tag LOCUS_07100 11841 10858 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028590.1 protein_id gnl|my_center|LOCUS_07100 13167 11935 gene locus_tag LOCUS_07110 13167 11935 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972798.1 protein_id gnl|my_center|LOCUS_07110 14298 13270 gene locus_tag LOCUS_07120 14298 13270 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921545.1 protein_id gnl|my_center|LOCUS_07120 14397 15221 gene locus_tag LOCUS_07130 14397 15221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173406.1 protein_id gnl|my_center|LOCUS_07130 15260 17044 gene locus_tag LOCUS_07140 15260 17044 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228613.1 protein_id gnl|my_center|LOCUS_07140 17048 18877 gene locus_tag LOCUS_07150 17048 18877 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228612.1 protein_id gnl|my_center|LOCUS_07150 18925 19590 gene locus_tag LOCUS_07160 18925 19590 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228657.1 protein_id gnl|my_center|LOCUS_07160 19750 20442 gene locus_tag LOCUS_07170 gene ccsA 19750 20442 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228656.1 protein_id gnl|my_center|LOCUS_07170 20444 20572 gene locus_tag LOCUS_07180 20444 20572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 20569 21000 gene locus_tag LOCUS_07190 gene ccmE 20569 21000 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228655.1 protein_id gnl|my_center|LOCUS_07190 20997 22988 gene locus_tag LOCUS_07200 20997 22988 CDS product cytochrome c-type biogenesis CcmF C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228654.1 protein_id gnl|my_center|LOCUS_07200 22991 23515 gene locus_tag LOCUS_07210 22991 23515 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228871.1 protein_id gnl|my_center|LOCUS_07210 23512 23976 gene locus_tag LOCUS_07220 23512 23976 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228652.1 protein_id gnl|my_center|LOCUS_07220 23973 24962 gene locus_tag LOCUS_07230 23973 24962 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228651.1 protein_id gnl|my_center|LOCUS_07230 24959 25540 gene locus_tag LOCUS_07240 24959 25540 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173451.1 protein_id gnl|my_center|LOCUS_07240 26853 25603 gene locus_tag LOCUS_07250 26853 25603 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388984.1 protein_id gnl|my_center|LOCUS_07250 26968 27603 gene locus_tag LOCUS_07260 26968 27603 CDS product DUF2847 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888467.1 protein_id gnl|my_center|LOCUS_07260 27620 28510 gene locus_tag LOCUS_07270 27620 28510 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227675.1 protein_id gnl|my_center|LOCUS_07270 29394 28522 gene locus_tag LOCUS_07280 29394 28522 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838714.1 protein_id gnl|my_center|LOCUS_07280 30531 29404 gene locus_tag LOCUS_07290 30531 29404 CDS product VLRF1 family aeRF1-type release factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228710.1 protein_id gnl|my_center|LOCUS_07290 30639 31391 gene locus_tag LOCUS_07300 30639 31391 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228802.1 protein_id gnl|my_center|LOCUS_07300 31391 32014 gene locus_tag LOCUS_07310 gene tmk 31391 32014 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886759.1 protein_id gnl|my_center|LOCUS_07310 32050 32802 gene locus_tag LOCUS_07320 32050 32802 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_07320 32799 33296 gene locus_tag LOCUS_07330 32799 33296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 34274 33318 gene locus_tag LOCUS_07340 34274 33318 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887127.1 protein_id gnl|my_center|LOCUS_07340 34598 34368 gene locus_tag LOCUS_07350 34598 34368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 34701 35246 gene locus_tag LOCUS_07360 34701 35246 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228804.1 protein_id gnl|my_center|LOCUS_07360 36216 35233 gene locus_tag LOCUS_07370 36216 35233 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887494.1 protein_id gnl|my_center|LOCUS_07370 37438 36224 gene locus_tag LOCUS_07380 37438 36224 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174149.1 protein_id gnl|my_center|LOCUS_07380 37574 37500 gene locus_tag LOCUS_t00110 37574 37500 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 <38197 37649 gene locus_tag LOCUS_07390 <38197 37649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228871.1:TlpA disulfide reductase family protein >Feature sequence015 <1 1513 gene locus_tag LOCUS_07400 <1 1513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005168575.1:iron ABC transporter permease 1510 2538 gene locus_tag LOCUS_07410 1510 2538 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067487.1 protein_id gnl|my_center|LOCUS_07410 2585 3037 gene locus_tag LOCUS_07420 2585 3037 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172543.1 protein_id gnl|my_center|LOCUS_07420 3041 4204 gene locus_tag LOCUS_07430 3041 4204 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227949.1 protein_id gnl|my_center|LOCUS_07430 5189 4170 gene locus_tag LOCUS_07440 5189 4170 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328040.1 protein_id gnl|my_center|LOCUS_07440 5948 5205 gene locus_tag LOCUS_07450 5948 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187767772.1 protein_id gnl|my_center|LOCUS_07450 7188 6040 gene locus_tag LOCUS_07460 7188 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 7623 7192 gene locus_tag LOCUS_07470 7623 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 8336 7638 gene locus_tag LOCUS_07480 8336 7638 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173892.1 protein_id gnl|my_center|LOCUS_07480 8745 8359 gene locus_tag LOCUS_07490 8745 8359 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228981.1 protein_id gnl|my_center|LOCUS_07490 9599 8742 gene locus_tag LOCUS_07500 9599 8742 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228982.1 protein_id gnl|my_center|LOCUS_07500 10260 9610 gene locus_tag LOCUS_07510 gene aat 10260 9610 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920768.1 protein_id gnl|my_center|LOCUS_07510 12003 10270 gene locus_tag LOCUS_07520 12003 10270 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228000.1 protein_id gnl|my_center|LOCUS_07520 12948 12013 gene locus_tag LOCUS_07530 12948 12013 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227999.1 protein_id gnl|my_center|LOCUS_07530 14117 13053 gene locus_tag LOCUS_07540 14117 13053 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228080.1 protein_id gnl|my_center|LOCUS_07540 15430 14177 gene locus_tag LOCUS_07550 gene hslU 15430 14177 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172715.1 protein_id gnl|my_center|LOCUS_07550 15990 15427 gene locus_tag LOCUS_07560 gene hslV 15990 15427 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228081.1 protein_id gnl|my_center|LOCUS_07560 16852 16064 gene locus_tag LOCUS_07570 gene lepB 16852 16064 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228627.1 protein_id gnl|my_center|LOCUS_07570 17647 16898 gene locus_tag LOCUS_07580 17647 16898 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228628.1 protein_id gnl|my_center|LOCUS_07580 17758 18570 gene locus_tag LOCUS_07590 17758 18570 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228629.1 protein_id gnl|my_center|LOCUS_07590 18573 19409 gene locus_tag LOCUS_07600 18573 19409 CDS product metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228816.1 protein_id gnl|my_center|LOCUS_07600 19604 19530 gene locus_tag LOCUS_t00120 19604 19530 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 19654 20385 gene locus_tag LOCUS_07610 gene rph 19654 20385 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256154.1 protein_id gnl|my_center|LOCUS_07610 20396 21007 gene locus_tag LOCUS_07620 gene rdgB 20396 21007 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926068.1 protein_id gnl|my_center|LOCUS_07620 21055 21414 gene locus_tag LOCUS_07630 21055 21414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 21398 22153 gene locus_tag LOCUS_07640 21398 22153 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228179.1 protein_id gnl|my_center|LOCUS_07640 22787 22161 gene locus_tag LOCUS_07650 22787 22161 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028564.1 protein_id gnl|my_center|LOCUS_07650 22983 24110 gene locus_tag LOCUS_07660 22983 24110 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228048.1 protein_id gnl|my_center|LOCUS_07660 24206 25120 gene locus_tag LOCUS_07670 24206 25120 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172673.1 protein_id gnl|my_center|LOCUS_07670 25122 25907 gene locus_tag LOCUS_07680 25122 25907 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228047.1 protein_id gnl|my_center|LOCUS_07680 25920 26675 gene locus_tag LOCUS_07690 25920 26675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228046.1 protein_id gnl|my_center|LOCUS_07690 26672 28570 gene locus_tag LOCUS_07700 26672 28570 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228045.1 protein_id gnl|my_center|LOCUS_07700 28583 29653 gene locus_tag LOCUS_07710 28583 29653 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228044.1 protein_id gnl|my_center|LOCUS_07710 29692 30024 gene locus_tag LOCUS_07720 29692 30024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 30014 30478 gene locus_tag LOCUS_07730 gene nusB 30014 30478 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632549.1 protein_id gnl|my_center|LOCUS_07730 30544 31404 gene locus_tag LOCUS_07740 30544 31404 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228455.1 protein_id gnl|my_center|LOCUS_07740 31424 31873 gene locus_tag LOCUS_07750 31424 31873 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228454.1 protein_id gnl|my_center|LOCUS_07750 31910 32329 gene locus_tag LOCUS_07760 31910 32329 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228814.1 protein_id gnl|my_center|LOCUS_07760 32527 34491 gene locus_tag LOCUS_07770 gene thrS 32527 34491 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228977.1 protein_id gnl|my_center|LOCUS_07770 34965 34531 gene locus_tag LOCUS_07780 34965 34531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228226.1 protein_id gnl|my_center|LOCUS_07780 35089 35580 gene locus_tag LOCUS_07790 35089 35580 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228225.1 protein_id gnl|my_center|LOCUS_07790 35653 36084 gene locus_tag LOCUS_07800 35653 36084 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228225.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence016 55 2424 gene locus_tag LOCUS_07810 gene ppsA 55 2424 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888362.1 protein_id gnl|my_center|LOCUS_07810 3353 2445 gene locus_tag LOCUS_07820 3353 2445 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109873241.1 protein_id gnl|my_center|LOCUS_07820 3461 4495 gene locus_tag LOCUS_07830 3461 4495 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222692.1 protein_id gnl|my_center|LOCUS_07830 4507 5358 gene locus_tag LOCUS_07840 4507 5358 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174448.1 protein_id gnl|my_center|LOCUS_07840 5416 6420 gene locus_tag LOCUS_07850 5416 6420 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259668.1 protein_id gnl|my_center|LOCUS_07850 6441 6854 gene locus_tag LOCUS_07860 6441 6854 CDS product DUF2255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975039.1 protein_id gnl|my_center|LOCUS_07860 7268 7669 gene locus_tag LOCUS_07870 7268 7669 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070690482.1 protein_id gnl|my_center|LOCUS_07870 8590 7784 gene locus_tag LOCUS_07880 8590 7784 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_07880 9450 8623 gene locus_tag LOCUS_07890 gene iolB 9450 8623 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196071.1 protein_id gnl|my_center|LOCUS_07890 10451 9447 gene locus_tag LOCUS_07900 gene iolG 10451 9447 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_07900 11277 10465 gene locus_tag LOCUS_07910 11277 10465 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529508.1 protein_id gnl|my_center|LOCUS_07910 12284 11277 gene locus_tag LOCUS_07920 12284 11277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 13221 12295 gene locus_tag LOCUS_07930 13221 12295 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223781.1 protein_id gnl|my_center|LOCUS_07930 15107 13230 gene locus_tag LOCUS_07940 gene iolD 15107 13230 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_07940 16111 15104 gene locus_tag LOCUS_07950 gene iolX 16111 15104 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244942.1 protein_id gnl|my_center|LOCUS_07950 16960 16118 gene locus_tag LOCUS_07960 16960 16118 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193469.1 protein_id gnl|my_center|LOCUS_07960 17997 16963 gene locus_tag LOCUS_07970 17997 16963 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192697.1 protein_id gnl|my_center|LOCUS_07970 18995 18081 gene locus_tag LOCUS_07980 18995 18081 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223780.1 protein_id gnl|my_center|LOCUS_07980 20767 19229 gene locus_tag LOCUS_07990 gene serA 20767 19229 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228321.1 protein_id gnl|my_center|LOCUS_07990 20979 21818 gene locus_tag LOCUS_08000 20979 21818 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228320.1 protein_id gnl|my_center|LOCUS_08000 21889 22575 gene locus_tag LOCUS_08010 21889 22575 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256366.1 protein_id gnl|my_center|LOCUS_08010 23451 22627 gene locus_tag LOCUS_08020 23451 22627 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_08020 24451 23444 gene locus_tag LOCUS_08030 24451 23444 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096543.1 protein_id gnl|my_center|LOCUS_08030 26069 24501 gene locus_tag LOCUS_08040 26069 24501 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139954.1 protein_id gnl|my_center|LOCUS_08040 26204 26527 gene locus_tag LOCUS_08050 26204 26527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 26929 26540 gene locus_tag LOCUS_08060 26929 26540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 27299 29461 gene locus_tag LOCUS_08070 27299 29461 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018112090.1 protein_id gnl|my_center|LOCUS_08070 29976 29458 gene locus_tag LOCUS_08080 29976 29458 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501457.1 protein_id gnl|my_center|LOCUS_08080 30550 29969 gene locus_tag LOCUS_08090 30550 29969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 30977 30570 gene locus_tag LOCUS_08100 30977 30570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 32464 31040 gene locus_tag LOCUS_08110 gene pyk 32464 31040 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227631.1 protein_id gnl|my_center|LOCUS_08110 33759 32485 gene locus_tag LOCUS_08120 gene eno 33759 32485 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173981.1 protein_id gnl|my_center|LOCUS_08120 34919 33834 gene locus_tag LOCUS_08130 gene dnaN 34919 33834 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227630.1 protein_id gnl|my_center|LOCUS_08130 36666 35341 gene locus_tag LOCUS_08140 gene dnaA 36666 35341 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229057.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence017 2020 908 gene locus_tag LOCUS_08150 2020 908 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227994.1 protein_id gnl|my_center|LOCUS_08150 2498 2031 gene locus_tag LOCUS_08160 gene purE 2498 2031 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_08160 2694 4139 gene locus_tag LOCUS_08170 2694 4139 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_08170 4232 5200 gene locus_tag LOCUS_08180 4232 5200 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_08180 5200 5502 gene locus_tag LOCUS_08190 5200 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227996.1 protein_id gnl|my_center|LOCUS_08190 5518 6417 gene locus_tag LOCUS_08200 5518 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173196.1 protein_id gnl|my_center|LOCUS_08200 9988 6398 gene locus_tag LOCUS_08210 9988 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 10058 10495 gene locus_tag LOCUS_08220 10058 10495 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172943.1 protein_id gnl|my_center|LOCUS_08220 10640 12082 gene locus_tag LOCUS_08230 gene cysS 10640 12082 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228277.1 protein_id gnl|my_center|LOCUS_08230 12809 12132 gene locus_tag LOCUS_08240 12809 12132 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228280.1 protein_id gnl|my_center|LOCUS_08240 13246 12974 gene locus_tag LOCUS_08250 13246 12974 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630673.1 protein_id gnl|my_center|LOCUS_08250 13546 18042 gene locus_tag LOCUS_08260 13546 18042 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228702.1 protein_id gnl|my_center|LOCUS_08260 18067 18618 gene locus_tag LOCUS_08270 18067 18618 CDS product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119613.1 protein_id gnl|my_center|LOCUS_08270 18655 19434 gene locus_tag LOCUS_08280 18655 19434 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227838.1 protein_id gnl|my_center|LOCUS_08280 20031 19450 gene locus_tag LOCUS_08290 gene ruvA 20031 19450 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174059.1 protein_id gnl|my_center|LOCUS_08290 20837 20067 gene locus_tag LOCUS_08300 20837 20067 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_08300 21617 20847 gene locus_tag LOCUS_08310 21617 20847 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 protein_id gnl|my_center|LOCUS_08310 24406 21668 gene locus_tag LOCUS_08320 24406 21668 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228363.1 protein_id gnl|my_center|LOCUS_08320 24478 25344 gene locus_tag LOCUS_08330 gene ilvE 24478 25344 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_08330 26115 26384 gene locus_tag LOCUS_08340 26115 26384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 26396 31411 gene locus_tag LOCUS_08350 26396 31411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 31398 32381 gene locus_tag LOCUS_08360 31398 32381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 32381 32935 gene locus_tag LOCUS_08370 32381 32935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 32928 34463 gene locus_tag LOCUS_08380 32928 34463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 35114 35296 gene locus_tag LOCUS_08390 35114 35296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 35474 35656 gene locus_tag LOCUS_08400 35474 35656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 35656 36324 gene locus_tag LOCUS_08410 35656 36324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 36562 36487 gene locus_tag LOCUS_t00130 36562 36487 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence018 346 882 gene locus_tag LOCUS_08420 346 882 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173992.1 protein_id gnl|my_center|LOCUS_08420 984 3638 gene locus_tag LOCUS_08430 gene pilB 984 3638 CDS product type IV pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173991.1 protein_id gnl|my_center|LOCUS_08430 3966 4622 gene locus_tag LOCUS_08440 3966 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979847.1 protein_id gnl|my_center|LOCUS_08440 4635 5996 gene locus_tag LOCUS_08450 4635 5996 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258857.1 protein_id gnl|my_center|LOCUS_08450 8033 6000 gene locus_tag LOCUS_08460 gene paaZ 8033 6000 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889007.1 protein_id gnl|my_center|LOCUS_08460 9172 8174 gene locus_tag LOCUS_08470 9172 8174 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228309.1 protein_id gnl|my_center|LOCUS_08470 10269 9169 gene locus_tag LOCUS_08480 gene pdhA 10269 9169 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228310.1 protein_id gnl|my_center|LOCUS_08480 10825 10595 gene locus_tag LOCUS_08490 10825 10595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 10930 11610 gene locus_tag LOCUS_08500 10930 11610 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081747.1 protein_id gnl|my_center|LOCUS_08500 11736 12059 gene locus_tag LOCUS_08510 11736 12059 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256234.1 protein_id gnl|my_center|LOCUS_08510 12064 12858 gene locus_tag LOCUS_08520 12064 12858 CDS product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256233.1 protein_id gnl|my_center|LOCUS_08520 13447 12998 gene locus_tag LOCUS_08530 13447 12998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 13739 13479 gene locus_tag LOCUS_08540 13739 13479 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630832.1 protein_id gnl|my_center|LOCUS_08540 14534 13743 gene locus_tag LOCUS_08550 14534 13743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 14770 14537 gene locus_tag LOCUS_08560 14770 14537 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963400.1 protein_id gnl|my_center|LOCUS_08560 14869 16032 gene locus_tag LOCUS_08570 14869 16032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384854.1 protein_id gnl|my_center|LOCUS_08570 16029 16331 gene locus_tag LOCUS_08580 16029 16331 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229161.1 protein_id gnl|my_center|LOCUS_08580 17492 16368 gene locus_tag LOCUS_08590 17492 16368 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228311.1 protein_id gnl|my_center|LOCUS_08590 18258 17515 gene locus_tag LOCUS_08600 gene tpiA 18258 17515 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228317.1 protein_id gnl|my_center|LOCUS_08600 19621 18296 gene locus_tag LOCUS_08610 gene asnS 19621 18296 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228137.1 protein_id gnl|my_center|LOCUS_08610 19692 23414 gene locus_tag LOCUS_08620 19692 23414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 25072 23411 gene locus_tag LOCUS_08630 25072 23411 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228762.1 protein_id gnl|my_center|LOCUS_08630 25625 25104 gene locus_tag LOCUS_08640 25625 25104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 25774 27012 gene locus_tag LOCUS_08650 25774 27012 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031716.1 protein_id gnl|my_center|LOCUS_08650 28174 27017 gene locus_tag LOCUS_08660 28174 27017 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228716.1 protein_id gnl|my_center|LOCUS_08660 29068 28223 gene locus_tag LOCUS_08670 29068 28223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 29181 30512 gene locus_tag LOCUS_08680 gene der 29181 30512 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228645.1 protein_id gnl|my_center|LOCUS_08680 31564 30515 gene locus_tag LOCUS_08690 31564 30515 CDS product protease complex subunit PrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228610.1 protein_id gnl|my_center|LOCUS_08690 32676 31627 gene locus_tag LOCUS_08700 32676 31627 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228609.1 protein_id gnl|my_center|LOCUS_08700 33589 32669 gene locus_tag LOCUS_08710 33589 32669 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_08710 35214 33670 gene locus_tag LOCUS_08720 35214 33670 CDS product glutathione ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065212.1 protein_id gnl|my_center|LOCUS_08720 35459 35773 gene locus_tag LOCUS_08730 35459 35773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 35967 >36668 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccgcgtgtgcggggaatac >Feature sequence019 254 1273 gene locus_tag LOCUS_08740 254 1273 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_08740 1275 1928 gene locus_tag LOCUS_08750 gene fsa 1275 1928 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869995.1 protein_id gnl|my_center|LOCUS_08750 1925 2845 gene locus_tag LOCUS_08760 1925 2845 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583161.1 protein_id gnl|my_center|LOCUS_08760 2978 4453 gene locus_tag LOCUS_08770 2978 4453 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391605.1 protein_id gnl|my_center|LOCUS_08770 4541 5686 gene locus_tag LOCUS_08780 4541 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 5683 6699 gene locus_tag LOCUS_08790 5683 6699 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331878.1 protein_id gnl|my_center|LOCUS_08790 6696 7835 gene locus_tag LOCUS_08800 6696 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 7854 9161 gene locus_tag LOCUS_08810 7854 9161 CDS product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703671.1 protein_id gnl|my_center|LOCUS_08810 9163 10179 gene locus_tag LOCUS_08820 9163 10179 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083943.1 protein_id gnl|my_center|LOCUS_08820 10180 10920 gene locus_tag LOCUS_08830 10180 10920 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184824.1 protein_id gnl|my_center|LOCUS_08830 10932 11780 gene locus_tag LOCUS_08840 10932 11780 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703672.1 protein_id gnl|my_center|LOCUS_08840 11784 14123 gene locus_tag LOCUS_08850 11784 14123 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926008.1 protein_id gnl|my_center|LOCUS_08850 14134 15273 gene locus_tag LOCUS_08860 14134 15273 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633142.1 protein_id gnl|my_center|LOCUS_08860 15464 16276 gene locus_tag LOCUS_08870 15464 16276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 16320 17147 gene locus_tag LOCUS_08880 16320 17147 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250978.1 protein_id gnl|my_center|LOCUS_08880 17174 17896 gene locus_tag LOCUS_08890 17174 17896 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229019.1 protein_id gnl|my_center|LOCUS_08890 17893 19080 gene locus_tag LOCUS_08900 17893 19080 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229018.1 protein_id gnl|my_center|LOCUS_08900 19583 19077 gene locus_tag LOCUS_08910 19583 19077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08910 20211 19543 gene locus_tag LOCUS_08920 20211 19543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08920 20873 20241 gene locus_tag LOCUS_08930 20873 20241 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172947.1 protein_id gnl|my_center|LOCUS_08930 21887 20874 gene locus_tag LOCUS_08940 21887 20874 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228247.1 protein_id gnl|my_center|LOCUS_08940 23017 21884 gene locus_tag LOCUS_08950 gene dxr 23017 21884 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228248.1 protein_id gnl|my_center|LOCUS_08950 23902 23042 gene locus_tag LOCUS_08960 23902 23042 CDS product CDP-archaeol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172950.1 protein_id gnl|my_center|LOCUS_08960 24461 23904 gene locus_tag LOCUS_08970 gene frr 24461 23904 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172951.1 protein_id gnl|my_center|LOCUS_08970 25287 24553 gene locus_tag LOCUS_08980 gene pyrH 25287 24553 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172952.1 protein_id gnl|my_center|LOCUS_08980 25940 25350 gene locus_tag LOCUS_08990 gene tsf 25940 25350 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228249.1 protein_id gnl|my_center|LOCUS_08990 26693 25956 gene locus_tag LOCUS_09000 gene rpsB 26693 25956 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172954.1 protein_id gnl|my_center|LOCUS_09000 26859 26933 gene locus_tag LOCUS_t00140 26859 26933 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 27889 26960 gene locus_tag LOCUS_09010 27889 26960 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328036.1 protein_id gnl|my_center|LOCUS_09010 28744 27893 gene locus_tag LOCUS_09020 gene pheA 28744 27893 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_09020 28810 29832 gene locus_tag LOCUS_09030 28810 29832 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228441.1 protein_id gnl|my_center|LOCUS_09030 29901 30446 gene locus_tag LOCUS_09040 29901 30446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173176.1 protein_id gnl|my_center|LOCUS_09040 30443 31357 gene locus_tag LOCUS_09050 30443 31357 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228440.1 protein_id gnl|my_center|LOCUS_09050 31397 32047 gene locus_tag LOCUS_09060 31397 32047 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228620.1 protein_id gnl|my_center|LOCUS_09060 32086 32520 gene locus_tag LOCUS_09070 32086 32520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09070 32460 33449 gene locus_tag LOCUS_09080 32460 33449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09080 34432 33452 gene locus_tag LOCUS_09090 34432 33452 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479639.1 protein_id gnl|my_center|LOCUS_09090 34770 34441 gene locus_tag LOCUS_09100 34770 34441 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227887.1 protein_id gnl|my_center|LOCUS_09100 >Feature sequence020 204 746 gene locus_tag LOCUS_09110 204 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228986.1 protein_id gnl|my_center|LOCUS_09110 798 2222 gene locus_tag LOCUS_09120 798 2222 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889165.1 protein_id gnl|my_center|LOCUS_09120 2267 3640 gene locus_tag LOCUS_09130 2267 3640 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228459.1 protein_id gnl|my_center|LOCUS_09130 3685 4971 gene locus_tag LOCUS_09140 3685 4971 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_09140 5027 5743 gene locus_tag LOCUS_09150 5027 5743 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228880.1 protein_id gnl|my_center|LOCUS_09150 8496 5734 gene locus_tag LOCUS_09160 8496 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228948.1 protein_id gnl|my_center|LOCUS_09160 9243 8539 gene locus_tag LOCUS_09170 9243 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 10956 9367 gene locus_tag LOCUS_09180 10956 9367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 12156 10966 gene locus_tag LOCUS_09190 12156 10966 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222986.1 protein_id gnl|my_center|LOCUS_09190 12378 13361 gene locus_tag LOCUS_09200 12378 13361 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909335.1 protein_id gnl|my_center|LOCUS_09200 14000 13368 gene locus_tag LOCUS_09210 gene cmk 14000 13368 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227951.1 protein_id gnl|my_center|LOCUS_09210 15285 13990 gene locus_tag LOCUS_09220 gene aroA 15285 13990 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227950.1 protein_id gnl|my_center|LOCUS_09220 15406 16383 gene locus_tag LOCUS_09230 15406 16383 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227723.1 protein_id gnl|my_center|LOCUS_09230 16651 17919 gene locus_tag LOCUS_09240 16651 17919 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228474.1 