>Feature sequence001 816 238 gene locus_tag LOCUS_00010 816 238 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545226.1 protein_id gnl|my_center|LOCUS_00010 1574 813 gene locus_tag LOCUS_00020 1574 813 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546413.1 protein_id gnl|my_center|LOCUS_00020 2947 1571 gene locus_tag LOCUS_00030 2947 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4233 2974 gene locus_tag LOCUS_00040 gene leuC 4233 2974 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545762.1 protein_id gnl|my_center|LOCUS_00040 5778 4252 gene locus_tag LOCUS_00050 5778 4252 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_00050 6591 5866 gene locus_tag LOCUS_00060 gene pssA 6591 5866 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546557.1 protein_id gnl|my_center|LOCUS_00060 7223 6588 gene locus_tag LOCUS_00070 7223 6588 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545974.1 protein_id gnl|my_center|LOCUS_00070 7356 7913 gene locus_tag LOCUS_00080 7356 7913 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_00080 7938 9695 gene locus_tag LOCUS_00090 7938 9695 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392706.1 protein_id gnl|my_center|LOCUS_00090 10415 9708 gene locus_tag LOCUS_00100 10415 9708 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940564.1 protein_id gnl|my_center|LOCUS_00100 12097 10427 gene locus_tag LOCUS_00110 gene mutL 12097 10427 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546175.1 protein_id gnl|my_center|LOCUS_00110 12272 13528 gene locus_tag LOCUS_00120 12272 13528 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545857.1 protein_id gnl|my_center|LOCUS_00120 13539 15017 gene locus_tag LOCUS_00130 gene lysS 13539 15017 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545717.1 protein_id gnl|my_center|LOCUS_00130 15130 16356 gene locus_tag LOCUS_00140 15130 16356 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545027.1 protein_id gnl|my_center|LOCUS_00140 16356 16613 gene locus_tag LOCUS_00150 16356 16613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16610 17278 gene locus_tag LOCUS_00160 16610 17278 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_00160 17361 17438 gene locus_tag LOCUS_t00010 17361 17438 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 17996 17547 gene locus_tag LOCUS_00170 17996 17547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 >Feature sequence002 <1 676 gene locus_tag LOCUS_00180 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545001.1:protein translocase subunit SecF 712 2403 gene locus_tag LOCUS_00190 gene recJ 712 2403 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546723.1 protein_id gnl|my_center|LOCUS_00190 2752 3108 gene locus_tag LOCUS_00200 2752 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 3184 4302 gene locus_tag LOCUS_00210 3184 4302 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_00210 4466 5560 gene locus_tag LOCUS_00220 4466 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 5794 5573 gene locus_tag LOCUS_00230 5794 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 6462 5809 gene locus_tag LOCUS_00240 6462 5809 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392812.1 protein_id gnl|my_center|LOCUS_00240 6570 7358 gene locus_tag LOCUS_00250 gene xth 6570 7358 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140144.1 protein_id gnl|my_center|LOCUS_00250 8816 7353 gene locus_tag LOCUS_00260 gene cls 8816 7353 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943983.1 protein_id gnl|my_center|LOCUS_00260 12319 9143 gene locus_tag LOCUS_00270 gene mfd 12319 9143 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545077.1 protein_id gnl|my_center|LOCUS_00270 12951 12475 gene locus_tag LOCUS_00280 12951 12475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 13365 12952 gene locus_tag LOCUS_00290 13365 12952 CDS product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944070.1 protein_id gnl|my_center|LOCUS_00290 14460 13369 gene locus_tag LOCUS_00300 gene rseP 14460 13369 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545838.1 protein_id gnl|my_center|LOCUS_00300 15658 14516 gene locus_tag LOCUS_00310 15658 14516 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546435.1 protein_id gnl|my_center|LOCUS_00310 16327 15671 gene locus_tag LOCUS_00320 16327 15671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 17167 16469 gene locus_tag LOCUS_00330 17167 16469 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545912.1 protein_id gnl|my_center|LOCUS_00330 >Feature sequence003 1116 334 gene locus_tag LOCUS_00340 1116 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 1863 1120 gene locus_tag LOCUS_00350 1863 1120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_00350 2834 1860 gene locus_tag LOCUS_00360 2834 1860 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883993.1 protein_id gnl|my_center|LOCUS_00360 3652 2831 gene locus_tag LOCUS_00370 3652 2831 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545710.1 protein_id gnl|my_center|LOCUS_00370 5692 3662 gene locus_tag LOCUS_00380 5692 3662 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087534.1 protein_id gnl|my_center|LOCUS_00380 6201 6126 gene locus_tag LOCUS_t00020 6201 6126 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7450 6353 gene locus_tag LOCUS_00390 7450 6353 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546530.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00390 7795 7502 gene locus_tag LOCUS_00400 7795 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00400 8774 8355 gene locus_tag LOCUS_00410 8774 8355 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545771.1 protein_id gnl|my_center|LOCUS_00410 9196 9957 gene locus_tag LOCUS_00420 9196 9957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 9980 10843 gene locus_tag LOCUS_00430 9980 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 10862 11245 gene locus_tag LOCUS_00440 10862 11245 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_00440 11299 13140 gene locus_tag LOCUS_00450 gene nuoF 11299 13140 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_00450 13137 15605 gene locus_tag LOCUS_00460 13137 15605 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941012.1 protein_id gnl|my_center|LOCUS_00460 15860 15696 gene locus_tag LOCUS_00470 15860 15696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 >Feature sequence004 <1 1030 gene locus_tag LOCUS_00480 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941439.1:cache domain-containing protein 1046 2425 gene locus_tag LOCUS_00490 1046 2425 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880700.1 protein_id gnl|my_center|LOCUS_00490 3102 2467 gene locus_tag LOCUS_00500 3102 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 3870 3118 gene locus_tag LOCUS_00510 gene ttrB 3870 3118 CDS product tetrathionate reductase subunit TtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269830.1 protein_id gnl|my_center|LOCUS_00510 5135 3885 gene locus_tag LOCUS_00520 gene hmeB 5135 3885 CDS product Hdr-like menaquinol oxidoreductase integral membrane subunit HmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_00520 5495 5169 gene locus_tag LOCUS_00530 5495 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 5852 5508 gene locus_tag LOCUS_00540 5852 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 6191 5856 gene locus_tag LOCUS_00550 6191 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 6792 8426 gene locus_tag LOCUS_00560 gene argS 6792 8426 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546374.1 protein_id gnl|my_center|LOCUS_00560 8509 11292 gene locus_tag LOCUS_00570 gene glnE 8509 11292 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038683.1 protein_id gnl|my_center|LOCUS_00570 11825 11289 gene locus_tag LOCUS_00580 11825 11289 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956700.1 protein_id gnl|my_center|LOCUS_00580 15123 11770 gene locus_tag LOCUS_00590 15123 11770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 16167 15181 gene locus_tag LOCUS_00600 16167 15181 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228360.1 protein_id gnl|my_center|LOCUS_00600 >Feature sequence005 1225 1599 gene locus_tag LOCUS_00610 1225 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 1596 2264 gene locus_tag LOCUS_00620 gene nfi 1596 2264 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583138.1 protein_id gnl|my_center|LOCUS_00620 2363 3553 gene locus_tag LOCUS_00630 2363 3553 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545761.1 protein_id gnl|my_center|LOCUS_00630 3581 4681 gene locus_tag LOCUS_00640 gene dprA 3581 4681 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546585.1 protein_id gnl|my_center|LOCUS_00640 4823 5107 gene locus_tag LOCUS_00650 4823 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 5127 7433 gene locus_tag LOCUS_00660 gene topA 5127 7433 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_00660 7733 10378 gene locus_tag LOCUS_00670 gene polA 7733 10378 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082086.1 protein_id gnl|my_center|LOCUS_00670 10590 11570 gene locus_tag LOCUS_00680 gene nadA 10590 11570 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546803.1 protein_id gnl|my_center|LOCUS_00680 11571 12854 gene locus_tag LOCUS_00690 gene rimO 11571 12854 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546475.1 protein_id gnl|my_center|LOCUS_00690 12851 13744 gene locus_tag LOCUS_00700 12851 13744 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_00700 14941 13886 gene locus_tag LOCUS_00710 14941 13886 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545234.1 protein_id gnl|my_center|LOCUS_00710 <15588 14934 gene locus_tag LOCUS_00720 <15588 14934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545469.1:chemotaxis protein CheA >Feature sequence006 <1 1562 gene locus_tag LOCUS_00730 <1 1562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_070691812.1:type II secretion system ATPase GspE 1564 2757 gene locus_tag LOCUS_00740 1564 2757 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_00740 2829 3296 gene locus_tag LOCUS_00750 2829 3296 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246056.1 protein_id gnl|my_center|LOCUS_00750 3296 3676 gene locus_tag LOCUS_00760 3296 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 3673 4350 gene locus_tag LOCUS_00770 3673 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 4510 5475 gene locus_tag LOCUS_00780 4510 5475 CDS product type II secretion system protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035906.1 protein_id gnl|my_center|LOCUS_00780 5459 6793 gene locus_tag LOCUS_00790 5459 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 6774 7331 gene locus_tag LOCUS_00800 6774 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 7328 8665 gene locus_tag LOCUS_00810 7328 8665 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546823.1 protein_id gnl|my_center|LOCUS_00810 8662 9372 gene locus_tag LOCUS_00820 8662 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 9363 10019 gene locus_tag LOCUS_00830 gene rpe 9363 10019 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_00830 10009 11118 gene locus_tag LOCUS_00840 10009 11118 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546019.1 protein_id gnl|my_center|LOCUS_00840 11140 11667 gene locus_tag LOCUS_00850 11140 11667 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545392.1 protein_id gnl|my_center|LOCUS_00850 11727 12974 gene locus_tag LOCUS_00860 11727 12974 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545290.1 protein_id gnl|my_center|LOCUS_00860 12958 13788 gene locus_tag LOCUS_00870 gene aroE 12958 13788 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544907.1 protein_id gnl|my_center|LOCUS_00870 13863 14111 gene locus_tag LOCUS_00880 13863 14111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 14208 14759 gene locus_tag LOCUS_00890 14208 14759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00890 >Feature sequence007 645 767 gene locus_tag LOCUS_00900 645 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 788 3046 gene locus_tag LOCUS_00910 788 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 3192 3509 gene locus_tag LOCUS_00920 3192 3509 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255937.1 protein_id gnl|my_center|LOCUS_00920 3662 3961 gene locus_tag LOCUS_00930 3662 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 3961 4413 gene locus_tag LOCUS_00940 3961 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 7139 4455 gene locus_tag LOCUS_00950 7139 4455 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942970.1 protein_id gnl|my_center|LOCUS_00950 7217 7972 gene locus_tag LOCUS_00960 7217 7972 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546017.1 protein_id gnl|my_center|LOCUS_00960 7969 8625 gene locus_tag LOCUS_00970 7969 8625 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546750.1 protein_id gnl|my_center|LOCUS_00970 8728 10116 gene locus_tag LOCUS_00980 8728 10116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 10752 10057 gene locus_tag LOCUS_00990 10752 10057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 10823 10896 gene locus_tag LOCUS_t00030 10823 10896 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 10961 11036 gene locus_tag LOCUS_t00040 10961 11036 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 13261 11114 gene locus_tag LOCUS_01000 13261 11114 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146750.1 protein_id gnl|my_center|LOCUS_01000 13653 13258 gene locus_tag LOCUS_01010 13653 13258 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145023062.1 protein_id gnl|my_center|LOCUS_01010 >Feature sequence008 498 1685 gene locus_tag LOCUS_01020 498 1685 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171267129.1 protein_id gnl|my_center|LOCUS_01020 1848 3749 gene locus_tag LOCUS_01030 1848 3749 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896800.1 protein_id gnl|my_center|LOCUS_01030 3787 5529 gene locus_tag LOCUS_01040 3787 5529 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398669.1 protein_id gnl|my_center|LOCUS_01040 6635 5535 gene locus_tag LOCUS_01050 gene proB 6635 5535 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546492.1 protein_id gnl|my_center|LOCUS_01050 7630 6632 gene locus_tag LOCUS_01060 gene obgE 7630 6632 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545625.1 protein_id gnl|my_center|LOCUS_01060 7734 8429 gene locus_tag LOCUS_01070 7734 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 8430 8840 gene locus_tag LOCUS_01080 8430 8840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 8873 11317 gene locus_tag LOCUS_01090 8873 11317 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545339.1 protein_id gnl|my_center|LOCUS_01090 11314 12183 gene locus_tag LOCUS_01100 11314 12183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 12336 12249 gene locus_tag LOCUS_t00050 12336 12249 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12649 12725 gene locus_tag LOCUS_t00060 12649 12725 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence009 <1 1579 gene locus_tag LOCUS_01110 <1 1579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544918.1:murein biosynthesis integral membrane protein MurJ 1709 2083 gene locus_tag LOCUS_01120 gene rpsF 1709 2083 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545875.1 protein_id gnl|my_center|LOCUS_01120 2076 2465 gene locus_tag LOCUS_01130 gene ssb 2076 2465 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545299.1 protein_id gnl|my_center|LOCUS_01130 2489 2710 gene locus_tag LOCUS_01140 gene rpsR 2489 2710 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545644.1 protein_id gnl|my_center|LOCUS_01140 2715 2996 gene locus_tag LOCUS_01150 2715 2996 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013194.1 protein_id gnl|my_center|LOCUS_01150 2996 3277 gene locus_tag LOCUS_01160 2996 3277 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546416.1 protein_id gnl|my_center|LOCUS_01160 3211 5232 gene locus_tag LOCUS_01170 3211 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 5219 5551 gene locus_tag LOCUS_01180 5219 5551 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545366.1 protein_id gnl|my_center|LOCUS_01180 6330 5608 gene locus_tag LOCUS_01190 6330 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 6438 8879 gene locus_tag LOCUS_01200 6438 8879 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545608.1 protein_id gnl|my_center|LOCUS_01200 8908 10419 gene locus_tag LOCUS_01210 8908 10419 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546353.1 protein_id gnl|my_center|LOCUS_01210 10440 11243 gene locus_tag LOCUS_01220 gene larE 10440 11243 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_01220 11240 12415 gene locus_tag LOCUS_01230 11240 12415 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943909.1 protein_id gnl|my_center|LOCUS_01230 >Feature sequence010 1247 645 gene locus_tag LOCUS_01240 1247 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 2750 1350 gene locus_tag LOCUS_01250 gene tilS 2750 1350 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_01250 3656 2754 gene locus_tag LOCUS_01260 3656 2754 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544987.1 protein_id gnl|my_center|LOCUS_01260 3755 5203 gene locus_tag LOCUS_01270 gene gatA 3755 5203 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546781.1 protein_id gnl|my_center|LOCUS_01270 5200 6642 gene locus_tag LOCUS_01280 gene gatB 5200 6642 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_01280 6652 7092 gene locus_tag LOCUS_01290 6652 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 7606 7163 gene locus_tag LOCUS_01300 7606 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 8255 7611 gene locus_tag LOCUS_01310 8255 7611 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545748.1 protein_id gnl|my_center|LOCUS_01310 8815 8291 gene locus_tag LOCUS_01320 8815 8291 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879640.1 protein_id gnl|my_center|LOCUS_01320 9783 8887 gene locus_tag LOCUS_01330 gene argB 9783 8887 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544977.1 protein_id gnl|my_center|LOCUS_01330 10366 9785 gene locus_tag LOCUS_01340 10366 9785 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545142.1 protein_id gnl|my_center|LOCUS_01340 10951 10391 gene locus_tag LOCUS_01350 10951 10391 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924852.1 protein_id gnl|my_center|LOCUS_01350 12468 11077 gene locus_tag LOCUS_01360 gene hslU 12468 11077 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_01360 13002 12472 gene locus_tag LOCUS_01370 gene hslV 13002 12472 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546241.1 protein_id gnl|my_center|LOCUS_01370 >Feature sequence011 574 296 gene locus_tag LOCUS_01380 574 296 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545551.1 protein_id gnl|my_center|LOCUS_01380 1165 593 gene locus_tag LOCUS_01390 1165 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 1275 1781 gene locus_tag LOCUS_01400 1275 1781 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_01400 1783 1971 gene locus_tag LOCUS_01410 gene rpmF 1783 1971 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_01410 1968 2999 gene locus_tag LOCUS_01420 gene plsX 1968 2999 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545117.1 protein_id gnl|my_center|LOCUS_01420 3023 4003 gene locus_tag LOCUS_01430 3023 4003 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_01430 4900 4124 gene locus_tag LOCUS_01440 4900 4124 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546761.1 protein_id gnl|my_center|LOCUS_01440 6191 4902 gene locus_tag LOCUS_01450 6191 4902 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_01450 6320 7408 gene locus_tag LOCUS_01460 6320 7408 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393402.1 protein_id gnl|my_center|LOCUS_01460 7386 9131 gene locus_tag LOCUS_01470 7386 9131 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546649.1 protein_id gnl|my_center|LOCUS_01470 9128 10252 gene locus_tag LOCUS_01480 9128 10252 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545696.1 protein_id gnl|my_center|LOCUS_01480 10322 11443 gene locus_tag LOCUS_01490 10322 11443 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545052.1 protein_id gnl|my_center|LOCUS_01490 11540 12277 gene locus_tag LOCUS_01500 11540 12277 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544934.1 protein_id gnl|my_center|LOCUS_01500 >Feature sequence012 228 752 gene locus_tag LOCUS_01510 228 752 CDS product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927006.1 protein_id gnl|my_center|LOCUS_01510 4918 779 gene locus_tag LOCUS_01520 gene rpoC 4918 779 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546248.1 protein_id gnl|my_center|LOCUS_01520 8928 4990 gene locus_tag LOCUS_01530 gene rpoB 8928 4990 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546627.1 protein_id gnl|my_center|LOCUS_01530 9411 9019 gene locus_tag LOCUS_01540 gene rplL 9411 9019 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546672.1 protein_id gnl|my_center|LOCUS_01540 9943 9449 gene locus_tag LOCUS_01550 gene rplJ 9943 9449 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924917.1 protein_id gnl|my_center|LOCUS_01550 10875 10180 gene locus_tag LOCUS_01560 gene rplA 10875 10180 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545797.1 protein_id gnl|my_center|LOCUS_01560 11340 10912 gene locus_tag LOCUS_01570 gene rplK 11340 10912 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546433.1 protein_id gnl|my_center|LOCUS_01570 11964 11440 gene locus_tag LOCUS_01580 gene nusG 11964 11440 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546677.1 protein_id gnl|my_center|LOCUS_01580 12156 11971 gene locus_tag LOCUS_01590 12156 11971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 12456 12381 gene locus_tag LOCUS_t00070 12456 12381 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence013 981 133 gene locus_tag LOCUS_01600 981 133 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545938.1 protein_id gnl|my_center|LOCUS_01600 1978 974 gene locus_tag LOCUS_01610 gene purM 1978 974 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545739.1 protein_id gnl|my_center|LOCUS_01610 2075 3025 gene locus_tag LOCUS_01620 2075 3025 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546739.1 protein_id gnl|my_center|LOCUS_01620 4909 2993 gene locus_tag LOCUS_01630 4909 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 5204 4899 gene locus_tag LOCUS_01640 5204 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 6593 5358 gene locus_tag LOCUS_01650 6593 5358 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924918.1 protein_id gnl|my_center|LOCUS_01650 7044 6583 gene locus_tag LOCUS_01660 gene rpiB 7044 6583 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_01660 7153 8232 gene locus_tag LOCUS_01670 7153 8232 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_01670 8236 9513 gene locus_tag LOCUS_01680 8236 9513 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_01680 9528 10463 gene locus_tag LOCUS_01690 gene mdh 9528 10463 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545039.1 protein_id gnl|my_center|LOCUS_01690 10496 11005 gene locus_tag LOCUS_01700 gene ndk 10496 11005 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831235.1 protein_id gnl|my_center|LOCUS_01700 11938 11111 gene locus_tag LOCUS_01710 11938 11111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 >Feature sequence014 426 10 gene locus_tag LOCUS_01720 gene nusB 426 10 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546543.1 protein_id gnl|my_center|LOCUS_01720 946 449 gene locus_tag LOCUS_01730 gene ribE 946 449 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545200.1 protein_id gnl|my_center|LOCUS_01730 2188 971 gene locus_tag LOCUS_01740 2188 971 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_01740 3130 2486 gene locus_tag LOCUS_01750 3130 2486 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544953.1 protein_id gnl|my_center|LOCUS_01750 3483 3133 gene locus_tag LOCUS_01760 3483 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 4088 3480 gene locus_tag LOCUS_01770 gene lepB 4088 3480 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_01770 5875 4085 gene locus_tag LOCUS_01780 gene lepA 5875 4085 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546674.1 protein_id gnl|my_center|LOCUS_01780 6785 5868 gene locus_tag LOCUS_01790 6785 5868 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545468.1 protein_id gnl|my_center|LOCUS_01790 7341 6970 gene locus_tag LOCUS_01800 7341 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01800 7959 7420 gene locus_tag LOCUS_01810 7959 7420 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583282.1 protein_id gnl|my_center|LOCUS_01810 8702 7959 gene locus_tag LOCUS_01820 8702 7959 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_01820 9030 8695 gene locus_tag LOCUS_01830 9030 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583278.1 protein_id gnl|my_center|LOCUS_01830 9878 9435 gene locus_tag LOCUS_01840 9878 9435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 10336 9989 gene locus_tag LOCUS_01850 10336 9989 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869442.1 protein_id gnl|my_center|LOCUS_01850 11724 10333 gene locus_tag LOCUS_01860 11724 10333 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_01860 >Feature sequence015 <1 1190 gene locus_tag LOCUS_01870 <1 1190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545854.1:glycosyltransferase family 39 protein 1902 1192 gene locus_tag LOCUS_01880 gene bioD 1902 1192 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_01880 2431 1889 gene locus_tag LOCUS_01890 2431 1889 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545295.1 protein_id gnl|my_center|LOCUS_01890 4555 2579 gene locus_tag LOCUS_01900 gene acs 4555 2579 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546141.1 protein_id gnl|my_center|LOCUS_01900 5872 4910 gene locus_tag LOCUS_01910 gene hemH 5872 4910 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124679.1 protein_id gnl|my_center|LOCUS_01910 5984 7051 gene locus_tag LOCUS_01920 gene hrcA 5984 7051 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545755.1 protein_id gnl|my_center|LOCUS_01920 7033 7677 gene locus_tag LOCUS_01930 7033 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 7749 9695 gene locus_tag LOCUS_01940 gene dnaK 7749 9695 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_01940 9859 10962 gene locus_tag LOCUS_01950 gene dnaJ 9859 10962 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545807.1 protein_id gnl|my_center|LOCUS_01950 11031 11765 gene locus_tag LOCUS_01960 11031 11765 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958567.1 protein_id gnl|my_center|LOCUS_01960 >Feature sequence016 488 751 gene locus_tag LOCUS_01970 488 751 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249839.1 protein_id gnl|my_center|LOCUS_01970 1076 1312 gene locus_tag LOCUS_01980 1076 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 1285 1524 gene locus_tag LOCUS_01990 1285 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 1521 1721 gene locus_tag LOCUS_02000 1521 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 1883 1808 gene locus_tag LOCUS_t00080 1883 1808 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3234 2047 gene locus_tag LOCUS_02010 gene ftsZ 3234 2047 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545914.1 protein_id gnl|my_center|LOCUS_02010 4486 3218 gene locus_tag LOCUS_02020 gene ftsA 4486 3218 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_02020 5276 4473 gene locus_tag LOCUS_02030 5276 4473 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545598.1 protein_id gnl|my_center|LOCUS_02030 6192 5242 gene locus_tag LOCUS_02040 6192 5242 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_02040 7129 6179 gene locus_tag LOCUS_02050 gene murB 7129 6179 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943692.1 protein_id gnl|my_center|LOCUS_02050 8486 7116 gene locus_tag LOCUS_02060 gene murC 8486 7116 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546590.1 protein_id gnl|my_center|LOCUS_02060 9624 8479 gene locus_tag LOCUS_02070 gene murG 9624 8479 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545433.1 protein_id gnl|my_center|LOCUS_02070 10802 9621 gene locus_tag LOCUS_02080 gene ftsW 10802 9621 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545997.1 protein_id gnl|my_center|LOCUS_02080 <11942 10792 gene locus_tag LOCUS_02090 <11942 10792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545218.