>Feature sequence001 140 814 gene locus_tag LOCUS_00010 140 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1591 866 gene locus_tag LOCUS_00020 1591 866 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549457.1 protein_id gnl|my_center|LOCUS_00020 1775 3085 gene locus_tag LOCUS_00030 1775 3085 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025014283.1 protein_id gnl|my_center|LOCUS_00030 3252 3518 gene locus_tag LOCUS_00040 3252 3518 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222012.1 protein_id gnl|my_center|LOCUS_00040 3508 3840 gene locus_tag LOCUS_00050 3508 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4023 4466 gene locus_tag LOCUS_00060 4023 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00060 4429 4788 gene locus_tag LOCUS_00070 4429 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00070 4830 5435 gene locus_tag LOCUS_00080 4830 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00080 5439 5816 gene locus_tag LOCUS_00090 5439 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00090 5905 7158 gene locus_tag LOCUS_00100 5905 7158 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693372.1 protein_id gnl|my_center|LOCUS_00100 7408 7196 gene locus_tag LOCUS_00110 7408 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00110 7970 7350 gene locus_tag LOCUS_00120 7970 7350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00120 8123 9433 gene locus_tag LOCUS_00130 8123 9433 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025014283.1 protein_id gnl|my_center|LOCUS_00130 9928 10284 gene locus_tag LOCUS_00140 9928 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 10295 11023 gene locus_tag LOCUS_00150 10295 11023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 11140 11580 gene locus_tag LOCUS_00160 11140 11580 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549441.1 protein_id gnl|my_center|LOCUS_00160 11596 11973 gene locus_tag LOCUS_00170 11596 11973 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549440.1 protein_id gnl|my_center|LOCUS_00170 11986 12273 gene locus_tag LOCUS_00180 11986 12273 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549438.1 protein_id gnl|my_center|LOCUS_00180 12273 14213 gene locus_tag LOCUS_00190 12273 14213 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549436.1 protein_id gnl|my_center|LOCUS_00190 14849 14205 gene locus_tag LOCUS_00200 14849 14205 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549430.1 protein_id gnl|my_center|LOCUS_00200 14942 15496 gene locus_tag LOCUS_00210 14942 15496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009550763.1 protein_id gnl|my_center|LOCUS_00210 15622 16986 gene locus_tag LOCUS_00220 15622 16986 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211863.1 protein_id gnl|my_center|LOCUS_00220 17195 17043 gene locus_tag LOCUS_00230 17195 17043 CDS product SPJ_0845 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549428.1 protein_id gnl|my_center|LOCUS_00230 18365 17256 gene locus_tag LOCUS_00240 18365 17256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254635.1 protein_id gnl|my_center|LOCUS_00240 20420 18861 gene locus_tag LOCUS_00250 20420 18861 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549425.1 protein_id gnl|my_center|LOCUS_00250 21925 20522 gene locus_tag LOCUS_00260 gene gndA 21925 20522 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254636.1 protein_id gnl|my_center|LOCUS_00260 24520 22712 gene locus_tag LOCUS_00270 gene spxB 24520 22712 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254637.1 protein_id gnl|my_center|LOCUS_00270 26787 24889 gene locus_tag LOCUS_00280 gene mnmG 26787 24889 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549419.1 protein_id gnl|my_center|LOCUS_00280 28180 26795 gene locus_tag LOCUS_00290 gene mnmE 28180 26795 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549418.1 protein_id gnl|my_center|LOCUS_00290 29166 28291 gene locus_tag LOCUS_00300 29166 28291 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254638.1 protein_id gnl|my_center|LOCUS_00300 29536 29168 gene locus_tag LOCUS_00310 gene rnpA 29536 29168 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549413.1 protein_id gnl|my_center|LOCUS_00310 29728 29588 gene locus_tag LOCUS_00320 gene rpmH 29728 29588 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549412.1 protein_id gnl|my_center|LOCUS_00320 30204 31571 gene locus_tag LOCUS_00330 gene dnaA 30204 31571 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011253999.1 protein_id gnl|my_center|LOCUS_00330 31746 32876 gene locus_tag LOCUS_00340 gene dnaN 31746 32876 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549381.1 protein_id gnl|my_center|LOCUS_00340 33099 33314 gene locus_tag LOCUS_00350 gene yaaA 33099 33314 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254000.1 protein_id gnl|my_center|LOCUS_00350 33323 34450 gene locus_tag LOCUS_00360 gene recF 33323 34450 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549377.1 protein_id gnl|my_center|LOCUS_00360 34451 36415 gene locus_tag LOCUS_00370 gene gyrB 34451 36415 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549374.1 protein_id gnl|my_center|LOCUS_00370 36425 38905 gene locus_tag LOCUS_00380 gene gyrA 36425 38905 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549372.1 protein_id gnl|my_center|LOCUS_00380 39123 39419 gene locus_tag LOCUS_00390 gene rpsF 39123 39419 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549370.1 protein_id gnl|my_center|LOCUS_00390 39469 39987 gene locus_tag LOCUS_00400 gene ssb 39469 39987 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254001.1 protein_id gnl|my_center|LOCUS_00400 40015 40251 gene locus_tag LOCUS_00410 gene rpsR 40015 40251 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549366.1 protein_id gnl|my_center|LOCUS_00410 40779 40309 gene locus_tag LOCUS_00420 40779 40309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 40884 41762 gene locus_tag LOCUS_00430 40884 41762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 41903 43018 gene locus_tag LOCUS_00440 41903 43018 CDS product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014565478.1 protein_id