protein_id gnl|my_center|LOCUS_09240 17909 18784 gene locus_tag LOCUS_09250 gene metF 17909 18784 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174022.1 protein_id gnl|my_center|LOCUS_09250 19328 18795 gene locus_tag LOCUS_09260 19328 18795 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633352.1 protein_id gnl|my_center|LOCUS_09260 19432 20355 gene locus_tag LOCUS_09270 gene hslO 19432 20355 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228278.1 protein_id gnl|my_center|LOCUS_09270 21419 20376 gene locus_tag LOCUS_09280 gene galK 21419 20376 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228053.1 protein_id gnl|my_center|LOCUS_09280 22474 21455 gene locus_tag LOCUS_09290 22474 21455 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582708.1 protein_id gnl|my_center|LOCUS_09290 23785 22553 gene locus_tag LOCUS_09300 23785 22553 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927940.1 protein_id gnl|my_center|LOCUS_09300 24111 23836 gene locus_tag LOCUS_09310 24111 23836 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633933.1 protein_id gnl|my_center|LOCUS_09310 25059 24163 gene locus_tag LOCUS_09320 25059 24163 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228215.1 protein_id gnl|my_center|LOCUS_09320 25150 25225 gene locus_tag LOCUS_t00150 25150 25225 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 25997 25254 gene locus_tag LOCUS_09330 25997 25254 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_09330 27073 26018 gene locus_tag LOCUS_09340 27073 26018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 27188 27871 gene locus_tag LOCUS_09350 27188 27871 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228811.1 protein_id gnl|my_center|LOCUS_09350 27868 28479 gene locus_tag LOCUS_09360 27868 28479 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228812.1 protein_id gnl|my_center|LOCUS_09360 28533 29273 gene locus_tag LOCUS_09370 28533 29273 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228813.1 protein_id gnl|my_center|LOCUS_09370 29258 29764 gene locus_tag LOCUS_09380 29258 29764 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256351.1 protein_id gnl|my_center|LOCUS_09380 30402 29911 gene locus_tag LOCUS_09390 30402 29911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141315.1 protein_id gnl|my_center|LOCUS_09390 30755 30402 gene locus_tag LOCUS_09400 30755 30402 CDS product DUF6152 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928747.1 protein_id gnl|my_center|LOCUS_09400 30880 31314 gene locus_tag LOCUS_09410 30880 31314 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227839.1 protein_id gnl|my_center|LOCUS_09410 33151 31352 gene locus_tag LOCUS_09420 33151 31352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018111959.1 protein_id gnl|my_center|LOCUS_09420 33803 33165 gene locus_tag LOCUS_09430 33803 33165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 33917 33990 gene locus_tag LOCUS_t00160 33917 33990 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 34060 34134 gene locus_tag LOCUS_t00170 34060 34134 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence021 144 1010 gene locus_tag LOCUS_09440 144 1010 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889298.1 protein_id gnl|my_center|LOCUS_09440 1073 2488 gene locus_tag LOCUS_09450 1073 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 2485 2673 gene locus_tag LOCUS_09460 2485 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 2827 3864 gene locus_tag LOCUS_09470 2827 3864 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889299.1 protein_id gnl|my_center|LOCUS_09470 3874 4806 gene locus_tag LOCUS_09480 gene rfbN 3874 4806 CDS product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 protein_id gnl|my_center|LOCUS_09480 4840 6276 gene locus_tag LOCUS_09490 4840 6276 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294624.1 protein_id gnl|my_center|LOCUS_09490 6273 7841 gene locus_tag LOCUS_09500 6273 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 7928 10477 gene locus_tag LOCUS_09510 7928 10477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 12488 10482 gene locus_tag LOCUS_09520 gene ligA 12488 10482 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228436.1 protein_id gnl|my_center|LOCUS_09520 12802 13935 gene locus_tag LOCUS_09530 12802 13935 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228437.1 protein_id gnl|my_center|LOCUS_09530 13995 15521 gene locus_tag LOCUS_09540 13995 15521 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228438.1 protein_id gnl|my_center|LOCUS_09540 18132 15526 gene locus_tag LOCUS_09550 18132 15526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065226.1 protein_id gnl|my_center|LOCUS_09550 18269 19108 gene locus_tag LOCUS_09560 18269 19108 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197525142.1 protein_id gnl|my_center|LOCUS_09560 19125 20252 gene locus_tag LOCUS_09570 19125 20252 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228572.1 protein_id gnl|my_center|LOCUS_09570 20265 22979 gene locus_tag LOCUS_09580 20265 22979 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228571.1 protein_id gnl|my_center|LOCUS_09580 22991 24505 gene locus_tag LOCUS_09590 gene murJ 22991 24505 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228570.1 protein_id gnl|my_center|LOCUS_09590 24489 24752 gene locus_tag LOCUS_09600 24489 24752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 25947 24742 gene locus_tag LOCUS_09610 gene aspS 25947 24742 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228692.1 protein_id gnl|my_center|LOCUS_09610 26944 26162 gene locus_tag LOCUS_09620 26944 26162 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228690.1 protein_id gnl|my_center|LOCUS_09620 27003 28052 gene locus_tag LOCUS_09630 27003 28052 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081481465.1 protein_id gnl|my_center|LOCUS_09630 28765 28022 gene locus_tag LOCUS_09640 28765 28022 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172511.1 protein_id gnl|my_center|LOCUS_09640 29499 28768 gene locus_tag LOCUS_09650 29499 28768 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227923.1 protein_id gnl|my_center|LOCUS_09650 30126 29602 gene locus_tag LOCUS_09660 gene scpB 30126 29602 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632201.1 protein_id gnl|my_center|LOCUS_09660 30176 31396 gene locus_tag LOCUS_09670 30176 31396 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 protein_id gnl|my_center|LOCUS_09670 31436 32602 gene locus_tag LOCUS_09680 31436 32602 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228148.1 protein_id gnl|my_center|LOCUS_09680 33178 32888 gene locus_tag LOCUS_09690 33178 32888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227807.1 protein_id gnl|my_center|LOCUS_09690 33468 33196 gene locus_tag LOCUS_09700 33468 33196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 33583 34023 gene locus_tag LOCUS_09710 33583 34023 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227808.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence022 850 29 gene locus_tag LOCUS_09720 850 29 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114001.1 protein_id gnl|my_center|LOCUS_09720 5172 847 gene locus_tag LOCUS_09730 gene cobN 5172 847 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258438.1 protein_id gnl|my_center|LOCUS_09730 5741 5178 gene locus_tag LOCUS_09740 gene cobO 5741 5178 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229235.1 protein_id gnl|my_center|LOCUS_09740 6806 5745 gene locus_tag LOCUS_09750 6806 5745 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228166.1 protein_id gnl|my_center|LOCUS_09750 7676 6810 gene locus_tag LOCUS_09760 7676 6810 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228165.1 protein_id gnl|my_center|LOCUS_09760 7997 8782 gene locus_tag LOCUS_09770 7997 8782 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228512.1 protein_id gnl|my_center|LOCUS_09770 9887 8784 gene locus_tag LOCUS_09780 9887 8784 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228588.1 protein_id gnl|my_center|LOCUS_09780 10558 9932 gene locus_tag LOCUS_09790 gene upp 10558 9932 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173367.1 protein_id gnl|my_center|LOCUS_09790 10650 10997 gene locus_tag LOCUS_09800 10650 10997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 10994 11380 gene locus_tag LOCUS_09810 10994 11380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 11416 12615 gene locus_tag LOCUS_09820 11416 12615 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259422.1 protein_id gnl|my_center|LOCUS_09820 12646 13101 gene locus_tag LOCUS_09830 12646 13101 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228960.1 protein_id gnl|my_center|LOCUS_09830 13128 14162 gene locus_tag LOCUS_09840 13128 14162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 14317 15303 gene locus_tag LOCUS_09850 14317 15303 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228817.1 protein_id gnl|my_center|LOCUS_09850 15407 16558 gene locus_tag LOCUS_09860 15407 16558 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929074.1 protein_id gnl|my_center|LOCUS_09860 17469 16555 gene locus_tag LOCUS_09870 17469 16555 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227827.1 protein_id gnl|my_center|LOCUS_09870 17562 18017 gene locus_tag LOCUS_09880 17562 18017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 18041 19366 gene locus_tag LOCUS_09890 18041 19366 CDS product MiaB/RimO family radical SAM methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173655.1 protein_id gnl|my_center|LOCUS_09890 19701 19336 gene locus_tag LOCUS_09900 19701 19336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 19767 20186 gene locus_tag LOCUS_09910 19767 20186 CDS product DUF3197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173575.1 protein_id gnl|my_center|LOCUS_09910 20556 20176 gene locus_tag LOCUS_09920 20556 20176 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118979.1 protein_id gnl|my_center|LOCUS_09920 21380 20562 gene locus_tag LOCUS_09930 21380 20562 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227947.1 protein_id gnl|my_center|LOCUS_09930 22647 21439 gene locus_tag LOCUS_09940 22647 21439 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926030.1 protein_id gnl|my_center|LOCUS_09940 23769 22693 gene locus_tag LOCUS_09950 23769 22693 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227945.1 protein_id gnl|my_center|LOCUS_09950 24687 23782 gene locus_tag LOCUS_09960 24687 23782 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227944.1 protein_id gnl|my_center|LOCUS_09960 26635 24698 gene locus_tag LOCUS_09970 26635 24698 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227943.1 protein_id gnl|my_center|LOCUS_09970 27484 26711 gene locus_tag LOCUS_09980 27484 26711 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227942.1 protein_id gnl|my_center|LOCUS_09980 28410 27646 gene locus_tag LOCUS_09990 28410 27646 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172461.1 protein_id gnl|my_center|LOCUS_09990 28798 28496 gene locus_tag LOCUS_10000 28798 28496 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173405.1 protein_id gnl|my_center|LOCUS_10000 29556 28915 gene locus_tag LOCUS_10010 29556 28915 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_10010 29707 30501 gene locus_tag LOCUS_10020 29707 30501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 30671 31759 gene locus_tag LOCUS_10030 30671 31759 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444177.1 protein_id gnl|my_center|LOCUS_10030 31821 33236 gene locus_tag LOCUS_10040 31821 33236 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926111.1 protein_id gnl|my_center|LOCUS_10040 33287 33910 gene locus_tag LOCUS_10050 33287 33910 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229199.1 protein_id gnl|my_center|LOCUS_10050 >Feature sequence023 114 746 gene locus_tag LOCUS_10060 114 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 2212 743 gene locus_tag LOCUS_10070 2212 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 2363 2515 gene locus_tag LOCUS_10080 2363 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 3048 2803 gene locus_tag LOCUS_10090 3048 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 3926 5044 gene locus_tag LOCUS_10100 3926 5044 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443464.1 protein_id gnl|my_center|LOCUS_10100 5037 5900 gene locus_tag LOCUS_10110 5037 5900 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173304.1 protein_id gnl|my_center|LOCUS_10110 5897 6673 gene locus_tag LOCUS_10120 5897 6673 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228542.1 protein_id gnl|my_center|LOCUS_10120 6708 7709 gene locus_tag LOCUS_10130 6708 7709 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887947.1 protein_id gnl|my_center|LOCUS_10130 8525 7719 gene locus_tag LOCUS_10140 gene nfo 8525 7719 CDS product endonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228231.1 protein_id gnl|my_center|LOCUS_10140 9154 8546 gene locus_tag LOCUS_10150 9154 8546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 10194 9151 gene locus_tag LOCUS_10160 10194 9151 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228417.1 protein_id gnl|my_center|LOCUS_10160 10248 11042 gene locus_tag LOCUS_10170 10248 11042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 11566 11045 gene locus_tag LOCUS_10180 11566 11045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 11651 12922 gene locus_tag LOCUS_10190 gene glmM 11651 12922 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228407.1 protein_id gnl|my_center|LOCUS_10190 12919 13320 gene locus_tag LOCUS_10200 12919 13320 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228286.1 protein_id gnl|my_center|LOCUS_10200 13523 14737 gene locus_tag LOCUS_10210 gene trpB 13523 14737 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173169.1 protein_id gnl|my_center|LOCUS_10210 14734 15522 gene locus_tag LOCUS_10220 gene trpA 14734 15522 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228434.1 protein_id gnl|my_center|LOCUS_10220 15533 16384 gene locus_tag LOCUS_10230 15533 16384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 16362 17210 gene locus_tag LOCUS_10240 16362 17210 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 protein_id gnl|my_center|LOCUS_10240 17560 17207 gene locus_tag LOCUS_10250 17560 17207 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633088.1 protein_id gnl|my_center|LOCUS_10250 18270 17593 gene locus_tag LOCUS_10260 18270 17593 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633090.1 protein_id gnl|my_center|LOCUS_10260 18357 19667 gene locus_tag LOCUS_10270 gene purB 18357 19667 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228728.1 protein_id gnl|my_center|LOCUS_10270 19688 20401 gene locus_tag LOCUS_10280 19688 20401 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228730.1 protein_id gnl|my_center|LOCUS_10280 20406 20657 gene locus_tag LOCUS_10290 gene purS 20406 20657 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173563.1 protein_id gnl|my_center|LOCUS_10290 20654 21355 gene locus_tag LOCUS_10300 gene purQ 20654 21355 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228731.1 protein_id gnl|my_center|LOCUS_10300 21392 22141 gene locus_tag LOCUS_10310 21392 22141 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173565.1 protein_id gnl|my_center|LOCUS_10310 22141 24342 gene locus_tag LOCUS_10320 gene purL 22141 24342 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173566.1 protein_id gnl|my_center|LOCUS_10320 24339 25757 gene locus_tag LOCUS_10330 gene purF 24339 25757 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173567.1 protein_id gnl|my_center|LOCUS_10330 26384 25887 gene locus_tag LOCUS_10340 26384 25887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 27029 26397 gene locus_tag LOCUS_10350 27029 26397 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229093.1 protein_id gnl|my_center|LOCUS_10350 27700 27074 gene locus_tag LOCUS_10360 27700 27074 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229094.1 protein_id gnl|my_center|LOCUS_10360 28241 27690 gene locus_tag LOCUS_10370 28241 27690 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229095.1 protein_id gnl|my_center|LOCUS_10370 28318 29343 gene locus_tag LOCUS_10380 gene trpS 28318 29343 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173293.1 protein_id gnl|my_center|LOCUS_10380 29340 30017 gene locus_tag LOCUS_10390 29340 30017 CDS product chromosome segregation protein ScpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228532.1 protein_id gnl|my_center|LOCUS_10390 30256 30023 gene locus_tag LOCUS_10400 gene minE 30256 30023 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631340.1 protein_id gnl|my_center|LOCUS_10400 31059 30256 gene locus_tag LOCUS_10410 gene minD 31059 30256 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173307.1 protein_id gnl|my_center|LOCUS_10410 32861 31176 gene locus_tag LOCUS_10420 32861 31176 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228698.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence024 1233 202 gene locus_tag LOCUS_10430 1233 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1854 1258 gene locus_tag LOCUS_10440 gene plsY 1854 1258 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228511.1 protein_id gnl|my_center|LOCUS_10440 2512 1907 gene locus_tag LOCUS_10450 2512 1907 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227865.1 protein_id gnl|my_center|LOCUS_10450 2603 3676 gene locus_tag LOCUS_10460 2603 3676 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015931.1 protein_id gnl|my_center|LOCUS_10460 3729 5081 gene locus_tag LOCUS_10470 gene dnaB 3729 5081 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173520.1 protein_id gnl|my_center|LOCUS_10470 5118 5720 gene locus_tag LOCUS_10480 5118 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 5802 8741 gene locus_tag LOCUS_10490 gene uvrA 5802 8741 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228683.1 protein_id gnl|my_center|LOCUS_10490 8747 10921 gene locus_tag LOCUS_10500 8747 10921 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926014.1 protein_id gnl|my_center|LOCUS_10500 11020 11880 gene locus_tag LOCUS_10510 11020 11880 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632430.1 protein_id gnl|my_center|LOCUS_10510 12609 11884 gene locus_tag LOCUS_10520 gene rlmB 12609 11884 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174056.1 protein_id gnl|my_center|LOCUS_10520 12689 12765 gene locus_tag LOCUS_t00180 12689 12765 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 12790 12874 gene locus_tag LOCUS_t00190 12790 12874 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12976 13257 gene locus_tag LOCUS_10530 12976 13257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 14112 13273 gene locus_tag LOCUS_10540 14112 13273 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257001.1 protein_id gnl|my_center|LOCUS_10540 14165 14941 gene locus_tag LOCUS_10550 14165 14941 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172895.1 protein_id gnl|my_center|LOCUS_10550 14975 16309 gene locus_tag LOCUS_10560 14975 16309 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229206.1 protein_id gnl|my_center|LOCUS_10560 16342 18162 gene locus_tag LOCUS_10570 gene pepF 16342 18162 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256129.1 protein_id gnl|my_center|LOCUS_10570 18168 19310 gene locus_tag LOCUS_10580 gene proB 18168 19310 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633899.1 protein_id gnl|my_center|LOCUS_10580 19321 20574 gene locus_tag LOCUS_10590 19321 20574 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229021.1 protein_id gnl|my_center|LOCUS_10590 20593 21435 gene locus_tag LOCUS_10600 20593 21435 CDS product YhjD/YihY/BrkB family envelope integrity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229022.1 protein_id gnl|my_center|LOCUS_10600 21611 23026 gene locus_tag LOCUS_10610 21611 23026 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 protein_id gnl|my_center|LOCUS_10610 23027 23962 gene locus_tag LOCUS_10620 23027 23962 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_10620 23974 24963 gene locus_tag LOCUS_10630 gene galE 23974 24963 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338033.1 protein_id gnl|my_center|LOCUS_10630 25540 24929 gene locus_tag LOCUS_10640 25540 24929 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_10640 28289 25563 gene locus_tag LOCUS_10650 28289 25563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 28855 28292 gene locus_tag LOCUS_10660 28855 28292 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173934.1 protein_id gnl|my_center|LOCUS_10660 28908 30332 gene locus_tag LOCUS_10670 gene gatB 28908 30332 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227883.1 protein_id gnl|my_center|LOCUS_10670 30329 31336 gene locus_tag LOCUS_10680 gene purM 30329 31336 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227884.1 protein_id gnl|my_center|LOCUS_10680 31356 31988 gene locus_tag LOCUS_10690 31356 31988 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634004.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence025 302 1090 gene locus_tag LOCUS_10700 gene pcaD 302 1090 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976279.1 protein_id gnl|my_center|LOCUS_10700 1080 1451 gene locus_tag LOCUS_10710 1080 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1448 2167 gene locus_tag LOCUS_10720 gene pcaH 1448 2167 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524239.1 protein_id gnl|my_center|LOCUS_10720 2167 2718 gene locus_tag LOCUS_10730 gene pcaG 2167 2718 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083750.1 protein_id gnl|my_center|LOCUS_10730 2720 4069 gene locus_tag LOCUS_10740 gene pcaB 2720 4069 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090665.1 protein_id gnl|my_center|LOCUS_10740 4066 5409 gene locus_tag LOCUS_10750 4066 5409 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479724.1 protein_id gnl|my_center|LOCUS_10750 5444 6637 gene locus_tag LOCUS_10760 5444 6637 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228024.1 protein_id gnl|my_center|LOCUS_10760 6960 6634 gene locus_tag LOCUS_10770 6960 6634 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172646.1 protein_id gnl|my_center|LOCUS_10770 7021 7683 gene locus_tag LOCUS_10780 7021 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 7739 8806 gene locus_tag LOCUS_10790 7739 8806 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259465.1 protein_id gnl|my_center|LOCUS_10790 8905 9498 gene locus_tag LOCUS_10800 8905 9498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 9506 11794 gene locus_tag LOCUS_10810 9506 11794 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229107.1 protein_id gnl|my_center|LOCUS_10810 11706 12551 gene locus_tag LOCUS_10820 gene fdhD 11706 12551 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228505.1 protein_id gnl|my_center|LOCUS_10820 13617 12514 gene locus_tag LOCUS_10830 13617 12514 CDS product DUF815 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228701.1 protein_id gnl|my_center|LOCUS_10830 14950 13643 gene locus_tag LOCUS_10840 14950 13643 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014902978.1 protein_id gnl|my_center|LOCUS_10840 15699 14953 gene locus_tag LOCUS_10850 gene allE 15699 14953 CDS product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887795.1 protein_id gnl|my_center|LOCUS_10850 17039 15696 gene locus_tag LOCUS_10860 17039 15696 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887796.1 protein_id gnl|my_center|LOCUS_10860 18270 17032 gene locus_tag LOCUS_10870 18270 17032 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887797.1 protein_id gnl|my_center|LOCUS_10870 18632 18276 gene locus_tag LOCUS_10880 gene uraH 18632 18276 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521222.1 protein_id gnl|my_center|LOCUS_10880 19955 18642 gene locus_tag LOCUS_10890 19955 18642 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083321.1 protein_id gnl|my_center|LOCUS_10890 20468 19971 gene locus_tag LOCUS_10900 20468 19971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 21235 20471 gene locus_tag LOCUS_10910 21235 20471 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971358.1 protein_id gnl|my_center|LOCUS_10910 22035 21232 gene locus_tag LOCUS_10920 22035 21232 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687942.1 protein_id gnl|my_center|LOCUS_10920 23115 22081 gene locus_tag LOCUS_10930 23115 22081 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971356.1 protein_id gnl|my_center|LOCUS_10930 24719 23409 gene locus_tag LOCUS_10940 gene hemL 24719 23409 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228305.1 protein_id gnl|my_center|LOCUS_10940 25070 24729 gene locus_tag LOCUS_10950 25070 24729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 26730 25054 gene locus_tag LOCUS_10960 26730 25054 CDS product NADPH-dependent assimilatory sulfite reductase hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256582.1 protein_id gnl|my_center|LOCUS_10960 27493 26696 gene locus_tag LOCUS_10970 gene cobA 27493 26696 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256583.1 protein_id gnl|my_center|LOCUS_10970 28173 27490 gene locus_tag LOCUS_10980 28173 27490 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256584.1 protein_id gnl|my_center|LOCUS_10980 28911 28174 gene locus_tag LOCUS_10990 28911 28174 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256585.1 protein_id gnl|my_center|LOCUS_10990 30077 28899 gene locus_tag LOCUS_11000 gene sat 30077 28899 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256586.1 protein_id gnl|my_center|LOCUS_11000 30782 30120 gene locus_tag LOCUS_11010 30782 30120 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256587.1 protein_id gnl|my_center|LOCUS_11010 31327 30779 gene locus_tag LOCUS_11020 gene cysC 31327 30779 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256588.1 protein_id gnl|my_center|LOCUS_11020 31631 31707 gene locus_tag LOCUS_t00200 31631 31707 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 31720 31795 gene locus_tag LOCUS_t00210 31720 31795 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 32133 31888 gene locus_tag LOCUS_11030 32133 31888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence026 <1 1508 gene locus_tag LOCUS_11040 <1 1508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228485.1:single-stranded-DNA-specific exonuclease RecJ 2352 1471 gene locus_tag LOCUS_11050 gene pdxS 2352 1471 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119184.1 protein_id gnl|my_center|LOCUS_11050 3542 2397 gene locus_tag LOCUS_11060 3542 2397 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228264.1 protein_id gnl|my_center|LOCUS_11060 4269 3559 gene locus_tag LOCUS_11070 4269 3559 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228266.1 protein_id gnl|my_center|LOCUS_11070 5385 4279 gene locus_tag LOCUS_11080 5385 4279 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172742.1 protein_id gnl|my_center|LOCUS_11080 6327 5431 gene locus_tag LOCUS_11090 gene rocF 6327 5431 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038039155.1 protein_id gnl|my_center|LOCUS_11090 7069 6335 gene locus_tag LOCUS_11100 7069 6335 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632942.1 protein_id gnl|my_center|LOCUS_11100 7768 7082 gene locus_tag LOCUS_11110 7768 7082 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228681.1 protein_id gnl|my_center|LOCUS_11110 7817 8437 gene locus_tag LOCUS_11120 7817 8437 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228680.1 protein_id gnl|my_center|LOCUS_11120 8462 8743 gene locus_tag LOCUS_11130 8462 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 8746 9528 gene locus_tag LOCUS_11140 8746 9528 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887914.1 protein_id gnl|my_center|LOCUS_11140 9529 10572 gene locus_tag LOCUS_11150 9529 10572 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177684.1 protein_id gnl|my_center|LOCUS_11150 10566 11075 gene locus_tag LOCUS_11160 10566 11075 CDS product isoprenylcysteine carboxyl methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618916.1 protein_id gnl|my_center|LOCUS_11160 12681 11095 gene locus_tag LOCUS_11170 gene cimA 12681 11095 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228516.1 protein_id gnl|my_center|LOCUS_11170 14243 12684 gene locus_tag LOCUS_11180 14243 12684 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228518.1 protein_id gnl|my_center|LOCUS_11180 15281 14259 gene locus_tag LOCUS_11190 gene ilvC 15281 14259 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173279.1 protein_id gnl|my_center|LOCUS_11190 15829 15320 gene locus_tag LOCUS_11200 gene ilvN 15829 15320 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173280.1 protein_id gnl|my_center|LOCUS_11200 17539 15854 gene locus_tag LOCUS_11210 gene ilvB 17539 15854 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228519.1 protein_id gnl|my_center|LOCUS_11210 18649 17726 gene locus_tag LOCUS_11220 18649 17726 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167345969.1 protein_id gnl|my_center|LOCUS_11220 19103 18732 gene locus_tag LOCUS_11230 19103 18732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 19801 19121 gene locus_tag LOCUS_11240 gene mtnN 19801 19121 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228756.1 protein_id gnl|my_center|LOCUS_11240 20280 19804 gene locus_tag LOCUS_11250 20280 19804 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480069.1 protein_id gnl|my_center|LOCUS_11250 21789 20308 gene locus_tag LOCUS_11260 21789 20308 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173241.1 protein_id gnl|my_center|LOCUS_11260 23352 21868 gene locus_tag LOCUS_11270 23352 21868 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173241.1 protein_id gnl|my_center|LOCUS_11270 24664 23327 gene locus_tag LOCUS_11280 gene trkA 24664 23327 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228490.1 protein_id gnl|my_center|LOCUS_11280 26148 24784 gene locus_tag LOCUS_11290 gene rimO 26148 24784 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228491.1 protein_id gnl|my_center|LOCUS_11290 27348 26212 gene locus_tag LOCUS_11300 gene metX 27348 26212 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228177.1 protein_id gnl|my_center|LOCUS_11300 28667 27372 gene locus_tag LOCUS_11310 28667 27372 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228178.1 protein_id gnl|my_center|LOCUS_11310 29900 29010 gene locus_tag LOCUS_11320 29900 29010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 29982 30431 gene locus_tag LOCUS_11330 29982 30431 CDS product CoxG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480365.1 protein_id gnl|my_center|LOCUS_11330 31965 30439 gene locus_tag LOCUS_11340 gene guaA 31965 30439 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228757.