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase >Feature sequence017 184 1119 gene locus_tag LOCUS_02100 184 1119 CDS product NOL1/NOP2/sun family putative RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879531.1 protein_id gnl|my_center|LOCUS_02100 1124 2584 gene locus_tag LOCUS_02110 1124 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 2655 3941 gene locus_tag LOCUS_02120 2655 3941 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791443.1 protein_id gnl|my_center|LOCUS_02120 3964 4278 gene locus_tag LOCUS_02130 gene cutA 3964 4278 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545706.1 protein_id gnl|my_center|LOCUS_02130 4533 4306 gene locus_tag LOCUS_02140 4533 4306 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_02140 5520 4672 gene locus_tag LOCUS_02150 gene modA 5520 4672 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_02150 6105 6938 gene locus_tag LOCUS_02160 6105 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 6984 7766 gene locus_tag LOCUS_02170 gene kdsA 6984 7766 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545456.1 protein_id gnl|my_center|LOCUS_02170 7763 8743 gene locus_tag LOCUS_02180 7763 8743 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_02180 8748 9935 gene locus_tag LOCUS_02190 gene trpB 8748 9935 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546381.1 protein_id gnl|my_center|LOCUS_02190 10871 9927 gene locus_tag LOCUS_02200 gene miaA 10871 9927 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546758.1 protein_id gnl|my_center|LOCUS_02200 11074 11149 gene locus_tag LOCUS_t00090 11074 11149 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence018 1323 484 gene locus_tag LOCUS_02210 1323 484 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436855.1 protein_id gnl|my_center|LOCUS_02210 2237 1320 gene locus_tag LOCUS_02220 2237 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 2956 2255 gene locus_tag LOCUS_02230 2956 2255 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272290.1 protein_id gnl|my_center|LOCUS_02230 5785 3023 gene locus_tag LOCUS_02240 5785 3023 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879871.1 protein_id gnl|my_center|LOCUS_02240 6812 5808 gene locus_tag LOCUS_02250 6812 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 7164 7496 gene locus_tag LOCUS_02260 7164 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 7508 8062 gene locus_tag LOCUS_02270 7508 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 9234 8056 gene locus_tag LOCUS_02280 9234 8056 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877728.1 protein_id gnl|my_center|LOCUS_02280 10734 9241 gene locus_tag LOCUS_02290 10734 9241 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227668.1 protein_id gnl|my_center|LOCUS_02290 >Feature sequence019 <1 1870 gene locus_tag LOCUS_02300 <1 1870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942856.1:HEAT repeat domain-containing protein 1863 2723 gene locus_tag LOCUS_02310 1863 2723 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942855.1 protein_id gnl|my_center|LOCUS_02310 2725 3774 gene locus_tag LOCUS_02320 2725 3774 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942854.1 protein_id gnl|my_center|LOCUS_02320 3811 4611 gene locus_tag LOCUS_02330 3811 4611 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942853.1 protein_id gnl|my_center|LOCUS_02330 4628 5002 gene locus_tag LOCUS_02340 4628 5002 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942852.1 protein_id gnl|my_center|LOCUS_02340 6026 5010 gene locus_tag LOCUS_02350 gene rlmN 6026 5010 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546659.1 protein_id gnl|my_center|LOCUS_02350 7590 6331 gene locus_tag LOCUS_02360 gene ahcY 7590 6331 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_02360 8757 7606 gene locus_tag LOCUS_02370 gene metK 8757 7606 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_02370 9193 9864 gene locus_tag LOCUS_02380 9193 9864 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_02380 >Feature sequence020 1969 710 gene locus_tag LOCUS_02390 1969 710 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_02390 3202 2003 gene locus_tag LOCUS_02400 3202 2003 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020733.1 protein_id gnl|my_center|LOCUS_02400 3902 3195 gene locus_tag LOCUS_02410 3902 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 4875 3934 gene locus_tag LOCUS_02420 gene folD 4875 3934 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545120.1 protein_id gnl|my_center|LOCUS_02420 5214 4897 gene locus_tag LOCUS_02430 5214 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809368.1 protein_id gnl|my_center|LOCUS_02430 7192 5219 gene locus_tag LOCUS_02440 7192 5219 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531166.1 protein_id gnl|my_center|LOCUS_02440 8033 7353 gene locus_tag LOCUS_02450 8033 7353 CDS product 4Fe-4S double cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860330.1 protein_id gnl|my_center|LOCUS_02450 8719 8030 gene locus_tag LOCUS_02460 8719 8030 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949054.1 protein_id gnl|my_center|LOCUS_02460 9275 8724 gene locus_tag LOCUS_02470 9275 8724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02470 9758 9315 gene locus_tag LOCUS_02480 9758 9315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02480 10740 9784 gene locus_tag LOCUS_02490 gene mtgA 10740 9784 CDS product methylcobalamin--tetrahydrofolate methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816523.1 protein_id gnl|my_center|LOCUS_02490 >Feature sequence021 803 1339 gene locus_tag LOCUS_02500 803 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 1427 3073 gene locus_tag LOCUS_02510 1427 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 3070 4725 gene locus_tag LOCUS_02520 3070 4725 CDS product DUF3880 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938740.1 protein_id gnl|my_center|LOCUS_02520 4856 5857 gene locus_tag LOCUS_02530 4856 5857 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_02530 5820 8582 gene locus_tag LOCUS_02540 5820 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 8579 10393 gene locus_tag LOCUS_02550 8579 10393 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044916.1 protein_id gnl|my_center|LOCUS_02550 >Feature sequence022 1447 866 gene locus_tag LOCUS_02560 1447 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 1827 1444 gene locus_tag LOCUS_02570 1827 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 2300 1824 gene locus_tag LOCUS_02580 2300 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 2814 2374 gene locus_tag LOCUS_02590 gene gspG 2814 2374 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_02590 3699 2914 gene locus_tag LOCUS_02600 3699 2914 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942660.1 protein_id gnl|my_center|LOCUS_02600 4382 3696 gene locus_tag LOCUS_02610 gene aat 4382 3696 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_02610 6618 4357 gene locus_tag LOCUS_02620 gene clpA 6618 4357 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546336.1 protein_id gnl|my_center|LOCUS_02620 6929 6615 gene locus_tag LOCUS_02630 gene clpS 6929 6615 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545154.1 protein_id gnl|my_center|LOCUS_02630 7286 8161 gene locus_tag LOCUS_02640 gene extKL 7286 8161 CDS product multiheme c-type cytochrome ExtKL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943568.1 protein_id gnl|my_center|LOCUS_02640 8189 8467 gene locus_tag LOCUS_02650 8189 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 8746 10476 gene locus_tag LOCUS_02660 gene polX 8746 10476 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_02660 >Feature sequence023 421 603 gene locus_tag LOCUS_02670 421 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 997 683 gene locus_tag LOCUS_02680 997 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 1177 1962 gene locus_tag LOCUS_02690 1177 1962 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883529.1 protein_id gnl|my_center|LOCUS_02690 2063 2743 gene locus_tag LOCUS_02700 2063 2743 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941515.1 protein_id gnl|my_center|LOCUS_02700 2835 3731 gene locus_tag LOCUS_02710 2835 3731 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942857.1 protein_id gnl|my_center|LOCUS_02710 3919 4182 gene locus_tag LOCUS_02720 3919 4182 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546861.1 protein_id gnl|my_center|LOCUS_02720 4215 5840 gene locus_tag LOCUS_02730 gene groL 4215 5840 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545192.1 protein_id gnl|my_center|LOCUS_02730 6083 7072 gene locus_tag LOCUS_02740 gene mltG 6083 7072 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545006.1 protein_id gnl|my_center|LOCUS_02740 7069 8136 gene locus_tag LOCUS_02750 gene ispG 7069 8136 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546314.1 protein_id gnl|my_center|LOCUS_02750 10467 8185 gene locus_tag LOCUS_02760 10467 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 >Feature sequence024 3711 2533 gene locus_tag LOCUS_02770 gene czcB 3711 2533 CDS product CzcB/NccB family metal efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880415.1 protein_id gnl|my_center|LOCUS_02770 5069 3708 gene locus_tag LOCUS_02780 5069 3708 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275526.1 protein_id gnl|my_center|LOCUS_02780 5470 5066 gene locus_tag LOCUS_02790 5470 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 5500 5679 gene locus_tag LOCUS_02800 5500 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 5648 6091 gene locus_tag LOCUS_02810 5648 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 6117 8207 gene locus_tag LOCUS_02820 gene fusA 6117 8207 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546422.1 protein_id gnl|my_center|LOCUS_02820 10037 8487 gene locus_tag LOCUS_02830 10037 8487 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546090.1 protein_id gnl|my_center|LOCUS_02830 >Feature sequence025 1644 184 gene locus_tag LOCUS_02840 gene guaB 1644 184 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546759.1 protein_id gnl|my_center|LOCUS_02840 2867 2013 gene locus_tag LOCUS_02850 2867 2013 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023015.1 protein_id gnl|my_center|LOCUS_02850 4591 2867 gene locus_tag LOCUS_02860 4591 2867 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545733.1 protein_id gnl|my_center|LOCUS_02860 6559 4790 gene locus_tag LOCUS_02870 6559 4790 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942999.1 protein_id gnl|my_center|LOCUS_02870 7139 6549 gene locus_tag LOCUS_02880 7139 6549 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_02880 7848 7117 gene locus_tag LOCUS_02890 gene rph 7848 7117 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545252.1 protein_id gnl|my_center|LOCUS_02890 8702 7845 gene locus_tag LOCUS_02900 gene murI 8702 7845 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_02900 9270 8713 gene locus_tag LOCUS_02910 9270 8713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 10156 9257 gene locus_tag LOCUS_02920 10156 9257 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545910.1 protein_id gnl|my_center|LOCUS_02920 >Feature sequence026 454 1857 gene locus_tag LOCUS_02930 454 1857 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918160.1 protein_id gnl|my_center|LOCUS_02930 1857 3074 gene locus_tag LOCUS_02940 1857 3074 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545659.1 protein_id gnl|my_center|LOCUS_02940 3798 3100 gene locus_tag LOCUS_02950 3798 3100 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039648148.1 protein_id gnl|my_center|LOCUS_02950 4225 3776 gene locus_tag LOCUS_02960 gene ybeY 4225 3776 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880869.1 protein_id gnl|my_center|LOCUS_02960 5756 4143 gene locus_tag LOCUS_02970 5756 4143 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546232.1 protein_id gnl|my_center|LOCUS_02970 6732 5737 gene locus_tag LOCUS_02980 6732 5737 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545286.1 protein_id gnl|my_center|LOCUS_02980 7394 6732 gene locus_tag LOCUS_02990 7394 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 8401 7391 gene locus_tag LOCUS_03000 gene queA 8401 7391 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545420.1 protein_id gnl|my_center|LOCUS_03000 9389 8388 gene locus_tag LOCUS_03010 9389 8388 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546594.1 protein_id gnl|my_center|LOCUS_03010 9615 9391 gene locus_tag LOCUS_03020 9615 9391 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545707.1 protein_id gnl|my_center|LOCUS_03020 10242 9703 gene locus_tag LOCUS_03030 10242 9703 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_03030 >Feature sequence027 2902 1157 gene locus_tag LOCUS_03040 2902 1157 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545590.1 protein_id gnl|my_center|LOCUS_03040 4041 2899 gene locus_tag LOCUS_03050 gene lpxB 4041 2899 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957694.1 protein_id gnl|my_center|LOCUS_03050 5165 4071 gene locus_tag LOCUS_03060 5165 4071 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546476.1 protein_id gnl|my_center|LOCUS_03060 6082 5162 gene locus_tag LOCUS_03070 6082 5162 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_03070 7094 6084 gene locus_tag LOCUS_03080 gene trpD 7094 6084 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_03080 8003 7413 gene locus_tag LOCUS_03090 8003 7413 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545428.1 protein_id gnl|my_center|LOCUS_03090 9488 8016 gene locus_tag LOCUS_03100 gene trpE 9488 8016 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546555.1 protein_id gnl|my_center|LOCUS_03100 9710 9994 gene locus_tag LOCUS_03110 9710 9994 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546546.1 protein_id gnl|my_center|LOCUS_03110 10143 10379 gene locus_tag LOCUS_03120 gene tusA 10143 10379 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_03120 >Feature sequence028 322 246 gene locus_tag LOCUS_t00100 322 246 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 532 1626 gene locus_tag LOCUS_03130 gene dnaJ 532 1626 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546226.1 protein_id gnl|my_center|LOCUS_03130 1620 1964 gene locus_tag LOCUS_03140 1620 1964 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545092.1 protein_id gnl|my_center|LOCUS_03140 1988 4633 gene locus_tag LOCUS_03150 gene clpB 1988 4633 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546043.1 protein_id gnl|my_center|LOCUS_03150 4748 5209 gene locus_tag LOCUS_03160 4748 5209 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546164.1 protein_id gnl|my_center|LOCUS_03160 8006 5247 gene locus_tag LOCUS_03170 gene uvrA 8006 5247 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545482.1 protein_id gnl|my_center|LOCUS_03170 8144 8608 gene locus_tag LOCUS_03180 gene dksA 8144 8608 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545075.1 protein_id gnl|my_center|LOCUS_03180 9036 8623 gene locus_tag LOCUS_03190 9036 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 9342 9106 gene locus_tag LOCUS_03200 9342 9106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 >Feature sequence029 503 796 gene locus_tag LOCUS_03210 503 796 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870729.1 protein_id gnl|my_center|LOCUS_03210 1007 1591 gene locus_tag LOCUS_03220 1007 1591 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060893.1 protein_id gnl|my_center|LOCUS_03220 2269 1598 gene locus_tag LOCUS_03230 2269 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 2760 2266 gene locus_tag LOCUS_03240 2760 2266 CDS product cytochrome P460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941405.1 protein_id gnl|my_center|LOCUS_03240 2839 3168 gene locus_tag LOCUS_03250 2839 3168 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785422.1 protein_id gnl|my_center|LOCUS_03250 5139 3154 gene locus_tag LOCUS_03260 gene uvrB 5139 3154 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545956.1 protein_id gnl|my_center|LOCUS_03260 6148 5285 gene locus_tag LOCUS_03270 6148 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 6824 6315 gene locus_tag LOCUS_03280 6824 6315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 6806 6988 gene locus_tag LOCUS_03290 6806 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 7163 9067 gene locus_tag LOCUS_03300 gene selB 7163 9067 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546044.1 protein_id gnl|my_center|LOCUS_03300 9064 9807 gene locus_tag LOCUS_03310 gene kdsB 9064 9807 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545187.1 protein_id gnl|my_center|LOCUS_03310 >Feature sequence030 1227 148 gene locus_tag LOCUS_03320 1227 148 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545158.1 protein_id gnl|my_center|LOCUS_03320 2213 1227 gene locus_tag LOCUS_03330 gene cbiB 2213 1227 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546383.1 protein_id gnl|my_center|LOCUS_03330 3730 2210 gene locus_tag LOCUS_03340 3730 2210 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544966.1 protein_id gnl|my_center|LOCUS_03340 4500 3727 gene locus_tag LOCUS_03350 4500 3727 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103682.1 protein_id gnl|my_center|LOCUS_03350 5581 4523 gene locus_tag LOCUS_03360 gene cobT 5581 4523 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545250.1 protein_id gnl|my_center|LOCUS_03360 6130 5594 gene locus_tag LOCUS_03370 gene cobU 6130 5594 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964692.1 protein_id gnl|my_center|LOCUS_03370 6424 6134 gene locus_tag LOCUS_03380 6424 6134 CDS product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965739.1 protein_id gnl|my_center|LOCUS_03380 7367 6873 gene locus_tag LOCUS_03390 7367 6873 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_03390 9897 7453 gene locus_tag LOCUS_03400 9897 7453 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545172.1 protein_id gnl|my_center|LOCUS_03400 10092 10168 gene locus_tag LOCUS_t00110 10092 10168 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence031 1390 191 gene locus_tag LOCUS_03410 1390 191 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939838.1 protein_id gnl|my_center|LOCUS_03410 2791 1715 gene locus_tag LOCUS_03420 2791 1715 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545833.1 protein_id gnl|my_center|LOCUS_03420 3165 2878 gene locus_tag LOCUS_03430 gene gatC 3165 2878 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_03430 5287 3179 gene locus_tag LOCUS_03440 5287 3179 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546392.1 protein_id gnl|my_center|LOCUS_03440 7174 5345 gene locus_tag LOCUS_03450 gene glmS 7174 5345 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545099.1 protein_id gnl|my_center|LOCUS_03450 8559 7186 gene locus_tag LOCUS_03460 gene glmU 8559 7186 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545497.1 protein_id gnl|my_center|LOCUS_03460 9539 8556 gene locus_tag LOCUS_03470 9539 8556 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142095.1 protein_id gnl|my_center|LOCUS_03470 9439 9690 gene locus_tag LOCUS_03480 9439 9690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 >Feature sequence032 1208 540 gene locus_tag LOCUS_03490 gene trmB 1208 540 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444815.1 protein_id gnl|my_center|LOCUS_03490 2759 1242 gene locus_tag LOCUS_03500 2759 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 3648 2809 gene locus_tag LOCUS_03510 gene ispE 3648 2809 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545467.1 protein_id gnl|my_center|LOCUS_03510 5315 3645 gene locus_tag LOCUS_03520 5315 3645 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_03520 7105 5633 gene locus_tag LOCUS_03530 7105 5633 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544976.1 protein_id gnl|my_center|LOCUS_03530 9030 7102 gene locus_tag LOCUS_03540 9030 7102 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545932.1 protein_id gnl|my_center|LOCUS_03540 9441 9058 gene locus_tag LOCUS_03550 9441 9058 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669698.1 protein_id gnl|my_center|LOCUS_03550 >Feature sequence033 2022 1531 gene locus_tag LOCUS_03560 2022 1531 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545311.1 protein_id gnl|my_center|LOCUS_03560 2511 2053 gene locus_tag LOCUS_03570 2511 2053 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943409.1 protein_id gnl|my_center|LOCUS_03570 2837 4366 gene locus_tag LOCUS_03580 gene cobA 2837 4366 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546266.1 protein_id gnl|my_center|LOCUS_03580 4359 4568 gene locus_tag LOCUS_03590 4359 4568 CDS product copper ion binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082089387.1 protein_id gnl|my_center|LOCUS_03590 6734 4674 gene locus_tag LOCUS_03600 gene pheT 6734 4674 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545282.1 protein_id gnl|my_center|LOCUS_03600 7597 6728 gene locus_tag LOCUS_03610 gene folP 7597 6728 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_03610 9468 7600 gene locus_tag LOCUS_03620 gene ftsH 9468 7600 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545429.1 protein_id gnl|my_center|LOCUS_03620 >Feature sequence034 905 462 gene locus_tag LOCUS_03630 gene rplO 905 462 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546521.1 protein_id gnl|my_center|LOCUS_03630 1116 937 gene locus_tag LOCUS_03640 gene rpmD 1116 937 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_03640 1615 1109 gene locus_tag LOCUS_03650 gene rpsE 1615 1109 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545629.1 protein_id gnl|my_center|LOCUS_03650 2064 1702 gene locus_tag LOCUS_03660 gene rplR 2064 1702 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545340.1 protein_id gnl|my_center|LOCUS_03660 2631 2086 gene locus_tag LOCUS_03670 gene rplF 2631 2086 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546082.1 protein_id gnl|my_center|LOCUS_03670 3063 2671 gene locus_tag LOCUS_03680 gene rpsH 3063 2671 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545222.1 protein_id gnl|my_center|LOCUS_03680 3258 3073 gene locus_tag LOCUS_03690 3258 3073 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258244.1 protein_id gnl|my_center|LOCUS_03690 3838 3278 gene locus_tag LOCUS_03700 gene rplE 3838 3278 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842801.1 protein_id gnl|my_center|LOCUS_03700 4158 3838 gene locus_tag LOCUS_03710 gene rplX 4158 3838 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546700.1 protein_id gnl|my_center|LOCUS_03710 4536 4168 gene locus_tag LOCUS_03720 gene rplN 4536 4168 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545550.1 protein_id gnl|my_center|LOCUS_03720 4840 4577 gene locus_tag LOCUS_03730 gene rpsQ 4840 4577 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546149.1 protein_id gnl|my_center|LOCUS_03730 5087 4875 gene locus_tag LOCUS_03740 gene rpmC 5087 4875 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544971.1 protein_id gnl|my_center|LOCUS_03740 5503 5084 gene locus_tag LOCUS_03750 gene rplP 5503 5084 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545254.1 protein_id gnl|my_center|LOCUS_03750 6170 5520 gene locus_tag LOCUS_03760 gene rpsC 6170 5520 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545204.1 protein_id gnl|my_center|LOCUS_03760 6560 6219 gene locus_tag LOCUS_03770 gene rplV 6560 6219 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546606.1 protein_id gnl|my_center|LOCUS_03770 6850 6563 gene locus_tag LOCUS_03780 gene rpsS 6850 6563 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_03780 7679 6861 gene locus_tag LOCUS_03790 gene rplB 7679 6861 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546860.1 protein_id gnl|my_center|LOCUS_03790 7977 7687 gene locus_tag LOCUS_03800 gene rplW 7977 7687 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546250.1 protein_id gnl|my_center|LOCUS_03800 8600 7974 gene locus_tag LOCUS_03810 gene rplD 8600 7974 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546805.1 protein_id gnl|my_center|LOCUS_03810 9217 8603 gene locus_tag LOCUS_03820 gene rplC 9217 8603 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545966.1 protein_id gnl|my_center|LOCUS_03820 9519 9214 gene locus_tag LOCUS_03830 gene rpsJ 9519 9214 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_03830 >Feature sequence035 1591 2985 gene locus_tag LOCUS_03840 1591 2985 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546425.1 protein_id gnl|my_center|LOCUS_03840 3751 2960 gene locus_tag LOCUS_03850 3751 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 4429 3782 gene locus_tag LOCUS_03860 4429 3782 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545579.1 protein_id gnl|my_center|LOCUS_03860 5001 4426 gene locus_tag LOCUS_03870 gene pyrE 5001 4426 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930785.1 protein_id gnl|my_center|LOCUS_03870 5978 5004 gene locus_tag LOCUS_03880 5978 5004 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_03880 6151 6864 gene locus_tag LOCUS_03890 6151 6864 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388218.1 protein_id gnl|my_center|LOCUS_03890 7521 6841 gene locus_tag LOCUS_03900 gene queC 7521 6841 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545080.1 protein_id gnl|my_center|LOCUS_03900 8678 7617 gene locus_tag LOCUS_03910 8678 7617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 >Feature sequence036 1250 87 gene locus_tag LOCUS_03920 1250 87 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545840.1 protein_id gnl|my_center|LOCUS_03920 1596 2672 gene locus_tag LOCUS_03930 gene ychF 1596 2672 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_03930 3627 2662 gene locus_tag LOCUS_03940 3627 2662 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546428.1 protein_id gnl|my_center|LOCUS_03940 4549 3629 gene locus_tag LOCUS_03950 gene bioB 4549 3629 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546730.1 protein_id gnl|my_center|LOCUS_03950 5539 4556 gene locus_tag LOCUS_03960 5539 4556 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546380.1 protein_id gnl|my_center|LOCUS_03960 5894 5526 gene locus_tag LOCUS_03970 gene rbfA 5894 5526 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545236.1 protein_id gnl|my_center|LOCUS_03970 6338 6063 gene locus_tag LOCUS_03980 6338 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 8715 6358 gene locus_tag LOCUS_03990 gene infB 8715 6358 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546130.1 protein_id gnl|my_center|LOCUS_03990 8835 9023 gene locus_tag LOCUS_04000 gene rpmB 8835 9023 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546135.1 protein_id gnl|my_center|LOCUS_04000 >Feature sequence037 902 36 gene locus_tag LOCUS_04010 gene atpG 902 36 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544924.1 protein_id gnl|my_center|LOCUS_04010 2426 918 gene locus_tag LOCUS_04020 gene atpA 2426 918 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545369.1 protein_id gnl|my_center|LOCUS_04020 3030 2482 gene locus_tag LOCUS_04030 3030 2482 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_04030 3624 3031 gene locus_tag LOCUS_04040 gene atpF 3624 3031 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545851.1 protein_id gnl|my_center|LOCUS_04040 4054 3632 gene locus_tag LOCUS_04050 4054 3632 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544957.1 protein_id gnl|my_center|LOCUS_04050 4322 4699 gene locus_tag LOCUS_04060 4322 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 5178 4990 gene locus_tag LOCUS_04070 5178 4990 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546194.1 protein_id gnl|my_center|LOCUS_04070 5287 7707 gene locus_tag LOCUS_04080 5287 7707 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005309.1 protein_id gnl|my_center|LOCUS_04080 7831 9216 gene locus_tag LOCUS_04090 7831 9216 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545017.1 protein_id gnl|my_center|LOCUS_04090 >Feature sequence038 894 2015 gene locus_tag LOCUS_04100 gene hemW 894 2015 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013191.1 protein_id gnl|my_center|LOCUS_04100 2012 3115 gene locus_tag LOCUS_04110 gene hypD 2012 3115 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072155.1 protein_id gnl|my_center|LOCUS_04110 3175 3681 gene locus_tag LOCUS_04120 3175 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 3665 4186 gene locus_tag LOCUS_04130 3665 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 4173 4904 gene locus_tag LOCUS_04140 gene lptB 4173 4904 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546539.1 protein_id gnl|my_center|LOCUS_04140 4904 6343 gene locus_tag LOCUS_04150 gene rpoN 4904 6343 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546561.1 protein_id gnl|my_center|LOCUS_04150 6384 6905 gene locus_tag LOCUS_04160 gene raiA 6384 6905 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546709.1 protein_id gnl|my_center|LOCUS_04160 6981 7817 gene locus_tag LOCUS_04170 gene rapZ 6981 7817 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545545.1 protein_id gnl|my_center|LOCUS_04170 7814 8938 gene locus_tag LOCUS_04180 7814 8938 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545327.1 protein_id gnl|my_center|LOCUS_04180 9023 9307 gene locus_tag LOCUS_04190 9023 9307 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_04190 >Feature sequence039 <1 519 gene locus_tag LOCUS_04200 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546849.1:ParB/RepB/Spo0J family partition protein 3197 861 gene locus_tag LOCUS_04210 3197 861 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546258.1 protein_id gnl|my_center|LOCUS_04210 4874 3213 gene locus_tag LOCUS_04220 4874 3213 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545407.1 protein_id gnl|my_center|LOCUS_04220 5962 4835 gene locus_tag LOCUS_04230 5962 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545929.1 protein_id gnl|my_center|LOCUS_04230 7047 6181 gene locus_tag LOCUS_04240 gene galU 7047 6181 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147293.1 protein_id gnl|my_center|LOCUS_04240 9016 7091 gene locus_tag LOCUS_04250 gene glgB 9016 7091 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_04250 >Feature sequence040 627 235 gene locus_tag LOCUS_04260 627 235 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545197.1 protein_id gnl|my_center|LOCUS_04260 1452 631 gene locus_tag LOCUS_04270 1452 631 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545471.1 protein_id gnl|my_center|LOCUS_04270 3287 1449 gene locus_tag LOCUS_04280 3287 1449 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545728.1 protein_id gnl|my_center|LOCUS_04280 4119 3376 gene locus_tag LOCUS_04290 4119 3376 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943678.1 protein_id gnl|my_center|LOCUS_04290 4976 4119 gene locus_tag LOCUS_04300 4976 4119 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943679.1 protein_id gnl|my_center|LOCUS_04300 6049 4973 gene locus_tag LOCUS_04310 gene flhF 6049 4973 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860708.1 protein_id gnl|my_center|LOCUS_04310 8075 6039 gene locus_tag LOCUS_04320 gene flhA 8075 6039 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206768427.1 protein_id gnl|my_center|LOCUS_04320 9109 8072 gene locus_tag LOCUS_04330 gene flhB 9109 8072 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545442.1 protein_id gnl|my_center|LOCUS_04330 >Feature sequence041 74 1657 gene locus_tag LOCUS_04340 gene cimA 74 1657 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546272.1 protein_id gnl|my_center|LOCUS_04340 2388 1786 gene locus_tag LOCUS_04350 2388 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 3263 2406 gene locus_tag LOCUS_04360 gene nadC 3263 2406 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_04360 3741 3265 gene locus_tag LOCUS_04370 3741 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546000.1 protein_id gnl|my_center|LOCUS_04370 6583 3743 gene locus_tag LOCUS_04380 6583 3743 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545538.1 protein_id gnl|my_center|LOCUS_04380 7835 6675 gene locus_tag LOCUS_04390 7835 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 8031 8777 gene locus_tag LOCUS_04400 gene larB 8031 8777 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_04400 >Feature sequence042 1525 365 gene locus_tag LOCUS_04410 gene bioF 1525 365 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545441.1 protein_id gnl|my_center|LOCUS_04410 1706 4192 gene locus_tag LOCUS_04420 1706 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 4192 5016 gene locus_tag LOCUS_04430 4192 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 6369 5017 gene locus_tag LOCUS_04440 gene radA 6369 5017 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545683.1 protein_id gnl|my_center|LOCUS_04440 7141 6362 gene locus_tag LOCUS_04450 gene thiD 7141 6362 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546315.1 protein_id gnl|my_center|LOCUS_04450 8097 7147 gene locus_tag LOCUS_04460 8097 7147 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546060.1 protein_id gnl|my_center|LOCUS_04460 8640 8212 gene locus_tag LOCUS_04470 8640 8212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 >Feature sequence043 736 446 gene locus_tag LOCUS_04480 736 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 2058 733 gene locus_tag LOCUS_04490 2058 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 2544 2062 gene locus_tag LOCUS_04500 2544 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 4579 2525 gene locus_tag LOCUS_04510 4579 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 5253 4579 gene locus_tag LOCUS_04520 5253 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 5598 5263 gene locus_tag LOCUS_04530 5598 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 6591 5830 gene locus_tag LOCUS_04540 6591 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 6926 6606 gene locus_tag LOCUS_04550 6926 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 7986 6946 gene locus_tag LOCUS_04560 7986 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 >Feature sequence044 1892 1452 gene locus_tag LOCUS_04570 1892 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 2182 1889 gene locus_tag LOCUS_04580 2182 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 3035 2310 gene locus_tag LOCUS_04590 3035 2310 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545556.1 protein_id gnl|my_center|LOCUS_04590 4122 3037 gene locus_tag LOCUS_04600 4122 3037 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_04600 4864 4133 gene locus_tag LOCUS_04610 4864 4133 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545249.1 protein_id gnl|my_center|LOCUS_04610 5474 4851 gene locus_tag LOCUS_04620 5474 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 6269 5481 gene locus_tag LOCUS_04630 gene flgG 6269 5481 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546478.1 protein_id gnl|my_center|LOCUS_04630 6986 6273 gene locus_tag LOCUS_04640 gene flgF 6986 6273 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_04640 7559 7197 gene locus_tag LOCUS_04650 7559 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 7748 7587 gene locus_tag LOCUS_04660 7748 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 8605 7757 gene locus_tag LOCUS_04670 8605 7757 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943642.1 protein_id gnl|my_center|LOCUS_04670 >Feature sequence045 <1 1404 gene locus_tag LOCUS_04680 <1 1404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_072774229.1:ABC transporter permease 2487 1405 gene locus_tag LOCUS_04690 2487 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 3254 2706 gene locus_tag LOCUS_04700 3254 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 3762 3232 gene locus_tag LOCUS_04710 3762 3232 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931087.1 protein_id gnl|my_center|LOCUS_04710 3749 3913 gene locus_tag LOCUS_04720 3749 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 3921 4673 gene locus_tag LOCUS_04730 3921 4673 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937943.1 protein_id gnl|my_center|LOCUS_04730 4676 5422 gene locus_tag LOCUS_04740 4676 5422 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870067.1 protein_id gnl|my_center|LOCUS_04740 5843 6109 gene locus_tag LOCUS_04750 5843 6109 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546699.1 protein_id gnl|my_center|LOCUS_04750 6102 6311 gene locus_tag LOCUS_04760 6102 6311 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_04760 6983 6327 gene locus_tag LOCUS_04770 6983 6327 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545723.1 protein_id gnl|my_center|LOCUS_04770 7052 8176 gene locus_tag LOCUS_04780 7052 8176 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545013.1 protein_id gnl|my_center|LOCUS_04780 <8756 8187 gene locus_tag LOCUS_04790 <8756 8187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924808.1:NAD(P)H-hydrate dehydratase >Feature sequence046 3192 397 gene locus_tag LOCUS_04800 3192 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 4048 3194 gene locus_tag LOCUS_04810 4048 3194 CDS product UbiA-like polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205587.1 protein_id gnl|my_center|LOCUS_04810 4402 4052 gene locus_tag LOCUS_04820 4402 4052 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878413.1 protein_id gnl|my_center|LOCUS_04820 4889 4404 gene locus_tag LOCUS_04830 gene ilvN 4889 4404 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545180.1 protein_id gnl|my_center|LOCUS_04830 6636 4900 gene locus_tag LOCUS_04840 gene ilvB 6636 4900 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_04840 7475 6783 gene locus_tag LOCUS_04850 7475 6783 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_04850 <8715 7476 gene locus_tag LOCUS_04860 <8715 7476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462155.1:DUF3365 domain-containing protein >Feature sequence047 328 1416 gene locus_tag LOCUS_04870 gene prfB 328 1416 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205591.1 protein_id gnl|my_center|LOCUS_04870 1742 3076 gene locus_tag LOCUS_04880 gene dnaA 1742 3076 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545093.1 protein_id gnl|my_center|LOCUS_04880 3202 4308 gene locus_tag LOCUS_04890 gene dnaN 3202 4308 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546822.1 protein_id gnl|my_center|LOCUS_04890 4322 6736 gene locus_tag LOCUS_04900 gene gyrB 4322 6736 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_04900 6860 7510 gene locus_tag LOCUS_04910 gene tolQ 6860 7510 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924836.1 protein_id gnl|my_center|LOCUS_04910 7510 7908 gene locus_tag LOCUS_04920 gene tolR 7510 7908 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546534.1 protein_id gnl|my_center|LOCUS_04920 7908 8627 gene locus_tag LOCUS_04930 7908 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 >Feature sequence048 <1 1217 gene locus_tag LOCUS_04940 <1 1217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942515.1:sensor domain-containing diguanylate cyclase 1288 3960 gene locus_tag LOCUS_04950 1288 3960 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546426.1 protein_id gnl|my_center|LOCUS_04950 4751 4089 gene locus_tag LOCUS_04960 4751 4089 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545229.1 protein_id gnl|my_center|LOCUS_04960 6137 4815 gene locus_tag LOCUS_04970 6137 4815 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546863.1 protein_id gnl|my_center|LOCUS_04970 6574 6137 gene locus_tag LOCUS_04980 6574 6137 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546553.1 protein_id gnl|my_center|LOCUS_04980 6948 6571 gene locus_tag LOCUS_04990 gene rsfS 6948 6571 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_04990 7703 7041 gene locus_tag LOCUS_05000 gene nadD 7703 7041 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841927.1 protein_id gnl|my_center|LOCUS_05000 8241 7693 gene locus_tag LOCUS_05010 gene cyaB 8241 7693 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120856.1 protein_id gnl|my_center|LOCUS_05010 >Feature sequence049 3797 1182 gene locus_tag LOCUS_05020 gene alaS 3797 1182 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545089.1 protein_id gnl|my_center|LOCUS_05020 4361 4020 gene locus_tag LOCUS_05030 4361 4020 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546204.1 protein_id gnl|my_center|LOCUS_05030 4822 4358 gene locus_tag LOCUS_05040 4822 4358 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940823.1 protein_id gnl|my_center|LOCUS_05040 5951 4803 gene locus_tag LOCUS_05050 5951 4803 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_05050 6948 5938 gene locus_tag LOCUS_05060 gene recA 6948 5938 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546028.1 protein_id gnl|my_center|LOCUS_05060 7513 6941 gene locus_tag LOCUS_05070 gene thpR 7513 6941 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392592.1 protein_id gnl|my_center|LOCUS_05070 7995 7510 gene locus_tag LOCUS_05080 7995 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 8450 8001 gene locus_tag LOCUS_05090 8450 8001 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546233.