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence027 737 1264 gene locus_tag LOCUS_11350 737 1264 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172651.1 protein_id gnl|my_center|LOCUS_11350 2913 1267 gene locus_tag LOCUS_11360 gene pgm 2913 1267 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480279.1 protein_id gnl|my_center|LOCUS_11360 4186 2966 gene locus_tag LOCUS_11370 gene lhgO 4186 2966 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546485.1 protein_id gnl|my_center|LOCUS_11370 5458 4196 gene locus_tag LOCUS_11380 5458 4196 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928952.1 protein_id gnl|my_center|LOCUS_11380 5550 6335 gene locus_tag LOCUS_11390 gene pyrF 5550 6335 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228884.1 protein_id gnl|my_center|LOCUS_11390 9105 6325 gene locus_tag LOCUS_11400 9105 6325 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228772.1 protein_id gnl|my_center|LOCUS_11400 10712 9180 gene locus_tag LOCUS_11410 gene pxpB 10712 9180 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228353.1 protein_id gnl|my_center|LOCUS_11410 11480 10728 gene locus_tag LOCUS_11420 11480 10728 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229109.1 protein_id gnl|my_center|LOCUS_11420 12800 11496 gene locus_tag LOCUS_11430 12800 11496 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039976.1 protein_id gnl|my_center|LOCUS_11430 13310 12804 gene locus_tag LOCUS_11440 13310 12804 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930615.1 protein_id gnl|my_center|LOCUS_11440 14347 13382 gene locus_tag LOCUS_11450 gene dctP 14347 13382 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930618.1 protein_id gnl|my_center|LOCUS_11450 15179 14364 gene locus_tag LOCUS_11460 15179 14364 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026361.1 protein_id gnl|my_center|LOCUS_11460 16236 15259 gene locus_tag LOCUS_11470 16236 15259 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_11470 16217 16453 gene locus_tag LOCUS_11480 16217 16453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 16618 16397 gene locus_tag LOCUS_11490 16618 16397 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632579.1 protein_id gnl|my_center|LOCUS_11490 17541 16645 gene locus_tag LOCUS_11500 gene era 17541 16645 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630929.1 protein_id gnl|my_center|LOCUS_11500 17586 18599 gene locus_tag LOCUS_11510 gene dprA 17586 18599 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227724.1 protein_id gnl|my_center|LOCUS_11510 19597 18584 gene locus_tag LOCUS_11520 gene dusA 19597 18584 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227643.1 protein_id gnl|my_center|LOCUS_11520 20046 19594 gene locus_tag LOCUS_11530 20046 19594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 20355 20047 gene locus_tag LOCUS_11540 20355 20047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11540 20594 20343 gene locus_tag LOCUS_11550 20594 20343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11550 21893 20853 gene locus_tag LOCUS_11560 gene ispH 21893 20853 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227642.1 protein_id gnl|my_center|LOCUS_11560 23296 21932 gene locus_tag LOCUS_11570 23296 21932 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631640.1 protein_id gnl|my_center|LOCUS_11570 23466 25331 gene locus_tag LOCUS_11580 gene ftsH 23466 25331 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227911.1 protein_id gnl|my_center|LOCUS_11580 25809 25426 gene locus_tag LOCUS_11590 gene rplL 25809 25426 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630582.1 protein_id gnl|my_center|LOCUS_11590 26346 25822 gene locus_tag LOCUS_11600 gene rplJ 26346 25822 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630583.1 protein_id gnl|my_center|LOCUS_11600 26672 27112 gene locus_tag LOCUS_11610 gene rplS 26672 27112 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228391.1 protein_id gnl|my_center|LOCUS_11610 27223 28443 gene locus_tag LOCUS_11620 gene ispG 27223 28443 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227844.1 protein_id gnl|my_center|LOCUS_11620 28820 28440 gene locus_tag LOCUS_11630 28820 28440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 29859 28870 gene locus_tag LOCUS_11640 29859 28870 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172623.1 protein_id gnl|my_center|LOCUS_11640 30041 32080 gene locus_tag LOCUS_11650 30041 32080 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228453.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence028 44 1093 gene locus_tag LOCUS_11660 44 1093 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_11660 1106 2059 gene locus_tag LOCUS_11670 1106 2059 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_11670 2056 3117 gene locus_tag LOCUS_11680 2056 3117 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057860.1 protein_id gnl|my_center|LOCUS_11680 3127 4086 gene locus_tag LOCUS_11690 3127 4086 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038327.1 protein_id gnl|my_center|LOCUS_11690 4691 4083 gene locus_tag LOCUS_11700 4691 4083 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350278.1 protein_id gnl|my_center|LOCUS_11700 4831 5271 gene locus_tag LOCUS_11710 4831 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 5294 5836 gene locus_tag LOCUS_11720 5294 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 5894 6748 gene locus_tag LOCUS_11730 gene modA 5894 6748 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228141.1 protein_id gnl|my_center|LOCUS_11730 6745 7425 gene locus_tag LOCUS_11740 gene modB 6745 7425 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172814.1 protein_id gnl|my_center|LOCUS_11740 7392 8396 gene locus_tag LOCUS_11750 7392 8396 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228140.1 protein_id gnl|my_center|LOCUS_11750 8572 8393 gene locus_tag LOCUS_11760 8572 8393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 8744 9721 gene locus_tag LOCUS_11770 gene deoC 8744 9721 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391592.1 protein_id gnl|my_center|LOCUS_11770 9724 12075 gene locus_tag LOCUS_11780 9724 12075 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975661.1 protein_id gnl|my_center|LOCUS_11780 12188 12763 gene locus_tag LOCUS_11790 12188 12763 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162467445.1 protein_id gnl|my_center|LOCUS_11790 13997 12666 gene locus_tag LOCUS_11800 13997 12666 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888387.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11800 15126 14020 gene locus_tag LOCUS_11810 15126 14020 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228257.1 protein_id gnl|my_center|LOCUS_11810 15947 15144 gene locus_tag LOCUS_11820 15947 15144 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228258.1 protein_id gnl|my_center|LOCUS_11820 17070 15961 gene locus_tag LOCUS_11830 gene menC 17070 15961 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228259.1 protein_id gnl|my_center|LOCUS_11830 17077 17529 gene locus_tag LOCUS_11840 17077 17529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 17530 18051 gene locus_tag LOCUS_11850 17530 18051 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119826.1 protein_id gnl|my_center|LOCUS_11850 18089 18454 gene locus_tag LOCUS_11860 18089 18454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632453.1 protein_id gnl|my_center|LOCUS_11860 18573 19046 gene locus_tag LOCUS_11870 18573 19046 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228396.1 protein_id gnl|my_center|LOCUS_11870 19458 19051 gene locus_tag LOCUS_11880 19458 19051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 19555 21048 gene locus_tag LOCUS_11890 gene lysS 19555 21048 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173121.1 protein_id gnl|my_center|LOCUS_11890 21208 23751 gene locus_tag LOCUS_11900 21208 23751 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392035.1 protein_id gnl|my_center|LOCUS_11900 23803 24549 gene locus_tag LOCUS_11910 gene cas5c 23803 24549 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392034.1 protein_id gnl|my_center|LOCUS_11910 24549 26399 gene locus_tag LOCUS_11920 24549 26399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 26420 27418 gene locus_tag LOCUS_11930 gene cas7c 26420 27418 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070169.1 protein_id gnl|my_center|LOCUS_11930 27411 28790 gene locus_tag LOCUS_11940 gene cmr1 27411 28790 CDS product type III-B CRISPR module RAMP protein Cmr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229142.1 protein_id gnl|my_center|LOCUS_11940 28793 30268 gene locus_tag LOCUS_11950 gene cas10 28793 30268 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229144.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence029 1997 1707 gene locus_tag LOCUS_11960 gene nuoK 1997 1707 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227704.1 protein_id gnl|my_center|LOCUS_11960 2587 1994 gene locus_tag LOCUS_11970 2587 1994 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227703.1 protein_id gnl|my_center|LOCUS_11970 3215 2676 gene locus_tag LOCUS_11980 gene nuoI 3215 2676 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174264.1 protein_id gnl|my_center|LOCUS_11980 4438 3212 gene locus_tag LOCUS_11990 gene nuoH 4438 3212 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227702.1 protein_id gnl|my_center|LOCUS_11990 6801 4435 gene locus_tag LOCUS_12000 gene nuoG 6801 4435 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227701.1 protein_id gnl|my_center|LOCUS_12000 8124 6808 gene locus_tag LOCUS_12010 gene nuoF 8124 6808 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227700.1 protein_id gnl|my_center|LOCUS_12010 8684 8121 gene locus_tag LOCUS_12020 gene nuoE 8684 8121 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174268.1 protein_id gnl|my_center|LOCUS_12020 9990 8743 gene locus_tag LOCUS_12030 gene nuoD 9990 8743 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227699.1 protein_id gnl|my_center|LOCUS_12030 10613 9990 gene locus_tag LOCUS_12040 10613 9990 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174270.1 protein_id gnl|my_center|LOCUS_12040 11162 10623 gene locus_tag LOCUS_12050 11162 10623 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174271.1 protein_id gnl|my_center|LOCUS_12050 11543 11184 gene locus_tag LOCUS_12060 11543 11184 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174272.1 protein_id gnl|my_center|LOCUS_12060 12927 11788 gene locus_tag LOCUS_12070 12927 11788 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118974.1 protein_id gnl|my_center|LOCUS_12070 13592 13008 gene locus_tag LOCUS_12080 13592 13008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 13692 14705 gene locus_tag LOCUS_12090 13692 14705 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_12090 15038 15607 gene locus_tag LOCUS_12100 15038 15607 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888630.1 protein_id gnl|my_center|LOCUS_12100 15966 15679 gene locus_tag LOCUS_12110 15966 15679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173720.1 protein_id gnl|my_center|LOCUS_12110 16048 17130 gene locus_tag LOCUS_12120 16048 17130 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228631.1 protein_id gnl|my_center|LOCUS_12120 17790 17113 gene locus_tag LOCUS_12130 17790 17113 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258011.1 protein_id gnl|my_center|LOCUS_12130 17849 18724 gene locus_tag LOCUS_12140 17849 18724 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254057.1 protein_id gnl|my_center|LOCUS_12140 18767 19543 gene locus_tag LOCUS_12150 gene phnC 18767 19543 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905272.1 protein_id gnl|my_center|LOCUS_12150 19540 21171 gene locus_tag LOCUS_12160 19540 21171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 21183 22250 gene locus_tag LOCUS_12170 21183 22250 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258014.1 protein_id gnl|my_center|LOCUS_12170 22260 22766 gene locus_tag LOCUS_12180 22260 22766 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630908.1 protein_id gnl|my_center|LOCUS_12180 22776 23198 gene locus_tag LOCUS_12190 gene tsaE 22776 23198 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926021.1 protein_id gnl|my_center|LOCUS_12190 23303 24547 gene locus_tag LOCUS_12200 23303 24547 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974048.1 protein_id gnl|my_center|LOCUS_12200 24548 25531 gene locus_tag LOCUS_12210 24548 25531 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974047.1 protein_id gnl|my_center|LOCUS_12210 25531 26343 gene locus_tag LOCUS_12220 25531 26343 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312430.1 protein_id gnl|my_center|LOCUS_12220 26888 26340 gene locus_tag LOCUS_12230 26888 26340 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258319.1 protein_id gnl|my_center|LOCUS_12230 26966 28315 gene locus_tag LOCUS_12240 26966 28315 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228370.1 protein_id gnl|my_center|LOCUS_12240 28312 29025 gene locus_tag LOCUS_12250 28312 29025 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173093.1 protein_id gnl|my_center|LOCUS_12250 29022 30314 gene locus_tag LOCUS_12260 29022 30314 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173094.1 protein_id gnl|my_center|LOCUS_12260 >Feature sequence030 242 167 gene locus_tag LOCUS_t00220 242 167 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 384 309 gene locus_tag LOCUS_t00230 384 309 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 532 447 gene locus_tag LOCUS_t00240 532 447 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 612 537 gene locus_tag LOCUS_t00250 612 537 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1451 732 gene locus_tag LOCUS_12270 1451 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 2724 1486 gene locus_tag LOCUS_12280 2724 1486 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922632.1 protein_id gnl|my_center|LOCUS_12280 3898 2813 gene locus_tag LOCUS_12290 3898 2813 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530916.1 protein_id gnl|my_center|LOCUS_12290 4546 3992 gene locus_tag LOCUS_12300 4546 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12300 4929 4438 gene locus_tag LOCUS_12310 4929 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 5834 4926 gene locus_tag LOCUS_12320 5834 4926 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391201.1 protein_id gnl|my_center|LOCUS_12320 6577 5834 gene locus_tag LOCUS_12330 6577 5834 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240183.1 protein_id gnl|my_center|LOCUS_12330 8089 6707 gene locus_tag LOCUS_12340 gene hydA 8089 6707 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651148.1 protein_id gnl|my_center|LOCUS_12340 9548 8163 gene locus_tag LOCUS_12350 gene preA 9548 8163 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_12350 10894 9563 gene locus_tag LOCUS_12360 10894 9563 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530893.1 protein_id gnl|my_center|LOCUS_12360 13631 11157 gene locus_tag LOCUS_12370 13631 11157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 13890 14927 gene locus_tag LOCUS_12380 13890 14927 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228214.1 protein_id gnl|my_center|LOCUS_12380 17364 14965 gene locus_tag LOCUS_12390 17364 14965 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403487.1 protein_id gnl|my_center|LOCUS_12390 17905 17351 gene locus_tag LOCUS_12400 17905 17351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 19050 17902 gene locus_tag LOCUS_12410 19050 17902 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931301.1 protein_id gnl|my_center|LOCUS_12410 20847 19072 gene locus_tag LOCUS_12420 20847 19072 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227731.1 protein_id gnl|my_center|LOCUS_12420 21878 20940 gene locus_tag LOCUS_12430 gene fmt 21878 20940 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227858.1 protein_id gnl|my_center|LOCUS_12430 22518 21910 gene locus_tag LOCUS_12440 gene def 22518 21910 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174028.1 protein_id gnl|my_center|LOCUS_12440 23497 22607 gene locus_tag LOCUS_12450 23497 22607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 23611 24180 gene locus_tag LOCUS_12460 23611 24180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 25419 24184 gene locus_tag LOCUS_12470 25419 24184 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228553.1 protein_id gnl|my_center|LOCUS_12470 26658 25429 gene locus_tag LOCUS_12480 26658 25429 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228554.1 protein_id gnl|my_center|LOCUS_12480 26727 29039 gene locus_tag LOCUS_12490 gene recG 26727 29039 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228555.1 protein_id gnl|my_center|LOCUS_12490 29124 29357 gene locus_tag LOCUS_12500 29124 29357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 29376 29504 gene locus_tag LOCUS_12510 29376 29504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence031 456 64 gene locus_tag LOCUS_12520 gene cas2e 456 64 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926117.1 protein_id gnl|my_center|LOCUS_12520 1403 459 gene locus_tag LOCUS_12530 gene cas1e 1403 459 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229111.1 protein_id gnl|my_center|LOCUS_12530 2033 1407 gene locus_tag LOCUS_12540 gene cas6e 2033 1407 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229112.1 protein_id gnl|my_center|LOCUS_12540 2703 2008 gene locus_tag LOCUS_12550 gene cas5e 2703 2008 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229113.1 protein_id gnl|my_center|LOCUS_12550 3839 2706 gene locus_tag LOCUS_12560 gene cas7e 3839 2706 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229114.1 protein_id gnl|my_center|LOCUS_12560 4383 3850 gene locus_tag LOCUS_12570 4383 3850 CDS product DUF2939 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227820.1 protein_id gnl|my_center|LOCUS_12570 4973 4380 gene locus_tag LOCUS_12580 4973 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 6513 4960 gene locus_tag LOCUS_12590 gene casA 6513 4960 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229116.1 protein_id gnl|my_center|LOCUS_12590 9117 6517 gene locus_tag LOCUS_12600 9117 6517 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229117.1 protein_id gnl|my_center|LOCUS_12600 10225 9236 gene locus_tag LOCUS_12610 10225 9236 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229118.1 protein_id gnl|my_center|LOCUS_12610 11953 10313 gene locus_tag LOCUS_12620 11953 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 14499 12166 gene locus_tag LOCUS_12630 14499 12166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228364.1 protein_id gnl|my_center|LOCUS_12630 15688 14543 gene locus_tag LOCUS_12640 15688 14543 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228579.1 protein_id gnl|my_center|LOCUS_12640 16593 15724 gene locus_tag LOCUS_12650 16593 15724 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228580.1 protein_id gnl|my_center|LOCUS_12650 17649 16597 gene locus_tag LOCUS_12660 17649 16597 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228581.1 protein_id gnl|my_center|LOCUS_12660 19145 17646 gene locus_tag LOCUS_12670 19145 17646 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228582.1 protein_id gnl|my_center|LOCUS_12670 19247 19322 gene locus_tag LOCUS_t00260 19247 19322 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 19404 20831 gene locus_tag LOCUS_12680 19404 20831 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887364.1 protein_id gnl|my_center|LOCUS_12680 20895 22295 gene locus_tag LOCUS_12690 20895 22295 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889437.1 protein_id gnl|my_center|LOCUS_12690 22292 24601 gene locus_tag LOCUS_12700 gene xdhB 22292 24601 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974005.1 protein_id gnl|my_center|LOCUS_12700 24633 24857 gene locus_tag LOCUS_12710 24633 24857 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227972.1 protein_id gnl|my_center|LOCUS_12710 24854 25240 gene locus_tag LOCUS_12720 24854 25240 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_12720 25243 26094 gene locus_tag LOCUS_12730 gene xdhC 25243 26094 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479762.1 protein_id gnl|my_center|LOCUS_12730 26847 26122 gene locus_tag LOCUS_12740 gene thiD 26847 26122 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228119.1 protein_id gnl|my_center|LOCUS_12740 28202 26895 gene locus_tag LOCUS_12750 gene thiC 28202 26895 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228117.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence032 774 1877 gene locus_tag LOCUS_12760 774 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227907.1 protein_id gnl|my_center|LOCUS_12760 1887 2288 gene locus_tag LOCUS_12770 gene mce 1887 2288 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172482.1 protein_id gnl|my_center|LOCUS_12770 2883 2281 gene locus_tag LOCUS_12780 2883 2281 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887810.1 protein_id gnl|my_center|LOCUS_12780 3320 2955 gene locus_tag LOCUS_12790 3320 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 4105 3404 gene locus_tag LOCUS_12800 4105 3404 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227906.1 protein_id gnl|my_center|LOCUS_12800 4203 4634 gene locus_tag LOCUS_12810 4203 4634 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228632.1 protein_id gnl|my_center|LOCUS_12810 4700 7651 gene locus_tag LOCUS_12820 gene mfd 4700 7651 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228274.1 protein_id gnl|my_center|LOCUS_12820 8969 7668 gene locus_tag LOCUS_12830 gene gabT 8969 7668 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103055.1 protein_id gnl|my_center|LOCUS_12830 10722 9076 gene locus_tag LOCUS_12840 10722 9076 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227748.1 protein_id gnl|my_center|LOCUS_12840 10997 12223 gene locus_tag LOCUS_12850 10997 12223 CDS product PEGA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228902.1 protein_id gnl|my_center|LOCUS_12850 12332 12874 gene locus_tag LOCUS_12860 12332 12874 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227921.1 protein_id gnl|my_center|LOCUS_12860 12899 13606 gene locus_tag LOCUS_12870 12899 13606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 13640 14647 gene locus_tag LOCUS_12880 13640 14647 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227687.1 protein_id gnl|my_center|LOCUS_12880 15696 14644 gene locus_tag LOCUS_12890 15696 14644 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228861.1 protein_id gnl|my_center|LOCUS_12890 16729 15737 gene locus_tag LOCUS_12900 gene plsX 16729 15737 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173767.1 protein_id gnl|my_center|LOCUS_12900 17973 16747 gene locus_tag LOCUS_12910 17973 16747 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 protein_id gnl|my_center|LOCUS_12910 18359 18027 gene locus_tag LOCUS_12920 gene trxA 18359 18027 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173768.1 protein_id gnl|my_center|LOCUS_12920 18449 18778 gene locus_tag LOCUS_12930 18449 18778 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118927.1 protein_id gnl|my_center|LOCUS_12930 19218 18784 gene locus_tag LOCUS_12940 19218 18784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 20832 19327 gene locus_tag LOCUS_12950 20832 19327 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229222.1 protein_id gnl|my_center|LOCUS_12950 21759 20893 gene locus_tag LOCUS_12960 21759 20893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 22028 24604 gene locus_tag LOCUS_12970 22028 24604 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228025.1 protein_id gnl|my_center|LOCUS_12970 25212 24601 gene locus_tag LOCUS_12980 gene kynB 25212 24601 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858074.1 protein_id gnl|my_center|LOCUS_12980 25877 25209 gene locus_tag LOCUS_12990 gene mqnB 25877 25209 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228023.1 protein_id gnl|my_center|LOCUS_12990 26232 27143 gene locus_tag LOCUS_13000 26232 27143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 27217 27792 gene locus_tag LOCUS_13010 27217 27792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence033 <1 1164 gene locus_tag LOCUS_13020 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113112.1:nitrous oxide reductase family maturation protein NosD 1149 1787 gene locus_tag LOCUS_13030 1149 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1768 2439 gene locus_tag LOCUS_13040 1768 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 2494 2997 gene locus_tag LOCUS_13050 2494 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 2994 3749 gene locus_tag LOCUS_13060 2994 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 3749 4186 gene locus_tag LOCUS_13070 3749 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 4548 4189 gene locus_tag LOCUS_13080 4548 4189 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228235.1 protein_id gnl|my_center|LOCUS_13080 4622 5299 gene locus_tag LOCUS_13090 4622 5299 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228234.1 protein_id gnl|my_center|LOCUS_13090 5296 5661 gene locus_tag LOCUS_13100 5296 5661 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228235.1 protein_id gnl|my_center|LOCUS_13100 5665 5937 gene locus_tag LOCUS_13110 5665 5937 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349861.1 protein_id gnl|my_center|LOCUS_13110 6027 6305 gene locus_tag LOCUS_13120 6027 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 8312 6312 gene locus_tag LOCUS_13130 gene uvrB 8312 6312 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228991.1 protein_id gnl|my_center|LOCUS_13130 9245 8370 gene locus_tag LOCUS_13140 gene aguB 9245 8370 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889160.1 protein_id gnl|my_center|LOCUS_13140 10282 9242 gene locus_tag LOCUS_13150 10282 9242 CDS product agmatine/peptidylarginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618851.1 protein_id gnl|my_center|LOCUS_13150 11403 10303 gene locus_tag LOCUS_13160 11403 10303 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257747.1 protein_id gnl|my_center|LOCUS_13160 12044 11439 gene locus_tag LOCUS_13170 12044 11439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 12694 12041 gene locus_tag LOCUS_13180 12694 12041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 13032 12766 gene locus_tag LOCUS_13190 13032 12766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 13705 13037 gene locus_tag LOCUS_13200 gene ccdA 13705 13037 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173460.1 protein_id gnl|my_center|LOCUS_13200 14445 13720 gene locus_tag LOCUS_13210 14445 13720 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880097.1 protein_id gnl|my_center|LOCUS_13210 15017 14454 gene locus_tag LOCUS_13220 15017 14454 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228659.1 protein_id gnl|my_center|LOCUS_13220 16321 15014 gene locus_tag LOCUS_13230 gene soxC 16321 15014 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228660.1 protein_id gnl|my_center|LOCUS_13230 17656 16379 gene locus_tag LOCUS_13240 17656 16379 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228661.1 protein_id gnl|my_center|LOCUS_13240 18649 17783 gene locus_tag LOCUS_13250 18649 17783 CDS product translation initiation factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228662.1 protein_id gnl|my_center|LOCUS_13250 19102 18671 gene locus_tag LOCUS_13260 19102 18671 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228663.1 protein_id gnl|my_center|LOCUS_13260 19915 19112 gene locus_tag LOCUS_13270 gene soxA 19915 19112 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228664.1 protein_id gnl|my_center|LOCUS_13270 20490 19918 gene locus_tag LOCUS_13280 gene soxX 20490 19918 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228665.1 protein_id gnl|my_center|LOCUS_13280 22140 20506 gene locus_tag LOCUS_13290 gene soxB 22140 20506 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228666.1 protein_id gnl|my_center|LOCUS_13290 22844 22269 gene locus_tag LOCUS_13300 gene soxX 22844 22269 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228667.1 protein_id gnl|my_center|LOCUS_13300 23646 22855 gene locus_tag LOCUS_13310 gene soxA 23646 22855 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228668.1 protein_id gnl|my_center|LOCUS_13310 23977 23657 gene locus_tag LOCUS_13320 gene soxZ 23977 23657 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228669.1 protein_id gnl|my_center|LOCUS_13320 24463 23996 gene locus_tag LOCUS_13330 gene soxY 24463 23996 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119460.1 protein_id gnl|my_center|LOCUS_13330 24833 24456 gene locus_tag LOCUS_13340 24833 24456 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228670.1 protein_id gnl|my_center|LOCUS_13340 26715 25096 gene locus_tag LOCUS_13350 26715 25096 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889593.1 protein_id gnl|my_center|LOCUS_13350 27215 26727 gene locus_tag LOCUS_13360 27215 26727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence034 <1 721 gene locus_tag LOCUS_13370 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813866.1:branched-chain amino acid ABC transporter permease 718 2481 gene locus_tag LOCUS_13380 718 2481 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350675.1 protein_id gnl|my_center|LOCUS_13380 2500 3237 gene locus_tag LOCUS_13390 2500 3237 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057841.1 protein_id gnl|my_center|LOCUS_13390 3230 3625 gene locus_tag LOCUS_13400 gene paaI 3230 3625 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228333.1 protein_id gnl|my_center|LOCUS_13400 3678 4880 gene locus_tag LOCUS_13410 3678 4880 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 protein_id gnl|my_center|LOCUS_13410 4877 5626 gene locus_tag LOCUS_13420 4877 5626 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229260.1 protein_id gnl|my_center|LOCUS_13420 5640 6986 gene locus_tag LOCUS_13430 5640 6986 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926050.1 protein_id gnl|my_center|LOCUS_13430 6983 7435 gene locus_tag LOCUS_13440 6983 7435 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228335.1 protein_id gnl|my_center|LOCUS_13440 7561 8739 gene locus_tag LOCUS_13450 gene radA 7561 8739 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228013.1 protein_id gnl|my_center|LOCUS_13450 8736 9791 gene locus_tag LOCUS_13460 8736 9791 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228012.1 protein_id gnl|my_center|LOCUS_13460 10250 9792 gene locus_tag LOCUS_13470 10250 9792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 11849 10260 gene locus_tag LOCUS_13480 11849 10260 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384516.1 protein_id gnl|my_center|LOCUS_13480 12417 11920 gene locus_tag LOCUS_13490 gene coaD 12417 11920 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173005.1 protein_id gnl|my_center|LOCUS_13490 12605 13021 gene locus_tag LOCUS_13500 12605 13021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 13018 14322 gene locus_tag LOCUS_13510 13018 14322 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228153.1 protein_id gnl|my_center|LOCUS_13510 14319 15308 gene locus_tag LOCUS_13520 14319 15308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 15308 16525 gene locus_tag LOCUS_13530 15308 16525 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228152.1 protein_id gnl|my_center|LOCUS_13530 16522 19830 gene locus_tag LOCUS_13540 16522 19830 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228151.1 protein_id gnl|my_center|LOCUS_13540 19838 20587 gene locus_tag LOCUS_13550 19838 20587 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228150.1 protein_id gnl|my_center|LOCUS_13550 20627 22492 gene locus_tag LOCUS_13560 20627 22492 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228962.1 protein_id gnl|my_center|LOCUS_13560 22512 23423 gene locus_tag LOCUS_13570 22512 23423 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228963.1 protein_id gnl|my_center|LOCUS_13570 23449 23739 gene locus_tag LOCUS_13580 23449 23739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173721.1 protein_id gnl|my_center|LOCUS_13580 23739 24164 gene locus_tag LOCUS_13590 23739 24164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 25265 24165 gene locus_tag LOCUS_13600 25265 24165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228035.1 protein_id gnl|my_center|LOCUS_13600 26029 25262 gene locus_tag LOCUS_13610 26029 25262 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172659.1 protein_id gnl|my_center|LOCUS_13610 27565 26132 gene locus_tag LOCUS_13620 gene gatA 27565 26132 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228034.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence035 328 1152 gene locus_tag LOCUS_13630 328 1152 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660376.1 protein_id gnl|my_center|LOCUS_13630 1585 1175 gene locus_tag LOCUS_13640 1585 1175 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229267.1 protein_id gnl|my_center|LOCUS_13640 1812 1582 gene locus_tag LOCUS_13650 1812 1582 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229268.1 protein_id gnl|my_center|LOCUS_13650 2971 1898 gene locus_tag LOCUS_13660 2971 1898 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227788.1 protein_id gnl|my_center|LOCUS_13660 3045 4151 gene locus_tag LOCUS_13670 3045 4151 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228181.1 protein_id gnl|my_center|LOCUS_13670 4568 4356 gene locus_tag LOCUS_13680 4568 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 5655 4930 gene locus_tag LOCUS_13690 5655 4930 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228646.1 protein_id gnl|my_center|LOCUS_13690 5708 7219 gene locus_tag LOCUS_13700 5708 7219 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228647.1 protein_id gnl|my_center|LOCUS_13700 7592 7164 gene locus_tag LOCUS_13710 7592 7164 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222283.1 protein_id gnl|my_center|LOCUS_13710 9107 7596 gene locus_tag LOCUS_13720 gene guaB 9107 7596 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227931.1 protein_id gnl|my_center|LOCUS_13720 10366 9173 gene locus_tag LOCUS_13730 10366 9173 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228201.1 protein_id gnl|my_center|LOCUS_13730 10462 11226 gene locus_tag LOCUS_13740 10462 11226 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228079.1 protein_id gnl|my_center|LOCUS_13740 11231 12844 gene locus_tag LOCUS_13750 11231 12844 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228174.1 protein_id gnl|my_center|LOCUS_13750 13836 12847 gene locus_tag LOCUS_13760 13836 12847 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173480.1 protein_id gnl|my_center|LOCUS_13760 13980 15038 gene locus_tag LOCUS_13770 13980 15038 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401259.1 protein_id gnl|my_center|LOCUS_13770 15035 16309 gene locus_tag LOCUS_13780 15035 16309 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065231.1 protein_id gnl|my_center|LOCUS_13780 16339 17190 gene locus_tag LOCUS_13790 16339 17190 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228343.1 protein_id gnl|my_center|LOCUS_13790 17187 17987 gene locus_tag LOCUS_13800 17187 17987 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228342.1 protein_id gnl|my_center|LOCUS_13800 18026 19084 gene locus_tag LOCUS_13810 18026 19084 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173056.1 protein_id gnl|my_center|LOCUS_13810 19087 20376 gene locus_tag LOCUS_13820 19087 20376 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228344.1 protein_id gnl|my_center|LOCUS_13820 20376 21089 gene locus_tag LOCUS_13830 20376 21089 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228738.1 protein_id gnl|my_center|LOCUS_13830 21670 21095 gene locus_tag LOCUS_13840 21670 21095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 22890 21718 gene locus_tag LOCUS_13850 22890 21718 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228265.1 protein_id gnl|my_center|LOCUS_13850 23950 23069 gene locus_tag LOCUS_13860 23950 23069 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228270.1 protein_id gnl|my_center|LOCUS_13860 25137 23956 gene locus_tag LOCUS_13870 25137 23956 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889249.1 protein_id gnl|my_center|LOCUS_13870 25742 25134 gene locus_tag LOCUS_13880 25742 25134 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228273.1 protein_id gnl|my_center|LOCUS_13880 26879 25758 gene locus_tag LOCUS_13890 26879 25758 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229012.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence036 899 216 gene locus_tag LOCUS_13900 899 216 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119401.1 protein_id gnl|my_center|LOCUS_13900 3250 1001 gene locus_tag LOCUS_13910 3250 1001 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479827.1 protein_id gnl|my_center|LOCUS_13910 3313 4317 gene locus_tag LOCUS_13920 3313 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228439.1 protein_id gnl|my_center|LOCUS_13920 4373 5590 gene locus_tag LOCUS_13930 4373 5590 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211249054.1 protein_id gnl|my_center|LOCUS_13930 6387 5650 gene locus_tag LOCUS_13940 6387 5650 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174202.1 protein_id gnl|my_center|LOCUS_13940 7788 6418 gene locus_tag LOCUS_13950 7788 6418 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479549.1 protein_id gnl|my_center|LOCUS_13950 8388 7882 gene locus_tag LOCUS_13960 8388 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 8625 8407 gene locus_tag LOCUS_13970 8625 8407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 8734 9528 gene locus_tag LOCUS_13980 8734 9528 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227843.1 protein_id gnl|my_center|LOCUS_13980 9903 9532 gene locus_tag LOCUS_13990 9903 9532 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228887.1 protein_id gnl|my_center|LOCUS_13990 10088 11272 gene locus_tag LOCUS_14000 10088 11272 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229031.1 protein_id gnl|my_center|LOCUS_14000 11286 12368 gene locus_tag LOCUS_14010 11286 12368 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228193.1 protein_id gnl|my_center|LOCUS_14010 12437 13495 gene locus_tag LOCUS_14020 12437 13495 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227709.1 protein_id gnl|my_center|LOCUS_14020 13539 14141 gene locus_tag LOCUS_14030 13539 14141 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886944.1 protein_id gnl|my_center|LOCUS_14030 14149 14769 gene locus_tag LOCUS_14040 14149 14769 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_14040 15156 14734 gene locus_tag LOCUS_14050 15156 14734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 16815 15622 gene locus_tag LOCUS_14060 16815 15622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 17944 16934 gene locus_tag LOCUS_14070 17944 16934 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_14070 18969 17941 gene locus_tag LOCUS_14080 18969 17941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227960.1 protein_id gnl|my_center|LOCUS_14080 20569 19001 gene locus_tag LOCUS_14090 20569 19001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 21775 20579 gene locus_tag LOCUS_14100 21775 20579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 23564 21831 gene locus_tag LOCUS_14110 23564 21831 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227959.1 protein_id gnl|my_center|LOCUS_14110 24023 23796 gene locus_tag LOCUS_14120 gene secG 24023 23796 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633583.1 protein_id gnl|my_center|LOCUS_14120 24127 24042 gene locus_tag LOCUS_t00270 24127 24042 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 25534 24140 gene locus_tag LOCUS_14130 gene lnt 25534 24140 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119347.1 protein_id gnl|my_center|LOCUS_14130 25648 26358 gene locus_tag LOCUS_14140 25648 26358 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227969.1 protein_id gnl|my_center|LOCUS_14140 26413 26736 gene locus_tag LOCUS_14150 26413 26736 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230323.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence037 192 1526 gene locus_tag LOCUS_14160 192 1526 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_14160 1755 1552 gene locus_tag LOCUS_14170 1755 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 2267 1788 gene locus_tag LOCUS_14180 2267 1788 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227750.1 protein_id gnl|my_center|LOCUS_14180 3866 2424 gene locus_tag LOCUS_14190 3866 2424 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889263.1 protein_id gnl|my_center|LOCUS_14190 4563 3892 gene locus_tag LOCUS_14200 4563 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 4661 5266 gene locus_tag LOCUS_14210 4661 5266 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992379.1 protein_id gnl|my_center|LOCUS_14210 5485 5258 gene locus_tag LOCUS_14220 5485 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 5496 5915 gene locus_tag LOCUS_14230 5496 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 5994 7139 gene locus_tag LOCUS_14240 5994 7139 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258129.1 protein_id gnl|my_center|LOCUS_14240 7154 7954 gene locus_tag LOCUS_14250 7154 7954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973691.1 protein_id gnl|my_center|LOCUS_14250 7938 8714 gene locus_tag LOCUS_14260 7938 8714 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315998.1 protein_id gnl|my_center|LOCUS_14260 8755 9753 gene locus_tag LOCUS_14270 8755 9753 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808730.1 protein_id gnl|my_center|LOCUS_14270 9781 10158 gene locus_tag LOCUS_14280 9781 10158 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174212.1 protein_id gnl|my_center|LOCUS_14280 10155 11084 gene locus_tag LOCUS_14290 gene meaB 10155 11084 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227730.1 protein_id gnl|my_center|LOCUS_14290 11092 11868 gene locus_tag LOCUS_14300 11092 11868 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887095.1 protein_id gnl|my_center|LOCUS_14300 13471 11873 gene locus_tag LOCUS_14310 13471 11873 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229156.1 protein_id gnl|my_center|LOCUS_14310 14648 13482 gene locus_tag LOCUS_14320 14648 13482 CDS product alanine--tRNA ligase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227734.1 protein_id gnl|my_center|LOCUS_14320 14683 15378 gene locus_tag LOCUS_14330 14683 15378 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228783.1 protein_id gnl|my_center|LOCUS_14330 15389 16312 gene locus_tag LOCUS_14340 15389 16312 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228782.1 protein_id gnl|my_center|LOCUS_14340 16334 17881 gene locus_tag LOCUS_14350 gene pruA 16334 17881 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228781.1 protein_id gnl|my_center|LOCUS_14350 17907 18977 gene locus_tag LOCUS_14360 17907 18977 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228041.1 protein_id gnl|my_center|LOCUS_14360 19025 19825 gene locus_tag LOCUS_14370 19025 19825 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256283.1 protein_id gnl|my_center|LOCUS_14370 19880 20350 gene locus_tag LOCUS_14380 gene dtd 19880 20350 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173028.1 protein_id gnl|my_center|LOCUS_14380 20392 21606 gene locus_tag LOCUS_14390 20392 21606 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227717.1 protein_id gnl|my_center|LOCUS_14390 21648 21899 gene locus_tag LOCUS_14400 21648 21899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 21903 22772 gene locus_tag LOCUS_14410 21903 22772 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228840.1 protein_id gnl|my_center|LOCUS_14410 24340 22775 gene locus_tag LOCUS_14420 24340 22775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065246.1 protein_id gnl|my_center|LOCUS_14420 24530 25372 gene locus_tag LOCUS_14430 24530 25372 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229011.1 protein_id gnl|my_center|LOCUS_14430 25473 26518 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatcctctacgaggctaacaggctttgcgac >Feature sequence038 312 992 gene locus_tag LOCUS_14440 312 992 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286332.1 protein_id gnl|my_center|LOCUS_14440 979 1779 gene locus_tag LOCUS_14450 979 1779 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384441.1 protein_id gnl|my_center|LOCUS_14450 1779 3248 gene locus_tag LOCUS_14460 1779 3248 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530266.1 protein_id gnl|my_center|LOCUS_14460 3241 4011 gene locus_tag LOCUS_14470 3241 4011 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530269.1 protein_id gnl|my_center|LOCUS_14470 3995 4810 gene locus_tag LOCUS_14480 3995 4810 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530271.1 protein_id gnl|my_center|LOCUS_14480 4826 6088 gene locus_tag LOCUS_14490 4826 6088 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530272.1 protein_id gnl|my_center|LOCUS_14490 6094 6933 gene locus_tag LOCUS_14500 6094 6933 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530273.1 protein_id gnl|my_center|LOCUS_14500 6949 7968 gene locus_tag LOCUS_14510 6949 7968 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443464.1 protein_id gnl|my_center|LOCUS_14510 7965 8774 gene locus_tag LOCUS_14520 7965 8774 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926101.1 protein_id gnl|my_center|LOCUS_14520 8774 9883 gene locus_tag LOCUS_14530 8774 9883 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529685.1 protein_id gnl|my_center|LOCUS_14530 9900 10706 gene locus_tag LOCUS_14540 9900 10706 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382189.1 protein_id gnl|my_center|LOCUS_14540 10703 11470 gene locus_tag LOCUS_14550 gene phnV 10703 11470 CDS product 2-aminoethylphosphonate ABC transport system, membrane component PhnV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703871.1 protein_id gnl|my_center|LOCUS_14550 12116 11496 gene locus_tag LOCUS_14560 12116 11496 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227693.1 protein_id gnl|my_center|LOCUS_14560 13519 12125 gene locus_tag LOCUS_14570 13519 12125 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228625.1 protein_id gnl|my_center|LOCUS_14570 14235 13516 gene locus_tag LOCUS_14580 14235 13516 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228624.1 protein_id gnl|my_center|LOCUS_14580 14317 14655 gene locus_tag LOCUS_14590 14317 14655 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173319.1 protein_id gnl|my_center|LOCUS_14590 15311 14649 gene locus_tag LOCUS_14600 15311 14649 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582866.1 protein_id gnl|my_center|LOCUS_14600 15386 15721 gene locus_tag LOCUS_14610 15386 15721 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816969.1 protein_id gnl|my_center|LOCUS_14610 15721 16893 gene locus_tag LOCUS_14620 15721 16893 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980645.1 protein_id gnl|my_center|LOCUS_14620 16917 17846 gene locus_tag LOCUS_14630 16917 17846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 17843 18835 gene locus_tag LOCUS_14640 17843 18835 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970694.1 protein_id gnl|my_center|LOCUS_14640 18832 20091 gene locus_tag LOCUS_14650 18832 20091 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972909.1 protein_id gnl|my_center|LOCUS_14650 20157 21062 gene locus_tag LOCUS_14660 20157 21062 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992469.1 protein_id gnl|my_center|LOCUS_14660 21120 21944 gene locus_tag LOCUS_14670 21120 21944 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314872.1 protein_id gnl|my_center|LOCUS_14670 21945 23261 gene locus_tag LOCUS_14680 21945 23261 CDS product L-fucose isomerase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582874.1 protein_id gnl|my_center|LOCUS_14680 23255 24085 gene locus_tag LOCUS_14690 23255 24085 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331257.1 protein_id gnl|my_center|LOCUS_14690 24142 24327 gene locus_tag LOCUS_14700 24142 24327 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172562.1 protein_id gnl|my_center|LOCUS_14700 24329 25279 gene locus_tag LOCUS_14710 24329 25279 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227962.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence039 564 1010 gene locus_tag LOCUS_14720 564 1010 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869023.1 protein_id gnl|my_center|LOCUS_14720 1929 1000 gene locus_tag LOCUS_14730 gene truB 1929 1000 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174127.1 protein_id gnl|my_center|LOCUS_14730 1984 2790 gene locus_tag LOCUS_14740 1984 2790 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807577.1 protein_id gnl|my_center|LOCUS_14740 3983 2787 gene locus_tag LOCUS_14750 3983 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 4636 3980 gene locus_tag LOCUS_14760 4636 3980 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479875.1 protein_id gnl|my_center|LOCUS_14760 5073 4633 gene locus_tag LOCUS_14770 5073 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 5374 5087 gene locus_tag LOCUS_14780 5374 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 6126 5530 gene locus_tag LOCUS_14790 6126 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 6286 6546 gene locus_tag LOCUS_14800 6286 6546 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172986.1 protein_id gnl|my_center|LOCUS_14800 6750 9602 gene locus_tag LOCUS_14810 gene gcvP 6750 9602 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967189.1 protein_id gnl|my_center|LOCUS_14810 10396 9617 gene locus_tag LOCUS_14820 10396 9617 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965862.1 protein_id gnl|my_center|LOCUS_14820 12952 10421 gene locus_tag LOCUS_14830 gene glgP 12952 10421 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228489.1 protein_id gnl|my_center|LOCUS_14830 13083 14768 gene locus_tag LOCUS_14840 13083 14768 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228700.1 protein_id gnl|my_center|LOCUS_14840 15407 14799 gene locus_tag LOCUS_14850 gene sdrP 15407 14799 CDS product Crp/Fnr family transcriptional regulator SdrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173413.1 protein_id gnl|my_center|LOCUS_14850 16388 15480 gene locus_tag LOCUS_14860 16388 15480 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480066.1 protein_id gnl|my_center|LOCUS_14860 16702 16385 gene locus_tag LOCUS_14870 16702 16385 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888922.1 protein_id gnl|my_center|LOCUS_14870 17599 16712 gene locus_tag LOCUS_14880 17599 16712 CDS product delta(1)-pyrroline-2-carboxylate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551610.1 protein_id gnl|my_center|LOCUS_14880 18057 17623 gene locus_tag LOCUS_14890 18057 17623 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228600.1 protein_id gnl|my_center|LOCUS_14890 18758 18057 gene locus_tag LOCUS_14900 18758 18057 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228599.1 protein_id gnl|my_center|LOCUS_14900 20155 18902 gene locus_tag LOCUS_14910 20155 18902 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228598.1 protein_id gnl|my_center|LOCUS_14910 21886 20264 gene locus_tag LOCUS_14920 gene mutL 21886 20264 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228596.1 protein_id gnl|my_center|LOCUS_14920 24420 21895 gene locus_tag LOCUS_14930 gene mutS 24420 21895 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197525138.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence040 401 165 gene locus_tag LOCUS_14940 401 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 437 1135 gene locus_tag LOCUS_14950 437 1135 CDS product recombination protein O N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926033.1 protein_id gnl|my_center|LOCUS_14950 1138 2601 gene locus_tag LOCUS_14960 1138 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 3417 2608 gene locus_tag LOCUS_14970 3417 2608 CDS product [LysW]-aminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229000.1 protein_id gnl|my_center|LOCUS_14970 3964 3428 gene locus_tag LOCUS_14980 gene yjjX 3964 3428 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226224.1 protein_id gnl|my_center|LOCUS_14980 5007 3967 gene locus_tag LOCUS_14990 gene argC 5007 3967 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229001.1 protein_id gnl|my_center|LOCUS_14990 5044 5601 gene locus_tag LOCUS_15000 5044 5601 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889427.1 protein_id gnl|my_center|LOCUS_15000 6308 5598 gene locus_tag LOCUS_15010 6308 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 6751 6305 gene locus_tag LOCUS_15020 6751 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 7266 6682 gene locus_tag LOCUS_15030 7266 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 8115 7276 gene locus_tag LOCUS_15040 gene lysX 8115 7276 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229004.1 protein_id gnl|my_center|LOCUS_15040 8326 8162 gene locus_tag LOCUS_15050 gene lysW 8326 8162 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229005.1 protein_id gnl|my_center|LOCUS_15050 8775 8467 gene locus_tag LOCUS_15060 8775 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229006.1 protein_id gnl|my_center|LOCUS_15060 9300 8797 gene locus_tag LOCUS_15070 9300 8797 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229007.1 protein_id gnl|my_center|LOCUS_15070 10543 9293 gene locus_tag LOCUS_15080 10543 9293 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926083.1 protein_id gnl|my_center|LOCUS_15080 11810 10581 gene locus_tag LOCUS_15090 gene lysS 11810 10581 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173924.1 protein_id gnl|my_center|LOCUS_15090 11984 13969 gene locus_tag LOCUS_15100 11984 13969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172834.1 protein_id gnl|my_center|LOCUS_15100 14001 14861 gene locus_tag LOCUS_15110 14001 14861 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228157.1 protein_id gnl|my_center|LOCUS_15110 14982 15677 gene locus_tag LOCUS_15120 14982 15677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 15682 16470 gene locus_tag LOCUS_15130 15682 16470 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936067.1 protein_id gnl|my_center|LOCUS_15130 16829 16569 gene locus_tag LOCUS_15140 16829 16569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 17131 17757 gene locus_tag LOCUS_15150 17131 17757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15150 17827 18039 gene locus_tag LOCUS_15160 17827 18039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15160 18141 18911 gene locus_tag LOCUS_15170 18141 18911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 20562 19000 gene locus_tag LOCUS_15180 20562 19000 CDS product IS200/IS605 family accessory protein TnpB-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228745.1 protein_id gnl|my_center|LOCUS_15180 20722 21048 gene locus_tag LOCUS_15190 20722 21048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence041 151 1107 gene locus_tag LOCUS_15200 151 1107 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228061.1 protein_id gnl|my_center|LOCUS_15200 2426 1104 gene locus_tag LOCUS_15210 gene trmFO 2426 1104 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228685.1 protein_id gnl|my_center|LOCUS_15210 2546 3022 gene locus_tag LOCUS_15220 2546 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 4169 3024 gene locus_tag LOCUS_15230 gene clpX 4169 3024 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228071.1 protein_id gnl|my_center|LOCUS_15230 4794 4207 gene locus_tag LOCUS_15240 gene clpP 4794 4207 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631995.1 protein_id gnl|my_center|LOCUS_15240 4862 6055 gene locus_tag LOCUS_15250 4862 6055 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_15250 6081 6938 gene locus_tag LOCUS_15260 6081 6938 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384741.1 protein_id gnl|my_center|LOCUS_15260 6968 8485 gene locus_tag LOCUS_15270 6968 8485 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729759.1 protein_id gnl|my_center|LOCUS_15270 10471 8534 gene locus_tag LOCUS_15280 gene gyrB 10471 8534 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228788.1 protein_id gnl|my_center|LOCUS_15280 11628 10498 gene locus_tag LOCUS_15290 11628 10498 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142934.1 protein_id gnl|my_center|LOCUS_15290 12626 11625 gene locus_tag LOCUS_15300 gene trpD 12626 11625 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173866.1 protein_id gnl|my_center|LOCUS_15300 13524 12661 gene locus_tag LOCUS_15310 13524 12661 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889298.1 protein_id gnl|my_center|LOCUS_15310 14402 13521 gene locus_tag LOCUS_15320 14402 13521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 15196 14378 gene locus_tag LOCUS_15330 15196 14378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 15833 15255 gene locus_tag LOCUS_15340 15833 15255 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926075.1 protein_id gnl|my_center|LOCUS_15340 17227 15830 gene locus_tag LOCUS_15350 gene trpE 17227 15830 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173868.1 protein_id gnl|my_center|LOCUS_15350 17406 18578 gene locus_tag LOCUS_15360 17406 18578 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227815.1 protein_id gnl|my_center|LOCUS_15360 19035 18562 gene locus_tag LOCUS_15370 19035 18562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 19104 20447 gene locus_tag LOCUS_15380 19104 20447 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227665.1 protein_id gnl|my_center|LOCUS_15380 21453 20461 gene locus_tag LOCUS_15390 21453 20461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 22053 21526 gene locus_tag LOCUS_15400 22053 21526 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928835.1 protein_id gnl|my_center|LOCUS_15400 22148 22915 gene locus_tag LOCUS_15410 gene udp 22148 22915 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073831.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence042 821 252 gene locus_tag LOCUS_15420 821 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1173 1024 gene locus_tag LOCUS_15430 1173 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1226 1981 gene locus_tag LOCUS_15440 1226 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 2578 2201 gene locus_tag LOCUS_15450 2578 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 2758 3666 gene locus_tag LOCUS_15460 2758 3666 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228457.1 protein_id gnl|my_center|LOCUS_15460 3672 4811 gene locus_tag LOCUS_15470 gene hemW 3672 4811 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227978.1 protein_id gnl|my_center|LOCUS_15470 6445 4808 gene locus_tag LOCUS_15480 gene groL 6445 4808 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174077.1 protein_id gnl|my_center|LOCUS_15480 6762 6466 gene locus_tag LOCUS_15490 gene groES 6762 6466 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174076.1 protein_id gnl|my_center|LOCUS_15490 8388 6907 gene locus_tag LOCUS_15500 8388 6907 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887156.1 protein_id gnl|my_center|LOCUS_15500 8722 9732 gene locus_tag LOCUS_15510 8722 9732 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173671.1 protein_id gnl|my_center|LOCUS_15510 9741 10958 gene locus_tag LOCUS_15520 9741 10958 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228820.1 protein_id gnl|my_center|LOCUS_15520 10983 11810 gene locus_tag LOCUS_15530 10983 11810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 12595 11798 gene locus_tag LOCUS_15540 gene truA 12595 11798 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173668.1 protein_id gnl|my_center|LOCUS_15540 13712 12633 gene locus_tag LOCUS_15550 13712 12633 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228819.1 protein_id gnl|my_center|LOCUS_15550 15271 13709 gene locus_tag LOCUS_15560 15271 13709 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840173.1 protein_id gnl|my_center|LOCUS_15560 15558 15905 gene locus_tag LOCUS_15570 15558 15905 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228527.1 protein_id gnl|my_center|LOCUS_15570 15979 16329 gene locus_tag LOCUS_15580 15979 16329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 16552 17856 gene locus_tag LOCUS_15590 16552 17856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 18384 17827 gene locus_tag LOCUS_15600 18384 17827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 19353 20831 gene locus_tag LOCUS_15610 19353 20831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 22371 21331 gene locus_tag LOCUS_15620 22371 21331 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_15620 <22918 22391 gene locus_tag LOCUS_15630 <22918 22391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085773.1:acyl-CoA dehydrogenase family protein >Feature sequence043 1217 207 gene locus_tag LOCUS_15640 1217 207 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227641.1 protein_id gnl|my_center|LOCUS_15640 1296 1958 gene locus_tag LOCUS_15650 1296 1958 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227636.1 protein_id gnl|my_center|LOCUS_15650 1974 2462 gene locus_tag LOCUS_15660 1974 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2473 3153 gene locus_tag LOCUS_15670 2473 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227635.1 protein_id gnl|my_center|LOCUS_15670 3228 5111 gene locus_tag LOCUS_15680 gene dxs 3228 5111 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227634.1 protein_id gnl|my_center|LOCUS_15680 5765 5304 gene locus_tag LOCUS_15690 5765 5304 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173961.1 protein_id gnl|my_center|LOCUS_15690 5842 6519 gene locus_tag LOCUS_15700 5842 6519 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173416.1 protein_id gnl|my_center|LOCUS_15700 7185 6523 gene locus_tag LOCUS_15710 7185 6523 CDS product type-5 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173217.1 protein_id gnl|my_center|LOCUS_15710 7270 8226 gene locus_tag LOCUS_15720 7270 8226 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 protein_id gnl|my_center|LOCUS_15720 8251 9471 gene locus_tag LOCUS_15730 8251 9471 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228611.1 protein_id gnl|my_center|LOCUS_15730 10750 9437 gene locus_tag LOCUS_15740 10750 9437 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_15740 11593 10772 gene locus_tag LOCUS_15750 11593 10772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 11942 11601 gene locus_tag LOCUS_15760 11942 11601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 12402 11965 gene locus_tag LOCUS_15770 12402 11965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 14459 12399 gene locus_tag LOCUS_15780 14459 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 15097 14519 gene locus_tag LOCUS_15790 15097 14519 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228390.1 protein_id gnl|my_center|LOCUS_15790 17062 15152 gene locus_tag LOCUS_15800 17062 15152 CDS product DUF4900 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229178.1 protein_id gnl|my_center|LOCUS_15800 17916 17050 gene locus_tag LOCUS_15810 17916 17050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 18404 17928 gene locus_tag LOCUS_15820 18404 17928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 18865 18401 gene locus_tag LOCUS_15830 18865 18401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 20045 19044 gene locus_tag LOCUS_15840 20045 19044 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228159.1 protein_id gnl|my_center|LOCUS_15840 20072 20845 gene locus_tag LOCUS_15850 gene trmI 20072 20845 CDS product tRNA (adenine(58)-N(1))-methyltransferase TrmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228067.1 protein_id gnl|my_center|LOCUS_15850 21098 22534 gene locus_tag LOCUS_15860 21098 22534 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228839.