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence050 552 301 gene locus_tag LOCUS_05100 552 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 2619 667 gene locus_tag LOCUS_05110 2619 667 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870173.1 protein_id gnl|my_center|LOCUS_05110 3416 2703 gene locus_tag LOCUS_05120 3416 2703 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546015.1 protein_id gnl|my_center|LOCUS_05120 5308 3413 gene locus_tag LOCUS_05130 5308 3413 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545360.1 protein_id gnl|my_center|LOCUS_05130 6984 5611 gene locus_tag LOCUS_05140 6984 5611 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545848.1 protein_id gnl|my_center|LOCUS_05140 <8495 6977 gene locus_tag LOCUS_05150 <8495 6977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113915.1:two-component system sensor histidine kinase CbrA >Feature sequence051 152 745 gene locus_tag LOCUS_05160 gene yedF 152 745 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546665.1 protein_id gnl|my_center|LOCUS_05160 2669 723 gene locus_tag LOCUS_05170 2669 723 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546396.1 protein_id gnl|my_center|LOCUS_05170 3636 2674 gene locus_tag LOCUS_05180 3636 2674 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546588.1 protein_id gnl|my_center|LOCUS_05180 4699 3650 gene locus_tag LOCUS_05190 gene mqnC 4699 3650 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545015.1 protein_id gnl|my_center|LOCUS_05190 5775 4696 gene locus_tag LOCUS_05200 gene mqnE 5775 4696 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546001.1 protein_id gnl|my_center|LOCUS_05200 6909 5797 gene locus_tag LOCUS_05210 6909 5797 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942515.1 protein_id gnl|my_center|LOCUS_05210 7892 6906 gene locus_tag LOCUS_05220 7892 6906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 8117 7893 gene locus_tag LOCUS_05230 8117 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence052 608 1405 gene locus_tag LOCUS_05240 608 1405 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868514.1 protein_id gnl|my_center|LOCUS_05240 1405 2199 gene locus_tag LOCUS_05250 1405 2199 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544975.1 protein_id gnl|my_center|LOCUS_05250 2419 2982 gene locus_tag LOCUS_05260 gene ruvA 2419 2982 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_05260 2993 4006 gene locus_tag LOCUS_05270 gene ruvB 2993 4006 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546115.1 protein_id gnl|my_center|LOCUS_05270 4051 6603 gene locus_tag LOCUS_05280 4051 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 7616 6606 gene locus_tag LOCUS_05290 gene tsaD 7616 6606 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546527.1 protein_id gnl|my_center|LOCUS_05290 <8202 7616 gene locus_tag LOCUS_05300 <8202 7616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001295343.1:outer membrane lipoprotein chaperone LolA >Feature sequence053 942 505 gene locus_tag LOCUS_05310 942 505 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545112.1 protein_id gnl|my_center|LOCUS_05310 2985 1036 gene locus_tag LOCUS_05320 2985 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 3097 4443 gene locus_tag LOCUS_05330 gene trkA 3097 4443 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_05330 4445 5893 gene locus_tag LOCUS_05340 4445 5893 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545413.1 protein_id gnl|my_center|LOCUS_05340 5899 7131 gene locus_tag LOCUS_05350 5899 7131 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 protein_id gnl|my_center|LOCUS_05350 7118 7909 gene locus_tag LOCUS_05360 7118 7909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 >Feature sequence054 501 196 gene locus_tag LOCUS_05370 501 196 CDS product alanine-zipper protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545139.1 protein_id gnl|my_center|LOCUS_05370 3311 591 gene locus_tag LOCUS_05380 gene ppdK 3311 591 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_05380 3425 6004 gene locus_tag LOCUS_05390 gene mutS 3425 6004 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545203.1 protein_id gnl|my_center|LOCUS_05390 6004 6579 gene locus_tag LOCUS_05400 gene coaE 6004 6579 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546225.1 protein_id gnl|my_center|LOCUS_05400 6555 7676 gene locus_tag LOCUS_05410 6555 7676 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880235.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence055 1312 230 gene locus_tag LOCUS_05420 gene mraY 1312 230 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545877.1 protein_id gnl|my_center|LOCUS_05420 2667 1312 gene locus_tag LOCUS_05430 2667 1312 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545266.1 protein_id gnl|my_center|LOCUS_05430 4202 2664 gene locus_tag LOCUS_05440 4202 2664 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546153.1 protein_id gnl|my_center|LOCUS_05440 5919 4189 gene locus_tag LOCUS_05450 5919 4189 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545621.1 protein_id gnl|my_center|LOCUS_05450 6435 6100 gene locus_tag LOCUS_05460 6435 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 7322 6432 gene locus_tag LOCUS_05470 gene rsmH 7322 6432 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545268.1 protein_id gnl|my_center|LOCUS_05470 7783 7331 gene locus_tag LOCUS_05480 gene mraZ 7783 7331 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545651.1 protein_id gnl|my_center|LOCUS_05480 >Feature sequence056 2141 1134 gene locus_tag LOCUS_05490 gene waaC 2141 1134 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_05490 3052 2138 gene locus_tag LOCUS_05500 3052 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 3317 4486 gene locus_tag LOCUS_05510 3317 4486 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545784.1 protein_id gnl|my_center|LOCUS_05510 4553 5248 gene locus_tag LOCUS_05520 4553 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 5259 6380 gene locus_tag LOCUS_05530 5259 6380 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546360.1 protein_id gnl|my_center|LOCUS_05530 6642 7004 gene locus_tag LOCUS_05540 6642 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 <7943 7073 gene locus_tag LOCUS_05550 <7943 7073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546747.1:AmmeMemoRadiSam system radical SAM enzyme >Feature sequence057 1255 227 gene locus_tag LOCUS_05560 gene mnmA 1255 227 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_05560 3286 1502 gene locus_tag LOCUS_05570 gene aspS 3286 1502 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546812.1 protein_id gnl|my_center|LOCUS_05570 4044 3313 gene locus_tag LOCUS_05580 4044 3313 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544927.1 protein_id gnl|my_center|LOCUS_05580 >Feature sequence058 327 1172 gene locus_tag LOCUS_05590 327 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 1169 2671 gene locus_tag LOCUS_05600 1169 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 2671 4188 gene locus_tag LOCUS_05610 2671 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 4185 6059 gene locus_tag LOCUS_05620 4185 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 6046 7392 gene locus_tag LOCUS_05630 6046 7392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 >Feature sequence059 353 2488 gene locus_tag LOCUS_05640 353 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 2452 3213 gene locus_tag LOCUS_05650 gene rlmB 2452 3213 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546281.1 protein_id gnl|my_center|LOCUS_05650 3335 6127 gene locus_tag LOCUS_05660 gene ileS 3335 6127 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546193.1 protein_id gnl|my_center|LOCUS_05660 6127 6618 gene locus_tag LOCUS_05670 gene lspA 6127 6618 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546319.1 protein_id gnl|my_center|LOCUS_05670 7041 6622 gene locus_tag LOCUS_05680 7041 6622 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_05680 <7876 7316 gene locus_tag LOCUS_05690 <7876 7316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940338.1:VOC family protein >Feature sequence060 <1 1500 gene locus_tag LOCUS_05700 <1 1500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545417.1:ATP-dependent DNA helicase RecG 1613 1942 gene locus_tag LOCUS_05710 1613 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 1939 2703 gene locus_tag LOCUS_05720 1939 2703 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546828.1 protein_id gnl|my_center|LOCUS_05720 2860 4236 gene locus_tag LOCUS_05730 gene hemG 2860 4236 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545161.1 protein_id gnl|my_center|LOCUS_05730 4252 4482 gene locus_tag LOCUS_05740 4252 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 4670 6322 gene locus_tag LOCUS_05750 gene ilvD 4670 6322 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546643.1 protein_id gnl|my_center|LOCUS_05750 6330 6788 gene locus_tag LOCUS_05760 6330 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 6770 7129 gene locus_tag LOCUS_05770 6770 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 7150 7668 gene locus_tag LOCUS_05780 7150 7668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 >Feature sequence061 <1 2760 gene locus_tag LOCUS_05790 <1 2760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546879.1:carbamoyl-phosphate synthase large subunit 3360 2776 gene locus_tag LOCUS_05800 3360 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 4646 3357 gene locus_tag LOCUS_05810 gene hisD 4646 3357 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546313.1 protein_id gnl|my_center|LOCUS_05810 5721 4675 gene locus_tag LOCUS_05820 5721 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545890.1 protein_id gnl|my_center|LOCUS_05820 5826 6704 gene locus_tag LOCUS_05830 5826 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 6704 6868 gene locus_tag LOCUS_05840 6704 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546002.1 protein_id gnl|my_center|LOCUS_05840 6913 7053 gene locus_tag LOCUS_05850 6913 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 <7763 7059 gene locus_tag LOCUS_05860 <7763 7059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074212.1:polysaccharide deacetylase family protein >Feature sequence062 739 2037 gene locus_tag LOCUS_05870 739 2037 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545411.1 protein_id gnl|my_center|LOCUS_05870 2772 2068 gene locus_tag LOCUS_05880 2772 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 4146 2827 gene locus_tag LOCUS_05890 4146 2827 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 protein_id gnl|my_center|LOCUS_05890 4356 4829 gene locus_tag LOCUS_05900 gene greA 4356 4829 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545525.1 protein_id gnl|my_center|LOCUS_05900 4822 5577 gene locus_tag LOCUS_05910 4822 5577 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546654.1 protein_id gnl|my_center|LOCUS_05910 5577 6506 gene locus_tag LOCUS_05920 5577 6506 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545671.1 protein_id gnl|my_center|LOCUS_05920 6476 7270 gene locus_tag LOCUS_05930 6476 7270 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842665.1 protein_id gnl|my_center|LOCUS_05930 >Feature sequence063 425 1609 gene locus_tag LOCUS_05940 425 1609 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942127.1 protein_id gnl|my_center|LOCUS_05940 1628 3151 gene locus_tag LOCUS_05950 1628 3151 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546639.1 protein_id gnl|my_center|LOCUS_05950 3239 5056 gene locus_tag LOCUS_05960 3239 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 5075 6136 gene locus_tag LOCUS_05970 gene mtnA 5075 6136 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546184.1 protein_id gnl|my_center|LOCUS_05970 6546 6133 gene locus_tag LOCUS_05980 6546 6133 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250023.1 protein_id gnl|my_center|LOCUS_05980 6868 6530 gene locus_tag LOCUS_05990 6868 6530 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546786.1 protein_id gnl|my_center|LOCUS_05990 7069 6905 gene locus_tag LOCUS_06000 7069 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 7211 7468 gene locus_tag LOCUS_06010 7211 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 >Feature sequence064 <1 524 gene locus_tag LOCUS_06020 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545000.1:twin-arginine translocase subunit TatC 505 783 gene locus_tag LOCUS_06030 505 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546054.1 protein_id gnl|my_center|LOCUS_06030 785 2422 gene locus_tag LOCUS_06040 785 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 2409 3809 gene locus_tag LOCUS_06050 2409 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 4329 3981 gene locus_tag LOCUS_tm00010 4329 3981 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 5346 4900 gene locus_tag LOCUS_06060 gene smpB 5346 4900 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_06060 5482 5811 gene locus_tag LOCUS_06070 5482 5811 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460053.1 protein_id gnl|my_center|LOCUS_06070 5811 7511 gene locus_tag LOCUS_06080 5811 7511 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545510.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence065 115 1359 gene locus_tag LOCUS_06090 115 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 1967 1347 gene locus_tag LOCUS_06100 1967 1347 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545248.1 protein_id gnl|my_center|LOCUS_06100 2518 1967 gene locus_tag LOCUS_06110 2518 1967 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941667.1 protein_id gnl|my_center|LOCUS_06110 3230 2520 gene locus_tag LOCUS_06120 3230 2520 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942367.1 protein_id gnl|my_center|LOCUS_06120 3631 3227 gene locus_tag LOCUS_06130 3631 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 3841 3674 gene locus_tag LOCUS_06140 3841 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 3768 4706 gene locus_tag LOCUS_06150 3768 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546406.1 protein_id gnl|my_center|LOCUS_06150 4703 5350 gene locus_tag LOCUS_06160 gene tmk 4703 5350 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence066 1557 49 gene locus_tag LOCUS_06170 1557 49 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545360.1 protein_id gnl|my_center|LOCUS_06170 1999 1739 gene locus_tag LOCUS_06180 gene rpmA 1999 1739 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545975.1 protein_id gnl|my_center|LOCUS_06180 2319 2002 gene locus_tag LOCUS_06190 gene rplU 2319 2002 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048023.1 protein_id gnl|my_center|LOCUS_06190 3111 2434 gene locus_tag LOCUS_06200 3111 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 3948 3145 gene locus_tag LOCUS_06210 gene amrB 3948 3145 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545930.1 protein_id gnl|my_center|LOCUS_06210 5315 3948 gene locus_tag LOCUS_06220 gene dnaB 5315 3948 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546182.1 protein_id gnl|my_center|LOCUS_06220 5869 5423 gene locus_tag LOCUS_06230 gene rplI 5869 5423 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_06230 7034 5940 gene locus_tag LOCUS_06240 7034 5940 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060968.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence067 <1 1428 gene locus_tag LOCUS_06250 <1 1428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942299.1:response regulator 1994 2908 gene locus_tag LOCUS_06260 gene hemB 1994 2908 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546067.1 protein_id gnl|my_center|LOCUS_06260 3090 5516 gene locus_tag LOCUS_06270 gene gyrA 3090 5516 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545423.1 protein_id gnl|my_center|LOCUS_06270 5523 6509 gene locus_tag LOCUS_06280 gene holB 5523 6509 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545713.1 protein_id gnl|my_center|LOCUS_06280 >Feature sequence068 633 22 gene locus_tag LOCUS_06290 633 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 723 1916 gene locus_tag LOCUS_06300 723 1916 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_06300 2847 1897 gene locus_tag LOCUS_06310 2847 1897 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545382.1 protein_id gnl|my_center|LOCUS_06310 3008 3151 gene locus_tag LOCUS_06320 3008 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 4092 3157 gene locus_tag LOCUS_06330 4092 3157 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544990.1 protein_id gnl|my_center|LOCUS_06330 4740 4111 gene locus_tag LOCUS_06340 gene thiE 4740 4111 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545043.1 protein_id gnl|my_center|LOCUS_06340 6150 4744 gene locus_tag LOCUS_06350 6150 4744 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942936.1 protein_id gnl|my_center|LOCUS_06350 6566 6790 gene locus_tag LOCUS_06360 6566 6790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 6790 7029 gene locus_tag LOCUS_06370 6790 7029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 >Feature sequence069 2765 1386 gene locus_tag LOCUS_06380 gene lpdA 2765 1386 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436922.1 protein_id gnl|my_center|LOCUS_06380 3151 2762 gene locus_tag LOCUS_06390 gene gcvH 3151 2762 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545115.1 protein_id gnl|my_center|LOCUS_06390 6309 3313 gene locus_tag LOCUS_06400 6309 3313 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725349.1 protein_id gnl|my_center|LOCUS_06400 >Feature sequence070 351 983 gene locus_tag LOCUS_06410 351 983 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_06410 962 1813 gene locus_tag LOCUS_06420 962 1813 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 protein_id gnl|my_center|LOCUS_06420 1810 2037 gene locus_tag LOCUS_06430 1810 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 2358 2053 gene locus_tag LOCUS_06440 2358 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 2648 3466 gene locus_tag LOCUS_06450 gene rpsB 2648 3466 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_06450 3463 4065 gene locus_tag LOCUS_06460 gene tsf 3463 4065 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545220.1 protein_id gnl|my_center|LOCUS_06460 4043 4780 gene locus_tag LOCUS_06470 gene pyrH 4043 4780 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546671.1 protein_id gnl|my_center|LOCUS_06470 4805 5362 gene locus_tag LOCUS_06480 gene frr 4805 5362 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545660.1 protein_id gnl|my_center|LOCUS_06480 5449 5607 gene locus_tag LOCUS_06490 5449 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 5585 6049 gene locus_tag LOCUS_06500 5585 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 6861 6046 gene locus_tag LOCUS_06510 gene truA 6861 6046 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_06510 >Feature sequence071 541 113 gene locus_tag LOCUS_06520 541 113 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094555.1 protein_id gnl|my_center|LOCUS_06520 975 538 gene locus_tag LOCUS_06530 975 538 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065983.1 protein_id gnl|my_center|LOCUS_06530 1248 3293 gene locus_tag LOCUS_06540 1248 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 4820 3306 gene locus_tag LOCUS_06550 gene waaF 4820 3306 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544960.1 protein_id gnl|my_center|LOCUS_06550 4980 5189 gene locus_tag LOCUS_06560 4980 5189 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546429.1 protein_id gnl|my_center|LOCUS_06560 5252 6097 gene locus_tag LOCUS_06570 gene lipA 5252 6097 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_06570 6360 7034 gene locus_tag LOCUS_06580 6360 7034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence072 570 1235 gene locus_tag LOCUS_06590 570 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 1251 2642 gene locus_tag LOCUS_06600 gene norB 1251 2642 CDS product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 protein_id gnl|my_center|LOCUS_06600 2699 2929 gene locus_tag LOCUS_06610 2699 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 2984 3949 gene locus_tag LOCUS_06620 2984 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 4141 5046 gene locus_tag LOCUS_06630 4141 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 5960 5052 gene locus_tag LOCUS_06640 5960 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 6787 5957 gene locus_tag LOCUS_06650 6787 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 >Feature sequence073 982 704 gene locus_tag LOCUS_06660 982 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 1855 986 gene locus_tag LOCUS_06670 gene dapF 1855 986 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546632.1 protein_id gnl|my_center|LOCUS_06670 3115 1859 gene locus_tag LOCUS_06680 gene lysA 3115 1859 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_06680 3296 6922 gene locus_tag LOCUS_06690 3296 6922 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930621.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence074 <1 677 gene locus_tag LOCUS_06700 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002379340.1:cell wall metabolism sensor histidine kinase WalK 674 1369 gene locus_tag LOCUS_06710 674 1369 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178201.1 protein_id gnl|my_center|LOCUS_06710 2165 1917 gene locus_tag LOCUS_06720 2165 1917 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545287.1 protein_id gnl|my_center|LOCUS_06720 2680 2168 gene locus_tag LOCUS_06730 2680 2168 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842874.1 protein_id gnl|my_center|LOCUS_06730 3589 2927 gene locus_tag LOCUS_06740 gene cybH 3589 2927 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940797.1 protein_id gnl|my_center|LOCUS_06740 5100 3604 gene locus_tag LOCUS_06750 5100 3604 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940798.1 protein_id gnl|my_center|LOCUS_06750 5313 5134 gene locus_tag LOCUS_06760 5313 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06760 6443 5346 gene locus_tag LOCUS_06770 6443 5346 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940799.1 protein_id gnl|my_center|LOCUS_06770 >Feature sequence075 316 1638 gene locus_tag LOCUS_06780 316 1638 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_06780 2031 3242 gene locus_tag LOCUS_06790 2031 3242 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_06790 3570 4592 gene locus_tag LOCUS_06800 3570 4592 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545596.1 protein_id gnl|my_center|LOCUS_06800 4586 5251 gene locus_tag LOCUS_06810 4586 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 5248 6468 gene locus_tag LOCUS_06820 5248 6468 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978370.1 protein_id gnl|my_center|LOCUS_06820 >Feature sequence076 403 1386 gene locus_tag LOCUS_06830 403 1386 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546641.1 protein_id gnl|my_center|LOCUS_06830 1387 1815 gene locus_tag LOCUS_06840 1387 1815 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545605.1 protein_id gnl|my_center|LOCUS_06840 2362 1964 gene locus_tag LOCUS_06850 gene rplQ 2362 1964 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545032.1 protein_id gnl|my_center|LOCUS_06850 3382 2366 gene locus_tag LOCUS_06860 3382 2366 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546042.1 protein_id gnl|my_center|LOCUS_06860 4242 3616 gene locus_tag LOCUS_06870 gene rpsD 4242 3616 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545818.1 protein_id gnl|my_center|LOCUS_06870 4635 4246 gene locus_tag LOCUS_06880 gene rpsK 4635 4246 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545788.1 protein_id gnl|my_center|LOCUS_06880 5012 4635 gene locus_tag LOCUS_06890 gene rpsM 5012 4635 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544955.1 protein_id gnl|my_center|LOCUS_06890 5413 5195 gene locus_tag LOCUS_06900 gene infA 5413 5195 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546095.1 protein_id gnl|my_center|LOCUS_06900 6188 5436 gene locus_tag LOCUS_06910 gene map 6188 5436 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence077 168 1583 gene locus_tag LOCUS_06920 168 1583 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_06920 1688 3454 gene locus_tag LOCUS_06930 1688 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 3454 4641 gene locus_tag LOCUS_06940 3454 4641 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545659.1 protein_id gnl|my_center|LOCUS_06940 4638 5963 gene locus_tag LOCUS_06950 4638 5963 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842237.1 protein_id gnl|my_center|LOCUS_06950 6065 6433 gene locus_tag LOCUS_06960 gene flgB 6065 6433 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880746.1 protein_id gnl|my_center|LOCUS_06960 >Feature sequence078 <1 1156 gene locus_tag LOCUS_06970 <1 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106007160.1:PocR ligand-binding domain-containing protein 1146 1907 gene locus_tag LOCUS_06980 1146 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 1911 2666 gene locus_tag LOCUS_06990 1911 2666 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545908.1 protein_id gnl|my_center|LOCUS_06990 2663 3340 gene locus_tag LOCUS_07000 2663 3340 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545014.1 protein_id gnl|my_center|LOCUS_07000 3494 5410 gene locus_tag LOCUS_07010 3494 5410 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257267.1 protein_id gnl|my_center|LOCUS_07010 5407 6510 gene locus_tag LOCUS_07020 5407 6510 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546236.1 protein_id gnl|my_center|LOCUS_07020 >Feature sequence079 130 1731 gene locus_tag LOCUS_07030 130 1731 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793021.1 protein_id gnl|my_center|LOCUS_07030 1928 3064 gene locus_tag LOCUS_07040 1928 3064 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545303.1 protein_id gnl|my_center|LOCUS_07040 3821 3069 gene locus_tag LOCUS_07050 3821 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 3942 4604 gene locus_tag LOCUS_07060 gene ftsE 3942 4604 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361935.1 protein_id gnl|my_center|LOCUS_07060 4609 5478 gene locus_tag LOCUS_07070 gene ftsX 4609 5478 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942418.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence080 2024 1839 gene locus_tag LOCUS_07080 2024 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 2176 3171 gene locus_tag LOCUS_07090 2176 3171 CDS product NrpR regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546211.1 protein_id gnl|my_center|LOCUS_07090 3176 4537 gene locus_tag LOCUS_07100 gene bioA 3176 4537 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546209.1 protein_id gnl|my_center|LOCUS_07100 5735 4581 gene locus_tag LOCUS_07110 5735 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 <6649 5732 gene locus_tag LOCUS_07120 <6649 5732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000958453.1:O-antigen ligase RfaL >Feature sequence081 <1 1252 gene locus_tag LOCUS_07130 <1 1252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546857.1:outer membrane protein assembly factor BamA 1305 1838 gene locus_tag LOCUS_07140 1305 1838 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942907.1 protein_id gnl|my_center|LOCUS_07140 1835 2875 gene locus_tag LOCUS_07150 gene lpxD 1835 2875 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546116.1 protein_id gnl|my_center|LOCUS_07150 2868 3302 gene locus_tag LOCUS_07160 gene fabZ 2868 3302 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545346.1 protein_id gnl|my_center|LOCUS_07160 3302 4111 gene locus_tag LOCUS_07170 gene lpxA 3302 4111 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_07170 4074 4931 gene locus_tag LOCUS_07180 gene lpxI 4074 4931 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_07180 5020 6600 gene locus_tag LOCUS_07190 gene nadB 5020 6600 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545397.