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence044 192 467 gene locus_tag LOCUS_15870 192 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 445 521 gene locus_tag LOCUS_t00280 445 521 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1569 550 gene locus_tag LOCUS_15880 gene fni 1569 550 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229187.1 protein_id gnl|my_center|LOCUS_15880 1758 2582 gene locus_tag LOCUS_15890 1758 2582 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228777.1 protein_id gnl|my_center|LOCUS_15890 4378 2579 gene locus_tag LOCUS_15900 gene uvrC 4378 2579 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228755.1 protein_id gnl|my_center|LOCUS_15900 4445 4837 gene locus_tag LOCUS_15910 4445 4837 CDS product NADH-quinone oxidoreductase subunit 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227977.1 protein_id gnl|my_center|LOCUS_15910 5657 4839 gene locus_tag LOCUS_15920 5657 4839 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259182.1 protein_id gnl|my_center|LOCUS_15920 6168 5740 gene locus_tag LOCUS_15930 6168 5740 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172524.1 protein_id gnl|my_center|LOCUS_15930 6812 6165 gene locus_tag LOCUS_15940 6812 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 7731 6817 gene locus_tag LOCUS_15950 gene ftsY 7731 6817 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227933.1 protein_id gnl|my_center|LOCUS_15950 8708 7800 gene locus_tag LOCUS_15960 8708 7800 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227725.1 protein_id gnl|my_center|LOCUS_15960 8809 9738 gene locus_tag LOCUS_15970 8809 9738 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227726.1 protein_id gnl|my_center|LOCUS_15970 9751 10698 gene locus_tag LOCUS_15980 9751 10698 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338457.1 protein_id gnl|my_center|LOCUS_15980 14355 10711 gene locus_tag LOCUS_15990 gene metH 14355 10711 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228073.1 protein_id gnl|my_center|LOCUS_15990 14433 16178 gene locus_tag LOCUS_16000 gene ade 14433 16178 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_16000 16185 17474 gene locus_tag LOCUS_16010 gene guaD 16185 17474 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889440.1 protein_id gnl|my_center|LOCUS_16010 17482 18075 gene locus_tag LOCUS_16020 17482 18075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 18586 18050 gene locus_tag LOCUS_16030 18586 18050 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888831.1 protein_id gnl|my_center|LOCUS_16030 19156 18602 gene locus_tag LOCUS_16040 19156 18602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 19255 21000 gene locus_tag LOCUS_16050 19255 21000 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence045 115 300 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcaaaaccaaagccccgaaaggggattgcaac 387 1616 gene locus_tag LOCUS_16060 387 1616 CDS product TIGR02710 family CRISPR-associated CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229155.1 protein_id gnl|my_center|LOCUS_16060 1902 2672 gene locus_tag LOCUS_16070 1902 2672 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228167.1 protein_id gnl|my_center|LOCUS_16070 2673 3008 gene locus_tag LOCUS_16080 2673 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228168.1 protein_id gnl|my_center|LOCUS_16080 3020 3538 gene locus_tag LOCUS_16090 3020 3538 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229232.1 protein_id gnl|my_center|LOCUS_16090 3538 4038 gene locus_tag LOCUS_16100 3538 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16100 4047 5096 gene locus_tag LOCUS_16110 gene cobT 4047 5096 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631396.1 protein_id gnl|my_center|LOCUS_16110 5100 5312 gene locus_tag LOCUS_16120 5100 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 5314 6009 gene locus_tag LOCUS_16130 5314 6009 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889498.1 protein_id gnl|my_center|LOCUS_16130 6442 5936 gene locus_tag LOCUS_16140 6442 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 7789 6503 gene locus_tag LOCUS_16150 7789 6503 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229023.1 protein_id gnl|my_center|LOCUS_16150 8440 7799 gene locus_tag LOCUS_16160 8440 7799 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229024.1 protein_id gnl|my_center|LOCUS_16160 8941 8450 gene locus_tag LOCUS_16170 8941 8450 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229025.1 protein_id gnl|my_center|LOCUS_16170 9706 8951 gene locus_tag LOCUS_16180 9706 8951 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229026.1 protein_id gnl|my_center|LOCUS_16180 10621 9863 gene locus_tag LOCUS_16190 10621 9863 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926101.1 protein_id gnl|my_center|LOCUS_16190 12548 10674 gene locus_tag LOCUS_16200 gene ftsH 12548 10674 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173542.1 protein_id gnl|my_center|LOCUS_16200 12759 14618 gene locus_tag LOCUS_16210 gene dnaK 12759 14618 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228715.1 protein_id gnl|my_center|LOCUS_16210 14693 15229 gene locus_tag LOCUS_16220 gene gprE 14693 15229 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228714.1 protein_id gnl|my_center|LOCUS_16220 15261 16139 gene locus_tag LOCUS_16230 gene dnaJ2 15261 16139 CDS product molecular chaperone DnaJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228713.1 protein_id gnl|my_center|LOCUS_16230 16189 17262 gene locus_tag LOCUS_16240 16189 17262 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228052.1 protein_id gnl|my_center|LOCUS_16240 18003 17269 gene locus_tag LOCUS_16250 gene surE 18003 17269 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229220.1 protein_id gnl|my_center|LOCUS_16250 18104 18823 gene locus_tag LOCUS_16260 18104 18823 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242519.1 protein_id gnl|my_center|LOCUS_16260 18871 19824 gene locus_tag LOCUS_16270 18871 19824 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626531.1 protein_id gnl|my_center|LOCUS_16270 19884 20561 gene locus_tag LOCUS_16280 19884 20561 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388217.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence046 753 439 gene locus_tag LOCUS_16290 753 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1464 763 gene locus_tag LOCUS_16300 gene hisA 1464 763 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228483.1 protein_id gnl|my_center|LOCUS_16300 1543 3657 gene locus_tag LOCUS_16310 1543 3657 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228675.1 protein_id gnl|my_center|LOCUS_16310 3757 7080 gene locus_tag LOCUS_16320 3757 7080 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258931.1 protein_id gnl|my_center|LOCUS_16320 7085 7324 gene locus_tag LOCUS_16330 7085 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 7480 8871 gene locus_tag LOCUS_16340 7480 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 9012 11651 gene locus_tag LOCUS_16350 9012 11651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 11758 12420 gene locus_tag LOCUS_16360 11758 12420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 12836 12423 gene locus_tag LOCUS_16370 12836 12423 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083374.1 protein_id gnl|my_center|LOCUS_16370 14055 12955 gene locus_tag LOCUS_16380 14055 12955 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228908.1 protein_id gnl|my_center|LOCUS_16380 14202 14492 gene locus_tag LOCUS_16390 14202 14492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 15411 14482 gene locus_tag LOCUS_16400 gene cysK 15411 14482 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227873.1 protein_id gnl|my_center|LOCUS_16400 15520 15990 gene locus_tag LOCUS_16410 15520 15990 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634034.1 protein_id gnl|my_center|LOCUS_16410 16543 16007 gene locus_tag LOCUS_16420 16543 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 17297 16548 gene locus_tag LOCUS_16430 gene ubiE 17297 16548 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_16430 18002 17340 gene locus_tag LOCUS_16440 gene phoU 18002 17340 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174206.1 protein_id gnl|my_center|LOCUS_16440 18988 18023 gene locus_tag LOCUS_16450 18988 18023 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227733.1 protein_id gnl|my_center|LOCUS_16450 19706 18990 gene locus_tag LOCUS_16460 19706 18990 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174204.1 protein_id gnl|my_center|LOCUS_16460 19792 20343 gene locus_tag LOCUS_16470 19792 20343 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888617.1 protein_id gnl|my_center|LOCUS_16470 20752 20348 gene locus_tag LOCUS_16480 20752 20348 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172656.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence047 913 629 gene locus_tag LOCUS_16490 913 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 1209 922 gene locus_tag LOCUS_16500 1209 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 1508 1206 gene locus_tag LOCUS_16510 1508 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2259 1510 gene locus_tag LOCUS_16520 2259 1510 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_16520 2975 2274 gene locus_tag LOCUS_16530 2975 2274 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632942.1 protein_id gnl|my_center|LOCUS_16530 4951 2972 gene locus_tag LOCUS_16540 gene tkt 4951 2972 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227715.1 protein_id gnl|my_center|LOCUS_16540 5126 8527 gene locus_tag LOCUS_16550 5126 8527 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_16550 8625 8795 gene locus_tag LOCUS_16560 8625 8795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 8776 11604 gene locus_tag LOCUS_16570 8776 11604 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_16570 11613 12017 gene locus_tag LOCUS_16580 11613 12017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 12057 12266 gene locus_tag LOCUS_16590 12057 12266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 12315 15590 gene locus_tag LOCUS_16600 12315 15590 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_16600 15657 16523 gene locus_tag LOCUS_16610 15657 16523 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_16610 16566 17573 gene locus_tag LOCUS_16620 16566 17573 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258144.1 protein_id gnl|my_center|LOCUS_16620 18627 17560 gene locus_tag LOCUS_16630 gene cax 18627 17560 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887018.1 protein_id gnl|my_center|LOCUS_16630 19149 18649 gene locus_tag LOCUS_16640 19149 18649 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543851.1 protein_id gnl|my_center|LOCUS_16640 20807 19788 gene locus_tag LOCUS_16650 20807 19788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 >Feature sequence048 <1 523 gene locus_tag LOCUS_16660 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228704.1:ATP-dependent Clp protease proteolytic subunit 3726 526 gene locus_tag LOCUS_16670 3726 526 CDS product chromosome segregation SMC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228281.1 protein_id gnl|my_center|LOCUS_16670 4274 3741 gene locus_tag LOCUS_16680 4274 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 5509 4271 gene locus_tag LOCUS_16690 5509 4271 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228282.1 protein_id gnl|my_center|LOCUS_16690 7152 5596 gene locus_tag LOCUS_16700 7152 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 7296 9458 gene locus_tag LOCUS_16710 7296 9458 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926052.1 protein_id gnl|my_center|LOCUS_16710 9494 10774 gene locus_tag LOCUS_16720 gene hisS 9494 10774 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172810.1 protein_id gnl|my_center|LOCUS_16720 11212 10781 gene locus_tag LOCUS_16730 gene smpB 11212 10781 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172991.1 protein_id gnl|my_center|LOCUS_16730 11409 11272 gene locus_tag LOCUS_16740 11409 11272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 11423 12505 gene locus_tag LOCUS_16750 gene rodA 11423 12505 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228544.1 protein_id gnl|my_center|LOCUS_16750 13716 12490 gene locus_tag LOCUS_16760 13716 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 14291 13722 gene locus_tag LOCUS_16770 gene yqeK 14291 13722 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173800.1 protein_id gnl|my_center|LOCUS_16770 14450 14755 gene locus_tag LOCUS_16780 gene rplU 14450 14755 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633581.1 protein_id gnl|my_center|LOCUS_16780 14766 15038 gene locus_tag LOCUS_16790 gene rpmA 14766 15038 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228914.1 protein_id gnl|my_center|LOCUS_16790 15090 16340 gene locus_tag LOCUS_16800 gene obgE 15090 16340 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228913.1 protein_id gnl|my_center|LOCUS_16800 16347 16688 gene locus_tag LOCUS_16810 gene rsfS 16347 16688 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633572.1 protein_id gnl|my_center|LOCUS_16810 17336 16683 gene locus_tag LOCUS_16820 17336 16683 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228230.1 protein_id gnl|my_center|LOCUS_16820 17963 17337 gene locus_tag LOCUS_16830 17963 17337 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172926.1 protein_id gnl|my_center|LOCUS_16830 19343 18000 gene locus_tag LOCUS_16840 gene accC 19343 18000 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886765.1 protein_id gnl|my_center|LOCUS_16840 19841 19356 gene locus_tag LOCUS_16850 gene accB 19841 19356 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228456.1 protein_id gnl|my_center|LOCUS_16850 20564 20010 gene locus_tag LOCUS_16860 gene efp 20564 20010 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173195.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence049 191 1045 gene locus_tag LOCUS_16870 191 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 1103 2197 gene locus_tag LOCUS_16880 1103 2197 CDS product 5-methylthioribulose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389751.1 protein_id gnl|my_center|LOCUS_16880 2203 2421 gene locus_tag LOCUS_16890 2203 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16890 2391 2657 gene locus_tag LOCUS_16900 2391 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16900 3383 2661 gene locus_tag LOCUS_16910 3383 2661 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227644.1 protein_id gnl|my_center|LOCUS_16910 3475 5016 gene locus_tag LOCUS_16920 3475 5016 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926057.1 protein_id gnl|my_center|LOCUS_16920 5069 6274 gene locus_tag LOCUS_16930 5069 6274 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228979.1 protein_id gnl|my_center|LOCUS_16930 6593 6348 gene locus_tag LOCUS_16940 6593 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 6767 8059 gene locus_tag LOCUS_16950 gene ffh 6767 8059 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173116.1 protein_id gnl|my_center|LOCUS_16950 8071 8313 gene locus_tag LOCUS_16960 gene rpsP 8071 8313 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173115.1 protein_id gnl|my_center|LOCUS_16960 8374 8592 gene locus_tag LOCUS_16970 8374 8592 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173114.1 protein_id gnl|my_center|LOCUS_16970 8615 9115 gene locus_tag LOCUS_16980 gene rimM 8615 9115 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228392.1 protein_id gnl|my_center|LOCUS_16980 9112 9828 gene locus_tag LOCUS_16990 gene trmD 9112 9828 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632436.1 protein_id gnl|my_center|LOCUS_16990 9858 10682 gene locus_tag LOCUS_17000 9858 10682 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227785.1 protein_id gnl|my_center|LOCUS_17000 10582 11112 gene locus_tag LOCUS_17010 gene hpt 10582 11112 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227786.1 protein_id gnl|my_center|LOCUS_17010 11133 11810 gene locus_tag LOCUS_17020 11133 11810 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_17020 12070 11807 gene locus_tag LOCUS_17030 12070 11807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 12119 13048 gene locus_tag LOCUS_17040 gene rihB 12119 13048 CDS product ribosylpyrimidine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415422.1 protein_id gnl|my_center|LOCUS_17040 13099 14313 gene locus_tag LOCUS_17050 13099 14313 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480316.1 protein_id gnl|my_center|LOCUS_17050 14428 17022 gene locus_tag LOCUS_17060 14428 17022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 17081 18256 gene locus_tag LOCUS_17070 gene metK 17081 18256 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173679.1 protein_id gnl|my_center|LOCUS_17070 19296 18292 gene locus_tag LOCUS_17080 19296 18292 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174155.1 protein_id gnl|my_center|LOCUS_17080 20236 19325 gene locus_tag LOCUS_17090 gene trmB 20236 19325 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228808.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence050 103 597 gene locus_tag LOCUS_17100 103 597 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174509.1 protein_id gnl|my_center|LOCUS_17100 587 1528 gene locus_tag LOCUS_17110 gene uvsE 587 1528 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605880.1 protein_id gnl|my_center|LOCUS_17110 3372 1525 gene locus_tag LOCUS_17120 3372 1525 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228821.1 protein_id gnl|my_center|LOCUS_17120 5356 3482 gene locus_tag LOCUS_17130 5356 3482 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228821.1 protein_id gnl|my_center|LOCUS_17130 5946 5509 gene locus_tag LOCUS_17140 gene erpA 5946 5509 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228822.1 protein_id gnl|my_center|LOCUS_17140 5965 7104 gene locus_tag LOCUS_17150 5965 7104 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_17150 8012 7080 gene locus_tag LOCUS_17160 8012 7080 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227915.1 protein_id gnl|my_center|LOCUS_17160 9251 8013 gene locus_tag LOCUS_17170 gene fabF 9251 8013 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227920.1 protein_id gnl|my_center|LOCUS_17170 9726 9265 gene locus_tag LOCUS_17180 9726 9265 CDS product DUF5317 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173430.1 protein_id gnl|my_center|LOCUS_17180 11108 9750 gene locus_tag LOCUS_17190 11108 9750 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228635.1 protein_id gnl|my_center|LOCUS_17190 11916 11572 gene locus_tag LOCUS_17200 11916 11572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 12075 12731 gene locus_tag LOCUS_17210 12075 12731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 13525 12701 gene locus_tag LOCUS_17220 13525 12701 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228494.1 protein_id gnl|my_center|LOCUS_17220 13511 13756 gene locus_tag LOCUS_17230 13511 13756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 13845 16223 gene locus_tag LOCUS_17240 13845 16223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 17423 16263 gene locus_tag LOCUS_17250 17423 16263 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228602.1 protein_id gnl|my_center|LOCUS_17250 18766 17573 gene locus_tag LOCUS_17260 18766 17573 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_17260 18854 19621 gene locus_tag LOCUS_17270 18854 19621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228556.1 protein_id gnl|my_center|LOCUS_17270 19669 19872 gene locus_tag LOCUS_17280 19669 19872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 19862 20026 gene locus_tag LOCUS_17290 19862 20026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence051 1531 704 gene locus_tag LOCUS_17300 1531 704 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926124.1 protein_id gnl|my_center|LOCUS_17300 2211 1546 gene locus_tag LOCUS_17310 2211 1546 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889187.1 protein_id gnl|my_center|LOCUS_17310 2316 3197 gene locus_tag LOCUS_17320 gene carH 2316 3197 CDS product HTH-type transcriptional repressor CarH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229194.1 protein_id gnl|my_center|LOCUS_17320 3219 3809 gene locus_tag LOCUS_17330 gene ldrP 3219 3809 CDS product transcriptional regulator LdrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229195.1 protein_id gnl|my_center|LOCUS_17330 3935 4834 gene locus_tag LOCUS_17340 3935 4834 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229196.1 protein_id gnl|my_center|LOCUS_17340 4881 5150 gene locus_tag LOCUS_17350 4881 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 5188 5997 gene locus_tag LOCUS_17360 5188 5997 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173830.1 protein_id gnl|my_center|LOCUS_17360 6305 5988 gene locus_tag LOCUS_17370 6305 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 6370 7329 gene locus_tag LOCUS_17380 gene ddl 6370 7329 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228789.1 protein_id gnl|my_center|LOCUS_17380 8666 7326 gene locus_tag LOCUS_17390 8666 7326 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227645.1 protein_id gnl|my_center|LOCUS_17390 9831 8674 gene locus_tag LOCUS_17400 9831 8674 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888092.1 protein_id gnl|my_center|LOCUS_17400 10950 9835 gene locus_tag LOCUS_17410 10950 9835 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228826.1 protein_id gnl|my_center|LOCUS_17410 11056 11706 gene locus_tag LOCUS_17420 11056 11706 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227771.1 protein_id gnl|my_center|LOCUS_17420 11716 12201 gene locus_tag LOCUS_17430 11716 12201 CDS product DUF4384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227770.1 protein_id gnl|my_center|LOCUS_17430 13452 12205 gene locus_tag LOCUS_17440 gene hisD 13452 12205 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228145.1 protein_id gnl|my_center|LOCUS_17440 14173 13484 gene locus_tag LOCUS_17450 14173 13484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228144.1 protein_id gnl|my_center|LOCUS_17450 14383 16734 gene locus_tag LOCUS_17460 14383 16734 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871577.1 protein_id gnl|my_center|LOCUS_17460 16782 17429 gene locus_tag LOCUS_17470 16782 17429 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228721.1 protein_id gnl|my_center|LOCUS_17470 19901 17439 gene locus_tag LOCUS_17480 19901 17439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence052 596 201 gene locus_tag LOCUS_17490 596 201 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889330.1 protein_id gnl|my_center|LOCUS_17490 1023 655 gene locus_tag LOCUS_17500 1023 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 1688 1020 gene locus_tag LOCUS_17510 1688 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 2726 2235 gene locus_tag LOCUS_17520 2726 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 2825 3265 gene locus_tag LOCUS_17530 2825 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 3308 3856 gene locus_tag LOCUS_17540 3308 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 3941 4381 gene locus_tag LOCUS_17550 3941 4381 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229034.1 protein_id gnl|my_center|LOCUS_17550 4384 5049 gene locus_tag LOCUS_17560 4384 5049 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229033.1 protein_id gnl|my_center|LOCUS_17560 5151 5732 gene locus_tag LOCUS_17570 5151 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 5779 6954 gene locus_tag LOCUS_17580 5779 6954 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577656.1 protein_id gnl|my_center|LOCUS_17580 6951 8150 gene locus_tag LOCUS_17590 6951 8150 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398440.1 protein_id gnl|my_center|LOCUS_17590 8185 8367 gene locus_tag LOCUS_17600 8185 8367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 8762 10015 gene locus_tag LOCUS_17610 8762 10015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 10761 10171 gene locus_tag LOCUS_17620 10761 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 15234 10771 gene locus_tag LOCUS_17630 15234 10771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 15987 15247 gene locus_tag LOCUS_17640 15987 15247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 16103 16807 gene locus_tag LOCUS_17650 16103 16807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 17196 16933 gene locus_tag LOCUS_17660 17196 16933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 17705 17238 gene locus_tag LOCUS_17670 17705 17238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 17860 17699 gene locus_tag LOCUS_17680 17860 17699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 17829 18257 gene locus_tag LOCUS_17690 17829 18257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 18295 18864 gene locus_tag LOCUS_17700 18295 18864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 18867 19340 gene locus_tag LOCUS_17710 18867 19340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence053 451 1410 gene locus_tag LOCUS_17720 451 1410 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_17720 2324 1407 gene locus_tag LOCUS_17730 gene holA 2324 1407 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228200.1 protein_id gnl|my_center|LOCUS_17730 2647 2321 gene locus_tag LOCUS_17740 2647 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2688 3359 gene locus_tag LOCUS_17750 2688 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 4537 3356 gene locus_tag LOCUS_17760 gene carA 4537 3356 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174069.1 protein_id gnl|my_center|LOCUS_17760 5098 4544 gene locus_tag LOCUS_17770 5098 4544 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038039476.1 protein_id gnl|my_center|LOCUS_17770 6489 5095 gene locus_tag LOCUS_17780 gene argH 6489 5095 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227830.1 protein_id gnl|my_center|LOCUS_17780 7691 6498 gene locus_tag LOCUS_17790 7691 6498 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_17790 7941 8495 gene locus_tag LOCUS_17800 7941 8495 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228301.1 protein_id gnl|my_center|LOCUS_17800 8537 9931 gene locus_tag LOCUS_17810 8537 9931 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081003.1 protein_id gnl|my_center|LOCUS_17810 9943 11259 gene locus_tag LOCUS_17820 9943 11259 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_17820 11261 11785 gene locus_tag LOCUS_17830 11261 11785 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227953.1 protein_id gnl|my_center|LOCUS_17830 11827 12978 gene locus_tag LOCUS_17840 gene aspC 11827 12978 CDS product aspartate/prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227669.1 protein_id gnl|my_center|LOCUS_17840 13838 12975 gene locus_tag LOCUS_17850 13838 12975 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227674.1 protein_id gnl|my_center|LOCUS_17850 13909 14802 gene locus_tag LOCUS_17860 13909 14802 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227672.1 protein_id gnl|my_center|LOCUS_17860 14882 16879 gene locus_tag LOCUS_17870 14882 16879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 16883 17110 gene locus_tag LOCUS_17880 16883 17110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 17715 17113 gene locus_tag LOCUS_17890 17715 17113 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 protein_id gnl|my_center|LOCUS_17890 18274 17726 gene locus_tag LOCUS_17900 gene msrA 18274 17726 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_17900 19064 18285 gene locus_tag LOCUS_17910 19064 18285 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228978.1 protein_id gnl|my_center|LOCUS_17910 <20250 19146 gene locus_tag LOCUS_17920 <20250 19146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037253001.1:polysaccharide biosynthesis tyrosine autokinase >Feature sequence054 601 3207 gene locus_tag LOCUS_17930 601 3207 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886794.1 protein_id gnl|my_center|LOCUS_17930 3204 3833 gene locus_tag LOCUS_17940 3204 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974662.1 protein_id gnl|my_center|LOCUS_17940 4712 3840 gene locus_tag LOCUS_17950 gene sucD 4712 3840 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228009.1 protein_id gnl|my_center|LOCUS_17950 5845 4709 gene locus_tag LOCUS_17960 gene sucC 5845 4709 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228010.1 protein_id gnl|my_center|LOCUS_17960 5931 6338 gene locus_tag LOCUS_17970 5931 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 6421 6942 gene locus_tag LOCUS_17980 gene pdxT 6421 6942 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228136.1 protein_id gnl|my_center|LOCUS_17980 8394 7021 gene locus_tag LOCUS_17990 8394 7021 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888807.1 protein_id gnl|my_center|LOCUS_17990 8903 8499 gene locus_tag LOCUS_18000 8903 8499 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228397.1 protein_id gnl|my_center|LOCUS_18000 9041 10228 gene locus_tag LOCUS_18010 9041 10228 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976271.1 protein_id gnl|my_center|LOCUS_18010 10231 11091 gene locus_tag LOCUS_18020 10231 11091 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086169.1 protein_id gnl|my_center|LOCUS_18020 11088 12038 gene locus_tag LOCUS_18030 11088 12038 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_18030 12019 13479 gene locus_tag LOCUS_18040 12019 13479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 13488 14822 gene locus_tag LOCUS_18050 13488 14822 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116063.1 protein_id gnl|my_center|LOCUS_18050 14831 15343 gene locus_tag LOCUS_18060 14831 15343 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276072.1 protein_id gnl|my_center|LOCUS_18060 15354 15608 gene locus_tag LOCUS_18070 15354 15608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 15601 16800 gene locus_tag LOCUS_18080 15601 16800 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441295.1 protein_id gnl|my_center|LOCUS_18080 16891 17874 gene locus_tag LOCUS_18090 16891 17874 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086600.1 protein_id gnl|my_center|LOCUS_18090 17876 18532 gene locus_tag LOCUS_18100 17876 18532 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930315.1 protein_id gnl|my_center|LOCUS_18100 18529 19440 gene locus_tag LOCUS_18110 18529 19440 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007717423.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence055 1911 925 gene locus_tag LOCUS_18120 gene glpX 1911 925 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632957.1 protein_id gnl|my_center|LOCUS_18120 2603 1971 gene locus_tag LOCUS_18130 gene hisIE 2603 1971 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228687.1 protein_id gnl|my_center|LOCUS_18130 3400 2609 gene locus_tag LOCUS_18140 gene hisF 3400 2609 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228686.1 protein_id gnl|my_center|LOCUS_18140 4596 3397 gene locus_tag LOCUS_18150 4596 3397 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228618.1 protein_id gnl|my_center|LOCUS_18150 4729 5676 gene locus_tag LOCUS_18160 4729 5676 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228475.1 protein_id gnl|my_center|LOCUS_18160 5789 7834 gene locus_tag LOCUS_18170 5789 7834 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228476.1 protein_id gnl|my_center|LOCUS_18170 7831 8280 gene locus_tag LOCUS_18180 7831 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 9063 8167 gene locus_tag LOCUS_18190 9063 8167 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228479.1 protein_id gnl|my_center|LOCUS_18190 9170 9958 gene locus_tag LOCUS_18200 gene trpC 9170 9958 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228482.1 protein_id gnl|my_center|LOCUS_18200 10494 9955 gene locus_tag LOCUS_18210 10494 9955 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_18210 10828 10496 gene locus_tag LOCUS_18220 10828 10496 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258045.1 protein_id gnl|my_center|LOCUS_18220 11559 10846 gene locus_tag LOCUS_18230 11559 10846 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_18230 12349 11546 gene locus_tag LOCUS_18240 12349 11546 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256821.1 protein_id gnl|my_center|LOCUS_18240 13779 12346 gene locus_tag LOCUS_18250 13779 12346 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228604.1 protein_id gnl|my_center|LOCUS_18250 14756 13776 gene locus_tag LOCUS_18260 14756 13776 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228603.1 protein_id gnl|my_center|LOCUS_18260 15760 14861 gene locus_tag LOCUS_18270 15760 14861 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228784.1 protein_id gnl|my_center|LOCUS_18270 15698 15925 gene locus_tag LOCUS_18280 15698 15925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 16890 15922 gene locus_tag LOCUS_18290 16890 15922 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227740.1 protein_id gnl|my_center|LOCUS_18290 17352 16909 gene locus_tag LOCUS_18300 17352 16909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228018.1 protein_id gnl|my_center|LOCUS_18300 18377 17382 gene locus_tag LOCUS_18310 18377 17382 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228015.1 protein_id gnl|my_center|LOCUS_18310 18567 18642 gene locus_tag LOCUS_t00290 18567 18642 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 19400 18687 gene locus_tag LOCUS_18320 19400 18687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence056 1263 598 gene locus_tag LOCUS_18330 1263 598 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528167.1 protein_id gnl|my_center|LOCUS_18330 1408 2367 gene locus_tag LOCUS_18340 1408 2367 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085835.1 protein_id gnl|my_center|LOCUS_18340 2377 2796 gene locus_tag LOCUS_18350 2377 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 2793 4274 gene locus_tag LOCUS_18360 2793 4274 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085833.1 protein_id gnl|my_center|LOCUS_18360 4274 5239 gene locus_tag LOCUS_18370 4274 5239 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170440.1 protein_id gnl|my_center|LOCUS_18370 5244 7070 gene locus_tag LOCUS_18380 5244 7070 CDS product sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083873.1 protein_id gnl|my_center|LOCUS_18380 8149 7058 gene locus_tag LOCUS_18390 8149 7058 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027597.1 protein_id gnl|my_center|LOCUS_18390 8488 8985 gene locus_tag LOCUS_18400 8488 8985 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_18400 8996 11362 gene locus_tag LOCUS_18410 8996 11362 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_18410 11412 12251 gene locus_tag LOCUS_18420 11412 12251 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_18420 12317 13216 gene locus_tag LOCUS_18430 12317 13216 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_18430 13213 14370 gene locus_tag LOCUS_18440 13213 14370 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_18440 14738 14367 gene locus_tag LOCUS_18450 14738 14367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 17359 14735 gene locus_tag LOCUS_18460 gene leuS 17359 14735 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227747.1 protein_id gnl|my_center|LOCUS_18460 17607 17522 gene locus_tag LOCUS_t00300 17607 17522 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17711 18166 gene locus_tag LOCUS_18470 17711 18166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 18243 19292 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatcctcactcgagctttcgcccgagtgcaac >Feature sequence057 1675 41 gene locus_tag LOCUS_18480 gene crtI 1675 41 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530118.1 protein_id gnl|my_center|LOCUS_18480 3470 1728 gene locus_tag LOCUS_18490 gene rny 3470 1728 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228936.1 protein_id gnl|my_center|LOCUS_18490 4733 3675 gene locus_tag LOCUS_18500 gene recA 4733 3675 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228937.1 protein_id gnl|my_center|LOCUS_18500 5238 4714 gene locus_tag LOCUS_18510 gene thpR 5238 4714 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173843.1 protein_id gnl|my_center|LOCUS_18510 6422 5235 gene locus_tag LOCUS_18520 6422 5235 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228938.1 protein_id gnl|my_center|LOCUS_18520 7477 6500 gene locus_tag LOCUS_18530 7477 6500 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479587.1 protein_id gnl|my_center|LOCUS_18530 10823 7518 gene locus_tag LOCUS_18540 10823 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 16378 10820 gene locus_tag LOCUS_18550 16378 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229122.1 protein_id gnl|my_center|LOCUS_18550 17484 16375 gene locus_tag LOCUS_18560 17484 16375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 19049 17565 gene locus_tag LOCUS_18570 19049 17565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence058 <1 2339 gene locus_tag LOCUS_18580 <1 2339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228550.1:adenylate/guanylate cyclase domain-containing protein 2414 4183 gene locus_tag LOCUS_18590 gene dnaG 2414 4183 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228551.1 protein_id gnl|my_center|LOCUS_18590 4946 4188 gene locus_tag LOCUS_18600 4946 4188 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172783.1 protein_id gnl|my_center|LOCUS_18600 5677 4973 gene locus_tag LOCUS_18610 5677 4973 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228129.1 protein_id gnl|my_center|LOCUS_18610 6390 5674 gene locus_tag LOCUS_18620 6390 5674 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 protein_id gnl|my_center|LOCUS_18620 7285 6383 gene locus_tag LOCUS_18630 7285 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 8139 7282 gene locus_tag LOCUS_18640 8139 7282 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_18640 9304 8147 gene locus_tag LOCUS_18650 9304 8147 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809685.1 protein_id gnl|my_center|LOCUS_18650 9720 9316 gene locus_tag LOCUS_18660 9720 9316 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 protein_id gnl|my_center|LOCUS_18660 10520 9717 gene locus_tag LOCUS_18670 10520 9717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 11985 10513 gene locus_tag LOCUS_18680 11985 10513 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 protein_id gnl|my_center|LOCUS_18680 12989 11976 gene locus_tag LOCUS_18690 12989 11976 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938503.1 protein_id gnl|my_center|LOCUS_18690 14081 13053 gene locus_tag LOCUS_18700 14081 13053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 14157 14708 gene locus_tag LOCUS_18710 14157 14708 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888627.1 protein_id gnl|my_center|LOCUS_18710 17083 14705 gene locus_tag LOCUS_18720 17083 14705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 17326 18216 gene locus_tag LOCUS_18730 17326 18216 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174107.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence059 2015 282 gene locus_tag LOCUS_18740 2015 282 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172599.1 protein_id gnl|my_center|LOCUS_18740 2268 3632 gene locus_tag LOCUS_18750 gene mgtE 2268 3632 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228410.1 protein_id gnl|my_center|LOCUS_18750 3641 4066 gene locus_tag LOCUS_18760 3641 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 4579 4019 gene locus_tag LOCUS_18770 4579 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 6024 4597 gene locus_tag LOCUS_18780 6024 4597 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888366.1 protein_id gnl|my_center|LOCUS_18780 6115 6825 gene locus_tag LOCUS_18790 6115 6825 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228242.1 protein_id gnl|my_center|LOCUS_18790 6847 7131 gene locus_tag LOCUS_18800 6847 7131 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228240.1 protein_id gnl|my_center|LOCUS_18800 7156 7704 gene locus_tag LOCUS_18810 7156 7704 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228239.1 protein_id gnl|my_center|LOCUS_18810 8330 7701 gene locus_tag LOCUS_18820 8330 7701 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 protein_id gnl|my_center|LOCUS_18820 9565 8327 gene locus_tag LOCUS_18830 9565 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 9707 10165 gene locus_tag LOCUS_18840 9707 10165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 11443 10169 gene locus_tag LOCUS_18850 gene icd 11443 10169 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189552.1 protein_id gnl|my_center|LOCUS_18850 11501 11959 gene locus_tag LOCUS_18860 11501 11959 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228204.1 protein_id gnl|my_center|LOCUS_18860 13179 11965 gene locus_tag LOCUS_18870 gene coaBC 13179 11965 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392412.1 protein_id gnl|my_center|LOCUS_18870 13940 13176 gene locus_tag LOCUS_18880 13940 13176 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_18880 14878 14303 gene locus_tag LOCUS_18890 14878 14303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 14918 16912 gene locus_tag LOCUS_18900 14918 16912 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228351.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence060 975 418 gene locus_tag LOCUS_18910 975 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227753.1 protein_id gnl|my_center|LOCUS_18910 1254 1063 gene locus_tag LOCUS_18920 1254 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 3224 1254 gene locus_tag LOCUS_18930 gene tkt 3224 1254 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227715.1 protein_id gnl|my_center|LOCUS_18930 3445 3927 gene locus_tag LOCUS_18940 gene cbaB 3445 3927 CDS product ba3-type cytochrome C oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173203.1 protein_id gnl|my_center|LOCUS_18940 3940 5622 gene locus_tag LOCUS_18950 gene cbaA 3940 5622 CDS product ba3-type cytochrome C oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173204.1 protein_id gnl|my_center|LOCUS_18950 5901 5680 gene locus_tag LOCUS_18960 gene rpmE 5901 5680 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887471.1 protein_id gnl|my_center|LOCUS_18960 5995 6363 gene locus_tag LOCUS_18970 gene aroH 5995 6363 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172959.1 protein_id gnl|my_center|LOCUS_18970 8272 6386 gene locus_tag LOCUS_18980 gene metG 8272 6386 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228577.1 protein_id gnl|my_center|LOCUS_18980 9101 8415 gene locus_tag LOCUS_18990 gene rpiA 9101 8415 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632746.1 protein_id gnl|my_center|LOCUS_18990 9581 9105 gene locus_tag LOCUS_19000 gene bcp 9581 9105 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_19000 10087 9596 gene locus_tag LOCUS_19010 10087 9596 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228431.1 protein_id gnl|my_center|LOCUS_19010 10640 10092 gene locus_tag LOCUS_19020 10640 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926046.1 protein_id gnl|my_center|LOCUS_19020 11404 10646 gene locus_tag LOCUS_19030 gene proC 11404 10646 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228245.1 protein_id gnl|my_center|LOCUS_19030 11507 12040 gene locus_tag LOCUS_19040 gene tsaB 11507 12040 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227889.1 protein_id gnl|my_center|LOCUS_19040 12037 13137 gene locus_tag LOCUS_19050 12037 13137 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228006.1 protein_id gnl|my_center|LOCUS_19050 13166 14710 gene locus_tag LOCUS_19060 13166 14710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 15755 14721 gene locus_tag LOCUS_19070 15755 14721 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918423.1 protein_id gnl|my_center|LOCUS_19070 16888 15797 gene locus_tag LOCUS_19080 gene nagA 16888 15797 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195336.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence061 <1 1765 gene locus_tag LOCUS_19090 <1 1765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942980.1:putative monovalent cation/H+ antiporter subunit A 1762 2187 gene locus_tag LOCUS_19100 1762 2187 CDS product Na+/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327700.1 protein_id gnl|my_center|LOCUS_19100 2187 2600 gene locus_tag LOCUS_19110 2187 2600 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 protein_id gnl|my_center|LOCUS_19110 2597 4072 gene locus_tag LOCUS_19120 2597 4072 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942977.1 protein_id gnl|my_center|LOCUS_19120 4069 4548 gene locus_tag LOCUS_19130 4069 4548 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942976.1 protein_id gnl|my_center|LOCUS_19130 4545 4811 gene locus_tag LOCUS_19140 4545 4811 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404442.1 protein_id gnl|my_center|LOCUS_19140 4842 5222 gene locus_tag LOCUS_19150 gene mnhG 4842 5222 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958313.1 protein_id gnl|my_center|LOCUS_19150 5967 5227 gene locus_tag LOCUS_19160 5967 5227 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895490.1 protein_id gnl|my_center|LOCUS_19160 7130 5970 gene locus_tag LOCUS_19170 7130 5970 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_19170 7229 7690 gene locus_tag LOCUS_19180 7229 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 7694 8446 gene locus_tag LOCUS_19190 7694 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228674.1 protein_id gnl|my_center|LOCUS_19190 9181 8453 gene locus_tag LOCUS_19200 9181 8453 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926088.1 protein_id gnl|my_center|LOCUS_19200 10565 9270 gene locus_tag LOCUS_19210 gene aceA 10565 9270 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173860.1 protein_id gnl|my_center|LOCUS_19210 13871 10746 gene locus_tag LOCUS_19220 gene carB 13871 10746 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228069.1 protein_id gnl|my_center|LOCUS_19220 15161 13962 gene locus_tag LOCUS_19230 15161 13962 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228267.1 protein_id gnl|my_center|LOCUS_19230 15278 15733 gene locus_tag LOCUS_19240 15278 15733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 16747 16085 gene locus_tag LOCUS_19250 16747 16085 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142341.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence062 941 459 gene locus_tag LOCUS_19260 941 459 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228028.1 protein_id gnl|my_center|LOCUS_19260 1605 964 gene locus_tag LOCUS_19270 1605 964 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228027.1 protein_id gnl|my_center|LOCUS_19270 2435 1608 gene locus_tag LOCUS_19280 2435 1608 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228026.1 protein_id gnl|my_center|LOCUS_19280 3836 2628 gene locus_tag LOCUS_19290 3836 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 5859 4138 gene locus_tag LOCUS_19300 5859 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 7418 5949 gene locus_tag LOCUS_19310 7418 5949 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197525141.1 protein_id gnl|my_center|LOCUS_19310 8331 7462 gene locus_tag LOCUS_19320 8331 7462 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173484.1 protein_id gnl|my_center|LOCUS_19320 9203 8406 gene locus_tag LOCUS_19330 9203 8406 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_19330 11754 9232 gene locus_tag LOCUS_19340 gene polA 11754 9232 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228405.1 protein_id gnl|my_center|LOCUS_19340 12168 11797 gene locus_tag LOCUS_19350 12168 11797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 12863 12165 gene locus_tag LOCUS_19360 12863 12165 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228101.1 protein_id gnl|my_center|LOCUS_19360 13626 12865 gene locus_tag LOCUS_19370 13626 12865 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228100.1 protein_id gnl|my_center|LOCUS_19370 14425 13631 gene locus_tag LOCUS_19380 14425 13631 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228146.1 protein_id gnl|my_center|LOCUS_19380 14997 14422 gene locus_tag LOCUS_19390 gene coaE 14997 14422 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173002.1 protein_id gnl|my_center|LOCUS_19390 16017 15619 gene locus_tag LOCUS_19400 16017 15619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 16136 16603 gene locus_tag LOCUS_19410 16136 16603 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174341.1 protein_id gnl|my_center|LOCUS_19410 16927 16496 gene locus_tag LOCUS_19420 16927 16496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 >Feature sequence063 2194 617 gene locus_tag LOCUS_19430 gene aceB 2194 617 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227987.1 protein_id gnl|my_center|LOCUS_19430 2317 3129 gene locus_tag LOCUS_19440 2317 3129 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887799.1 protein_id gnl|my_center|LOCUS_19440 3579 3139 gene locus_tag LOCUS_19450 gene speD 3579 3139 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014510642.1 protein_id gnl|my_center|LOCUS_19450 3821 4573 gene locus_tag LOCUS_19460 3821 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_19460 4585 6414 gene locus_tag LOCUS_19470 4585 6414 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_19470 6417 7187 gene locus_tag LOCUS_19480 6417 7187 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 protein_id gnl|my_center|LOCUS_19480 7305 8372 gene locus_tag LOCUS_19490 7305 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 8540 8788 gene locus_tag LOCUS_19500 8540 8788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 9083 10147 gene locus_tag LOCUS_19510 9083 10147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19510 11300 10203 gene locus_tag LOCUS_19520 gene mnmA 11300 10203 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174090.1 protein_id gnl|my_center|LOCUS_19520 11558 12103 gene locus_tag LOCUS_19530 gene pyrR 11558 12103 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172875.1 protein_id gnl|my_center|LOCUS_19530 12100 13023 gene locus_tag LOCUS_19540 12100 13023 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172874.1 protein_id gnl|my_center|LOCUS_19540 13030 14334 gene locus_tag LOCUS_19550 13030 14334 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228195.1 protein_id gnl|my_center|LOCUS_19550 14370 14852 gene locus_tag LOCUS_19560 14370 14852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 15125 15631 gene locus_tag LOCUS_19570 15125 15631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119628.1 protein_id gnl|my_center|LOCUS_19570 15644 16921 gene locus_tag LOCUS_19580 15644 16921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence064 1313 264 gene locus_tag LOCUS_19590 1313 264 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256159.1 protein_id gnl|my_center|LOCUS_19590 3150 1324 gene locus_tag LOCUS_19600 3150 1324 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256158.1 protein_id gnl|my_center|LOCUS_19600 3332 4579 gene locus_tag LOCUS_19610 3332 4579 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229236.1 protein_id gnl|my_center|LOCUS_19610 5319 4576 gene locus_tag LOCUS_19620 5319 4576 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228649.1 protein_id gnl|my_center|LOCUS_19620 6325 5363 gene locus_tag LOCUS_19630 gene thrB 6325 5363 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228648.1 protein_id gnl|my_center|LOCUS_19630 6392 6468 gene locus_tag LOCUS_t00310 6392 6468 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6561 6935 gene locus_tag LOCUS_19640 6561 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 8096 6942 gene locus_tag LOCUS_19650 8096 6942 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228566.1 protein_id gnl|my_center|LOCUS_19650 8249 8563 gene locus_tag LOCUS_19660 8249 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 8560 10560 gene locus_tag LOCUS_19670 8560 10560 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228564.1 protein_id gnl|my_center|LOCUS_19670 10624 10920 gene locus_tag LOCUS_19680 10624 10920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 10982 11548 gene locus_tag LOCUS_19690 10982 11548 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228563.1 protein_id gnl|my_center|LOCUS_19690 11552 12529 gene locus_tag LOCUS_19700 11552 12529 CDS product V-type ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228562.1 protein_id gnl|my_center|LOCUS_19700 12546 12866 gene locus_tag LOCUS_19710 12546 12866 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887344.1 protein_id gnl|my_center|LOCUS_19710 12945 14681 gene locus_tag LOCUS_19720 12945 14681 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887345.1 protein_id gnl|my_center|LOCUS_19720 14703 16103 gene locus_tag LOCUS_19730 14703 16103 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173333.1 protein_id gnl|my_center|LOCUS_19730 16134 16799 gene locus_tag LOCUS_19740 gene atpD 16134 16799 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173332.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence065 125 211 gene locus_tag LOCUS_t00320 125 211 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 360 815 gene locus_tag LOCUS_19750 gene rimP 360 815 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172800.1 protein_id gnl|my_center|LOCUS_19750 828 2009 gene locus_tag LOCUS_19760 gene nusA 828 2009 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172799.1 protein_id gnl|my_center|LOCUS_19760 2013 2279 gene locus_tag LOCUS_19770 2013 2279 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172798.1 protein_id gnl|my_center|LOCUS_19770 2291 4006 gene locus_tag LOCUS_19780 gene infB 2291 4006 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172797.1 protein_id gnl|my_center|LOCUS_19780 4008 4319 gene locus_tag LOCUS_19790 4008 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 4428 6701 gene locus_tag LOCUS_19800 gene secD 4428 6701 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172795.1 protein_id gnl|my_center|LOCUS_19800 6800 7207 gene locus_tag LOCUS_19810 6800 7207 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564559.1 protein_id gnl|my_center|LOCUS_19810 8304 7204 gene locus_tag LOCUS_19820 8304 7204 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228437.1 protein_id gnl|my_center|LOCUS_19820 8796 8338 gene locus_tag LOCUS_19830 8796 8338 CDS product DNA base-flipping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228767.1 protein_id gnl|my_center|LOCUS_19830 9425 8796 gene locus_tag LOCUS_19840 gene fadR 9425 8796 CDS product TetR family transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227711.1 protein_id gnl|my_center|LOCUS_19840 10112 9486 gene locus_tag LOCUS_19850 10112 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 11920 10118 gene locus_tag LOCUS_19860 11920 10118 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228219.1 protein_id gnl|my_center|LOCUS_19860 12354 11926 gene locus_tag LOCUS_19870 12354 11926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 14136 12409 gene locus_tag LOCUS_19880 14136 12409 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228221.1 protein_id gnl|my_center|LOCUS_19880 14402 14148 gene locus_tag LOCUS_19890 14402 14148 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_19890 16429 14570 gene locus_tag LOCUS_19900 16429 14570 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228088.