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence082 2813 1746 gene locus_tag LOCUS_07200 2813 1746 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940905.1 protein_id gnl|my_center|LOCUS_07200 4670 2826 gene locus_tag LOCUS_07210 4670 2826 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940906.1 protein_id gnl|my_center|LOCUS_07210 5183 4800 gene locus_tag LOCUS_07220 5183 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 5902 5183 gene locus_tag LOCUS_07230 5902 5183 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_07230 6483 5977 gene locus_tag LOCUS_07240 6483 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 >Feature sequence083 1301 309 gene locus_tag LOCUS_07250 1301 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 3016 1724 gene locus_tag LOCUS_07260 3016 1724 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326690.1 protein_id gnl|my_center|LOCUS_07260 3573 3013 gene locus_tag LOCUS_07270 3573 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 4374 3601 gene locus_tag LOCUS_07280 gene fabL 4374 3601 CDS product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946107.1 protein_id gnl|my_center|LOCUS_07280 4637 5602 gene locus_tag LOCUS_07290 4637 5602 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914065.1 protein_id gnl|my_center|LOCUS_07290 6258 5614 gene locus_tag LOCUS_07300 6258 5614 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_07300 6569 6342 gene locus_tag LOCUS_07310 gene atpE 6569 6342 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941001.1 protein_id gnl|my_center|LOCUS_07310 >Feature sequence084 1325 219 gene locus_tag LOCUS_07320 1325 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 3525 1543 gene locus_tag LOCUS_07330 3525 1543 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480299.1 protein_id gnl|my_center|LOCUS_07330 3929 3522 gene locus_tag LOCUS_07340 3929 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 4550 3942 gene locus_tag LOCUS_07350 4550 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 5614 4547 gene locus_tag LOCUS_07360 5614 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence085 3 1097 gene locus_tag LOCUS_07370 gene pheA 3 1097 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546845.1 protein_id gnl|my_center|LOCUS_07370 1094 2179 gene locus_tag LOCUS_07380 gene hisC 1094 2179 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546009.1 protein_id gnl|my_center|LOCUS_07380 2181 3206 gene locus_tag LOCUS_07390 gene aroF 2181 3206 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_07390 3210 4070 gene locus_tag LOCUS_07400 3210 4070 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_07400 4073 5362 gene locus_tag LOCUS_07410 gene aroA 4073 5362 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545275.1 protein_id gnl|my_center|LOCUS_07410 <6500 5403 gene locus_tag LOCUS_07420 <6500 5403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546334.1:rod shape-determining protein RodA >Feature sequence086 2559 271 gene locus_tag LOCUS_07430 2559 271 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545711.1 protein_id gnl|my_center|LOCUS_07430 2957 2559 gene locus_tag LOCUS_07440 2957 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 3326 2967 gene locus_tag LOCUS_07450 3326 2967 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545359.1 protein_id gnl|my_center|LOCUS_07450 4598 3333 gene locus_tag LOCUS_07460 4598 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 4971 4651 gene locus_tag LOCUS_07470 4971 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 6315 5038 gene locus_tag LOCUS_07480 gene eno 6315 5038 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_07480 >Feature sequence087 2122 1571 gene locus_tag LOCUS_07490 2122 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 4254 2224 gene locus_tag LOCUS_07500 4254 2224 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_07500 6007 4268 gene locus_tag LOCUS_07510 6007 4268 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943144.1 protein_id gnl|my_center|LOCUS_07510 >Feature sequence088 1889 366 gene locus_tag LOCUS_07520 1889 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 2285 3313 gene locus_tag LOCUS_07530 2285 3313 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545439.1 protein_id gnl|my_center|LOCUS_07530 3404 4231 gene locus_tag LOCUS_07540 gene mreC 3404 4231 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546337.1 protein_id gnl|my_center|LOCUS_07540 4218 4682 gene locus_tag LOCUS_07550 4218 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 4723 6420 gene locus_tag LOCUS_07560 gene mrdA 4723 6420 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545126.1 protein_id gnl|my_center|LOCUS_07560 >Feature sequence089 1886 717 gene locus_tag LOCUS_07570 1886 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 2067 2534 gene locus_tag LOCUS_07580 2067 2534 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545419.1 protein_id gnl|my_center|LOCUS_07580 2541 3377 gene locus_tag LOCUS_07590 2541 3377 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_07590 4985 3384 gene locus_tag LOCUS_07600 4985 3384 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_07600 5805 4999 gene locus_tag LOCUS_07610 5805 4999 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545170.1 protein_id gnl|my_center|LOCUS_07610 <6397 5879 gene locus_tag LOCUS_07620 <6397 5879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583310.1:beta-ketoacyl-ACP synthase II >Feature sequence090 558 1292 gene locus_tag LOCUS_07630 gene fabG 558 1292 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546317.1 protein_id gnl|my_center|LOCUS_07630 1378 1614 gene locus_tag LOCUS_07640 gene acpP 1378 1614 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545237.1 protein_id gnl|my_center|LOCUS_07640 1708 2967 gene locus_tag LOCUS_07650 gene fabF 1708 2967 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_07650 2930 3646 gene locus_tag LOCUS_07660 gene rnc 2930 3646 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557292.1 protein_id gnl|my_center|LOCUS_07660 4845 3643 gene locus_tag LOCUS_07670 4845 3643 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924850.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence091 <1 706 gene locus_tag LOCUS_07680 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000845048.1:class 1 integron integrase IntI1 803 1786 gene locus_tag LOCUS_07690 gene trpS 803 1786 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546811.1 protein_id gnl|my_center|LOCUS_07690 2743 1796 gene locus_tag LOCUS_07700 gene pdxA 2743 1796 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545509.1 protein_id gnl|my_center|LOCUS_07700 2810 3919 gene locus_tag LOCUS_07710 gene tgt 2810 3919 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546567.1 protein_id gnl|my_center|LOCUS_07710 5130 3943 gene locus_tag LOCUS_07720 5130 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 5810 5190 gene locus_tag LOCUS_07730 5810 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 5870 6067 gene locus_tag LOCUS_07740 5870 6067 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943901.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence092 611 258 gene locus_tag LOCUS_07750 611 258 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965070.1 protein_id gnl|my_center|LOCUS_07750 739 2070 gene locus_tag LOCUS_07760 739 2070 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545535.1 protein_id gnl|my_center|LOCUS_07760 2302 3771 gene locus_tag LOCUS_07770 2302 3771 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666069.1 protein_id gnl|my_center|LOCUS_07770 3768 6044 gene locus_tag LOCUS_07780 3768 6044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence093 <1 2055 gene locus_tag LOCUS_07790 <1 2055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546362.1:formate dehydrogenase-N subunit alpha 2068 2874 gene locus_tag LOCUS_07800 2068 2874 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545194.1 protein_id gnl|my_center|LOCUS_07800 2874 3488 gene locus_tag LOCUS_07810 2874 3488 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880649.1 protein_id gnl|my_center|LOCUS_07810 3566 3754 gene locus_tag LOCUS_07820 3566 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 3764 5197 gene locus_tag LOCUS_07830 3764 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 5200 5955 gene locus_tag LOCUS_07840 gene fdhE 5200 5955 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544950.1 protein_id gnl|my_center|LOCUS_07840 >Feature sequence094 91 255 gene locus_tag LOCUS_07850 91 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 271 684 gene locus_tag LOCUS_07860 271 684 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582438.1 protein_id gnl|my_center|LOCUS_07860 693 857 gene locus_tag LOCUS_07870 693 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 857 1348 gene locus_tag LOCUS_07880 857 1348 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546005.1 protein_id gnl|my_center|LOCUS_07880 1507 2721 gene locus_tag LOCUS_07890 1507 2721 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943906.1 protein_id gnl|my_center|LOCUS_07890 2768 2899 gene locus_tag LOCUS_07900 2768 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 2987 3466 gene locus_tag LOCUS_07910 2987 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 3668 4042 gene locus_tag LOCUS_07920 3668 4042 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279208.1 protein_id gnl|my_center|LOCUS_07920 4078 4269 gene locus_tag LOCUS_07930 4078 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 4300 4476 gene locus_tag LOCUS_07940 4300 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07940 4486 4917 gene locus_tag LOCUS_07950 4486 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07950 4973 5728 gene locus_tag LOCUS_07960 4973 5728 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875755.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence095 2293 1370 gene locus_tag LOCUS_07970 2293 1370 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393378.1 protein_id gnl|my_center|LOCUS_07970 2608 3513 gene locus_tag LOCUS_07980 gene gnd 2608 3513 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256404.1 protein_id gnl|my_center|LOCUS_07980 3596 4744 gene locus_tag LOCUS_07990 3596 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 4750 5466 gene locus_tag LOCUS_08000 4750 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 5476 5859 gene locus_tag LOCUS_08010 gene cdd 5476 5859 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240361.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence096 844 635 gene locus_tag LOCUS_08020 gene yidD 844 635 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462333.1 protein_id gnl|my_center|LOCUS_08020 1104 829 gene locus_tag LOCUS_08030 1104 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 1513 2130 gene locus_tag LOCUS_08040 1513 2130 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_08040 2123 3106 gene locus_tag LOCUS_08050 2123 3106 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_08050 4503 3142 gene locus_tag LOCUS_08060 4503 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 5249 4500 gene locus_tag LOCUS_08070 5249 4500 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546731.1 protein_id gnl|my_center|LOCUS_08070 5467 5551 gene locus_tag LOCUS_t00120 5467 5551 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence097 396 818 gene locus_tag LOCUS_08080 396 818 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545804.1 protein_id gnl|my_center|LOCUS_08080 1007 1219 gene locus_tag LOCUS_08090 1007 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 1224 1634 gene locus_tag LOCUS_08100 1224 1634 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048201672.1 protein_id gnl|my_center|LOCUS_08100 1828 2475 gene locus_tag LOCUS_08110 1828 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 2702 2965 gene locus_tag LOCUS_08120 2702 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 2965 3477 gene locus_tag LOCUS_08130 2965 3477 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 protein_id gnl|my_center|LOCUS_08130 3580 4749 gene locus_tag LOCUS_08140 3580 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 >Feature sequence098 233 1696 gene locus_tag LOCUS_08150 233 1696 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880602.1 protein_id gnl|my_center|LOCUS_08150 2709 1693 gene locus_tag LOCUS_08160 gene aroF 2709 1693 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943946.1 protein_id gnl|my_center|LOCUS_08160 3619 2720 gene locus_tag LOCUS_08170 3619 2720 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172854.1 protein_id gnl|my_center|LOCUS_08170 3694 5277 gene locus_tag LOCUS_08180 3694 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 5767 6135 gene locus_tag LOCUS_08190 5767 6135 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842486.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence099 <1 1170 gene locus_tag LOCUS_08200 <1 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963294.1:cytochrome-c oxidase, cbb3-type subunit I note possible pseudo, frameshifted 1185 2159 gene locus_tag LOCUS_08210 1185 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08210 2156 2305 gene locus_tag LOCUS_08220 2156 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 2339 2812 gene locus_tag LOCUS_08230 2339 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 2913 4196 gene locus_tag LOCUS_08240 2913 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 4177 5280 gene locus_tag LOCUS_08250 gene ccoG 4177 5280 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074321.1 protein_id gnl|my_center|LOCUS_08250 5277 5708 gene locus_tag LOCUS_08260 5277 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 5687 6118 gene locus_tag LOCUS_08270 5687 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence100 18 419 gene locus_tag LOCUS_08280 18 419 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670476.1 protein_id gnl|my_center|LOCUS_08280 1101 430 gene locus_tag LOCUS_08290 1101 430 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545169.1 protein_id gnl|my_center|LOCUS_08290 1940 1098 gene locus_tag LOCUS_08300 1940 1098 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_08300 2916 1942 gene locus_tag LOCUS_08310 2916 1942 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_08310 3126 2920 gene locus_tag LOCUS_08320 3126 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08320 3338 3117 gene locus_tag LOCUS_08330 3338 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08330 4107 3613 gene locus_tag LOCUS_08340 4107 3613 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545747.1 protein_id gnl|my_center|LOCUS_08340 5056 4127 gene locus_tag LOCUS_08350 gene fmt 5056 4127 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546616.1 protein_id gnl|my_center|LOCUS_08350 5583 5074 gene locus_tag LOCUS_08360 gene def 5583 5074 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_08360 5650 5823 gene locus_tag LOCUS_08370 5650 5823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 >Feature sequence101 1273 311 gene locus_tag LOCUS_08380 1273 311 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_08380 2556 1270 gene locus_tag LOCUS_08390 gene fabF 2556 1270 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358339.1 protein_id gnl|my_center|LOCUS_08390 3002 2559 gene locus_tag LOCUS_08400 3002 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 3581 3165 gene locus_tag LOCUS_08410 gene acpS 3581 3165 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704154.1 protein_id gnl|my_center|LOCUS_08410 4330 3578 gene locus_tag LOCUS_08420 gene fabG 4330 3578 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_08420 5731 4451 gene locus_tag LOCUS_08430 gene fabF 5731 4451 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence102 1133 297 gene locus_tag LOCUS_08440 1133 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 1531 1130 gene locus_tag LOCUS_08450 1531 1130 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546098.1 protein_id gnl|my_center|LOCUS_08450 1823 1518 gene locus_tag LOCUS_08460 1823 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 3093 1834 gene locus_tag LOCUS_08470 gene rho 3093 1834 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545880.1 protein_id gnl|my_center|LOCUS_08470 4237 3509 gene locus_tag LOCUS_08480 4237 3509 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545462.1 protein_id gnl|my_center|LOCUS_08480 4931 4227 gene locus_tag LOCUS_08490 4931 4227 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546597.1 protein_id gnl|my_center|LOCUS_08490 5746 4931 gene locus_tag LOCUS_08500 5746 4931 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545230.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence103 56 1405 gene locus_tag LOCUS_08510 56 1405 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880700.1 protein_id gnl|my_center|LOCUS_08510 1556 1771 gene locus_tag LOCUS_08520 1556 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 1894 5556 gene locus_tag LOCUS_08530 1894 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 >Feature sequence104 1438 1046 gene locus_tag LOCUS_08540 gene rpsI 1438 1046 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_08540 1893 1468 gene locus_tag LOCUS_08550 gene rplM 1893 1468 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_08550 2680 2042 gene locus_tag LOCUS_08560 2680 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08560 3593 2691 gene locus_tag LOCUS_08570 3593 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08570 3672 4856 gene locus_tag LOCUS_08580 3672 4856 CDS product DUF401 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545901.1 protein_id gnl|my_center|LOCUS_08580 5049 5414 gene locus_tag LOCUS_08590 5049 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence105 1403 1077 gene locus_tag LOCUS_08600 1403 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1656 1435 gene locus_tag LOCUS_08610 1656 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 1939 2709 gene locus_tag LOCUS_08620 1939 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 2821 3582 gene locus_tag LOCUS_08630 2821 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 3640 5976 gene locus_tag LOCUS_08640 3640 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence106 1343 909 gene locus_tag LOCUS_08650 1343 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 2228 1347 gene locus_tag LOCUS_08660 gene hisG 2228 1347 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_08660 2708 2328 gene locus_tag LOCUS_08670 2708 2328 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545617.1 protein_id gnl|my_center|LOCUS_08670 3230 2712 gene locus_tag LOCUS_08680 3230 2712 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931087.1 protein_id gnl|my_center|LOCUS_08680 3437 3352 gene locus_tag LOCUS_t00130 3437 3352 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3774 3559 gene locus_tag LOCUS_08690 3774 3559 CDS product DUF6485 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584058.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence107 338 667 gene locus_tag LOCUS_08700 338 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 2116 668 gene locus_tag LOCUS_08710 2116 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 2549 2196 gene locus_tag LOCUS_08720 2549 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 3058 2546 gene locus_tag LOCUS_08730 gene amrA 3058 2546 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546745.1 protein_id gnl|my_center|LOCUS_08730 4050 3058 gene locus_tag LOCUS_08740 4050 3058 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546623.1 protein_id gnl|my_center|LOCUS_08740 4130 4516 gene locus_tag LOCUS_08750 gene queF 4130 4516 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546535.1 protein_id gnl|my_center|LOCUS_08750 4503 4763 gene locus_tag LOCUS_08760 4503 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 5403 4771 gene locus_tag LOCUS_08770 5403 4771 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_08770 <5942 5400 gene locus_tag LOCUS_08780 <5942 5400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000574070.1:peptidylprolyl isomerase >Feature sequence108 148 456 gene locus_tag LOCUS_08790 gene fliE 148 456 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147918.1 protein_id gnl|my_center|LOCUS_08790 456 2006 gene locus_tag LOCUS_08800 gene fliF 456 2006 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546552.1 protein_id gnl|my_center|LOCUS_08800 2003 3001 gene locus_tag LOCUS_08810 gene fliG 2003 3001 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545416.1 protein_id gnl|my_center|LOCUS_08810 2994 3611 gene locus_tag LOCUS_08820 2994 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 3592 4914 gene locus_tag LOCUS_08830 3592 4914 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545917.1 protein_id gnl|my_center|LOCUS_08830 4940 5413 gene locus_tag LOCUS_08840 4940 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 5410 5892 gene locus_tag LOCUS_08850 5410 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 >Feature sequence109 2 1099 gene locus_tag LOCUS_08860 2 1099 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986414.1 protein_id gnl|my_center|LOCUS_08860 1118 2887 gene locus_tag LOCUS_08870 1118 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 4472 3459 gene locus_tag LOCUS_08880 4472 3459 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_08880 4971 4552 gene locus_tag LOCUS_08890 4971 4552 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021853.1 protein_id gnl|my_center|LOCUS_08890 5396 4968 gene locus_tag LOCUS_08900 5396 4968 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259347.1 protein_id gnl|my_center|LOCUS_08900 >Feature sequence110 1036 188 gene locus_tag LOCUS_08910 1036 188 CDS product GeoRSP system SPASM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943533.1 protein_id gnl|my_center|LOCUS_08910 2024 1029 gene locus_tag LOCUS_08920 2024 1029 CDS product GeoRSP system radical SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044909.1 protein_id gnl|my_center|LOCUS_08920 2366 2058 gene locus_tag LOCUS_08930 2366 2058 CDS product GeoRSP system PqqD family peptide chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943535.1 protein_id gnl|my_center|LOCUS_08930 3640 2363 gene locus_tag LOCUS_08940 3640 2363 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403144.1 protein_id gnl|my_center|LOCUS_08940 4578 3637 gene locus_tag LOCUS_08950 4578 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 5686 4580 gene locus_tag LOCUS_08960 gene yedE 5686 4580 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943530.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence111 790 596 gene locus_tag LOCUS_08970 790 596 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545767.1 protein_id gnl|my_center|LOCUS_08970 1200 823 gene locus_tag LOCUS_08980 1200 823 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545623.1 protein_id gnl|my_center|LOCUS_08980 1456 2472 gene locus_tag LOCUS_08990 gene pstS 1456 2472 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545084.1 protein_id gnl|my_center|LOCUS_08990 2488 3432 gene locus_tag LOCUS_09000 gene pstC 2488 3432 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545177.1 protein_id gnl|my_center|LOCUS_09000 3429 4271 gene locus_tag LOCUS_09010 gene pstA 3429 4271 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546243.1 protein_id gnl|my_center|LOCUS_09010 4272 5030 gene locus_tag LOCUS_09020 gene pstB 4272 5030 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546432.1 protein_id gnl|my_center|LOCUS_09020 5030 5698 gene locus_tag LOCUS_09030 gene phoU 5030 5698 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545517.1 protein_id gnl|my_center|LOCUS_09030 >Feature sequence112 1769 1155 gene locus_tag LOCUS_09040 1769 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 4144 1805 gene locus_tag LOCUS_09050 4144 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 4680 4180 gene locus_tag LOCUS_09060 gene nuoE 4680 4180 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_09060 <5800 4760 gene locus_tag LOCUS_09070 <5800 4760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066467.1:anaerobic carbon-monoxide dehydrogenase catalytic subunit >Feature sequence113 <1 686 gene locus_tag LOCUS_09080 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391785.1:Ig-like domain-containing protein 765 1187 gene locus_tag LOCUS_09090 765 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1220 2383 gene locus_tag LOCUS_09100 1220 2383 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946829.1 protein_id gnl|my_center|LOCUS_09100 2383 5565 gene locus_tag LOCUS_09110 2383 5565 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946755.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence114 <1 1050 gene locus_tag LOCUS_09120 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024118841.1:ATP-binding protein 2665 1238 gene locus_tag LOCUS_09130 gene gltA 2665 1238 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023687.1 protein_id gnl|my_center|LOCUS_09130 3521 2670 gene locus_tag LOCUS_09140 3521 2670 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_09140 5528 3540 gene locus_tag LOCUS_09150 gene cooS 5528 3540 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence115 254 694 gene locus_tag LOCUS_09160 254 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 679 1794 gene locus_tag LOCUS_09170 679 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1784 2470 gene locus_tag LOCUS_09180 1784 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence116 989 441 gene locus_tag LOCUS_09190 gene rsmD 989 441 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_09190 1641 991 gene locus_tag LOCUS_09200 gene purN 1641 991 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_09200 1974 1711 gene locus_tag LOCUS_09210 1974 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 2803 1964 gene locus_tag LOCUS_09220 gene rsmI 2803 1964 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546504.1 protein_id gnl|my_center|LOCUS_09220 3279 2803 gene locus_tag LOCUS_09230 3279 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 3539 3279 gene locus_tag LOCUS_09240 3539 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 5274 3541 gene locus_tag LOCUS_09250 5274 3541 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545979.1 protein_id gnl|my_center|LOCUS_09250 >Feature sequence117 <1 643 gene locus_tag LOCUS_09260 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546351.1:YggS family pyridoxal phosphate-dependent enzyme 943 1734 gene locus_tag LOCUS_09270 gene proC 943 1734 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546562.1 protein_id gnl|my_center|LOCUS_09270 1734 2042 gene locus_tag LOCUS_09280 1734 2042 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545961.1 protein_id gnl|my_center|LOCUS_09280 2039 2608 gene locus_tag LOCUS_09290 2039 2608 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545060.1 protein_id gnl|my_center|LOCUS_09290 2589 3836 gene locus_tag LOCUS_09300 gene hisS 2589 3836 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545147.1 protein_id gnl|my_center|LOCUS_09300 4322 3867 gene locus_tag LOCUS_09310 4322 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546456.1 protein_id gnl|my_center|LOCUS_09310 5296 4319 gene locus_tag LOCUS_09320 gene msrB 5296 4319 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202796156.1 protein_id gnl|my_center|LOCUS_09320 5547 5621 gene locus_tag LOCUS_t00140 5547 5621 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence118 1370 486 gene locus_tag LOCUS_09330 gene hisF 1370 486 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545004.1 protein_id gnl|my_center|LOCUS_09330 1542 2630 gene locus_tag LOCUS_09340 gene aroB 1542 2630 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_09340 3965 2658 gene locus_tag LOCUS_09350 gene wbpA 3965 2658 CDS product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113429.1 protein_id gnl|my_center|LOCUS_09350 4365 5237 gene locus_tag LOCUS_09360 4365 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057419.1 protein_id gnl|my_center|LOCUS_09360 5546 5620 gene locus_tag LOCUS_t00150 5546 5620 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence119 2106 397 gene locus_tag LOCUS_09370 gene dnaG 2106 397 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546187.1 protein_id gnl|my_center|LOCUS_09370 3100 2147 gene locus_tag LOCUS_09380 3100 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545019.1 protein_id gnl|my_center|LOCUS_09380 3871 3419 gene locus_tag LOCUS_09390 3871 3419 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_09390 4072 3872 gene locus_tag LOCUS_09400 gene rpsU 4072 3872 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546110.1 protein_id gnl|my_center|LOCUS_09400 4239 4787 gene locus_tag LOCUS_09410 4239 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 4780 5364 gene locus_tag LOCUS_09420 4780 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence120 610 290 gene locus_tag LOCUS_09430 gene sdhD 610 290 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545668.1 protein_id gnl|my_center|LOCUS_09430 954 610 gene locus_tag LOCUS_09440 gene sdhC 954 610 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544970.1 protein_id gnl|my_center|LOCUS_09440 1600 956 gene locus_tag LOCUS_09450 1600 956 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_09450 2342 1638 gene locus_tag LOCUS_09460 2342 1638 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942652.1 protein_id gnl|my_center|LOCUS_09460 3057 2335 gene locus_tag LOCUS_09470 3057 2335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_09470 3995 3057 gene locus_tag LOCUS_09480 3995 3057 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 protein_id gnl|my_center|LOCUS_09480 4918 3992 gene locus_tag LOCUS_09490 4918 3992 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_09490 5601 4996 gene locus_tag LOCUS_09500 5601 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence121 <1 696 gene locus_tag LOCUS_09510 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546282.1:ribosome biogenesis GTPase Der 727 1491 gene locus_tag LOCUS_09520 727 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 1488 2069 gene locus_tag LOCUS_09530 1488 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 2150 2656 gene locus_tag LOCUS_09540 2150 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 4990 2660 gene locus_tag LOCUS_09550 4990 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 <5592 4983 gene locus_tag LOCUS_09560 <5592 4983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099684015.1:tyrosine protein phosphatase >Feature sequence122 452 721 gene locus_tag LOCUS_09570 452 721 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_09570 835 1149 gene locus_tag LOCUS_09580 835 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926944.1 protein_id gnl|my_center|LOCUS_09580 1179 1796 gene locus_tag LOCUS_09590 gene hisH 1179 1796 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_09590 2251 1787 gene locus_tag LOCUS_09600 gene folK 2251 1787 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_09600 3488 2322 gene locus_tag LOCUS_09610 3488 2322 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546563.1 protein_id gnl|my_center|LOCUS_09610 4955 3561 gene locus_tag LOCUS_09620 4955 3561 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546113.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence123 2352 3794 gene locus_tag LOCUS_09630 2352 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 3737 4183 gene locus_tag LOCUS_09640 3737 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence124 1727 1551 gene locus_tag LOCUS_09650 1727 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 2492 1929 gene locus_tag LOCUS_09660 2492 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 2967 4943 gene locus_tag LOCUS_09670 gene feoB 2967 4943 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045027.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence125 1859 453 gene locus_tag LOCUS_09680 1859 453 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_09680 2317 1856 gene locus_tag LOCUS_09690 2317 1856 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020220.1 protein_id gnl|my_center|LOCUS_09690 2538 2326 gene locus_tag LOCUS_09700 2538 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 2766 2551 gene locus_tag LOCUS_09710 2766 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 3029 2778 gene locus_tag LOCUS_09720 3029 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 4514 3075 gene locus_tag LOCUS_09730 4514 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 >Feature sequence126 2443 1823 gene locus_tag LOCUS_09740 2443 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 3053 2463 gene locus_tag LOCUS_09750 3053 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939792.1 protein_id gnl|my_center|LOCUS_09750 3252 3076 gene locus_tag LOCUS_09760 3252 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 4063 3596 gene locus_tag LOCUS_09770 4063 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09770 4746 4066 gene locus_tag LOCUS_09780 gene ispD 4746 4066 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583828.1 protein_id gnl|my_center|LOCUS_09780 <5357 4746 gene locus_tag LOCUS_09790 <5357 4746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003235014.1:PIN/TRAM domain-containing protein >Feature sequence127 672 160 gene locus_tag LOCUS_09800 672 160 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_09800 872 3409 gene locus_tag LOCUS_09810 gene uvrA 872 3409 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546498.1 protein_id gnl|my_center|LOCUS_09810 3486 4499 gene locus_tag LOCUS_09820 3486 4499 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_09820 4591 4872 gene locus_tag LOCUS_09830 4591 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence128 226 1584 gene locus_tag LOCUS_09840 226 1584 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082160.1 protein_id gnl|my_center|LOCUS_09840 3347 1587 gene locus_tag LOCUS_09850 3347 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 3458 4903 gene locus_tag LOCUS_09860 3458 4903 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811709.1 protein_id gnl|my_center|LOCUS_09860 4900 5154 gene locus_tag LOCUS_09870 4900 5154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 >Feature sequence129 744 181 gene locus_tag LOCUS_09880 gene folE 744 181 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545785.1 protein_id gnl|my_center|LOCUS_09880 1336 734 gene locus_tag LOCUS_09890 1336 734 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_09890 2109 1333 gene locus_tag LOCUS_09900 2109 1333 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 protein_id gnl|my_center|LOCUS_09900 2242 3318 gene locus_tag LOCUS_09910 gene dctP 2242 3318 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_09910 4685 3372 gene locus_tag LOCUS_09920 4685 3372 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_09920 5214 4678 gene locus_tag LOCUS_09930 5214 4678 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence130 282 611 gene locus_tag LOCUS_09940 gene trxA 282 611 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545412.1 protein_id gnl|my_center|LOCUS_09940 621 1154 gene locus_tag LOCUS_09950 621 1154 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244797.1 protein_id gnl|my_center|LOCUS_09950 1241 2578 gene locus_tag LOCUS_09960 gene ffh 1241 2578 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546620.1 protein_id gnl|my_center|LOCUS_09960 2649 2897 gene locus_tag LOCUS_09970 gene rpsP 2649 2897 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_09970 2919 3149 gene locus_tag LOCUS_09980 2919 3149 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546040.1 protein_id gnl|my_center|LOCUS_09980 3210 3740 gene locus_tag LOCUS_09990 gene rimM 3210 3740 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699991.1 protein_id gnl|my_center|LOCUS_09990 3737 4498 gene locus_tag LOCUS_10000 gene trmD 3737 4498 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545349.1 protein_id gnl|my_center|LOCUS_10000 4476 4829 gene locus_tag LOCUS_10010 gene rplS 4476 4829 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545830.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence131 <1 3961 gene locus_tag LOCUS_10020 <1 3961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544939.1:PAS domain S-box protein 3958 4305 gene locus_tag LOCUS_10030 3958 4305 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546385.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence132 1534 110 gene locus_tag LOCUS_10040 1534 110 CDS product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545153.1 protein_id gnl|my_center|LOCUS_10040 2735 1527 gene locus_tag LOCUS_10050 2735 1527 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546020.1 protein_id gnl|my_center|LOCUS_10050 3455 2769 gene locus_tag LOCUS_10060 gene pgl 3455 2769 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547427.1 protein_id gnl|my_center|LOCUS_10060 4942 3440 gene locus_tag LOCUS_10070 gene zwf 4942 3440 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_10070 4929 5105 gene locus_tag LOCUS_10080 4929 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence133 <1 920 gene locus_tag LOCUS_10090 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546755.1:bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ 1237 1692 gene locus_tag LOCUS_10100 1237 1692 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546787.1 protein_id gnl|my_center|LOCUS_10100 3978 1981 gene locus_tag LOCUS_10110 3978 1981 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943260.1 protein_id gnl|my_center|LOCUS_10110 4908 4465 gene locus_tag LOCUS_10120 4908 4465 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546571.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence134 <1 2465 gene locus_tag LOCUS_10130 <1 2465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544968.1:phosphoribosylformylglycinamidine synthase 2905 2462 gene locus_tag LOCUS_10140 2905 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 3210 2944 gene locus_tag LOCUS_10150 3210 2944 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546407.1 protein_id gnl|my_center|LOCUS_10150 3440 3222 gene locus_tag LOCUS_10160 3440 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 4034 3501 gene locus_tag LOCUS_10170 4034 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 4142 4321 gene locus_tag LOCUS_10180 4142 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4448 4975 gene locus_tag LOCUS_10190 4448 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence135 1849 287 gene locus_tag LOCUS_10200 gene rny 1849 287 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546866.1 protein_id gnl|my_center|LOCUS_10200 3120 1849 gene locus_tag LOCUS_10210 3120 1849 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_10210 3674 4270 gene locus_tag LOCUS_10220 3674 4270 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545242.1 protein_id gnl|my_center|LOCUS_10220 4274 4507 gene locus_tag LOCUS_10230 4274 4507 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545632.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence136 560 1135 gene locus_tag LOCUS_10240 560 1135 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545865.1 protein_id gnl|my_center|LOCUS_10240 1132 1416 gene locus_tag LOCUS_10250 1132 1416 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546290.1 protein_id gnl|my_center|LOCUS_10250 1417 2595 gene locus_tag LOCUS_10260 1417 2595 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545720.1 protein_id gnl|my_center|LOCUS_10260 2686 3645 gene locus_tag LOCUS_10270 2686 3645 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_10270 3815 4300 gene locus_tag LOCUS_10280 3815 4300 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_10280 4310 4897 gene locus_tag LOCUS_10290 4310 4897 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence137 292 453 gene locus_tag LOCUS_10300 292 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1370 456 gene locus_tag LOCUS_10310 gene cysK 1370 456 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_10310 1472 3454 gene locus_tag LOCUS_10320 1472 3454 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583112.1 protein_id gnl|my_center|LOCUS_10320 3451 4392 gene locus_tag LOCUS_10330 3451 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 <5123 4472 gene locus_tag LOCUS_10340 <5123 4472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546854.1:lipoate--protein ligase family protein >Feature sequence138 1893 478 gene locus_tag LOCUS_10350 1893 478 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_10350 3194 1986 gene locus_tag LOCUS_10360 3194 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 3411 3596 gene locus_tag LOCUS_10370 3411 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 3914 3663 gene locus_tag LOCUS_10380 3914 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 4349 3936 gene locus_tag LOCUS_10390 4349 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 4714 4352 gene locus_tag LOCUS_10400 4714 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 5020 4727 gene locus_tag LOCUS_10410 5020 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence139 119 2710 gene locus_tag LOCUS_10420 gene fdhF 119 2710 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_10420 2714 3748 gene locus_tag LOCUS_10430 gene nuoH 2714 3748 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546488.1 protein_id gnl|my_center|LOCUS_10430 3773 4384 gene locus_tag LOCUS_10440 gene nuoI 3773 4384 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546584.1 protein_id gnl|my_center|LOCUS_10440 4377 4883 gene locus_tag LOCUS_10450 4377 4883 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_10450 >Feature sequence140 49 231 gene locus_tag LOCUS_10460 49 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 346 272 gene locus_tag LOCUS_t00160 346 272 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1542 406 gene locus_tag LOCUS_10470 1542 406 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545474.1 protein_id gnl|my_center|LOCUS_10470 2240 1551 gene locus_tag LOCUS_10480 2240 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 2874 2233 gene locus_tag LOCUS_10490 2874 2233 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544951.1 protein_id gnl|my_center|LOCUS_10490 4850 2958 gene locus_tag LOCUS_10500 gene dxs 4850 2958 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence141 2301 1006 gene locus_tag LOCUS_10510 2301 1006 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545756.1 protein_id gnl|my_center|LOCUS_10510 3142 4188 gene locus_tag LOCUS_10520 3142 4188 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546094.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence142 118 993 gene locus_tag LOCUS_10530 gene galU 118 993 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546586.1 protein_id gnl|my_center|LOCUS_10530 1169 1546 gene locus_tag LOCUS_10540 1169 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1546 3924 gene locus_tag LOCUS_10550 gene lon 1546 3924 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545466.1 protein_id gnl|my_center|LOCUS_10550 3946 4947 gene locus_tag LOCUS_10560 gene thiL 3946 4947 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence143 <1 1146 gene locus_tag LOCUS_10570 <1 1146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943144.1:sigma-54 dependent transcriptional regulator 2215 1151 gene locus_tag LOCUS_10580 gene ugpC 2215 1151 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_10580 3029 2217 gene locus_tag LOCUS_10590 3029 2217 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173998.1 protein_id gnl|my_center|LOCUS_10590 3910 3026 gene locus_tag LOCUS_10600 3910 3026 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 protein_id gnl|my_center|LOCUS_10600 <5023 3915 gene locus_tag LOCUS_10610 <5023 3915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888077.1:ABC transporter substrate-binding protein >Feature sequence144 100 840 gene locus_tag LOCUS_10620 100 840 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879644.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence145 1050 1565 gene locus_tag LOCUS_10630 1050 1565 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924863.1 protein_id gnl|my_center|LOCUS_10630 1569 2759 gene locus_tag LOCUS_10640 1569 2759 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_10640 2762 3676 gene locus_tag LOCUS_10650 gene era 2762 3676 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546764.1 protein_id gnl|my_center|LOCUS_10650 3708 4133 gene locus_tag LOCUS_10660 3708 4133 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545067.1 protein_id gnl|my_center|LOCUS_10660 4200 4952 gene locus_tag LOCUS_10670 gene recO 4200 4952 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545948.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence146 4279 2402 gene locus_tag LOCUS_10680 4279 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 4707 4276 gene locus_tag LOCUS_10690 4707 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence147 712 5 gene locus_tag LOCUS_10700 712 5 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546437.1 protein_id gnl|my_center|LOCUS_10700 1712 744 gene locus_tag LOCUS_10710 1712 744 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444370.1 protein_id gnl|my_center|LOCUS_10710 3444 1714 gene locus_tag LOCUS_10720 3444 1714 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545097.1 protein_id gnl|my_center|LOCUS_10720 4299 3577 gene locus_tag LOCUS_10730 4299 3577 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545129.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence148 1266 445 gene locus_tag LOCUS_10740 1266 445 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_10740 3211 1259 gene locus_tag LOCUS_10750 3211 1259 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942862.1 protein_id gnl|my_center|LOCUS_10750 3579 3208 gene locus_tag LOCUS_10760 3579 3208 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942863.1 protein_id gnl|my_center|LOCUS_10760 4661 3576 gene locus_tag LOCUS_10770 4661 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence149 <1 1371 gene locus_tag LOCUS_10780 <1 1371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001189724.1:aminodeoxychorismate synthase component I 2315 1368 gene locus_tag LOCUS_10790 2315 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 3744 2371 gene locus_tag LOCUS_10800 3744 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 <4955 3737 gene locus_tag LOCUS_10810 <4955 3737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545108.1:preprotein translocase subunit SecA >Feature sequence150 <1 1023 gene locus_tag LOCUS_10820 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946770.1:multicopper oxidase domain-containing protein 1027 1494 gene locus_tag LOCUS_10830 1027 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 1515 3935 gene locus_tag LOCUS_10840 1515 3935 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_10840 4363 3938 gene locus_tag LOCUS_10850 4363 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence151 1507 695 gene locus_tag LOCUS_10860 1507 695 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_10860 1687 2688 gene locus_tag LOCUS_10870 1687 2688 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261092.1 protein_id gnl|my_center|LOCUS_10870 2695 4725 gene locus_tag LOCUS_10880 2695 4725 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228476.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence152 <1 842 gene locus_tag LOCUS_10890 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546159.1:sigma-54-dependent Fis family transcriptional regulator 2254 1916 gene locus_tag LOCUS_10900 2254 1916 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_10900 3651 2266 gene locus_tag LOCUS_10910 3651 2266 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405103.1 protein_id gnl|my_center|LOCUS_10910 4436 3687 gene locus_tag LOCUS_10920 4436 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 4722 4540 gene locus_tag LOCUS_10930 4722 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 >Feature sequence153 480 1 gene locus_tag LOCUS_10940 gene moaC 480 1 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545678.1 protein_id gnl|my_center|LOCUS_10940 586 500 gene locus_tag LOCUS_t00170 586 500 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 682 1965 gene locus_tag LOCUS_10950 gene hemL 682 1965 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545461.1 protein_id gnl|my_center|LOCUS_10950 2012 2989 gene locus_tag LOCUS_10960 2012 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 3074 3544 gene locus_tag LOCUS_10970 3074 3544 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940746.1 protein_id gnl|my_center|LOCUS_10970 3544 4314 gene locus_tag LOCUS_10980 3544 4314 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940747.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence154 589 1590 gene locus_tag LOCUS_10990 589 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1781 3010 gene locus_tag LOCUS_11000 gene thrC 1781 3010 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546459.1 protein_id gnl|my_center|LOCUS_11000 3034 3318 gene locus_tag LOCUS_11010 3034 3318 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545583.1 protein_id gnl|my_center|LOCUS_11010 3315 3551 gene locus_tag LOCUS_11020 3315 3551 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545388.1 protein_id gnl|my_center|LOCUS_11020 3615 4739 gene locus_tag LOCUS_11030 gene thrC 3615 4739 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546273.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence155 2300 228 gene locus_tag LOCUS_11040 gene fusA 2300 228 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545225.1 protein_id gnl|my_center|LOCUS_11040 2906 2436 gene locus_tag LOCUS_11050 gene rpsG 2906 2436 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545233.1 protein_id gnl|my_center|LOCUS_11050 3287 2916 gene locus_tag LOCUS_11060 gene rpsL 3287 2916 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_11060 4899 3490 gene locus_tag LOCUS_11070 4899 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence156 253 3423 gene locus_tag LOCUS_11080 253 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 3416 3784 gene locus_tag LOCUS_11090 3416 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 3762 4910 gene locus_tag LOCUS_11100 3762 4910 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545054.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence157 554 1273 gene locus_tag LOCUS_11110 gene hisA 554 1273 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545163.1 protein_id gnl|my_center|LOCUS_11110 1578 4772 gene locus_tag LOCUS_11120 1578 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence158 544 365 gene locus_tag LOCUS_11130 544 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1343 588 gene locus_tag LOCUS_11140 1343 588 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185803.1 protein_id gnl|my_center|LOCUS_11140 2103 1360 gene locus_tag LOCUS_11150 gene cysZ 2103 1360 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489850.1 protein_id gnl|my_center|LOCUS_11150 2129 3130 gene locus_tag LOCUS_11160 gene hypE 2129 3130 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880633.1 protein_id gnl|my_center|LOCUS_11160 3132 3503 gene locus_tag LOCUS_11170 gene hypA 3132 3503 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880634.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence159 728 372 gene locus_tag LOCUS_11180 728 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 2420 825 gene locus_tag LOCUS_11190 2420 825 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459002.1 protein_id gnl|my_center|LOCUS_11190 2722 2480 gene locus_tag LOCUS_11200 2722 2480 CDS product DUF5395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879113.1 protein_id gnl|my_center|LOCUS_11200 2934 2731 gene locus_tag LOCUS_11210 2934 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 4578 3187 gene locus_tag LOCUS_11220 4578 3187 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938245.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence160 634 783 gene locus_tag LOCUS_11230 634 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 923 3016 gene locus_tag LOCUS_11240 923 3016 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_11240 3013 3657 gene locus_tag LOCUS_11250 3013 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 3760 4401 gene locus_tag LOCUS_11260 3760 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence161 2808 1603 gene locus_tag LOCUS_11270 2808 1603 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_11270 3653 2970 gene locus_tag LOCUS_11280 gene yknY 3653 2970 CDS product ABC transporter ATP-binding protein YknY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232356.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence162 574 1419 gene locus_tag LOCUS_11290 574 1419 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546368.1 protein_id gnl|my_center|LOCUS_11290 1470 1742 gene locus_tag LOCUS_11300 1470 1742 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545639.1 protein_id gnl|my_center|LOCUS_11300 1839 2357 gene locus_tag LOCUS_11310 gene gmk 1839 2357 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942878.1 protein_id gnl|my_center|LOCUS_11310 2410 2784 gene locus_tag LOCUS_11320 gene rpoZ 2410 2784 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545675.1 protein_id gnl|my_center|LOCUS_11320 2759 3949 gene locus_tag LOCUS_11330 gene coaBC 2759 3949 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544995.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence163 1241 1119 gene locus_tag LOCUS_11340 1241 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 2152 1238 gene locus_tag LOCUS_11350 2152 1238 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545982.1 protein_id gnl|my_center|LOCUS_11350 2718 2167 gene locus_tag LOCUS_11360 gene pyrR 2718 2167 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546581.1 protein_id gnl|my_center|LOCUS_11360 3277 2870 gene locus_tag LOCUS_11370 3277 2870 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545870.1 protein_id gnl|my_center|LOCUS_11370 4752 3316 gene locus_tag LOCUS_11380 gene atpD 4752 3316 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546293.1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence164 2327 2791 gene locus_tag LOCUS_11390 2327 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 3149 2766 gene locus_tag LOCUS_11400 3149 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 3524 3153 gene locus_tag LOCUS_11410 3524 3153 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256185.1 protein_id gnl|my_center|LOCUS_11410 4106 3600 gene locus_tag LOCUS_11420 4106 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 >Feature sequence165 1 618 gene locus_tag LOCUS_11430 1 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 2023 737 gene locus_tag LOCUS_11440 gene thiC 2023 737 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546777.1 protein_id gnl|my_center|LOCUS_11440 2634 2020 gene locus_tag LOCUS_11450 gene thiE 2634 2020 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_11450 3207 2635 gene locus_tag LOCUS_11460 3207 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 4112 3339 gene locus_tag LOCUS_11470 4112 3339 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545324.1 protein_id gnl|my_center|LOCUS_11470 4435 4214 gene locus_tag LOCUS_11480 gene thiS 4435 4214 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546191.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence166 137 1567 gene locus_tag LOCUS_11490 gene ompQ 137 1567 CDS product pyoverdine export/recycling transporter outer membrane subunit OmpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895610.1 protein_id gnl|my_center|LOCUS_11490 1869 3029 gene locus_tag LOCUS_11500 1869 3029 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence167 1288 2556 gene locus_tag LOCUS_11510 gene serS 1288 2556 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545752.1 protein_id gnl|my_center|LOCUS_11510 2841 2969 gene locus_tag LOCUS_11520 2841 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 3176 2976 gene locus_tag LOCUS_11530 3176 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 4512 3169 gene locus_tag LOCUS_11540 4512 3169 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence168 2939 348 gene locus_tag LOCUS_11550 2939 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 4803 3085 gene locus_tag LOCUS_11560 4803 3085 CDS product DUF3880 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938740.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence169 525 1163 gene locus_tag LOCUS_11570 525 1163 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545876.1 protein_id gnl|my_center|LOCUS_11570 1190 2032 gene locus_tag LOCUS_11580 1190 2032 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258850.1 protein_id gnl|my_center|LOCUS_11580 2045 2485 gene locus_tag LOCUS_11590 2045 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 4263 2596 gene locus_tag LOCUS_11600 gene hcp 4263 2596 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791786.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence170 1335 874 gene locus_tag LOCUS_11610 gene nuoE 1335 874 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967798.1 protein_id gnl|my_center|LOCUS_11610 2531 1332 gene locus_tag LOCUS_11620 gene nuoD 2531 1332 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545955.1 protein_id gnl|my_center|LOCUS_11620 3052 2519 gene locus_tag LOCUS_11630 3052 2519 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546804.1 protein_id gnl|my_center|LOCUS_11630 3555 3034 gene locus_tag LOCUS_11640 3555 3034 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545381.1 protein_id gnl|my_center|LOCUS_11640 3959 3588 gene locus_tag LOCUS_11650 3959 3588 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence171 689 958 gene locus_tag LOCUS_11660 gene rpsO 689 958 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_11660 971 3112 gene locus_tag LOCUS_11670 gene pnp 971 3112 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545734.1 protein_id gnl|my_center|LOCUS_11670 3288 4514 gene locus_tag LOCUS_11680 3288 4514 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_11680 >Feature sequence172 1295 717 gene locus_tag LOCUS_11690 1295 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence173 716 1600 gene locus_tag LOCUS_11700 716 1600 CDS product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942772.1 protein_id gnl|my_center|LOCUS_11700 1566 2315 gene locus_tag LOCUS_11710 1566 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 2735 2286 gene locus_tag LOCUS_11720 2735 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 2845 3108 gene locus_tag LOCUS_11730 2845 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 3118 4530 gene locus_tag LOCUS_11740 3118 4530 CDS product conjugal transfer protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942773.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence174 1197 580 gene locus_tag LOCUS_11750 gene plsY 1197 580 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545962.1 protein_id gnl|my_center|LOCUS_11750 1730 1194 gene locus_tag LOCUS_11760 gene pgsA 1730 1194 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546842.1 protein_id gnl|my_center|LOCUS_11760 2253 1711 gene locus_tag LOCUS_11770 2253 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 2994 2374 gene locus_tag LOCUS_11780 2994 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 3115 3588 gene locus_tag LOCUS_11790 3115 3588 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868143.1 protein_id gnl|my_center|LOCUS_11790 3618 4298 gene locus_tag LOCUS_11800 gene radC 3618 4298 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532006.1 protein_id gnl|my_center|LOCUS_11800 4499 4390 gene locus_tag LOCUS_r00010 4499 4390 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence175 350 1375 gene locus_tag LOCUS_11810 350 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1372 2727 gene locus_tag LOCUS_11820 1372 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 2748 3509 gene locus_tag LOCUS_11830 2748 3509 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203060.1 protein_id gnl|my_center|LOCUS_11830 3536 4180 gene locus_tag LOCUS_11840 3536 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence176 108 2015 gene locus_tag LOCUS_11850 gene metG 108 2015 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545288.1 protein_id gnl|my_center|LOCUS_11850 2628 2008 gene locus_tag LOCUS_11860 2628 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 3032 2625 gene locus_tag LOCUS_11870 3032 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 3555 3013 gene locus_tag LOCUS_11880 3555 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 4020 3598 gene locus_tag LOCUS_11890 gene gspG 4020 3598 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 protein_id gnl|my_center|LOCUS_11890 4204 4115 gene locus_tag LOCUS_t00180 4204 4115 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4296 4372 gene locus_tag LOCUS_t00190 4296 4372 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4491 4567 gene locus_tag LOCUS_t00200 4491 4567 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence177 781 1023 gene locus_tag LOCUS_11900 781 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1020 1811 gene locus_tag LOCUS_11910 1020 1811 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941514.1 protein_id gnl|my_center|LOCUS_11910 1798 1980 gene locus_tag LOCUS_11920 1798 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 2050 2349 gene locus_tag LOCUS_11930 2050 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 2461 2727 gene locus_tag LOCUS_11940 2461 2727 CDS product type IV conjugative transfer system protein TraL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087333.1 protein_id gnl|my_center|LOCUS_11940 2756 3331 gene locus_tag LOCUS_11950 2756 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 3328 4239 gene locus_tag LOCUS_11960 3328 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence178 75 2537 gene locus_tag LOCUS_11970 75 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 2541 3896 gene locus_tag LOCUS_11980 2541 3896 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_11980 4551 3856 gene locus_tag LOCUS_11990 gene hypB 4551 3856 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence179 <1 1224 gene locus_tag LOCUS_12000 <1 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942582.1:diguanylate cyclase 1217 1816 gene locus_tag LOCUS_12010 1217 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 2136 1843 gene locus_tag LOCUS_12020 2136 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 2304 2492 gene locus_tag LOCUS_12030 2304 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2509 2715 gene locus_tag LOCUS_12040 gene rpmE 2509 2715 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545159.1 protein_id gnl|my_center|LOCUS_12040 2846 3763 gene locus_tag LOCUS_12050 2846 3763 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546693.1 protein_id gnl|my_center|LOCUS_12050 >Feature sequence180 <1 535 gene locus_tag LOCUS_12060 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942701.1:TldD/PmbA family protein 553 1713 gene locus_tag LOCUS_12070 553 1713 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_12070 1735 2517 gene locus_tag LOCUS_12080 1735 2517 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_12080 2547 3740 gene locus_tag LOCUS_12090 2547 3740 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545166.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence181 <1 664 gene locus_tag LOCUS_12100 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256383.1:ABC transporter ATP-binding protein 657 1331 gene locus_tag LOCUS_12110 657 1331 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_12110 1334 2014 gene locus_tag LOCUS_12120 gene ccsA 1334 2014 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_12120 2007 2144 gene locus_tag LOCUS_12130 2007 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 2146 2442 gene locus_tag LOCUS_12140 2146 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 2461 2760 gene locus_tag LOCUS_12150 2461 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 2952 3215 gene locus_tag LOCUS_12160 2952 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 3390 3902 gene locus_tag LOCUS_12170 3390 3902 CDS product glycine/sarcosine/betaine reductase selenoprotein B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255959.1 protein_id gnl|my_center|LOCUS_12170 3921 4262 gene locus_tag LOCUS_12180 3921 4262 CDS product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255960.1 protein_id gnl|my_center|LOCUS_12180 4262 4513 gene locus_tag LOCUS_12190 4262 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence182 1387 374 gene locus_tag LOCUS_12200 gene rfbB 1387 374 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_12200 1854 1384 gene locus_tag LOCUS_12210 1854 1384 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942724.1 protein_id gnl|my_center|LOCUS_12210 2922 1855 gene locus_tag LOCUS_12220 2922 1855 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143227.1 protein_id gnl|my_center|LOCUS_12220 2996 4420 gene locus_tag LOCUS_12230 2996 4420 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097853.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence183 <1 1856 gene locus_tag LOCUS_12240 <1 1856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546688.1:DNA translocase FtsK 3169 1859 gene locus_tag LOCUS_12250 3169 1859 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545232.1 protein_id gnl|my_center|LOCUS_12250 3906 3166 gene locus_tag LOCUS_12260 3906 3166 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_12260 >Feature sequence184 1245 607 gene locus_tag LOCUS_12270 1245 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 2108 1248 gene locus_tag LOCUS_12280 2108 1248 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942292.1 protein_id gnl|my_center|LOCUS_12280 3192 2110 gene locus_tag LOCUS_12290 3192 2110 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942293.1 protein_id gnl|my_center|LOCUS_12290 3638 3228 gene locus_tag LOCUS_12300 3638 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 4515 3793 gene locus_tag LOCUS_12310 4515 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence185 <1 513 gene locus_tag LOCUS_12320 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932547.1:CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein 514 2841 gene locus_tag LOCUS_12330 514 2841 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932548.1 protein_id gnl|my_center|LOCUS_12330 2932 4047 gene locus_tag LOCUS_12340 gene qmoC 2932 4047 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932549.1 protein_id gnl|my_center|LOCUS_12340 4057 4500 gene locus_tag LOCUS_12350 4057 4500 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729927.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence186 383 3235 gene locus_tag LOCUS_12360 383 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 3534 4370 gene locus_tag LOCUS_12370 3534 4370 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330362.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence187 1730 333 gene locus_tag LOCUS_12380 1730 333 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924859.1 protein_id gnl|my_center|LOCUS_12380 2521 1727 gene locus_tag LOCUS_12390 gene surE 2521 1727 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545452.1 protein_id gnl|my_center|LOCUS_12390 2641 3570 gene locus_tag LOCUS_12400 2641 3570 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_12400 3786 4154 gene locus_tag LOCUS_12410 3786 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 >Feature sequence188 980 96 gene locus_tag LOCUS_12420 980 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 2139 1114 gene locus_tag LOCUS_12430 gene purC 2139 1114 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582681.1 protein_id gnl|my_center|LOCUS_12430 2605 2117 gene locus_tag LOCUS_12440 2605 2117 CDS product AIR carboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319908.1 protein_id gnl|my_center|LOCUS_12440 3211 2774 gene locus_tag LOCUS_12450 3211 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 >Feature sequence189 <1 852 gene locus_tag LOCUS_12460 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544936.1:c-type cytochrome biogenesis protein CcsB 857 2305 gene locus_tag LOCUS_12470 857 2305 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943547.1 protein_id gnl|my_center|LOCUS_12470 2314 3696 gene locus_tag LOCUS_12480 2314 3696 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_12480 3800 4168 gene locus_tag LOCUS_12490 3800 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence190 191 1198 gene locus_tag LOCUS_12500 191 1198 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771258.1 protein_id gnl|my_center|LOCUS_12500 1183 2448 gene locus_tag LOCUS_12510 1183 2448 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942830.1 protein_id gnl|my_center|LOCUS_12510 2473 2796 gene locus_tag LOCUS_12520 2473 2796 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546786.1 protein_id gnl|my_center|LOCUS_12520 2793 3206 gene locus_tag LOCUS_12530 2793 3206 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022836528.1 protein_id gnl|my_center|LOCUS_12530 3196 3864 gene locus_tag LOCUS_12540 3196 3864 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_12540 4179 3874 gene locus_tag LOCUS_12550 4179 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545893.