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence066 2024 1680 gene locus_tag LOCUS_tm00010 2024 1680 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2069 2479 gene locus_tag LOCUS_19910 2069 2479 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228753.1 protein_id gnl|my_center|LOCUS_19910 2665 3702 gene locus_tag LOCUS_19920 gene aroF 2665 3702 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228209.1 protein_id gnl|my_center|LOCUS_19920 3743 4825 gene locus_tag LOCUS_19930 3743 4825 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228208.1 protein_id gnl|my_center|LOCUS_19930 5319 4810 gene locus_tag LOCUS_19940 5319 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 6210 5344 gene locus_tag LOCUS_19950 6210 5344 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888971.1 protein_id gnl|my_center|LOCUS_19950 9218 6213 gene locus_tag LOCUS_19960 gene secA 9218 6213 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228548.1 protein_id gnl|my_center|LOCUS_19960 9632 9324 gene locus_tag LOCUS_19970 9632 9324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 10932 9637 gene locus_tag LOCUS_19980 10932 9637 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888244.1 protein_id gnl|my_center|LOCUS_19980 11597 10929 gene locus_tag LOCUS_19990 11597 10929 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479875.1 protein_id gnl|my_center|LOCUS_19990 12884 11889 gene locus_tag LOCUS_20000 12884 11889 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883972.1 protein_id gnl|my_center|LOCUS_20000 13813 12887 gene locus_tag LOCUS_20010 gene yfmC 13813 12887 CDS product Fe(3+)-citrate ABC transporter substrate-binding protein YfmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243996.1 protein_id gnl|my_center|LOCUS_20010 14625 13810 gene locus_tag LOCUS_20020 14625 13810 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883970.1 protein_id gnl|my_center|LOCUS_20020 <15308 14622 gene locus_tag LOCUS_20030 <15308 14622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_180970221.1:iron ABC transporter permease >Feature sequence067 112 426 gene locus_tag LOCUS_20040 gene rpsJ 112 426 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633424.1 protein_id gnl|my_center|LOCUS_20040 426 1067 gene locus_tag LOCUS_20050 gene rplC 426 1067 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173714.1 protein_id gnl|my_center|LOCUS_20050 1067 1678 gene locus_tag LOCUS_20060 gene rplD 1067 1678 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173713.1 protein_id gnl|my_center|LOCUS_20060 1675 1965 gene locus_tag LOCUS_20070 1675 1965 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633421.1 protein_id gnl|my_center|LOCUS_20070 2049 2876 gene locus_tag LOCUS_20080 gene rplB 2049 2876 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173712.1 protein_id gnl|my_center|LOCUS_20080 2888 3166 gene locus_tag LOCUS_20090 gene rpsS 2888 3166 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173711.1 protein_id gnl|my_center|LOCUS_20090 3175 3669 gene locus_tag LOCUS_20100 3175 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 3662 4420 gene locus_tag LOCUS_20110 gene rpsC 3662 4420 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633418.1 protein_id gnl|my_center|LOCUS_20110 4424 4849 gene locus_tag LOCUS_20120 gene rplP 4424 4849 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228846.1 protein_id gnl|my_center|LOCUS_20120 4827 5045 gene locus_tag LOCUS_20130 gene rpmC 4827 5045 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633416.1 protein_id gnl|my_center|LOCUS_20130 5038 5331 gene locus_tag LOCUS_20140 gene rpsQ 5038 5331 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228845.1 protein_id gnl|my_center|LOCUS_20140 5328 5696 gene locus_tag LOCUS_20150 gene rplN 5328 5696 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228844.1 protein_id gnl|my_center|LOCUS_20150 5880 6209 gene locus_tag LOCUS_20160 gene rplX 5880 6209 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173707.1 protein_id gnl|my_center|LOCUS_20160 6219 6767 gene locus_tag LOCUS_20170 gene rplE 6219 6767 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228843.1 protein_id gnl|my_center|LOCUS_20170 6783 7052 gene locus_tag LOCUS_20180 gene rpsN 6783 7052 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479943.1 protein_id gnl|my_center|LOCUS_20180 7204 7599 gene locus_tag LOCUS_20190 gene rpsH 7204 7599 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173705.1 protein_id gnl|my_center|LOCUS_20190 7607 8152 gene locus_tag LOCUS_20200 gene rplF 7607 8152 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173704.1 protein_id gnl|my_center|LOCUS_20200 8165 8503 gene locus_tag LOCUS_20210 gene rplR 8165 8503 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633391.1 protein_id gnl|my_center|LOCUS_20210 8525 9013 gene locus_tag LOCUS_20220 gene rpsE 8525 9013 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633389.1 protein_id gnl|my_center|LOCUS_20220 9010 9186 gene locus_tag LOCUS_20230 gene rpmD 9010 9186 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633387.1 protein_id gnl|my_center|LOCUS_20230 9183 9644 gene locus_tag LOCUS_20240 gene rplO 9183 9644 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173703.1 protein_id gnl|my_center|LOCUS_20240 9646 10968 gene locus_tag LOCUS_20250 gene secY 9646 10968 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228842.1 protein_id gnl|my_center|LOCUS_20250 10982 11554 gene locus_tag LOCUS_20260 10982 11554 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173701.1 protein_id gnl|my_center|LOCUS_20260 11561 12352 gene locus_tag LOCUS_20270 gene map 11561 12352 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173700.1 protein_id gnl|my_center|LOCUS_20270 12368 12586 gene locus_tag LOCUS_20280 gene infA 12368 12586 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633373.1 protein_id gnl|my_center|LOCUS_20280 12724 13104 gene locus_tag LOCUS_20290 gene rpsM 12724 13104 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633368.1 protein_id gnl|my_center|LOCUS_20290 13202 13600 gene locus_tag LOCUS_20300 gene rpsK 13202 13600 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633365.1 protein_id gnl|my_center|LOCUS_20300 13691 14308 gene locus_tag LOCUS_20310 gene rpsD 13691 14308 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888758.1 protein_id gnl|my_center|LOCUS_20310 >Feature sequence068 110 940 gene locus_tag LOCUS_20320 110 940 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229087.1 protein_id gnl|my_center|LOCUS_20320 937 1734 gene locus_tag LOCUS_20330 937 1734 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229088.1 protein_id gnl|my_center|LOCUS_20330 1746 2321 gene locus_tag LOCUS_20340 1746 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2318 2656 gene locus_tag LOCUS_20350 2318 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2682 3707 gene locus_tag LOCUS_20360 2682 3707 CDS product EfeM/EfeO family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256531.1 protein_id gnl|my_center|LOCUS_20360 3704 5926 gene locus_tag LOCUS_20370 3704 5926 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256532.1 protein_id gnl|my_center|LOCUS_20370 5990 6907 gene locus_tag LOCUS_20380 5990 6907 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883974.1 protein_id gnl|my_center|LOCUS_20380 6936 7829 gene locus_tag LOCUS_20390 6936 7829 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015613.1 protein_id gnl|my_center|LOCUS_20390 7838 8716 gene locus_tag LOCUS_20400 7838 8716 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256533.1 protein_id gnl|my_center|LOCUS_20400 8727 9617 gene locus_tag LOCUS_20410 8727 9617 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229086.1 protein_id gnl|my_center|LOCUS_20410 9690 10442 gene locus_tag LOCUS_20420 9690 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 10455 11384 gene locus_tag LOCUS_20430 10455 11384 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821935.1 protein_id gnl|my_center|LOCUS_20430 11388 12326 gene locus_tag LOCUS_20440 11388 12326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 12340 12816 gene locus_tag LOCUS_20450 12340 12816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 12835 14535 gene locus_tag LOCUS_20460 12835 14535 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040204.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence069 124 333 gene locus_tag LOCUS_20470 124 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632685.1 protein_id gnl|my_center|LOCUS_20470 545 3283 gene locus_tag LOCUS_20480 gene acnA 545 3283 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 protein_id gnl|my_center|LOCUS_20480 3361 3933 gene locus_tag LOCUS_20490 3361 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174019.1 protein_id gnl|my_center|LOCUS_20490 3946 4743 gene locus_tag LOCUS_20500 gene hisJ 3946 4743 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227864.1 protein_id gnl|my_center|LOCUS_20500 4740 6350 gene locus_tag LOCUS_20510 4740 6350 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887112.1 protein_id gnl|my_center|LOCUS_20510 6781 6347 gene locus_tag LOCUS_20520 6781 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 7426 6809 gene locus_tag LOCUS_20530 7426 6809 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227863.1 protein_id gnl|my_center|LOCUS_20530 7884 7411 gene locus_tag LOCUS_20540 gene moaC 7884 7411 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228918.1 protein_id gnl|my_center|LOCUS_20540 8683 7910 gene locus_tag LOCUS_20550 8683 7910 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228988.1 protein_id gnl|my_center|LOCUS_20550 9582 8713 gene locus_tag LOCUS_20560 9582 8713 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228987.1 protein_id gnl|my_center|LOCUS_20560 9850 10866 gene locus_tag LOCUS_20570 9850 10866 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631628.1 protein_id gnl|my_center|LOCUS_20570 10863 11903 gene locus_tag LOCUS_20580 10863 11903 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227909.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence070 175 339 gene locus_tag LOCUS_20590 gene rpmG 175 339 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630505.1 protein_id gnl|my_center|LOCUS_20590 350 565 gene locus_tag LOCUS_20600 350 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 578 1135 gene locus_tag LOCUS_20610 gene nusG 578 1135 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630512.1 protein_id gnl|my_center|LOCUS_20610 1236 1670 gene locus_tag LOCUS_20620 gene rplK 1236 1670 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174097.1 protein_id gnl|my_center|LOCUS_20620 1663 2364 gene locus_tag LOCUS_20630 gene rplA 1663 2364 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227804.1 protein_id gnl|my_center|LOCUS_20630 2413 3348 gene locus_tag LOCUS_20640 2413 3348 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228395.1 protein_id gnl|my_center|LOCUS_20640 3832 3353 gene locus_tag LOCUS_20650 gene greA 3832 3353 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172708.1 protein_id gnl|my_center|LOCUS_20650 4773 3886 gene locus_tag LOCUS_20660 gene ribF 4773 3886 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228004.1 protein_id gnl|my_center|LOCUS_20660 5273 4776 gene locus_tag LOCUS_20670 gene ndx4 5273 4776 CDS product ADP-ribose pyrophosphatase Ndx4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172615.1 protein_id gnl|my_center|LOCUS_20670 5190 7994 gene locus_tag LOCUS_20680 5190 7994 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172711.1 protein_id gnl|my_center|LOCUS_20680 9168 7999 gene locus_tag LOCUS_20690 9168 7999 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703346.1 protein_id gnl|my_center|LOCUS_20690 9203 10162 gene locus_tag LOCUS_20700 9203 10162 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228450.1 protein_id gnl|my_center|LOCUS_20700 10186 10887 gene locus_tag LOCUS_20710 10186 10887 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228451.1 protein_id gnl|my_center|LOCUS_20710 11106 11894 gene locus_tag LOCUS_20720 11106 11894 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227998.1 protein_id gnl|my_center|LOCUS_20720 12243 12812 gene locus_tag LOCUS_20730 12243 12812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 12890 13102 gene locus_tag LOCUS_20740 12890 13102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228382.1 protein_id gnl|my_center|LOCUS_20740 13115 13582 gene locus_tag LOCUS_20750 13115 13582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence071 1432 236 gene locus_tag LOCUS_20760 gene murA 1432 236 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227732.1 protein_id gnl|my_center|LOCUS_20760 1682 1900 gene locus_tag LOCUS_20770 1682 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888507.1 protein_id gnl|my_center|LOCUS_20770 1954 2589 gene locus_tag LOCUS_20780 1954 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 4940 2586 gene locus_tag LOCUS_20790 gene rnr 4940 2586 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228288.1 protein_id gnl|my_center|LOCUS_20790 6184 4949 gene locus_tag LOCUS_20800 6184 4949 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228287.1 protein_id gnl|my_center|LOCUS_20800 6244 7254 gene locus_tag LOCUS_20810 6244 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 8159 7218 gene locus_tag LOCUS_20820 8159 7218 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173675.1 protein_id gnl|my_center|LOCUS_20820 8300 9301 gene locus_tag LOCUS_20830 8300 9301 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228500.1 protein_id gnl|my_center|LOCUS_20830 9277 9876 gene locus_tag LOCUS_20840 9277 9876 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228501.1 protein_id gnl|my_center|LOCUS_20840 9940 10731 gene locus_tag LOCUS_20850 gene mreC 9940 10731 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228502.1 protein_id gnl|my_center|LOCUS_20850 10733 11203 gene locus_tag LOCUS_20860 gene mreD 10733 11203 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228503.1 protein_id gnl|my_center|LOCUS_20860 11213 12970 gene locus_tag LOCUS_20870 11213 12970 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173259.1 protein_id gnl|my_center|LOCUS_20870 <13620 12924 gene locus_tag LOCUS_20880 <13620 12924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229201.1:FAD-dependent oxidoreductase >Feature sequence072 199 285 gene locus_tag LOCUS_t00330 199 285 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 338 1513 gene locus_tag LOCUS_20890 338 1513 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887075.1 protein_id gnl|my_center|LOCUS_20890 2205 1501 gene locus_tag LOCUS_20900 2205 1501 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173858.1 protein_id gnl|my_center|LOCUS_20900 3386 2205 gene locus_tag LOCUS_20910 3386 2205 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228946.1 protein_id gnl|my_center|LOCUS_20910 3590 3399 gene locus_tag LOCUS_20920 3590 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 4015 3587 gene locus_tag LOCUS_20930 4015 3587 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_20930 4105 6753 gene locus_tag LOCUS_20940 gene alaS 4105 6753 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228945.1 protein_id gnl|my_center|LOCUS_20940 6799 7200 gene locus_tag LOCUS_20950 gene ruvX 6799 7200 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173853.1 protein_id gnl|my_center|LOCUS_20950 7291 8259 gene locus_tag LOCUS_20960 gene mltG 7291 8259 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119531.1 protein_id gnl|my_center|LOCUS_20960 8545 8252 gene locus_tag LOCUS_20970 8545 8252 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631991.1 protein_id gnl|my_center|LOCUS_20970 9021 8560 gene locus_tag LOCUS_20980 9021 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173321.1 protein_id gnl|my_center|LOCUS_20980 11277 9043 gene locus_tag LOCUS_20990 11277 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 12730 11309 gene locus_tag LOCUS_21000 12730 11309 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227706.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence073 2406 382 gene locus_tag LOCUS_21010 2406 382 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228793.1 protein_id gnl|my_center|LOCUS_21010 3161 2403 gene locus_tag LOCUS_21020 3161 2403 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926063.1 protein_id gnl|my_center|LOCUS_21020 3184 4971 gene locus_tag LOCUS_21030 3184 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228795.1 protein_id gnl|my_center|LOCUS_21030 5011 6225 gene locus_tag LOCUS_21040 5011 6225 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228796.1 protein_id gnl|my_center|LOCUS_21040 6266 6580 gene locus_tag LOCUS_21050 6266 6580 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633232.1 protein_id gnl|my_center|LOCUS_21050 6596 7180 gene locus_tag LOCUS_21060 gene recR 6596 7180 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228798.1 protein_id gnl|my_center|LOCUS_21060 7284 7610 gene locus_tag LOCUS_21070 7284 7610 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173642.1 protein_id gnl|my_center|LOCUS_21070 7619 7972 gene locus_tag LOCUS_21080 7619 7972 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228800.1 protein_id gnl|my_center|LOCUS_21080 7969 8259 gene locus_tag LOCUS_21090 7969 8259 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173644.1 protein_id gnl|my_center|LOCUS_21090 8773 8261 gene locus_tag LOCUS_21100 8773 8261 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256302.1 protein_id gnl|my_center|LOCUS_21100 8842 9816 gene locus_tag LOCUS_21110 gene moaA 8842 9816 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119789.1 protein_id gnl|my_center|LOCUS_21110 9877 11454 gene locus_tag LOCUS_21120 9877 11454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 12212 11451 gene locus_tag LOCUS_21130 gene argB 12212 11451 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229040.1 protein_id gnl|my_center|LOCUS_21130 12258 12332 gene locus_tag LOCUS_t00340 12258 12332 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence074 <1 863 gene locus_tag LOCUS_21140 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229192.1:deoxyribodipyrimidine photo-lyase 2193 904 gene locus_tag LOCUS_21150 2193 904 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029732907.1 protein_id gnl|my_center|LOCUS_21150 2312 2626 gene locus_tag LOCUS_21160 2312 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2639 3115 gene locus_tag LOCUS_21170 2639 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 3256 3750 gene locus_tag LOCUS_21180 3256 3750 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120910.1 protein_id gnl|my_center|LOCUS_21180 3853 4509 gene locus_tag LOCUS_21190 3853 4509 CDS product DUF4397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229204.1 protein_id gnl|my_center|LOCUS_21190 4604 5995 gene locus_tag LOCUS_21200 4604 5995 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926110.1 protein_id gnl|my_center|LOCUS_21200 6514 5936 gene locus_tag LOCUS_21210 6514 5936 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888427.1 protein_id gnl|my_center|LOCUS_21210 7082 6543 gene locus_tag LOCUS_21220 7082 6543 CDS product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888428.1 protein_id gnl|my_center|LOCUS_21220 7999 7100 gene locus_tag LOCUS_21230 7999 7100 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002242382.1 protein_id gnl|my_center|LOCUS_21230 8772 8068 gene locus_tag LOCUS_21240 8772 8068 CDS product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528224.1 protein_id gnl|my_center|LOCUS_21240 9048 8800 gene locus_tag LOCUS_21250 9048 8800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 9564 9106 gene locus_tag LOCUS_21260 9564 9106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 9699 10361 gene locus_tag LOCUS_21270 9699 10361 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118816.1 protein_id gnl|my_center|LOCUS_21270 10358 11680 gene locus_tag LOCUS_21280 10358 11680 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228367.1 protein_id gnl|my_center|LOCUS_21280 <12621 11658 gene locus_tag LOCUS_21290 <12621 11658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259685.1:ATP-binding protein >Feature sequence075 2866 1586 gene locus_tag LOCUS_21300 2866 1586 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228985.1 protein_id gnl|my_center|LOCUS_21300 2904 3629 gene locus_tag LOCUS_21310 2904 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 4730 3615 gene locus_tag LOCUS_21320 4730 3615 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227755.1 protein_id gnl|my_center|LOCUS_21320 4990 6057 gene locus_tag LOCUS_21330 4990 6057 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227756.1 protein_id gnl|my_center|LOCUS_21330 7049 6054 gene locus_tag LOCUS_21340 gene csaB 7049 6054 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228036.1 protein_id gnl|my_center|LOCUS_21340 8835 7102 gene locus_tag LOCUS_21350 8835 7102 CDS product DUF5693 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228037.1 protein_id gnl|my_center|LOCUS_21350 9491 8847 gene locus_tag LOCUS_21360 gene udk 9491 8847 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172663.1 protein_id gnl|my_center|LOCUS_21360 9546 10487 gene locus_tag LOCUS_21370 9546 10487 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228357.1 protein_id gnl|my_center|LOCUS_21370 11642 10497 gene locus_tag LOCUS_21380 gene ugpC 11642 10497 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228038.1 protein_id gnl|my_center|LOCUS_21380 12067 11861 gene locus_tag LOCUS_21390 12067 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 12317 12057 gene locus_tag LOCUS_21400 12317 12057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21400 >Feature sequence076 706 248 gene locus_tag LOCUS_21410 706 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 811 3138 gene locus_tag LOCUS_21420 811 3138 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926025.1 protein_id gnl|my_center|LOCUS_21420 3216 4187 gene locus_tag LOCUS_21430 gene paaA 3216 4187 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228339.1 protein_id gnl|my_center|LOCUS_21430 4197 4778 gene locus_tag LOCUS_21440 4197 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 4744 5502 gene locus_tag LOCUS_21450 gene paaC 4744 5502 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228337.1 protein_id gnl|my_center|LOCUS_21450 5504 5998 gene locus_tag LOCUS_21460 gene paaJ 5504 5998 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618854.1 protein_id gnl|my_center|LOCUS_21460 6060 6644 gene locus_tag LOCUS_21470 6060 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 6827 6687 gene locus_tag LOCUS_21480 6827 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21480 8959 8087 gene locus_tag LOCUS_21490 8959 8087 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173325.1 protein_id gnl|my_center|LOCUS_21490 10698 9037 gene locus_tag LOCUS_21500 10698 9037 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228601.1 protein_id gnl|my_center|LOCUS_21500 <11487 10767 gene locus_tag LOCUS_21510 <11487 10767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000382099.1:amidohydrolase >Feature sequence077 787 164 gene locus_tag LOCUS_21520 gene pilO 787 164 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173434.1 protein_id gnl|my_center|LOCUS_21520 1430 768 gene locus_tag LOCUS_21530 1430 768 CDS product competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228637.1 protein_id gnl|my_center|LOCUS_21530 2559 1423 gene locus_tag LOCUS_21540 gene pilM 2559 1423 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228636.1 protein_id gnl|my_center|LOCUS_21540 3717 2713 gene locus_tag LOCUS_21550 3717 2713 CDS product homoisocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173431.1 protein_id gnl|my_center|LOCUS_21550 3773 4510 gene locus_tag LOCUS_21560 3773 4510 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172915.1 protein_id gnl|my_center|LOCUS_21560 4568 5110 gene locus_tag LOCUS_21570 4568 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 6117 5107 gene locus_tag LOCUS_21580 gene queA 6117 5107 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173135.1 protein_id gnl|my_center|LOCUS_21580 6431 6114 gene locus_tag LOCUS_21590 6431 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21590 6685 6338 gene locus_tag LOCUS_21600 6685 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21600 7469 6777 gene locus_tag LOCUS_21610 7469 6777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227869.1 protein_id gnl|my_center|LOCUS_21610 7619 9046 gene locus_tag LOCUS_21620 7619 9046 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227868.1 protein_id gnl|my_center|LOCUS_21620 9062 9835 gene locus_tag LOCUS_21630 9062 9835 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227867.1 protein_id gnl|my_center|LOCUS_21630 9920 10714 gene locus_tag LOCUS_21640 9920 10714 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227787.1 protein_id gnl|my_center|LOCUS_21640 <11328 10711 gene locus_tag LOCUS_21650 <11328 10711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257674.1:S41 family peptidase >Feature sequence078 941 1486 gene locus_tag LOCUS_21660 gene dcd 941 1486 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174218.1 protein_id gnl|my_center|LOCUS_21660 1686 1519 gene locus_tag LOCUS_21670 1686 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 1685 2233 gene locus_tag LOCUS_21680 1685 2233 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177743.1 protein_id gnl|my_center|LOCUS_21680 2245 3357 gene locus_tag LOCUS_21690 2245 3357 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174219.1 protein_id gnl|my_center|LOCUS_21690 3395 4051 gene locus_tag LOCUS_21700 3395 4051 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532264.1 protein_id gnl|my_center|LOCUS_21700 4117 5082 gene locus_tag LOCUS_21710 4117 5082 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085519.1 protein_id gnl|my_center|LOCUS_21710 5155 5586 gene locus_tag LOCUS_21720 5155 5586 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365604.1 protein_id gnl|my_center|LOCUS_21720 5590 7095 gene locus_tag LOCUS_21730 5590 7095 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114173.1 protein_id gnl|my_center|LOCUS_21730 8703 7108 gene locus_tag LOCUS_21740 8703 7108 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229182.1 protein_id gnl|my_center|LOCUS_21740 8736 9755 gene locus_tag LOCUS_21750 8736 9755 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618830.1 protein_id gnl|my_center|LOCUS_21750 9960 9760 gene locus_tag LOCUS_21760 9960 9760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 10675 9995 gene locus_tag LOCUS_21770 10675 9995 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229158.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence079 975 298 gene locus_tag LOCUS_21780 975 298 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086341.1 protein_id gnl|my_center|LOCUS_21780 1482 1066 gene locus_tag LOCUS_21790 1482 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 1878 1672 gene locus_tag LOCUS_21800 1878 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 1781 2923 gene locus_tag LOCUS_21810 1781 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 2968 4620 gene locus_tag LOCUS_21820 2968 4620 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228733.1 protein_id gnl|my_center|LOCUS_21820 4668 5891 gene locus_tag LOCUS_21830 4668 5891 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228877.1 protein_id gnl|my_center|LOCUS_21830 8260 5897 gene locus_tag LOCUS_21840 8260 5897 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336882.1 protein_id gnl|my_center|LOCUS_21840 9413 8412 gene locus_tag LOCUS_21850 9413 8412 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727331.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence080 502 131 gene locus_tag LOCUS_21860 502 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 623 1561 gene locus_tag LOCUS_21870 gene trxB 623 1561 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_21870 1568 2635 gene locus_tag LOCUS_21880 gene tdt 1568 2635 CDS product tellurite-resistance/dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250965.1 protein_id gnl|my_center|LOCUS_21880 2769 3314 gene locus_tag LOCUS_21890 2769 3314 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227767.1 protein_id gnl|my_center|LOCUS_21890 3311 4810 gene locus_tag LOCUS_21900 3311 4810 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227768.1 protein_id gnl|my_center|LOCUS_21900 5934 4855 gene locus_tag LOCUS_21910 5934 4855 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_21910 6084 6860 gene locus_tag LOCUS_21920 6084 6860 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172903.1 protein_id gnl|my_center|LOCUS_21920 6870 8030 gene locus_tag LOCUS_21930 6870 8030 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227871.1 protein_id gnl|my_center|LOCUS_21930 8113 8481 gene locus_tag LOCUS_21940 8113 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 8483 9613 gene locus_tag LOCUS_21950 8483 9613 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112824.1 protein_id gnl|my_center|LOCUS_21950 9610 10578 gene locus_tag LOCUS_21960 9610 10578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 10735 10583 gene locus_tag LOCUS_21970 10735 10583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence081 117 1652 gene locus_tag LOCUS_21980 117 1652 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090058733.1 protein_id gnl|my_center|LOCUS_21980 1759 2796 gene locus_tag LOCUS_21990 gene xylF 1759 2796 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329224.1 protein_id gnl|my_center|LOCUS_21990 2906 4126 gene locus_tag LOCUS_22000 2906 4126 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315596.1 protein_id gnl|my_center|LOCUS_22000 4130 4900 gene locus_tag LOCUS_22010 4130 4900 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529276.1 protein_id gnl|my_center|LOCUS_22010 4914 5960 gene locus_tag LOCUS_22020 4914 5960 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225828.1 protein_id gnl|my_center|LOCUS_22020 6004 7977 gene locus_tag LOCUS_22030 6004 7977 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228719.1 protein_id gnl|my_center|LOCUS_22030 8014 9429 gene locus_tag LOCUS_22040 8014 9429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence082 382 1494 gene locus_tag LOCUS_22050 382 1494 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227848.1 protein_id gnl|my_center|LOCUS_22050 1498 2634 gene locus_tag LOCUS_22060 1498 2634 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227848.1 protein_id gnl|my_center|LOCUS_22060 3452 2637 gene locus_tag LOCUS_22070 3452 2637 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228211.1 protein_id gnl|my_center|LOCUS_22070 4633 3449 gene locus_tag LOCUS_22080 gene mqnE 4633 3449 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887011.1 protein_id gnl|my_center|LOCUS_22080 6570 4720 gene locus_tag LOCUS_22090 6570 4720 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227888.1 protein_id gnl|my_center|LOCUS_22090 6776 7204 gene locus_tag LOCUS_22100 6776 7204 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227729.1 protein_id gnl|my_center|LOCUS_22100 7988 7191 gene locus_tag LOCUS_22110 7988 7191 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889616.1 protein_id gnl|my_center|LOCUS_22110 8808 8083 gene locus_tag LOCUS_22120 8808 8083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 <10452 8825 gene locus_tag LOCUS_22130 <10452 8825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025567610.1:hybrid sensor histidine kinase/response regulator >Feature sequence083 463 1467 gene locus_tag LOCUS_22140 463 1467 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877605.1 protein_id gnl|my_center|LOCUS_22140 1486 2547 gene locus_tag LOCUS_22150 1486 2547 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030815.1 protein_id gnl|my_center|LOCUS_22150 2544 3671 gene locus_tag LOCUS_22160 2544 3671 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089165.1 protein_id gnl|my_center|LOCUS_22160 3668 4702 gene locus_tag LOCUS_22170 3668 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 4686 5456 gene locus_tag LOCUS_22180 4686 5456 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921388.1 protein_id gnl|my_center|LOCUS_22180 5458 6384 gene locus_tag LOCUS_22190 5458 6384 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926514.1 protein_id gnl|my_center|LOCUS_22190 6882 6400 gene locus_tag LOCUS_22200 6882 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 8069 6879 gene locus_tag LOCUS_22210 8069 6879 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583530.1 protein_id gnl|my_center|LOCUS_22210 9716 8073 gene locus_tag LOCUS_22220 9716 8073 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_22220 10254 9694 gene locus_tag LOCUS_22230 10254 9694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 >Feature sequence084 458 1108 gene locus_tag LOCUS_22240 458 1108 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859012.1 protein_id gnl|my_center|LOCUS_22240 1108 1911 gene locus_tag LOCUS_22250 1108 1911 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085067.1 protein_id gnl|my_center|LOCUS_22250 2738 2034 gene locus_tag LOCUS_22260 2738 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 3538 2807 gene locus_tag LOCUS_22270 3538 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 3802 3590 gene locus_tag LOCUS_22280 3802 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 3693 4817 gene