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence191 1326 427 gene locus_tag LOCUS_12560 gene rfbN 1326 427 CDS product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 protein_id gnl|my_center|LOCUS_12560 1479 2456 gene locus_tag LOCUS_12570 1479 2456 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545846.1 protein_id gnl|my_center|LOCUS_12570 2453 2884 gene locus_tag LOCUS_12580 2453 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 3169 2951 gene locus_tag LOCUS_12590 3169 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 >Feature sequence192 1656 667 gene locus_tag LOCUS_12600 1656 667 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_12600 2047 1685 gene locus_tag LOCUS_12610 gene secG 2047 1685 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546661.1 protein_id gnl|my_center|LOCUS_12610 2818 2069 gene locus_tag LOCUS_12620 gene tpiA 2818 2069 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_12620 3045 3542 gene locus_tag LOCUS_12630 3045 3542 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943377.1 protein_id gnl|my_center|LOCUS_12630 <4388 3546 gene locus_tag LOCUS_12640 <4388 3546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545592.1:energy transducer TonB >Feature sequence193 92 415 gene locus_tag LOCUS_12650 92 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 559 2145 gene locus_tag LOCUS_12660 559 2145 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_12660 3899 2946 gene locus_tag LOCUS_12670 3899 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 4167 3877 gene locus_tag LOCUS_12680 4167 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence194 1154 2560 gene locus_tag LOCUS_12690 1154 2560 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546123.1 protein_id gnl|my_center|LOCUS_12690 2596 3240 gene locus_tag LOCUS_12700 2596 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 3846 3235 gene locus_tag LOCUS_12710 3846 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 <4348 3843 gene locus_tag LOCUS_12720 <4348 3843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545176.1:phosphomannomutase >Feature sequence195 207 668 gene locus_tag LOCUS_12730 207 668 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868429.1 protein_id gnl|my_center|LOCUS_12730 665 1660 gene locus_tag LOCUS_12740 665 1660 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_12740 1737 2174 gene locus_tag LOCUS_12750 1737 2174 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938241.1 protein_id gnl|my_center|LOCUS_12750 2180 3205 gene locus_tag LOCUS_12760 2180 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 3218 4069 gene locus_tag LOCUS_12770 3218 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence196 730 933 gene locus_tag LOCUS_12780 730 933 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294067.1 protein_id gnl|my_center|LOCUS_12780 1697 1011 gene locus_tag LOCUS_12790 1697 1011 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545862.1 protein_id gnl|my_center|LOCUS_12790 2545 1694 gene locus_tag LOCUS_12800 2545 1694 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_12800 2997 2542 gene locus_tag LOCUS_12810 2997 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 3464 2997 gene locus_tag LOCUS_12820 3464 2997 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942446.1 protein_id gnl|my_center|LOCUS_12820 4138 3461 gene locus_tag LOCUS_12830 gene pgeF 4138 3461 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545414.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence197 <1 1717 gene locus_tag LOCUS_12840 <1 1717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546379.1:NADH-quinone oxidoreductase subunit L 1745 3256 gene locus_tag LOCUS_12850 1745 3256 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence198 1007 45 gene locus_tag LOCUS_12860 1007 45 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941360.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12860 1164 997 gene locus_tag LOCUS_12870 1164 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 3308 1161 gene locus_tag LOCUS_12880 3308 1161 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941359.1 protein_id gnl|my_center|LOCUS_12880 3399 3887 gene locus_tag LOCUS_12890 3399 3887 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544998.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence199 779 2554 gene locus_tag LOCUS_12900 779 2554 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545662.1 protein_id gnl|my_center|LOCUS_12900 3227 2592 gene locus_tag LOCUS_12910 3227 2592 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545041.1 protein_id gnl|my_center|LOCUS_12910 3952 3281 gene locus_tag LOCUS_12920 3952 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence200 <1 1099 gene locus_tag LOCUS_12930 <1 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942515.1:sensor domain-containing diguanylate cyclase 1096 1860 gene locus_tag LOCUS_12940 gene fdhD 1096 1860 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546799.1 protein_id gnl|my_center|LOCUS_12940 3251 1857 gene locus_tag LOCUS_12950 3251 1857 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_12950 <4297 3251 gene locus_tag LOCUS_12960 <4297 3251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942140.1:ATP-binding protein >Feature sequence201 1356 499 gene locus_tag LOCUS_12970 gene cysQ 1356 499 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813481.1 protein_id gnl|my_center|LOCUS_12970 1717 1346 gene locus_tag LOCUS_12980 gene nifU 1717 1346 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877697.1 protein_id gnl|my_center|LOCUS_12980 2895 1699 gene locus_tag LOCUS_12990 2895 1699 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880446.1 protein_id gnl|my_center|LOCUS_12990 3248 2907 gene locus_tag LOCUS_13000 3248 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 3703 3245 gene locus_tag LOCUS_13010 3703 3245 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_13010 3818 4243 gene locus_tag LOCUS_13020 3818 4243 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905176.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence202 <1 1756 gene locus_tag LOCUS_13030 <1 1756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812925.1:methyltransferase domain-containing protein 1775 1900 gene locus_tag LOCUS_13040 1775 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 2092 2889 gene locus_tag LOCUS_13050 2092 2889 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147838.1 protein_id gnl|my_center|LOCUS_13050 3380 3303 gene locus_tag LOCUS_t00210 3380 3303 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3814 3389 gene locus_tag LOCUS_13060 3814 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 4098 3811 gene locus_tag LOCUS_13070 4098 3811 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707547.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence203 840 70 gene locus_tag LOCUS_13080 840 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1147 857 gene locus_tag LOCUS_13090 1147 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 2555 1152 gene locus_tag LOCUS_13100 2555 1152 CDS product type IV secretion system DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942770.1 protein_id gnl|my_center|LOCUS_13100 2895 2545 gene locus_tag LOCUS_13110 2895 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 3243 3458 gene locus_tag LOCUS_13120 3243 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 3759 3983 gene locus_tag LOCUS_13130 3759 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence204 <1 1524 gene locus_tag LOCUS_13140 <1 1524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255931.1:phosphate/phosphite/phosphonate ABC transporter substrate-binding protein 1521 2990 gene locus_tag LOCUS_13150 1521 2990 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937430.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence205 279 1652 gene locus_tag LOCUS_13160 279 1652 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544919.1 protein_id gnl|my_center|LOCUS_13160 1649 3595 gene locus_tag LOCUS_13170 1649 3595 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545799.1 protein_id gnl|my_center|LOCUS_13170 4109 3582 gene locus_tag LOCUS_13180 gene cysC 4109 3582 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468764.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence206 120 773 gene locus_tag LOCUS_13190 120 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1060 1135 gene locus_tag LOCUS_t00220 1060 1135 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1351 2607 gene locus_tag LOCUS_13200 gene murA 1351 2607 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546097.1 protein_id gnl|my_center|LOCUS_13200 2604 3227 gene locus_tag LOCUS_13210 gene hisG 2604 3227 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943722.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence207 513 1892 gene locus_tag LOCUS_13220 513 1892 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_13220 1892 2275 gene locus_tag LOCUS_13230 1892 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 2282 2728 gene locus_tag LOCUS_13240 2282 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 2725 3501 gene locus_tag LOCUS_13250 gene ccsA 2725 3501 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943928.1 protein_id gnl|my_center|LOCUS_13250 3514 4245 gene locus_tag LOCUS_13260 3514 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence208 <1 511 gene locus_tag LOCUS_13270 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211292884.1:ammonium transporter 650 1333 gene locus_tag LOCUS_13280 650 1333 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545422.1 protein_id gnl|my_center|LOCUS_13280 1432 2844 gene locus_tag LOCUS_13290 gene glnA 1432 2844 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_13290 3389 3051 gene locus_tag LOCUS_13300 3389 3051 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262598.1 protein_id gnl|my_center|LOCUS_13300 3500 3575 gene locus_tag LOCUS_t00230 3500 3575 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3653 3737 gene locus_tag LOCUS_t00240 3653 3737 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3813 3887 gene locus_tag LOCUS_t00250 3813 3887 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3978 4053 gene locus_tag LOCUS_t00260 3978 4053 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence209 <1 745 gene locus_tag LOCUS_13310 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015943352.1:4Fe-4S binding protein 742 1620 gene locus_tag LOCUS_13320 742 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1623 1850 gene locus_tag LOCUS_13330 1623 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1888 3393 gene locus_tag LOCUS_13340 1888 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence210 <1 610 gene locus_tag LOCUS_13350 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479830.1:complex I NDUFA9 subunit family protein 1154 681 gene locus_tag LOCUS_13360 gene ruvC 1154 681 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_13360 1888 1292 gene locus_tag LOCUS_13370 1888 1292 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546496.1 protein_id gnl|my_center|LOCUS_13370 3397 2027 gene locus_tag LOCUS_13380 gene argH 3397 2027 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_13380 3836 3480 gene locus_tag LOCUS_13390 3836 3480 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942666.1 protein_id gnl|my_center|LOCUS_13390 4218 3814 gene locus_tag LOCUS_13400 4218 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence211 398 3907 gene locus_tag LOCUS_13410 gene smc 398 3907 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546468.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence212 1185 166 gene locus_tag LOCUS_13420 1185 166 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_13420 1673 1467 gene locus_tag LOCUS_13430 1673 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1915 1670 gene locus_tag LOCUS_13440 1915 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 3012 1945 gene locus_tag LOCUS_13450 3012 1945 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence213 1025 24 gene locus_tag LOCUS_13460 1025 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 2422 1022 gene locus_tag LOCUS_13470 2422 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 3071 2403 gene locus_tag LOCUS_13480 3071 2403 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390614.1 protein_id gnl|my_center|LOCUS_13480 <4157 3074 gene locus_tag LOCUS_13490 <4157 3074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002671214.1:FtsX-like permease family protein >Feature sequence214 3150 2005 gene locus_tag LOCUS_13500 3150 2005 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence215 <1 603 gene locus_tag LOCUS_13510 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087973.1:glycosyltransferase family 4 protein 607 2712 gene locus_tag LOCUS_13520 607 2712 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085539.1 protein_id gnl|my_center|LOCUS_13520 2789 3988 gene locus_tag LOCUS_13530 2789 3988 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546390.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence216 <1 920 gene locus_tag LOCUS_13540 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545322.1:alanine racemase 925 2595 gene locus_tag LOCUS_13550 925 2595 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_13550 2595 3542 gene locus_tag LOCUS_13560 gene gspK 2595 3542 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940990.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence217 972 1388 gene locus_tag LOCUS_13570 972 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1737 2753 gene locus_tag LOCUS_13580 gene ilvC 1737 2753 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545824.1 protein_id gnl|my_center|LOCUS_13580 2757 3689 gene locus_tag LOCUS_13590 2757 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence218 71 2470 gene locus_tag LOCUS_13600 71 2470 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832365.1 protein_id gnl|my_center|LOCUS_13600 2789 2574 gene locus_tag LOCUS_13610 2789 2574 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393808.1 protein_id gnl|my_center|LOCUS_13610 3031 2792 gene locus_tag LOCUS_13620 3031 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 3538 3693 gene locus_tag LOCUS_13630 3538 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence219 262 438 gene locus_tag LOCUS_13640 262 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 451 2136 gene locus_tag LOCUS_13650 451 2136 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545094.1 protein_id gnl|my_center|LOCUS_13650 2147 2674 gene locus_tag LOCUS_13660 2147 2674 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544933.1 protein_id gnl|my_center|LOCUS_13660 2667 3752 gene locus_tag LOCUS_13670 2667 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence220 881 291 gene locus_tag LOCUS_13680 881 291 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197907.1 protein_id gnl|my_center|LOCUS_13680 1611 1480 gene locus_tag LOCUS_13690 1611 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1810 1604 gene locus_tag LOCUS_13700 1810 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 2304 1957 gene locus_tag LOCUS_13710 2304 1957 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545864.1 protein_id gnl|my_center|LOCUS_13710 2693 2307 gene locus_tag LOCUS_13720 2693 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 2900 2976 gene locus_tag LOCUS_t00270 2900 2976 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3185 3907 gene locus_tag LOCUS_13730 3185 3907 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence221 164 757 gene locus_tag LOCUS_13740 164 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 735 926 gene locus_tag LOCUS_13750 735 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 926 1741 gene locus_tag LOCUS_13760 gene ccsB 926 1741 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_13760 1738 3006 gene locus_tag LOCUS_13770 gene hemA 1738 3006 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546522.1 protein_id gnl|my_center|LOCUS_13770 3010 3951 gene locus_tag LOCUS_13780 gene hemC 3010 3951 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073972.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence222 1820 1122 gene locus_tag LOCUS_13790 1820 1122 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810750.1 protein_id gnl|my_center|LOCUS_13790 2121 1786 gene locus_tag LOCUS_13800 gene yajC 2121 1786 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545404.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence223 1 510 gene locus_tag LOCUS_13810 1 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 590 1864 gene locus_tag LOCUS_13820 gene purD 590 1864 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_13820 2667 2005 gene locus_tag LOCUS_13830 2667 2005 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925888.1 protein_id gnl|my_center|LOCUS_13830 3619 2744 gene locus_tag LOCUS_13840 gene prmC 3619 2744 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546726.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence224 1528 305 gene locus_tag LOCUS_13850 1528 305 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_13850 3065 1770 gene locus_tag LOCUS_13860 3065 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 <4024 3084 gene locus_tag LOCUS_13870 <4024 3084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804186.1:AAA family ATPase >Feature sequence225 1913 855 gene locus_tag LOCUS_13880 1913 855 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_13880 3553 1910 gene locus_tag LOCUS_13890 3553 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 >Feature sequence226 904 635 gene locus_tag LOCUS_13900 gene fliQ 904 635 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546140.1 protein_id gnl|my_center|LOCUS_13900 1635 901 gene locus_tag LOCUS_13910 gene fliP 1635 901 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_13910 1966 1640 gene locus_tag LOCUS_13920 1966 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 2322 1963 gene locus_tag LOCUS_13930 gene fliN 2322 1963 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546327.1 protein_id gnl|my_center|LOCUS_13930 3322 2324 gene locus_tag LOCUS_13940 gene fliM 3322 2324 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545847.1 protein_id gnl|my_center|LOCUS_13940 3819 3319 gene locus_tag LOCUS_13950 3819 3319 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546721.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence227 1795 1238 gene locus_tag LOCUS_13960 1795 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 3144 1822 gene locus_tag LOCUS_13970 3144 1822 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203793.1 protein_id gnl|my_center|LOCUS_13970 <3986 3141 gene locus_tag LOCUS_13980 <3986 3141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102481.1:two-component system response regulator note possible pseudo, frameshifted >Feature sequence228 2457 100 gene locus_tag LOCUS_13990 2457 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 3520 2477 gene locus_tag LOCUS_14000 3520 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence229 1455 2537 gene locus_tag LOCUS_14010 gene serC 1455 2537 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence230 <1 1171 gene locus_tag LOCUS_14020 <1 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263662.1:outer membrane protein transport protein 1834 1238 gene locus_tag LOCUS_14030 1834 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 2060 2776 gene locus_tag LOCUS_14040 2060 2776 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274356.1 protein_id gnl|my_center|LOCUS_14040 <3960 2763 gene locus_tag LOCUS_14050 <3960 2763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941262.1:ATP-binding protein >Feature sequence231 >Feature sequence232 307 711 gene locus_tag LOCUS_14060 307 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1127 729 gene locus_tag LOCUS_14070 1127 729 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545896.1 protein_id gnl|my_center|LOCUS_14070 2122 1124 gene locus_tag LOCUS_14080 gene lpxK 2122 1124 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence233 952 593 gene locus_tag LOCUS_14090 gene rplT 952 593 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545766.1 protein_id gnl|my_center|LOCUS_14090 1184 987 gene locus_tag LOCUS_14100 gene rpmI 1184 987 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545453.1 protein_id gnl|my_center|LOCUS_14100 1783 1370 gene locus_tag LOCUS_14110 gene infC 1783 1370 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_14110 3769 1898 gene locus_tag LOCUS_14120 gene thrS 3769 1898 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence234 <1 1194 gene locus_tag LOCUS_14130 <1 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940703.1:Tol-Pal system beta propeller repeat protein TolB 1207 1776 gene locus_tag LOCUS_14140 gene pal 1207 1776 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546782.1 protein_id gnl|my_center|LOCUS_14140 1779 2690 gene locus_tag LOCUS_14150 gene ybgF 1779 2690 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545231.1 protein_id gnl|my_center|LOCUS_14150 2691 3668 gene locus_tag LOCUS_14160 gene moaA 2691 3668 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence235 828 313 gene locus_tag LOCUS_14170 828 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 2157 913 gene locus_tag LOCUS_14180 2157 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 3345 2302 gene locus_tag LOCUS_14190 3345 2302 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460365.1 protein_id gnl|my_center|LOCUS_14190 3729 3418 gene locus_tag LOCUS_14200 3729 3418 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879039.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence236 <1 1323 gene locus_tag LOCUS_14210 <1 1323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583493.1:phosphoglycerate kinase 2538 1324 gene locus_tag LOCUS_14220 2538 1324 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933267.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence237 1844 633 gene locus_tag LOCUS_14230 1844 633 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460255.1 protein_id gnl|my_center|LOCUS_14230 1944 2066 gene locus_tag LOCUS_14240 1944 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3278 2289 gene locus_tag LOCUS_14250 3278 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence238 198 1064 gene locus_tag LOCUS_14260 gene panC 198 1064 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546748.1 protein_id gnl|my_center|LOCUS_14260 1077 1412 gene locus_tag LOCUS_14270 1077 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1470 1931 gene locus_tag LOCUS_14280 1470 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 >Feature sequence239 <1 544 gene locus_tag LOCUS_14290 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942379.1:ABC transporter substrate-binding protein 621 1511 gene locus_tag LOCUS_14300 621 1511 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_14300 1511 2590 gene locus_tag LOCUS_14310 1511 2590 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_14310 2587 3363 gene locus_tag LOCUS_14320 2587 3363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227934.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence240 340 585 gene locus_tag LOCUS_14330 340 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 741 1076 gene locus_tag LOCUS_14340 741 1076 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_14340 1150 1668 gene locus_tag LOCUS_14350 1150 1668 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810499.1 protein_id gnl|my_center|LOCUS_14350 1705 2754 gene locus_tag LOCUS_14360 gene dsrM 1705 2754 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393108.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence241 1016 93 gene locus_tag LOCUS_14370 1016 93 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_14370 1447 1013 gene locus_tag LOCUS_14380 1447 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 3047 1782 gene locus_tag LOCUS_14390 3047 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 3788 3147 gene locus_tag LOCUS_14400 3788 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence242 176 550 gene locus_tag LOCUS_14410 176 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 616 2379 gene locus_tag LOCUS_14420 616 2379 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546634.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence243 492 163 gene locus_tag LOCUS_14430 492 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 757 1647 gene locus_tag LOCUS_14440 757 1647 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545377.1 protein_id gnl|my_center|LOCUS_14440 3140 1644 gene locus_tag LOCUS_14450 3140 1644 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064509.1 protein_id gnl|my_center|LOCUS_14450 3677 3159 gene locus_tag LOCUS_14460 3677 3159 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence244 1928 21 gene locus_tag LOCUS_14470 1928 21 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544993.1 protein_id gnl|my_center|LOCUS_14470 2808 1912 gene locus_tag LOCUS_14480 2808 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 <3661 2927 gene locus_tag LOCUS_14490 <3661 2927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868400.1:MoxR family ATPase >Feature sequence245 112 1902 gene locus_tag LOCUS_14500 112 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 >Feature sequence246 864 370 gene locus_tag LOCUS_14510 864 370 CDS product DUF2155 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940716.1 protein_id gnl|my_center|LOCUS_14510 1274 2011 gene locus_tag LOCUS_14520 1274 2011 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942629.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence247 426 3602 gene locus_tag LOCUS_14530 426 3602 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255936.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence248 348 1217 gene locus_tag LOCUS_14540 348 1217 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244130.1 protein_id gnl|my_center|LOCUS_14540 1214 2485 gene locus_tag LOCUS_14550 1214 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 2918 3529 gene locus_tag LOCUS_14560 2918 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence249 329 1522 gene locus_tag LOCUS_14570 gene alaC 329 1522 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546347.1 protein_id gnl|my_center|LOCUS_14570 1522 2817 gene locus_tag LOCUS_14580 1522 2817 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_14580 2905 3150 gene locus_tag LOCUS_14590 2905 3150 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015106.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence250 318 73 gene locus_tag LOCUS_14600 318 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 3485 618 gene locus_tag LOCUS_14610 3485 618 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939341.1 protein_id gnl|my_center|LOCUS_14610 >Feature sequence251 1575 133 gene locus_tag LOCUS_14620 1575 133 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_14620 1757 2626 gene locus_tag LOCUS_14630 1757 2626 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546276.1 protein_id gnl|my_center|LOCUS_14630 3128 2682 gene locus_tag LOCUS_14640 3128 2682 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729173.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence252 33 1058 gene locus_tag LOCUS_14650 33 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1055 2503 gene locus_tag LOCUS_14660 1055 2503 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_14660 2506 3219 gene locus_tag LOCUS_14670 2506 3219 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021473.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence253 1917 106 gene locus_tag LOCUS_14680 1917 106 CDS product TIGR04442 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943104.1 protein_id gnl|my_center|LOCUS_14680 2044 2961 gene locus_tag LOCUS_14690 2044 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 >Feature sequence254 347 1744 gene locus_tag LOCUS_14700 347 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1993 2442 gene locus_tag LOCUS_14710 1993 2442 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943047.1 protein_id gnl|my_center|LOCUS_14710 2463 2864 gene locus_tag LOCUS_14720 2463 2864 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180222.1 protein_id gnl|my_center|LOCUS_14720 2911 3402 gene locus_tag LOCUS_14730 2911 3402 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence255 395 201 gene locus_tag LOCUS_14740 395 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 <3434 494 gene locus_tag LOCUS_14750 <3434 494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211921382.1:putative Ig domain-containing protein >Feature sequence256 873 3293 gene locus_tag LOCUS_14760 873 3293 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461557.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence257 385 35 gene locus_tag LOCUS_14770 385 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 738 382 gene locus_tag LOCUS_14780 738 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1856 936 gene locus_tag LOCUS_14790 1856 936 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393185.1 protein_id gnl|my_center|LOCUS_14790 2903 1863 gene locus_tag LOCUS_14800 gene hisC 2903 1863 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545615.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence258 1 147 gene locus_tag LOCUS_14810 1 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 476 2428 gene locus_tag LOCUS_14820 476 2428 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545950.1 protein_id gnl|my_center|LOCUS_14820 2726 2947 gene locus_tag LOCUS_14830 2726 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 2944 3387 gene locus_tag LOCUS_14840 2944 3387 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529139.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence259 <1 2043 gene locus_tag LOCUS_14850 <1 2043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545569.1:acetate--CoA ligase 2063 3109 gene locus_tag LOCUS_14860 2063 3109 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545048.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence260 704 255 gene locus_tag LOCUS_14870 gene mlaD 704 255 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545373.1 protein_id gnl|my_center|LOCUS_14870 1471 722 gene locus_tag LOCUS_14880 1471 722 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_14880 2366 1539 gene locus_tag LOCUS_14890 2366 1539 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545987.1 protein_id gnl|my_center|LOCUS_14890 2791 2369 gene locus_tag LOCUS_14900 2791 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 <3383 2778 gene locus_tag LOCUS_14910 <3383 2778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228324.1:mannosyl-3-phosphoglycerate phosphatase >Feature sequence261 1034 390 gene locus_tag LOCUS_14920 1034 390 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545937.1 protein_id gnl|my_center|LOCUS_14920 1795 1031 gene locus_tag LOCUS_14930 gene cdaA 1795 1031 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_14930 1880 3079 gene locus_tag LOCUS_14940 gene tyrS 1880 3079 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546544.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence262 287 1171 gene locus_tag LOCUS_14950 287 1171 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877333.1 protein_id gnl|my_center|LOCUS_14950 1210 2952 gene locus_tag LOCUS_14960 1210 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 >Feature sequence263 2111 231 gene locus_tag LOCUS_14970 gene mnmG 2111 231 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546402.1 protein_id gnl|my_center|LOCUS_14970 2638 2108 gene locus_tag LOCUS_14980 2638 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 2787 3041 gene locus_tag LOCUS_14990 2787 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence264 275 397 gene locus_tag LOCUS_15000 275 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 708 2009 gene locus_tag LOCUS_15010 708 2009 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_15010 2023 2454 gene locus_tag LOCUS_15020 2023 2454 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence265 <1 939 gene locus_tag LOCUS_15030 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812149.1:amidohydrolase family protein 1064 1387 gene locus_tag LOCUS_15040 1064 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1790 1353 gene locus_tag LOCUS_15050 1790 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1958 1794 gene locus_tag LOCUS_15060 1958 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2392 2295 gene locus_tag LOCUS_t00280 2392 2295 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 2577 3290 gene locus_tag LOCUS_15070 2577 3290 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence266 898 296 gene locus_tag LOCUS_15080 898 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 1103 885 gene locus_tag LOCUS_15090 1103 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 1635 1246 gene locus_tag LOCUS_15100 1635 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 2101 1661 gene locus_tag LOCUS_15110 2101 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 <3301 2162 gene locus_tag LOCUS_15120 <3301 2162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943652.1:glycosyltransferase family 9 protein >Feature sequence267 77 1297 gene locus_tag LOCUS_15130 77 1297 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_15130 1388 2608 gene locus_tag LOCUS_15140 1388 2608 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545682.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence268 196 645 gene locus_tag LOCUS_15150 196 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1552 650 gene locus_tag LOCUS_15160 1552 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 3063 1549 gene locus_tag LOCUS_15170 3063 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence269 2835 2017 gene locus_tag LOCUS_15180 2835 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence270 <1 1210 gene locus_tag LOCUS_15190 <1 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012296515.1:RecB family exonuclease 2116 1247 gene locus_tag LOCUS_15200 2116 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence271 106 435 gene locus_tag LOCUS_15210 106 435 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545820.1 protein_id gnl|my_center|LOCUS_15210 402 734 gene locus_tag LOCUS_15220 402 734 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392910.1 protein_id gnl|my_center|LOCUS_15220 1536 799 gene locus_tag LOCUS_15230 1536 799 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 protein_id gnl|my_center|LOCUS_15230 2336 1533 gene locus_tag LOCUS_15240 gene cbiQ 2336 1533 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941935.1 protein_id gnl|my_center|LOCUS_15240 3237 2524 gene locus_tag LOCUS_15250 3237 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence272 1 366 gene locus_tag LOCUS_15260 1 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 472 1410 gene locus_tag LOCUS_15270 472 1410 CDS product acetyl-CoA decarbonylase/synthase complex subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545620.1 protein_id gnl|my_center|LOCUS_15270 1458 2801 gene locus_tag LOCUS_15280 gene acsC 1458 2801 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545537.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence273 1605 574 gene locus_tag LOCUS_15290 1605 574 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020204.1 protein_id gnl|my_center|LOCUS_15290 1957 1571 gene locus_tag LOCUS_15300 1957 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 2145 3032 gene locus_tag LOCUS_15310 2145 3032 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949052.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence274 1925 1020 gene locus_tag LOCUS_15320 1925 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 2863 1922 gene locus_tag LOCUS_15330 2863 1922 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941886.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence275 3043 866 gene locus_tag LOCUS_15340 3043 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence276 96 1907 gene locus_tag LOCUS_15350 gene pilB 96 1907 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_15350 1933 3063 gene locus_tag LOCUS_15360 1933 3063 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence277 <1 867 gene locus_tag LOCUS_15370 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013087341.1:TraU family protein 843 1838 gene locus_tag LOCUS_15380 843 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1903 2142 gene locus_tag LOCUS_15390 1903 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 2123 2503 gene locus_tag LOCUS_15400 2123 2503 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617906.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence278 128 1888 gene locus_tag LOCUS_15410 128 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1885 2604 gene locus_tag LOCUS_15420 1885 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence279 309 1313 gene locus_tag LOCUS_15430 gene galT 309 1313 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_15430 1401 2840 gene locus_tag LOCUS_15440 gene glgA 1401 2840 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546609.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence280 453 584 gene locus_tag LOCUS_15450 453 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 577 795 gene locus_tag LOCUS_15460 577 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 805 1074 gene locus_tag LOCUS_15470 805 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1068 1301 gene locus_tag LOCUS_15480 1068 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 1298 1636 gene locus_tag LOCUS_15490 1298 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1623 2027 gene locus_tag LOCUS_15500 1623 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 2079 2810 gene locus_tag LOCUS_15510 2079 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence281 <1 1060 gene locus_tag LOCUS_15520 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064263.1:ABC transporter substrate-binding protein 1070 1918 gene locus_tag LOCUS_15530 1070 1918 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496487.1 protein_id gnl|my_center|LOCUS_15530 1923 2669 gene locus_tag LOCUS_15540 1923 2669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence282 560 841 gene locus_tag LOCUS_15550 gene cas2 560 841 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545199.1 protein_id gnl|my_center|LOCUS_15550 841 1827 gene locus_tag LOCUS_15560 gene cas1 841 1827 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546247.1 protein_id gnl|my_center|LOCUS_15560 1775 2644 gene locus_tag LOCUS_15570 1775 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 2616 2891 gene locus_tag LOCUS_15580 gene cas2 2616 2891 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546007.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence283 1353 91 gene locus_tag LOCUS_15590 1353 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 2248 1457 gene locus_tag LOCUS_15600 2248 1457 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_15600 <3133 2226 gene locus_tag LOCUS_15610 <3133 2226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223217130.1:glycosyltransferase family 1 protein >Feature sequence284 1563 148 gene locus_tag LOCUS_15620 1563 148 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_15620 2270 1638 gene locus_tag LOCUS_15630 gene cysC 2270 1638 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468764.1 protein_id gnl|my_center|LOCUS_15630 2859 2545 gene locus_tag LOCUS_15640 2859 2545 CDS product MarR family EPS-associated transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340715.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence285 454 999 gene locus_tag LOCUS_15650 454 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1083 1268 gene locus_tag LOCUS_15660 1083 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence286 34 1365 gene locus_tag LOCUS_15670 34 1365 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545236.1 protein_id gnl|my_center|LOCUS_15670 1770 2552 gene locus_tag LOCUS_15680 1770 2552 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877636.1 protein_id gnl|my_center|LOCUS_15680 2570 2989 gene locus_tag LOCUS_15690 2570 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence287 1845 1297 gene locus_tag LOCUS_15700 1845 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 2790 1861 gene locus_tag LOCUS_15710 2790 1861 CDS product WYL domain-containing transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582487.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence288 <1 1115 gene locus_tag LOCUS_15720 <1 1115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107366.1:Na+/H+ antiporter NhaA 1367 1819 gene locus_tag LOCUS_15730 gene nuoE 1367 1819 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence289 824 219 gene locus_tag LOCUS_15740 gene clpP 824 219 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545892.1 protein_id gnl|my_center|LOCUS_15740 2107 821 gene locus_tag LOCUS_15750 gene tig 2107 821 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545152.1 protein_id gnl|my_center|LOCUS_15750 2326 2251 gene locus_tag LOCUS_t00290 2326 2251 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence290 453 923 gene locus_tag LOCUS_15760 453 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 <3076 1023 gene locus_tag LOCUS_15770 <3076 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546286.1:PBP1A family penicillin-binding protein >Feature sequence291 1652 240 gene locus_tag LOCUS_15780 gene selA 1652 240 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_15780 1718 2758 gene locus_tag LOCUS_15790 1718 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence292 1116 2840 gene locus_tag LOCUS_15800 gene sdhA 1116 2840 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545258.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence293 1 165 gene locus_tag LOCUS_15810 1 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 644 228 gene locus_tag LOCUS_15820 644 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 735 1193 gene locus_tag LOCUS_15830 735 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 <3051 1168 gene locus_tag LOCUS_15840 <3051 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546735.1:DNA internalization-related competence protein ComEC/Rec2 >Feature sequence294 107 1834 gene locus_tag LOCUS_15850 107 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 1876 2544 gene locus_tag LOCUS_15860 1876 2544 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044955.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence295 242 655 gene locus_tag LOCUS_15870 242 655 CDS product ClpXP protease specificity-enhancing factor SspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545983.1 protein_id gnl|my_center|LOCUS_15870 1110 658 gene locus_tag LOCUS_15880 1110 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 2740 1190 gene locus_tag LOCUS_15890 gene gspE 2740 1190 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence296 1517 510 gene locus_tag LOCUS_15900 1517 510 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975792.1 protein_id gnl|my_center|LOCUS_15900 <3043 1514 gene locus_tag LOCUS_15910 <3043 1514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942321.1:cation-translocating P-type ATPase >Feature sequence297 977 423 gene locus_tag LOCUS_15920 gene pth 977 423 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545410.1 protein_id gnl|my_center|LOCUS_15920 1642 980 gene locus_tag LOCUS_15930 1642 980 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546254.1 protein_id gnl|my_center|LOCUS_15930 2614 1670 gene locus_tag LOCUS_15940 2614 1670 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence298 1540 1247 gene locus_tag LOCUS_15950 1540 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1762 2169 gene locus_tag LOCUS_15960 gene speD 1762 2169 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545906.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence299 182 1588 gene locus_tag LOCUS_15970 182 1588 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545267.1 protein_id gnl|my_center|LOCUS_15970 1804 2688 gene locus_tag LOCUS_15980 1804 2688 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942085.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence300 >Feature sequence301 1205 459 gene locus_tag LOCUS_15990 1205 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 2572 1343 gene locus_tag LOCUS_16000 gene nrfD 2572 1343 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933893.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence302 48 1400 gene locus_tag LOCUS_16010 48 1400 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545680.1 protein_id gnl|my_center|LOCUS_16010 1397 2095 gene locus_tag LOCUS_16020 gene ccsA 1397 2095 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943928.1 protein_id gnl|my_center|LOCUS_16020 2666 2103 gene locus_tag LOCUS_16030 2666 2103 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545889.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence303 1708 485 gene locus_tag LOCUS_16040 1708 485 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_16040 2664 1669 gene locus_tag LOCUS_16050 2664 1669 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence304 >Feature sequence305 379 1068 gene locus_tag LOCUS_16060 379 1068 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257980.1 protein_id gnl|my_center|LOCUS_16060 1065 2189 gene locus_tag LOCUS_16070 1065 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence306 <1 726 gene locus_tag LOCUS_16080 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545754.1:ABC transporter permease 723 1487 gene locus_tag LOCUS_16090 723 1487 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546084.1 protein_id gnl|my_center|LOCUS_16090 1474 2535 gene locus_tag LOCUS_16100 1474 2535 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545262.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence307 234 677 gene locus_tag LOCUS_16110 gene rimI 234 677 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817348.1 protein_id gnl|my_center|LOCUS_16110 1188 652 gene locus_tag LOCUS_16120 1188 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 1699 1424 gene locus_tag LOCUS_16130 1699 1424 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545694.1 protein_id gnl|my_center|LOCUS_16130 2744 1941 gene locus_tag LOCUS_16140 gene dapB 2744 1941 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence308 1258 416 gene locus_tag LOCUS_16150 1258 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 2098 1397 gene locus_tag LOCUS_16160 2098 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence309 303 1448 gene locus_tag LOCUS_16170 gene carA 303 1448 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545700.1 protein_id gnl|my_center|LOCUS_16170 1445 1990 gene locus_tag LOCUS_16180 1445 1990 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895862.1 protein_id gnl|my_center|LOCUS_16180 1983 2606 gene locus_tag LOCUS_16190 1983 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence310 <1 762 gene locus_tag LOCUS_16200 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932553.1:YkgJ family cysteine cluster protein 1500 763 gene locus_tag LOCUS_16210 1500 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 2736 1507 gene locus_tag LOCUS_16220 gene glgC 2736 1507 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544940.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence311 2422 1040 gene locus_tag LOCUS_16230 2422 1040 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941561.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence312 377 727 gene locus_tag LOCUS_16240 377 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 738 1016 gene locus_tag LOCUS_16250 738 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1111 2301 gene locus_tag LOCUS_16260 1111 2301 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881436.1 protein_id gnl|my_center|LOCUS_16260 2867 2634 gene locus_tag LOCUS_16270 2867 2634 CDS product DUF4926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403415.1 protein_id gnl|my_center|LOCUS_16270 >Feature sequence313 256 1224 gene locus_tag LOCUS_16280 256 1224 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546047.1 protein_id gnl|my_center|LOCUS_16280 1205 2176 gene locus_tag LOCUS_16290 1205 2176 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545040.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence314 2127 1783 gene locus_tag LOCUS_16300 2127 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 2720 2124 gene locus_tag LOCUS_16310 2720 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence315 778 11 gene locus_tag LOCUS_16320 gene mazG 778 11 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_16320 1419 778 gene locus_tag LOCUS_16330 1419 778 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545638.1 protein_id gnl|my_center|LOCUS_16330 1900 1412 gene locus_tag LOCUS_16340 gene coaD 1900 1412 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941899.1 protein_id gnl|my_center|LOCUS_16340 2357 2160 gene locus_tag LOCUS_16350 2357 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence316 116 403 gene locus_tag LOCUS_16360 116 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1776 805 gene locus_tag LOCUS_16370 1776 805 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943774.1 protein_id gnl|my_center|LOCUS_16370 2545 2231 gene locus_tag LOCUS_16380 2545 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 >Feature sequence317 2418 2002 gene locus_tag LOCUS_16390 2418 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence318 <1 1888 gene locus_tag LOCUS_16400 <1 1888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045002.1:PAS domain S-box protein 2823 1912 gene locus_tag LOCUS_16410 2823 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence319 2189 1185 gene locus_tag LOCUS_16420 gene akrN 2189 1185 CDS product aldo/keto reductase AkrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245422.1 protein_id gnl|my_center|LOCUS_16420 2817 2155 gene locus_tag LOCUS_16430 2817 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence320 642 91 gene locus_tag LOCUS_16440 gene pgsA 642 91 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389876.1 protein_id gnl|my_center|LOCUS_16440 1810 656 gene locus_tag LOCUS_16450 1810 656 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824469.1 protein_id gnl|my_center|LOCUS_16450 2676 1807 gene locus_tag LOCUS_16460 2676 1807 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194966.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence321 415 1182 gene locus_tag LOCUS_16470 415 1182 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025085.1 protein_id gnl|my_center|LOCUS_16470 1182 1892 gene locus_tag LOCUS_16480 1182 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1909 2640 gene locus_tag LOCUS_16490 1909 2640 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257980.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence322 614 1177 gene locus_tag LOCUS_16500 614 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence323 <1 1442 gene locus_tag LOCUS_16510 <1 1442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886991.1:heme lyase CcmF/NrfE family subunit 1444 1818 gene locus_tag LOCUS_16520 1444 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1791 2462 gene locus_tag LOCUS_16530 1791 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence324 348 1520 gene locus_tag LOCUS_16540 gene gspF 348 1520 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940995.1 protein_id gnl|my_center|LOCUS_16540 2290 1529 gene locus_tag LOCUS_16550 2290 1529 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_16550 <2797 2287 gene locus_tag LOCUS_16560 <2797 2287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545054.1:HD domain-containing protein >Feature sequence325 950 357 gene locus_tag LOCUS_16570 gene rsxA 950 357 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302262.1 protein_id gnl|my_center|LOCUS_16570 1672 1034 gene locus_tag LOCUS_16580 1672 1034 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 protein_id gnl|my_center|LOCUS_16580 2315 1662 gene locus_tag LOCUS_16590 2315 1662 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_16590 2791 2312 gene locus_tag LOCUS_16600 2791 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence326 469 113 gene locus_tag LOCUS_16610 469 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 2189 444 gene locus_tag LOCUS_16620 2189 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16620 2498 2301 gene locus_tag LOCUS_16630 2498 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence327 397 188 gene locus_tag LOCUS_16640 397 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 2378 372 gene locus_tag LOCUS_16650 2378 372 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787512.1 protein_id gnl|my_center|LOCUS_16650 2613 2368 gene locus_tag LOCUS_16660 2613 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence328 462 1925 gene locus_tag LOCUS_16670 462 1925 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_16670 1922 2713 gene locus_tag LOCUS_16680 1922 2713 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842806.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence329 <2765 377 gene locus_tag LOCUS_16690 <2765 377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546871.1:leucine--tRNA ligase >Feature sequence330 1347 1 gene locus_tag LOCUS_16700 gene accC 1347 1 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546633.1 protein_id gnl|my_center|LOCUS_16700 1819 1373 gene locus_tag LOCUS_16710 gene accB 1819 1373 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545496.1 protein_id gnl|my_center|LOCUS_16710 2379 1816 gene locus_tag LOCUS_16720 gene efp 2379 1816 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545338.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence331 501 1193 gene locus_tag LOCUS_16730 501 1193 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948714.1 protein_id gnl|my_center|LOCUS_16730 1183 2556 gene locus_tag LOCUS_16740 1183 2556 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942788.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence332 218 523 gene locus_tag LOCUS_16750 218 523 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545454.1 protein_id gnl|my_center|LOCUS_16750 535 1641 gene locus_tag LOCUS_16760 gene fbp 535 1641 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881162.1 protein_id gnl|my_center|LOCUS_16760 2295 1687 gene locus_tag LOCUS_16770 2295 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence333 1749 292 gene locus_tag LOCUS_16780 1749 292 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943517.1 protein_id gnl|my_center|LOCUS_16780 <2733 1749 gene locus_tag LOCUS_16790 <2733 1749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943517.1:radical SAM protein >Feature sequence334 1951 437 gene locus_tag LOCUS_16800 1951 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533628.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence335 750 169 gene locus_tag LOCUS_16810 750 169 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381223.1 protein_id gnl|my_center|LOCUS_16810 <2724 747 gene locus_tag LOCUS_16820 <2724 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943007.1:methyl-accepting chemotaxis protein >Feature sequence336 203 15 gene locus_tag LOCUS_16830 203 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 2374 281 gene locus_tag LOCUS_16840 2374 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence337 213 1769 gene locus_tag LOCUS_16850 213 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence338 <1 2365 gene locus_tag LOCUS_16860 <1 2365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941727.1:PilC/PilY family type IV pilus protein >Feature sequence339 91 2043 gene locus_tag LOCUS_16870 91 2043 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545582.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence340 <1 1413 gene locus_tag LOCUS_16880 <1 1413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045002.1:PAS domain S-box protein 2540 1416 gene locus_tag LOCUS_16890 2540 1416 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943943.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence341 530 1747 gene locus_tag LOCUS_16900 530 1747 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941362.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence342 221 424 gene locus_tag LOCUS_16910 221 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 435 2450 gene locus_tag LOCUS_16920 gene ligA 435 2450 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545963.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence343 384 2369 gene locus_tag LOCUS_16930 384 2369 CDS product conjugal transfer protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087339.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence344 >Feature sequence345 708 1280 gene locus_tag LOCUS_16940 708 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 <2661 1285 gene locus_tag LOCUS_16950 <2661 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403054.1:transketolase >Feature sequence346 1377 409 gene locus_tag LOCUS_16960 gene hflC 1377 409 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_16960 2408 1374 gene locus_tag LOCUS_16970 gene hflK 2408 1374 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence347 <1 1188 gene locus_tag LOCUS_16980 <1 1188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546318.1:CTP synthase 1512 1784 gene locus_tag LOCUS_16990 1512 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1818 1985 gene locus_tag LOCUS_17000 1818 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 2014 2316 gene locus_tag LOCUS_17010 2014 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence348 881 447 gene locus_tag LOCUS_17020 gene fliW 881 447 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510650.1 protein_id gnl|my_center|LOCUS_17020 1108 878 gene locus_tag LOCUS_17030 gene csrA 1108 878 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865081.1 protein_id gnl|my_center|LOCUS_17030 2135 1131 gene locus_tag LOCUS_17040 gene flgL 2135 1131 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_17040 <2635 2132 gene locus_tag LOCUS_17050 <2635 2132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704937.1:flagellar hook-associated protein FlgK >Feature sequence349 1496 624 gene locus_tag LOCUS_17060 1496 624 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980161.1 protein_id gnl|my_center|LOCUS_17060 <2615 1496 gene locus_tag LOCUS_17070 <2615 1496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250627.1:nicotinate phosphoribosyltransferase >Feature sequence350 260 775 gene locus_tag LOCUS_17080 260 775 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_17080 783 2177 gene locus_tag LOCUS_17090 783 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2448 2155 gene locus_tag LOCUS_17100 2448 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence351 2480 564 gene locus_tag LOCUS_17110 2480 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence352 389 1504 gene locus_tag LOCUS_17120 389 1504 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence353 1088 195 gene locus_tag LOCUS_17130 1088 195 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943532.1 protein_id gnl|my_center|LOCUS_17130 1590 1102 gene locus_tag LOCUS_17140 1590 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 2288 1590 gene locus_tag LOCUS_17150 2288 1590 CDS product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870604.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence354 410 1510 gene locus_tag LOCUS_17160 410 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence355 684 364 gene locus_tag LOCUS_17170 684 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1984 686 gene locus_tag LOCUS_17180 1984 686 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence356 504 2159 gene locus_tag LOCUS_17190 504 2159 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941702.1 protein_id gnl|my_center|LOCUS_17190 >Feature sequence357 <1 781 gene locus_tag LOCUS_17200 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546774.1:phenylalanine--tRNA ligase subunit alpha >Feature sequence358 87 554 gene locus_tag LOCUS_17210 gene tadA 87 554 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_17210 532 621 gene locus_tag LOCUS_t00300 532 621 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 972 1313 gene locus_tag LOCUS_17220 972 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence359 1172 531 gene locus_tag LOCUS_17230 1172 531 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 protein_id gnl|my_center|LOCUS_17230 1953 1183 gene locus_tag LOCUS_17240 1953 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 <2507 1950 gene locus_tag LOCUS_17250 <2507 1950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948146.1:RnfABCDGE type electron transport complex subunit D >Feature sequence360 923 2257 gene locus_tag LOCUS_17260 923 2257 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence361 1906 584 gene locus_tag LOCUS_17270 1906 584 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943919.1 protein_id gnl|my_center|LOCUS_17270 <2495 1923 gene locus_tag LOCUS_17280 <2495 1923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546680.1:phosphoglycerate dehydrogenase >Feature sequence362 1399 377 gene locus_tag LOCUS_17290 1399 377 CDS product DmsE family decaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941884.1 protein_id gnl|my_center|LOCUS_17290 <2489 1430 gene locus_tag LOCUS_17300 <2489 1430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943734.1:ribonuclease J >Feature sequence363 >Feature sequence364 527 670 gene locus_tag LOCUS_17310 527 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 798 2417 gene locus_tag LOCUS_17320 798 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence365 1515 439 gene locus_tag LOCUS_17330 1515 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 2069 1626 gene locus_tag LOCUS_17340 2069 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence366 <1 507 gene locus_tag LOCUS_17350 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436749.1:DUF362 domain-containing protein 2196 508 gene locus_tag LOCUS_17360 2196 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence367 >Feature sequence368 761 1867 gene locus_tag LOCUS_17370 gene larC 761 1867 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460167.1 protein_id gnl|my_center|LOCUS_17370 2297 1899 gene locus_tag LOCUS_17380 2297 1899 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091161.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence369 274 804 gene locus_tag LOCUS_17390 274 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 785 1183 gene locus_tag LOCUS_17400 785 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 1185 1370 gene locus_tag LOCUS_17410 1185 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 1367 1558 gene locus_tag LOCUS_17420 1367 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 1586 1855 gene locus_tag LOCUS_17430 1586 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence370 2433 1330 gene locus_tag LOCUS_17440 2433 1330 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868574.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence371 1021 1881 gene locus_tag LOCUS_17450 gene murQ 1021 1881 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963499.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence372 >Feature sequence373 <1 606 gene locus_tag LOCUS_17460 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066275.1:PKD domain-containing protein 623 871 gene locus_tag LOCUS_17470 623 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 907 1779 gene locus_tag LOCUS_17480 907 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence374 >Feature sequence375 >Feature sequence376 198 1991 gene locus_tag LOCUS_17490 gene uvrC 198 1991 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545436.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence377 193 1311 gene locus_tag LOCUS_17500 gene dnaN 193 1311 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003013639.1 protein_id gnl|my_center|LOCUS_17500 1421 1825 gene locus_tag LOCUS_17510 gene ssb 1421 1825 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545299.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence378 1909 104 gene locus_tag LOCUS_17520 1909 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence379 <1 955 gene locus_tag LOCUS_17530 <1 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948644.1:molybdopterin-binding protein 1641 1195 gene locus_tag LOCUS_17540 1641 1195 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545150.1 protein_id gnl|my_center|LOCUS_17540 2053 1616 gene locus_tag LOCUS_17550 2053 1616 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546607.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence380 325 5 gene locus_tag LOCUS_17560 325 5 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545882.1 protein_id gnl|my_center|LOCUS_17560 673 329 gene locus_tag LOCUS_17570 673 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1425 1234 gene locus_tag LOCUS_17580 1425 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 1691 2029 gene locus_tag LOCUS_17590 1691 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 2031 2264 gene locus_tag LOCUS_17600 2031 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence381 105 890 gene locus_tag LOCUS_17610 105 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 988 1530 gene locus_tag LOCUS_17620 988 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 2266 1550 gene locus_tag LOCUS_17630 2266 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence382 >Feature sequence383 <2329 34 gene locus_tag LOCUS_17640 <2329 34 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255936.1:molybdopterin-dependent oxidoreductase >Feature sequence384 1 936 gene locus_tag LOCUS_17650 1 936 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377275.1 protein_id gnl|my_center|LOCUS_17650 936 1238 gene locus_tag LOCUS_17660 936 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 1231 1611 gene locus_tag LOCUS_17670 1231 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence385 242 664 gene locus_tag LOCUS_17680 242 664 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877808.1 protein_id gnl|my_center|LOCUS_17680 724 1146 gene locus_tag LOCUS_17690 724 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 2261 1338 gene locus_tag LOCUS_17700 2261 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence386 1288 314 gene locus_tag LOCUS_17710 gene amrS 1288 314 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_17710 1879 1307 gene locus_tag LOCUS_17720 1879 1307 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_17720 2104 2307 gene locus_tag LOCUS_17730 2104 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence387 112 996 gene locus_tag LOCUS_17740 112 996 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941029.1 protein_id gnl|my_center|LOCUS_17740 1963 1013 gene locus_tag LOCUS_17750 1963 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 >Feature sequence388 601 2223 gene locus_tag LOCUS_17760 601 2223 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545178.