locus_tag LOCUS_22290 3693 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 4821 5675 gene locus_tag LOCUS_22300 4821 5675 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243765.1 protein_id gnl|my_center|LOCUS_22300 5662 7344 gene locus_tag LOCUS_22310 5662 7344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 7341 8039 gene locus_tag LOCUS_22320 7341 8039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228129.1 protein_id gnl|my_center|LOCUS_22320 8036 8458 gene locus_tag LOCUS_22330 8036 8458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 8467 9261 gene locus_tag LOCUS_22340 8467 9261 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_22340 >Feature sequence085 3 131 gene locus_tag LOCUS_22350 3 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 205 1542 gene locus_tag LOCUS_22360 205 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 2136 1516 gene locus_tag LOCUS_22370 2136 1516 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228763.1 protein_id gnl|my_center|LOCUS_22370 2611 2147 gene locus_tag LOCUS_22380 gene argR 2611 2147 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633181.1 protein_id gnl|my_center|LOCUS_22380 3015 2707 gene locus_tag LOCUS_22390 gene rpoZ 3015 2707 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633185.1 protein_id gnl|my_center|LOCUS_22390 4113 3067 gene locus_tag LOCUS_22400 4113 3067 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227743.1 protein_id gnl|my_center|LOCUS_22400 4313 5461 gene locus_tag LOCUS_22410 4313 5461 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173212.1 protein_id gnl|my_center|LOCUS_22410 5477 6223 gene locus_tag LOCUS_22420 5477 6223 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228467.1 protein_id gnl|my_center|LOCUS_22420 6249 7187 gene locus_tag LOCUS_22430 6249 7187 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443441.1 protein_id gnl|my_center|LOCUS_22430 8518 7229 gene locus_tag LOCUS_22440 8518 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 8894 8529 gene locus_tag LOCUS_22450 8894 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 9412 8906 gene locus_tag LOCUS_22460 9412 8906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 >Feature sequence086 975 190 gene locus_tag LOCUS_22470 975 190 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143432.1 protein_id gnl|my_center|LOCUS_22470 1041 2165 gene locus_tag LOCUS_22480 1041 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2640 2128 gene locus_tag LOCUS_22490 gene nrdR 2640 2128 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174215.1 protein_id gnl|my_center|LOCUS_22490 3366 2647 gene locus_tag LOCUS_22500 3366 2647 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174216.1 protein_id gnl|my_center|LOCUS_22500 6093 3421 gene locus_tag LOCUS_22510 6093 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 6198 6974 gene locus_tag LOCUS_22520 6198 6974 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227694.1 protein_id gnl|my_center|LOCUS_22520 9458 6981 gene locus_tag LOCUS_22530 gene hrpB 9458 6981 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887065.1 protein_id gnl|my_center|LOCUS_22530 9503 9706 gene locus_tag LOCUS_22540 9503 9706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 9853 9778 gene locus_tag LOCUS_t00350 9853 9778 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 9935 9859 gene locus_tag LOCUS_t00360 9935 9859 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence087 1002 31 gene locus_tag LOCUS_22550 gene hemH 1002 31 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228058.1 protein_id gnl|my_center|LOCUS_22550 1797 1015 gene locus_tag LOCUS_22560 1797 1015 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 protein_id gnl|my_center|LOCUS_22560 2852 1794 gene locus_tag LOCUS_22570 gene hemE 2852 1794 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944063.1 protein_id gnl|my_center|LOCUS_22570 3553 2849 gene locus_tag LOCUS_22580 3553 2849 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_22580 4728 3550 gene locus_tag LOCUS_22590 4728 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 5775 4738 gene locus_tag LOCUS_22600 gene hemB 5775 4738 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761803.1 protein_id gnl|my_center|LOCUS_22600 6443 5763 gene locus_tag LOCUS_22610 6443 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 7330 6428 gene locus_tag LOCUS_22620 gene hemC 7330 6428 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258453.1 protein_id gnl|my_center|LOCUS_22620 8492 7323 gene locus_tag LOCUS_22630 8492 7323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 8748 8673 gene locus_tag LOCUS_t00370 8748 8673 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8831 9769 gene locus_tag LOCUS_22640 gene xerD 8831 9769 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792251.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence088 2503 50 gene locus_tag LOCUS_22650 gene ctaD 2503 50 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227851.1 protein_id gnl|my_center|LOCUS_22650 3587 2520 gene locus_tag LOCUS_22660 gene coxB 3587 2520 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227850.1 protein_id gnl|my_center|LOCUS_22660 4571 3687 gene locus_tag LOCUS_22670 4571 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22670 5534 4578 gene locus_tag LOCUS_22680 5534 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22680 5669 6865 gene locus_tag LOCUS_22690 5669 6865 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228180.1 protein_id gnl|my_center|LOCUS_22690 7439 7149 gene locus_tag LOCUS_22700 7439 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 9095 7596 gene locus_tag LOCUS_22710 9095 7596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 >Feature sequence089 881 1063 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcactcgggcttcggcccgagtgaggattgaaac 1939 1256 gene locus_tag LOCUS_22720 1939 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 2485 1949 gene locus_tag LOCUS_22730 2485 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 4907 2502 gene locus_tag LOCUS_22740 4907 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 5092 4922 gene locus_tag LOCUS_22750 5092 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 8941 5435 gene locus_tag LOCUS_22760 8941 5435 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258122.1 protein_id gnl|my_center|LOCUS_22760 >Feature sequence090 420 1061 gene locus_tag LOCUS_22770 420 1061 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173693.1 protein_id gnl|my_center|LOCUS_22770 1058 1456 gene locus_tag LOCUS_22780 1058 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 1515 2474 gene locus_tag LOCUS_22790 1515 2474 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228837.1 protein_id gnl|my_center|LOCUS_22790 3042 2479 gene locus_tag LOCUS_22800 3042 2479 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228778.1 protein_id gnl|my_center|LOCUS_22800 4350 3073 gene locus_tag LOCUS_22810 4350 3073 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228779.1 protein_id gnl|my_center|LOCUS_22810 5635 4361 gene locus_tag LOCUS_22820 5635 4361 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228780.1 protein_id gnl|my_center|LOCUS_22820 5722 6096 gene locus_tag LOCUS_22830 5722 6096 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173828.1 protein_id gnl|my_center|LOCUS_22830 7193 6093 gene locus_tag LOCUS_22840 7193 6093 CDS product beta-carotene 2-hydroxylase CYP287A1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889098.1 protein_id gnl|my_center|LOCUS_22840 8532 7180 gene locus_tag LOCUS_22850 8532 7180 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871916.1 protein_id gnl|my_center|LOCUS_22850 >Feature sequence091 962 465 gene locus_tag LOCUS_22860 gene dps 962 465 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258826.1 protein_id gnl|my_center|LOCUS_22860 1585 1019 gene locus_tag LOCUS_22870 1585 1019 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228727.1 protein_id gnl|my_center|LOCUS_22870 2144 1626 gene locus_tag LOCUS_22880 2144 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 2213 3910 gene locus_tag LOCUS_22890 2213 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 4959 3913 gene locus_tag LOCUS_22900 4959 3913 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479997.1 protein_id gnl|my_center|LOCUS_22900 6281 4956 gene locus_tag LOCUS_22910 6281 4956 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065240.1 protein_id gnl|my_center|LOCUS_22910 6400 7785 gene locus_tag LOCUS_22920 6400 7785 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480136.1 protein_id gnl|my_center|LOCUS_22920 >Feature sequence092 21 776 gene locus_tag LOCUS_22930 21 776 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228054.1 protein_id gnl|my_center|LOCUS_22930 826 1971 gene locus_tag LOCUS_22940 gene aztD 826 1971 CDS product metallochaperone AztD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383481.1 protein_id gnl|my_center|LOCUS_22940 2019 3131 gene locus_tag LOCUS_22950 2019 3131 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124033.1 protein_id gnl|my_center|LOCUS_22950 4440 3142 gene locus_tag LOCUS_22960 4440 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 5501 4437 gene locus_tag LOCUS_22970 gene zinU 5501 4437 CDS product zinc metallochaperone ZinU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234625.1 protein_id gnl|my_center|LOCUS_22970 5813 6184 gene locus_tag LOCUS_22980 5813 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 6290 7726 gene locus_tag LOCUS_22990 6290 7726 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109023.1 protein_id gnl|my_center|LOCUS_22990 7748 8053 gene locus_tag LOCUS_23000 7748 8053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 >Feature sequence093 207 476 gene locus_tag LOCUS_23010 gene rpsO 207 476 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632621.1 protein_id gnl|my_center|LOCUS_23010 691 2829 gene locus_tag LOCUS_23020 gene pnp 691 2829 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228463.1 protein_id gnl|my_center|LOCUS_23020 2904 4634 gene locus_tag LOCUS_23030 2904 4634 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173208.1 protein_id gnl|my_center|LOCUS_23030 5430 4642 gene locus_tag LOCUS_23040 gene aroE 5430 4642 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228401.1 protein_id gnl|my_center|LOCUS_23040 5547 6821 gene locus_tag LOCUS_23050 5547 6821 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926053.1 protein_id gnl|my_center|LOCUS_23050 6865 7866 gene locus_tag LOCUS_23060 gene floA 6865 7866 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence094 662 222 gene locus_tag LOCUS_23070 662 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 1185 1829 gene locus_tag LOCUS_23080 gene gmk 1185 1829 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633187.1 protein_id gnl|my_center|LOCUS_23080 2309 1836 gene locus_tag LOCUS_23090 2309 1836 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174165.1 protein_id gnl|my_center|LOCUS_23090 2662 2435 gene locus_tag LOCUS_23100 2662 2435 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227757.1 protein_id gnl|my_center|LOCUS_23100 3145 2909 gene locus_tag LOCUS_23110 gene acpP 3145 2909 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479819.1 protein_id gnl|my_center|LOCUS_23110 3929 3192 gene locus_tag LOCUS_23120 gene fabG 3929 3192 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172504.1 protein_id gnl|my_center|LOCUS_23120 4815 3946 gene locus_tag LOCUS_23130 gene fabD 4815 3946 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172505.1 protein_id gnl|my_center|LOCUS_23130 5905 4928 gene locus_tag LOCUS_23140 5905 4928 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172506.1 protein_id gnl|my_center|LOCUS_23140 6258 6067 gene locus_tag LOCUS_23150 gene rpmF 6258 6067 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631660.1 protein_id gnl|my_center|LOCUS_23150 6390 7493 gene locus_tag LOCUS_23160 6390 7493 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_23160 >Feature sequence095 <1 713 gene locus_tag LOCUS_23170 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976970.1:putative cobaltochelatase 710 2041 gene locus_tag LOCUS_23180 710 2041 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229236.1 protein_id gnl|my_center|LOCUS_23180 2046 3428 gene locus_tag LOCUS_23190 2046 3428 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012695322.1 protein_id gnl|my_center|LOCUS_23190 3474 4283 gene locus_tag LOCUS_23200 3474 4283 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228771.1 protein_id gnl|my_center|LOCUS_23200 4355 4996 gene locus_tag LOCUS_23210 4355 4996 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228770.1 protein_id gnl|my_center|LOCUS_23210 5052 6548 gene locus_tag LOCUS_23220 gene bshC 5052 6548 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228769.1 protein_id gnl|my_center|LOCUS_23220 6549 7034 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcaatcccctttcggggctttggttttgcgac >Feature sequence096 447 2033 gene locus_tag LOCUS_23230 447 2033 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229159.1 protein_id gnl|my_center|LOCUS_23230 2096 3154 gene locus_tag LOCUS_23240 gene recF 2096 3154 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227816.1 protein_id gnl|my_center|LOCUS_23240 3145 3489 gene locus_tag LOCUS_23250 3145 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 3615 3521 gene locus_tag LOCUS_t00380 3615 3521 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3788 3699 gene locus_tag LOCUS_t00390 3788 3699 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3876 4709 gene locus_tag LOCUS_23260 3876 4709 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889156.1 protein_id gnl|my_center|LOCUS_23260 4753 5610 gene locus_tag LOCUS_23270 gene ubiA 4753 5610 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228063.1 protein_id gnl|my_center|LOCUS_23270 6868 6617 gene locus_tag LOCUS_23280 6868 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 7293 6877 gene locus_tag LOCUS_23290 7293 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence097 346 696 gene locus_tag LOCUS_23300 346 696 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119555.1 protein_id gnl|my_center|LOCUS_23300 696 2732 gene locus_tag LOCUS_23310 696 2732 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229052.1 protein_id gnl|my_center|LOCUS_23310 3544 2729 gene locus_tag LOCUS_23320 3544 2729 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229053.1 protein_id gnl|my_center|LOCUS_23320 4277 3528 gene locus_tag LOCUS_23330 4277 3528 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229054.1 protein_id gnl|my_center|LOCUS_23330 5004 4285 gene locus_tag LOCUS_23340 gene rsmG 5004 4285 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229055.1 protein_id gnl|my_center|LOCUS_23340 6839 5037 gene locus_tag LOCUS_23350 gene mnmG 6839 5037 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229056.1 protein_id gnl|my_center|LOCUS_23350 >Feature sequence098 42 929 gene locus_tag LOCUS_23360 42 929 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228587.1 protein_id gnl|my_center|LOCUS_23360 1165 935 gene locus_tag LOCUS_23370 1165 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172522.1 protein_id gnl|my_center|LOCUS_23370 1247 1744 gene locus_tag LOCUS_23380 1247 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227932.1 protein_id gnl|my_center|LOCUS_23380 2358 1720 gene locus_tag LOCUS_23390 2358 1720 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310898.1 protein_id gnl|my_center|LOCUS_23390 3339 2362 gene locus_tag LOCUS_23400 3339 2362 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926098.1 protein_id gnl|my_center|LOCUS_23400 3401 3967 gene locus_tag LOCUS_23410 3401 3967 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228658.1 protein_id gnl|my_center|LOCUS_23410 3987 4667 gene locus_tag LOCUS_23420 3987 4667 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228995.1 protein_id gnl|my_center|LOCUS_23420 5644 4664 gene locus_tag LOCUS_23430 gene mutY 5644 4664 CDS product A/G-specific adenine glycosylase MutY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228996.1 protein_id gnl|my_center|LOCUS_23430 6015 5608 gene locus_tag LOCUS_23440 6015 5608 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228997.1 protein_id gnl|my_center|LOCUS_23440 6478 6032 gene locus_tag LOCUS_23450 6478 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 >Feature sequence099 1290 388 gene locus_tag LOCUS_23460 1290 388 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228493.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence100 659 390 gene locus_tag LOCUS_23470 659 390 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480068.1 protein_id gnl|my_center|LOCUS_23470 829 1464 gene locus_tag LOCUS_23480 829 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 2489 1461 gene locus_tag LOCUS_23490 2489 1461 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886836.1 protein_id gnl|my_center|LOCUS_23490 3612 2500 gene locus_tag LOCUS_23500 3612 2500 CDS product DUF898 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941131.1 protein_id gnl|my_center|LOCUS_23500 4421 3663 gene locus_tag LOCUS_23510 4421 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 5625 4432 gene locus_tag LOCUS_23520 5625 4432 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728380.1 protein_id gnl|my_center|LOCUS_23520 <6121 5618 gene locus_tag LOCUS_23530 <6121 5618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003406908.1:P1 family peptidase >Feature sequence101 263 1576 gene locus_tag LOCUS_23540 263 1576 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228576.1 protein_id gnl|my_center|LOCUS_23540 1590 2330 gene locus_tag LOCUS_23550 1590 2330 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_23550 2367 2870 gene locus_tag LOCUS_23560 2367 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228841.1 protein_id gnl|my_center|LOCUS_23560 2907 2983 gene locus_tag LOCUS_t00400 2907 2983 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3731 3021 gene locus_tag LOCUS_23570 3731 3021 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174315.1 protein_id gnl|my_center|LOCUS_23570 4087 3791 gene locus_tag LOCUS_23580 gene rpmB 4087 3791 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631133.1 protein_id gnl|my_center|LOCUS_23580 4184 4672 gene locus_tag LOCUS_23590 gene lspA 4184 4672 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174313.1 protein_id gnl|my_center|LOCUS_23590 4696 5433 gene locus_tag LOCUS_23600 4696 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228941.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence102 1598 390 gene locus_tag LOCUS_23610 1598 390 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208502.1 protein_id gnl|my_center|LOCUS_23610 2232 1609 gene locus_tag LOCUS_23620 2232 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 3401 2337 gene locus_tag LOCUS_23630 3401 2337 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227788.1 protein_id gnl|my_center|LOCUS_23630 5084 3474 gene locus_tag LOCUS_23640 5084 3474 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926017.1 protein_id gnl|my_center|LOCUS_23640 >Feature sequence103 <1 568 gene locus_tag LOCUS_23650 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227970.1:tRNA epoxyqueuosine(34) reductase QueG 910 551 gene locus_tag LOCUS_23660 910 551 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632387.1 protein_id gnl|my_center|LOCUS_23660 1029 1565 gene locus_tag LOCUS_23670 1029 1565 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228210.1 protein_id gnl|my_center|LOCUS_23670 1573 2526 gene locus_tag LOCUS_23680 1573 2526 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969705.1 protein_id gnl|my_center|LOCUS_23680 2513 3130 gene locus_tag LOCUS_23690 2513 3130 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086030.1 protein_id gnl|my_center|LOCUS_23690 3783 3157 gene locus_tag LOCUS_23700 3783 3157 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926013.1 protein_id gnl|my_center|LOCUS_23700 >Feature sequence104 2252 159 gene locus_tag LOCUS_23710 gene fusA 2252 159 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228848.1 protein_id gnl|my_center|LOCUS_23710 2725 2255 gene locus_tag LOCUS_23720 gene rpsG 2725 2255 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633429.1 protein_id gnl|my_center|LOCUS_23720 3149 2733 gene locus_tag LOCUS_23730 gene rpsL 3149 2733 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118744.1 protein_id gnl|my_center|LOCUS_23730 4038 3421 gene locus_tag LOCUS_23740 4038 3421 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229033.1 protein_id gnl|my_center|LOCUS_23740 4146 4643 gene locus_tag LOCUS_23750 4146 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 4665 5240 gene locus_tag LOCUS_23760 4665 5240 CDS product MazG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229037.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence105 399 1622 gene locus_tag LOCUS_23770 399 1622 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228007.1 protein_id gnl|my_center|LOCUS_23770 1627 2142 gene locus_tag LOCUS_23780 1627 2142 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228008.1 protein_id gnl|my_center|LOCUS_23780 3695 2139 gene locus_tag LOCUS_23790 3695 2139 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173309.1 protein_id gnl|my_center|LOCUS_23790 3866 3705 gene locus_tag LOCUS_23800 3866 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 <5233 3876 gene locus_tag LOCUS_23810 <5233 3876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228057.1:protoporphyrinogen oxidase >Feature sequence106 2954 468 gene locus_tag LOCUS_23820 2954 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 4585 3158 gene locus_tag LOCUS_23830 4585 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 4944 4735 gene locus_tag LOCUS_23840 4944 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence107 3113 393 gene locus_tag LOCUS_23850 gene aceE 3113 393 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227763.1 protein_id gnl|my_center|LOCUS_23850 3956 3264 gene locus_tag LOCUS_23860 3956 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227745.1 protein_id gnl|my_center|LOCUS_23860 4185 4006 gene locus_tag LOCUS_23870 4185 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022799503.1 protein_id gnl|my_center|LOCUS_23870 4652 4194 gene locus_tag LOCUS_23880 4652 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 >Feature sequence108 249 734 gene locus_tag LOCUS_23890 249 734 CDS product L17 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123829.1 protein_id gnl|my_center|LOCUS_23890 2069 789 gene locus_tag LOCUS_23900 2069 789 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887950.1 protein_id gnl|my_center|LOCUS_23900 3318 2077 gene locus_tag LOCUS_23910 3318 2077 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887950.1 protein_id gnl|my_center|LOCUS_23910 4379 3360 gene locus_tag LOCUS_23920 4379 3360 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926061.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence109 648 451 gene locus_tag LOCUS_23930 648 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 1154 738 gene locus_tag LOCUS_23940 1154 738 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098308.1 protein_id gnl|my_center|LOCUS_23940 1589 1158 gene locus_tag LOCUS_23950 1589 1158 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228878.1 protein_id gnl|my_center|LOCUS_23950 2532 1597 gene locus_tag LOCUS_23960 2532 1597 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141923.1 protein_id gnl|my_center|LOCUS_23960 3918 2554 gene locus_tag LOCUS_23970 3918 2554 CDS product 2-phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118965.1 protein_id gnl|my_center|LOCUS_23970 4060 4134 gene locus_tag LOCUS_t00410 4060 4134 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4142 4218 gene locus_tag LOCUS_t00420 4142 4218 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence110 <1 1145 gene locus_tag LOCUS_23980 <1 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_060384639.1:GTPase HflX 1741 1142 gene locus_tag LOCUS_23990 1741 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 2524 1745 gene locus_tag LOCUS_24000 gene ricT 2524 1745 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228964.1 protein_id gnl|my_center|LOCUS_24000 3464 2583 gene locus_tag LOCUS_24010 3464 2583 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228965.1 protein_id gnl|my_center|LOCUS_24010 4201 3467 gene locus_tag LOCUS_24020 4201 3467 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228966.1 protein_id gnl|my_center|LOCUS_24020 >Feature sequence111 834 262 gene locus_tag LOCUS_24030 834 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 1041 1673 gene locus_tag LOCUS_24040 1041 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 1733 1939 gene locus_tag LOCUS_24050 1733 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 2062 2952 gene locus_tag LOCUS_24060 2062 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 2974 4509 gene locus_tag LOCUS_24070 2974 4509 CDS product YfjI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481742.1 protein_id gnl|my_center|LOCUS_24070 >Feature sequence112 213 1196 gene locus_tag LOCUS_24080 213 1196 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228398.1 protein_id gnl|my_center|LOCUS_24080 1197 1628 gene locus_tag LOCUS_24090 gene ybeY 1197 1628 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173125.1 protein_id gnl|my_center|LOCUS_24090 <4364 1625 gene locus_tag LOCUS_24100 <4364 1625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228030.1:translocation/assembly module TamB domain-containing protein >Feature sequence113 <1 598 gene locus_tag LOCUS_24110 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257971.1:molybdopterin-dependent oxidoreductase 635 1054 gene locus_tag LOCUS_24120 635 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 1135 2028 gene locus_tag LOCUS_24130 gene hemC 1135 2028 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174006.1 protein_id gnl|my_center|LOCUS_24130 3735 2032 gene locus_tag LOCUS_24140 3735 2032 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228219.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence114 1208 291 gene locus_tag LOCUS_24150 1208 291 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479988.1 protein_id gnl|my_center|LOCUS_24150 1429 1211 gene locus_tag LOCUS_24160 1429 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 1567 1491 gene locus_tag LOCUS_t00430 1567 1491 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1782 3062 gene locus_tag LOCUS_24170 1782 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 >Feature sequence115 1286 153 gene locus_tag LOCUS_24180 1286 153 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228590.1 protein_id gnl|my_center|LOCUS_24180 1375 2163 gene locus_tag LOCUS_24190 gene rsmI 1375 2163 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229050.1 protein_id gnl|my_center|LOCUS_24190 2235 3203 gene locus_tag LOCUS_24200 gene pfkA 2235 3203 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173968.1 protein_id gnl|my_center|LOCUS_24200 3868 3200 gene locus_tag LOCUS_24210 3868 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 >Feature sequence116 3200 1314 gene locus_tag LOCUS_24220 3200 1314 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_24220 3688 3197 gene locus_tag LOCUS_24230 3688 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 >Feature sequence117 1450 602 gene locus_tag LOCUS_24240 gene accD 1450 602 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228904.1 protein_id gnl|my_center|LOCUS_24240 2426 1536 gene locus_tag LOCUS_24250 2426 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 2863 2477 gene locus_tag LOCUS_24260 2863 2477 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173792.1 protein_id gnl|my_center|LOCUS_24260 <3400 2899 gene locus_tag LOCUS_24270 <3400 2899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228905.1:M23 family metallopeptidase >Feature sequence118 113 1189 gene locus_tag LOCUS_24280 113 1189 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926074.1 protein_id gnl|my_center|LOCUS_24280 1463 1999 gene locus_tag LOCUS_24290 1463 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 2048 2785 gene locus_tag LOCUS_24300 2048 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 >Feature sequence119 970 1983 gene locus_tag LOCUS_24310 970 1983 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence120 <1 1527 gene locus_tag LOCUS_24320 <1 1527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034350148.1:S8 family serine peptidase 1560 1712 gene locus_tag LOCUS_24330 1560 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 <3119 1672 gene locus_tag LOCUS_24340 <3119 1672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228224.1:DNA translocase FtsK >Feature sequence121 348 755 gene locus_tag LOCUS_24350 348 755 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017671.1 protein_id gnl|my_center|LOCUS_24350 791 1810 gene locus_tag LOCUS_24360 791 1810 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229059.1 protein_id gnl|my_center|LOCUS_24360 1821 2582 gene locus_tag LOCUS_24370 1821 2582 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728711.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence122 783 1820 gene locus_tag LOCUS_24380 783 1820 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705236.1 protein_id gnl|my_center|LOCUS_24380 1817 2308 gene locus_tag LOCUS_24390 1817 2308 CDS product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067085.1 protein_id gnl|my_center|LOCUS_24390 2464 2374 gene locus_tag LOCUS_t00440 2464 2374 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence123 920 486 gene locus_tag LOCUS_24400 920 486 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228705.1 protein_id gnl|my_center|LOCUS_24400 1968 934 gene locus_tag LOCUS_24410 gene xerC 1968 934 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064714.1 protein_id gnl|my_center|LOCUS_24410 2180 2503 gene locus_tag LOCUS_24420 2180 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 >Feature sequence124 3 341 gene locus_tag LOCUS_24430 3 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 673 344 gene locus_tag LOCUS_24440 673 344 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119361310.1 protein_id gnl|my_center|LOCUS_24440 730 1383 gene locus_tag LOCUS_24450 730 1383 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 protein_id gnl|my_center|LOCUS_24450 1387 2421 gene locus_tag LOCUS_24460 1387 2421 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173407.1 protein_id gnl|my_center|LOCUS_24460