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence389 1383 2057 gene locus_tag LOCUS_17770 gene atpB 1383 2057 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546836.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence390 <2298 141 gene locus_tag LOCUS_17780 <2298 141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_109982246.1:response regulator >Feature sequence391 312 566 gene locus_tag LOCUS_17790 312 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 563 1078 gene locus_tag LOCUS_17800 gene lptE 563 1078 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545934.1 protein_id gnl|my_center|LOCUS_17800 1092 1973 gene locus_tag LOCUS_17810 gene holA 1092 1973 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545757.1 protein_id gnl|my_center|LOCUS_17810 2235 1954 gene locus_tag LOCUS_17820 gene rpsT 2235 1954 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545489.1 protein_id gnl|my_center|LOCUS_17820 >Feature sequence392 230 1546 gene locus_tag LOCUS_17830 gene trmFO 230 1546 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392541.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence393 154 804 gene locus_tag LOCUS_17840 154 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941356.1 protein_id gnl|my_center|LOCUS_17840 961 842 gene locus_tag LOCUS_17850 961 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 <2295 1038 gene locus_tag LOCUS_17860 <2295 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546624.1:cytochrome c3 family protein >Feature sequence394 1724 192 gene locus_tag LOCUS_17870 1724 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence395 2251 509 gene locus_tag LOCUS_17880 2251 509 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence396 >Feature sequence397 908 321 gene locus_tag LOCUS_17890 908 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 1751 924 gene locus_tag LOCUS_17900 1751 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence398 2083 62 gene locus_tag LOCUS_17910 2083 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence399 2059 548 gene locus_tag LOCUS_17920 2059 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence400 1474 119 gene locus_tag LOCUS_17930 1474 119 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545858.1 protein_id gnl|my_center|LOCUS_17930 <2235 1502 gene locus_tag LOCUS_17940 <2235 1502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392852.1:indole-3-glycerol phosphate synthase TrpC >Feature sequence401 85 678 gene locus_tag LOCUS_17950 85 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 681 1175 gene locus_tag LOCUS_17960 681 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence402 212 679 gene locus_tag LOCUS_17970 gene rimP 212 679 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082324.1 protein_id gnl|my_center|LOCUS_17970 676 1770 gene locus_tag LOCUS_17980 gene nusA 676 1770 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546178.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence403 <1 1266 gene locus_tag LOCUS_17990 <1 1266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881132.1:M23 family metallopeptidase 1273 1554 gene locus_tag LOCUS_18000 1273 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence404 664 317 gene locus_tag LOCUS_18010 664 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 1090 731 gene locus_tag LOCUS_18020 1090 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence405 <1 1093 gene locus_tag LOCUS_18030 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545913.1:membrane protein insertase YidC 1472 1396 gene locus_tag LOCUS_t00310 1472 1396 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1765 2037 gene locus_tag LOCUS_18040 1765 2037 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence406 >Feature sequence407 >Feature sequence408 806 2026 gene locus_tag LOCUS_18050 806 2026 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814565.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence409 <1 598 gene locus_tag LOCUS_18060 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546465.1:acetylornithine transaminase 595 1500 gene locus_tag LOCUS_18070 gene argF 595 1500 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545574.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence410 <1 567 gene locus_tag LOCUS_18080 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208195.1:type II secretion system secretin GspD 564 1070 gene locus_tag LOCUS_18090 gene cobO 564 1070 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942222.1 protein_id gnl|my_center|LOCUS_18090 1646 1116 gene locus_tag LOCUS_18100 gene scpB 1646 1116 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842431.1 protein_id gnl|my_center|LOCUS_18100 1848 1970 gene locus_tag LOCUS_18110 1848 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence411 401 1243 gene locus_tag LOCUS_18120 401 1243 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330362.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence412 1490 297 gene locus_tag LOCUS_18130 1490 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 >Feature sequence413 402 1940 gene locus_tag LOCUS_18140 402 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 >Feature sequence414 1118 156 gene locus_tag LOCUS_18150 1118 156 CDS product DUF3137 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761173.1 protein_id gnl|my_center|LOCUS_18150 1696 1124 gene locus_tag LOCUS_18160 1696 1124 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761174.1 protein_id gnl|my_center|LOCUS_18160 1857 1696 gene locus_tag LOCUS_18170 1857 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence415 >Feature sequence416 295 68 gene locus_tag LOCUS_18180 295 68 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545602.1 protein_id gnl|my_center|LOCUS_18180 1953 292 gene locus_tag LOCUS_18190 gene recN 1953 292 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546310.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence417 524 1171 gene locus_tag LOCUS_18200 gene pilO 524 1171 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546057.1 protein_id gnl|my_center|LOCUS_18200 1168 1698 gene locus_tag LOCUS_18210 1168 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence418 >Feature sequence419 <1 573 gene locus_tag LOCUS_18220 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044910.1:right-handed parallel beta-helix repeat-containing protein 717 1415 gene locus_tag LOCUS_18230 717 1415 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943540.1 protein_id gnl|my_center|LOCUS_18230 1396 1977 gene locus_tag LOCUS_18240 1396 1977 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943539.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence420 <2136 99 gene locus_tag LOCUS_18250 <2136 99 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546882.1:type IV pilus secretin PilQ >Feature sequence421 446 30 gene locus_tag LOCUS_18260 446 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1150 446 gene locus_tag LOCUS_18270 1150 446 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_18270 1262 1186 gene locus_tag LOCUS_t00320 1262 1186 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 <2112 1304 gene locus_tag LOCUS_18280 <2112 1304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943710.1:RNA polymerase sigma factor RpoD >Feature sequence422 <2104 766 gene locus_tag LOCUS_18290 <2104 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545022.1:ribonuclease R >Feature sequence423 >Feature sequence424 >Feature sequence425 >Feature sequence426 2042 933 gene locus_tag LOCUS_18300 2042 933 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240438.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence427 <1 879 gene locus_tag LOCUS_18310 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546190.1:class II fructose-bisphosphate aldolase 879 1832 gene locus_tag LOCUS_18320 gene fbp 879 1832 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939127.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence428 <1 1245 gene locus_tag LOCUS_18330 <1 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942384.1:indolepyruvate ferredoxin oxidoreductase subunit alpha 1242 1844 gene locus_tag LOCUS_18340 1242 1844 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence429 <1 156 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cacgcgggggcgtggattgaaac 463 293 gene locus_tag LOCUS_18350 463 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 807 658 gene locus_tag LOCUS_18360 807 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 1432 1172 gene locus_tag LOCUS_18370 1432 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 1796 1425 gene locus_tag LOCUS_18380 1796 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence430 <1 696 gene locus_tag LOCUS_18390 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958222.1:tRNA pseudouridine(55) synthase TruB 873 1925 gene locus_tag LOCUS_18400 gene pilM 873 1925 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181416674.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence431 1322 99 gene locus_tag LOCUS_18410 1322 99 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816576.1 protein_id gnl|my_center|LOCUS_18410 1776 1336 gene locus_tag LOCUS_18420 1776 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence432 1706 168 gene locus_tag LOCUS_18430 gene guaA 1706 168 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence433 1126 338 gene locus_tag LOCUS_18440 1126 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1931 1497 gene locus_tag LOCUS_18450 1931 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence434 <2023 1043 gene locus_tag LOCUS_18460 <2023 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932546.1:adenylyl-sulfate reductase subunit alpha >Feature sequence435 57 617 gene locus_tag LOCUS_18470 57 617 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546295.1 protein_id gnl|my_center|LOCUS_18470 595 1278 gene locus_tag LOCUS_18480 595 1278 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545458.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence436 414 1331 gene locus_tag LOCUS_18490 414 1331 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545844.1 protein_id gnl|my_center|LOCUS_18490 <2008 1476 gene locus_tag LOCUS_18500 <2008 1476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869559.1:selenide, water dikinase SelD >Feature sequence437 49 312 gene locus_tag LOCUS_18510 49 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 306 578 gene locus_tag LOCUS_18520 306 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 575 1018 gene locus_tag LOCUS_18530 575 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 990 1250 gene locus_tag LOCUS_18540 990 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 1237 1845 gene locus_tag LOCUS_18550 1237 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 >Feature sequence438 2000 1782 gene locus_tag LOCUS_18560 2000 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence439 341 583 gene locus_tag LOCUS_18570 341 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence440 454 1056 gene locus_tag LOCUS_18580 454 1056 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546497.1 protein_id gnl|my_center|LOCUS_18580 1365 1060 gene locus_tag LOCUS_18590 1365 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 <1995 1362 gene locus_tag LOCUS_18600 <1995 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938977.1:lysophospholipid acyltransferase family protein >Feature sequence441 3 806 gene locus_tag LOCUS_18610 3 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 808 1365 gene locus_tag LOCUS_18620 808 1365 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545481.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence442 1941 595 gene locus_tag LOCUS_18630 1941 595 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence443 1899 133 gene locus_tag LOCUS_18640 1899 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence444 1453 428 gene locus_tag LOCUS_18650 gene rfbB 1453 428 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence445 3 326 gene locus_tag LOCUS_18660 3 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 405 851 gene locus_tag LOCUS_18670 405 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18670 1927 827 gene locus_tag LOCUS_18680 1927 827 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942536.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence446 817 239 gene locus_tag LOCUS_18690 817 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 915 1292 gene locus_tag LOCUS_18700 gene hisI 915 1292 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546303.1 protein_id gnl|my_center|LOCUS_18700 1273 1572 gene locus_tag LOCUS_18710 gene hisE 1273 1572 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642719.1 protein_id gnl|my_center|LOCUS_18710 1616 1957 gene locus_tag LOCUS_18720 1616 1957 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546430.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence447 525 79 gene locus_tag LOCUS_18730 525 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1772 522 gene locus_tag LOCUS_18740 1772 522 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531232.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence448 3 1616 gene locus_tag LOCUS_18750 3 1616 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545101.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence449 <1 1645 gene locus_tag LOCUS_18760 <1 1645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071225.1:efflux RND transporter permease subunit >Feature sequence450 43 171 gene locus_tag LOCUS_18770 43 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence451 1 930 gene locus_tag LOCUS_18780 1 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 >Feature sequence452 17 1789 gene locus_tag LOCUS_18790 17 1789 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_18790 >Feature sequence453 686 117 gene locus_tag LOCUS_18800 686 117 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877282.1 protein_id gnl|my_center|LOCUS_18800 1623 703 gene locus_tag LOCUS_18810 1623 703 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545634.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence454 230 751 gene locus_tag LOCUS_18820 gene hpt 230 751 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546262.1 protein_id gnl|my_center|LOCUS_18820 775 1146 gene locus_tag LOCUS_18830 gene queD 775 1146 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence455 >Feature sequence456 12 752 gene locus_tag LOCUS_18840 12 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 <1890 754 gene locus_tag LOCUS_18850 <1890 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142355.1:gamma-glutamyltransferase >Feature sequence457 232 981 gene locus_tag LOCUS_18860 232 981 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723743.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence458 >Feature sequence459 379 1503 gene locus_tag LOCUS_18870 379 1503 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583703.1 protein_id gnl|my_center|LOCUS_18870 1627 1493 gene locus_tag LOCUS_18880 1627 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence460 >Feature sequence461 768 508 gene locus_tag LOCUS_18890 768 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 1612 989 gene locus_tag LOCUS_18900 gene nth 1612 989 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583053.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence462 1363 62 gene locus_tag LOCUS_18910 1363 62 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762567.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence463 <1 1747 gene locus_tag LOCUS_18920 <1 1747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035214612.1:4Fe-4S binding protein >Feature sequence464 <1827 1034 gene locus_tag LOCUS_18930 <1827 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868192.1:S-methyl-5'-thioadenosine phosphorylase >Feature sequence465 299 1399 gene locus_tag LOCUS_18940 299 1399 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence466 277 561 gene locus_tag LOCUS_18950 277 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 548 1156 gene locus_tag LOCUS_18960 548 1156 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255938.1 protein_id gnl|my_center|LOCUS_18960 1083 1421 gene locus_tag LOCUS_18970 1083 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence467 1805 660 gene locus_tag LOCUS_18980 gene glmM 1805 660 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546798.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence468 237 824 gene locus_tag LOCUS_18990 237 824 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545352.1 protein_id gnl|my_center|LOCUS_18990 953 1438 gene locus_tag LOCUS_19000 953 1438 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546148.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence469 382 828 gene locus_tag LOCUS_19010 382 828 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546607.1 protein_id gnl|my_center|LOCUS_19010 809 1240 gene locus_tag LOCUS_19020 809 1240 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545150.1 protein_id gnl|my_center|LOCUS_19020 >Feature sequence470 45 1001 gene locus_tag LOCUS_19030 45 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence471 28 567 gene locus_tag LOCUS_19040 28 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 840 1496 gene locus_tag LOCUS_19050 840 1496 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence472 1590 808 gene locus_tag LOCUS_19060 1590 808 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868851.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence473 1004 774 gene locus_tag LOCUS_19070 1004 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 1300 1007 gene locus_tag LOCUS_19080 1300 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 >Feature sequence474 <1 1699 gene locus_tag LOCUS_19090 <1 1699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071157.1:S8 family serine peptidase >Feature sequence475 238 1323 gene locus_tag LOCUS_19100 238 1323 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546217.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence476 1690 194 gene locus_tag LOCUS_19110 1690 194 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_19110 >Feature sequence477 468 1496 gene locus_tag LOCUS_19120 468 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 1587 1679 gene locus_tag LOCUS_t00330 1587 1679 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence478 17 781 gene locus_tag LOCUS_19130 17 781 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_19130 1397 756 gene locus_tag LOCUS_19140 1397 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence479 >Feature sequence480 1741 935 gene locus_tag LOCUS_19150 1741 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 >Feature sequence481 26 733 gene locus_tag LOCUS_19160 26 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 1702 806 gene locus_tag LOCUS_19170 1702 806 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546038.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence482 <1726 253 gene locus_tag LOCUS_19180 <1726 253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112411.1:sulfotransferase family protein >Feature sequence483 <1725 746 gene locus_tag LOCUS_19190 <1725 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942430.1:cytochrome c3 family protein >Feature sequence484 1235 624 gene locus_tag LOCUS_19200 1235 624 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943370.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence485 <1716 933 gene locus_tag LOCUS_19210 <1716 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887920.1:aliphatic sulfonate ABC transporter substrate-binding protein >Feature sequence486 <1 685 gene locus_tag LOCUS_19220 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941916.1:ABC transporter ATP-binding protein 682 1683 gene locus_tag LOCUS_19230 682 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941917.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence487 273 1610 gene locus_tag LOCUS_19240 273 1610 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880977.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence488 >Feature sequence489 3 1379 gene locus_tag LOCUS_19250 3 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 1376 1639 gene locus_tag LOCUS_19260 1376 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence490 480 1409 gene locus_tag LOCUS_19270 480 1409 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080803342.1 protein_id gnl|my_center|LOCUS_19270 >Feature sequence491 <1 723 gene locus_tag LOCUS_19280 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545685.1:DegQ family serine endoprotease 793 1647 gene locus_tag LOCUS_19290 793 1647 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842785.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence492 <1 747 gene locus_tag LOCUS_19300 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405539.1:ABC transporter transmembrane domain-containing protein 744 1664 gene locus_tag LOCUS_19310 744 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence493 977 126 gene locus_tag LOCUS_19320 gene ilvE 977 126 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870345.1 protein_id gnl|my_center|LOCUS_19320 >Feature sequence494 174 1421 gene locus_tag LOCUS_19330 174 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 >Feature sequence495 161 535 gene locus_tag LOCUS_19340 gene crcB 161 535 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258331.1 protein_id gnl|my_center|LOCUS_19340 538 1260 gene locus_tag LOCUS_19350 538 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 >Feature sequence496 168 1466 gene locus_tag LOCUS_19360 168 1466 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942374.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence497 <1 1273 gene locus_tag LOCUS_19370 <1 1273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444593.1:AmmeMemoRadiSam system protein B >Feature sequence498 1013 396 gene locus_tag LOCUS_19380 1013 396 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544944.1 protein_id gnl|my_center|LOCUS_19380 <1647 1023 gene locus_tag LOCUS_19390 <1647 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880542.1:DUF89 domain-containing protein >Feature sequence499 >Feature sequence500 314 550 gene locus_tag LOCUS_19400 314 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 889 605 gene locus_tag LOCUS_19410 889 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 >Feature sequence501 214 942 gene locus_tag LOCUS_19420 214 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 >Feature sequence502 1018 278 gene locus_tag LOCUS_19430 1018 278 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence503 <1 996 gene locus_tag LOCUS_19440 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546673.1:outer membrane protein assembly factor 962 1519 gene locus_tag LOCUS_19450 962 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546023.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence504 <1610 300 gene locus_tag LOCUS_19460 <1610 300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256515.1:glycerate kinase >Feature sequence505 1559 1068 gene locus_tag LOCUS_19470 1559 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence506 1 888 gene locus_tag LOCUS_19480 gene xerD 1 888 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546237.1 protein_id gnl|my_center|LOCUS_19480 <1576 997 gene locus_tag LOCUS_19490 <1576 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393557.1:Uma2 family endonuclease >Feature sequence507 >Feature sequence508 429 151 gene locus_tag LOCUS_19500 429 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 803 426 gene locus_tag LOCUS_19510 803 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence509 1331 126 gene locus_tag LOCUS_19520 1331 126 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964893.1 protein_id gnl|my_center|LOCUS_19520 1564 1328 gene locus_tag LOCUS_19530 1564 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence510 >Feature sequence511 648 10 gene locus_tag LOCUS_19540 648 10 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545227.1 protein_id gnl|my_center|LOCUS_19540 1198 824 gene locus_tag LOCUS_19550 1198 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence512 259 516 gene locus_tag LOCUS_19560 259 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 510 1337 gene locus_tag LOCUS_19570 510 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence513 >Feature sequence514 909 4 gene locus_tag LOCUS_19580 gene folD 909 4 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941526.1 protein_id gnl|my_center|LOCUS_19580 1490 921 gene locus_tag LOCUS_19590 1490 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 >Feature sequence515 >Feature sequence516 >Feature sequence517 805 194 gene locus_tag LOCUS_19600 805 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 1450 818 gene locus_tag LOCUS_19610 1450 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence518 961 641 gene locus_tag LOCUS_19620 961 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545895.1 protein_id gnl|my_center|LOCUS_19620 <1518 1008 gene locus_tag LOCUS_19630 <1518 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546417.1:pitrilysin family protein >Feature sequence519 <1518 472 gene locus_tag LOCUS_19640 <1518 472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943636.1:cobyrinate a,c-diamide synthase >Feature sequence520 <1512 58 gene locus_tag LOCUS_19650 <1512 58 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081461260.1:PAS domain S-box protein >Feature sequence521 <1 562 gene locus_tag LOCUS_19660 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546472.1:acetyl-CoA decarbonylase/synthase complex subunit alpha/beta >Feature sequence522 419 871 gene locus_tag LOCUS_19670 419 871 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878970.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence523 >Feature sequence524 1157 186 gene locus_tag LOCUS_19680 1157 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 >Feature sequence525 1 699 gene locus_tag LOCUS_19690 1 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 710 1126 gene locus_tag LOCUS_19700 gene fliS 710 1126 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943663.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence526 <1 896 gene locus_tag LOCUS_19710 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941062.1:efflux RND transporter permease subunit <1489 957 gene locus_tag LOCUS_19720 <1489 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939260.1:FAD-dependent oxidoreductase >Feature sequence527 218 51 gene locus_tag LOCUS_19730 218 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 1468 215 gene locus_tag LOCUS_19740 1468 215 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545855.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence528 >Feature sequence529 <1 704 gene locus_tag LOCUS_19750 <1 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963764.1:chloride channel protein 756 1436 gene locus_tag LOCUS_19760 756 1436 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545727.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence530 <1460 245 gene locus_tag LOCUS_19770 <1460 245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948145.1:electron transport complex subunit RsxC >Feature sequence531 >Feature sequence532 898 275 gene locus_tag LOCUS_19780 898 275 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941085.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence533 1152 442 gene locus_tag LOCUS_19790 1152 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence534 <1421 728 gene locus_tag LOCUS_19800 <1421 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584159.1:Crp/Fnr family transcriptional regulator >Feature sequence535 <1 1223 gene locus_tag LOCUS_19810 <1 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942773.1:conjugal transfer protein TraH >Feature sequence536 119 1207 gene locus_tag LOCUS_19820 119 1207 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_19820 1364 1274 gene locus_tag LOCUS_t00340 1364 1274 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence537 88 1008 gene locus_tag LOCUS_19830 gene phnD 88 1008 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255931.1 protein_id gnl|my_center|LOCUS_19830 >Feature sequence538 <1395 542 gene locus_tag LOCUS_19840 <1395 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124123.1:alpha/beta hydrolase >Feature sequence539 1355 444 gene locus_tag LOCUS_19850 1355 444 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941029.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence540 <1376 429 gene locus_tag LOCUS_19860 <1376 429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013087336.1:TraB/VirB10 family protein >Feature sequence541 660 262 gene locus_tag LOCUS_19870 660 262 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_19870 908 657 gene locus_tag LOCUS_19880 908 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 >Feature sequence542 >Feature sequence543 >Feature sequence544 >Feature sequence545 >Feature sequence546 >Feature sequence547 165 443 gene locus_tag LOCUS_19890 165 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence548 125 391 gene locus_tag LOCUS_19900 125 391 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545507.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence549 <1 664 gene locus_tag LOCUS_19910 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941973.1:ATP-binding protein 792 995 gene locus_tag LOCUS_19920 792 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 >Feature sequence550 3 731 gene locus_tag LOCUS_19930 3 731 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_19930 1227 736 gene locus_tag LOCUS_19940 1227 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence551 >Feature sequence552 <1 922 gene locus_tag LOCUS_19950 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546495.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE >Feature sequence553 <1282 145 gene locus_tag LOCUS_19960 <1282 145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941262.1:ATP-binding protein note possible pseudo, internal stop codon >Feature sequence554 1010 87 gene locus_tag LOCUS_19970 1010 87 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546183.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence555 >Feature sequence556 1165 275 gene locus_tag LOCUS_19980 1165 275 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545334.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence557 >Feature sequence558 178 255 gene locus_tag LOCUS_t00350 178 255 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 <1228 659 gene locus_tag LOCUS_19990 <1228 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924829.1:sigma-54 dependent transcriptional regulator >Feature sequence559 332 1126 gene locus_tag LOCUS_20000 332 1126 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545335.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence560 1009 164 gene locus_tag LOCUS_20010 1009 164 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941121.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence561 <1216 526 gene locus_tag LOCUS_20020 <1216 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546852.1:4Fe-4S dicluster domain-containing protein >Feature sequence562 >Feature sequence563 >Feature sequence564 817 563 gene locus_tag LOCUS_20030 817 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 >Feature sequence565 869 1048 gene locus_tag LOCUS_20040 869 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence566 <1 1034 gene locus_tag LOCUS_20050 <1 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142291.1:glutamate--cysteine ligase >Feature sequence567 >Feature sequence568 159 557 gene locus_tag LOCUS_20060 159 557 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence569 >Feature sequence570 <1 524 gene locus_tag LOCUS_20070 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546577.1:CRISPR-associated ring nuclease Csm6 >Feature sequence571 >Feature sequence572 <1124 469 gene locus_tag LOCUS_20080 <1124 469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965188.1:ABC transporter ATP-binding protein >Feature sequence573 468 764 gene locus_tag LOCUS_20090 468 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941914.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence574 <1097 515 gene locus_tag LOCUS_20100 <1097 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193330362.1:phosphate ABC transporter substrate-binding protein >Feature sequence575 >Feature sequence576 <1 846 gene locus_tag LOCUS_20110 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545970.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB >Feature sequence577 <1 950 gene locus_tag LOCUS_20120 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014584390.1:AAA family ATPase >Feature sequence578 836 141 gene locus_tag LOCUS_20130 836 141 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986926.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence579 36 230 gene locus_tag LOCUS_20140 36 230 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877678.1 protein_id gnl|my_center|LOCUS_20140 217 891 gene locus_tag LOCUS_20150 217 891 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256674.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence580 29 523 gene locus_tag LOCUS_20160 29 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160