gnl|my_center|LOCUS_00440 43302 43108 gene locus_tag LOCUS_00450 43302 43108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 43229 45250 gene locus_tag LOCUS_00460 43229 45250 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549345.1 protein_id gnl|my_center|LOCUS_00460 45262 45717 gene locus_tag LOCUS_00470 gene rplI 45262 45717 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549343.1 protein_id gnl|my_center|LOCUS_00470 45737 47128 gene locus_tag LOCUS_00480 gene dnaB 45737 47128 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549341.1 protein_id gnl|my_center|LOCUS_00480 47296 48231 gene locus_tag LOCUS_00490 gene phnD 47296 48231 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254002.1 protein_id gnl|my_center|LOCUS_00490 48341 49270 gene locus_tag LOCUS_00500 48341 49270 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549336.1 protein_id gnl|my_center|LOCUS_00500 49386 50264 gene locus_tag LOCUS_00510 49386 50264 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254003.1 protein_id gnl|my_center|LOCUS_00510 50412 50603 gene locus_tag LOCUS_00520 50412 50603 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549333.1 protein_id gnl|my_center|LOCUS_00520 50654 50911 gene locus_tag LOCUS_00530 50654 50911 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546917.1 protein_id gnl|my_center|LOCUS_00530 52192 50963 gene locus_tag LOCUS_00540 52192 50963 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254005.1 protein_id gnl|my_center|LOCUS_00540 >Feature sequence002 1224 172 gene locus_tag LOCUS_00550 gene cobT 1224 172 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437772.1 protein_id gnl|my_center|LOCUS_00550 1936 1226 gene locus_tag LOCUS_00560 1936 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 2540 1950 gene locus_tag LOCUS_00570 gene cobC 2540 1950 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933053.1 protein_id gnl|my_center|LOCUS_00570 3298 2537 gene locus_tag LOCUS_00580 gene cobS 3298 2537 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836544.1 protein_id gnl|my_center|LOCUS_00580 3897 3307 gene locus_tag LOCUS_00590 gene cobU 3897 3307 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836543.1 protein_id gnl|my_center|LOCUS_00590 5254 3959 gene locus_tag LOCUS_00600 gene hemL 5254 3959 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398699.1 protein_id gnl|my_center|LOCUS_00600 6245 5274 gene locus_tag LOCUS_00610 gene hemB 6245 5274 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836541.1 protein_id gnl|my_center|LOCUS_00610 7168 6251 gene locus_tag LOCUS_00620 gene hemC 7168 6251 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723240.1 protein_id gnl|my_center|LOCUS_00620 8423 7158 gene locus_tag LOCUS_00630 gene hemA 8423 7158 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723241.1 protein_id gnl|my_center|LOCUS_00630 8884 8426 gene locus_tag LOCUS_00640 8884 8426 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009659744.1 protein_id gnl|my_center|LOCUS_00640 10404 8893 gene locus_tag LOCUS_00650 10404 8893 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836536.1 protein_id gnl|my_center|LOCUS_00650 11309 10500 gene locus_tag LOCUS_00660 11309 10500 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989706.1 protein_id gnl|my_center|LOCUS_00660 11996 11319 gene locus_tag LOCUS_00670 11996 11319 CDS product energy-coupling factor ABC transporter transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721604.1 protein_id gnl|my_center|LOCUS_00670 12345 12022 gene locus_tag LOCUS_00680 12345 12022 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721603.1 protein_id gnl|my_center|LOCUS_00680 13085 12342 gene locus_tag LOCUS_00690 13085 12342 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901131.1 protein_id gnl|my_center|LOCUS_00690 13786 13088 gene locus_tag LOCUS_00700 13786 13088 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836533.1 protein_id gnl|my_center|LOCUS_00700 14568 13792 gene locus_tag LOCUS_00710 14568 13792 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721600.1 protein_id gnl|my_center|LOCUS_00710 15955 14561 gene locus_tag LOCUS_00720 gene cobA 15955 14561 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836532.1 protein_id gnl|my_center|LOCUS_00720 16703 15945 gene locus_tag LOCUS_00730 gene cobK 16703 15945 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721598.1 protein_id gnl|my_center|LOCUS_00730 17425 16700 gene locus_tag LOCUS_00740 gene cobJ 17425 16700 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896461.1 protein_id gnl|my_center|LOCUS_00740 18492 17437 gene locus_tag LOCUS_00750 gene cbiG 18492 17437 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901140.1 protein_id gnl|my_center|LOCUS_00750 19256 18495 gene locus_tag LOCUS_00760 19256 18495 CDS product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896463.1 protein_id gnl|my_center|LOCUS_00760 19825 19271 gene locus_tag LOCUS_00770 19825 19271 CDS product decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836530.1 protein_id gnl|my_center|LOCUS_00770 20368 19967 gene locus_tag LOCUS_00780 20368 19967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00780 21516 20365 gene locus_tag LOCUS_00790 gene cbiD 21516 20365 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836528.1 protein_id gnl|my_center|LOCUS_00790 22180 21494 gene locus_tag LOCUS_00800 22180 21494 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721591.1 protein_id gnl|my_center|LOCUS_00800 23145 22186 gene locus_tag LOCUS_00810 gene cbiB 23145 22186 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989705.1 protein_id gnl|my_center|LOCUS_00810 24506 23142 gene locus_tag LOCUS_00820 24506 23142 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917659.1 protein_id gnl|my_center|LOCUS_00820 25591 24503 gene locus_tag LOCUS_00830 gene cobD 25591 24503 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926914.1 protein_id gnl|my_center|LOCUS_00830 25949 26515 gene locus_tag LOCUS_00840 25949 26515 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382343.1 protein_id gnl|my_center|LOCUS_00840 27413 26574 gene locus_tag LOCUS_00850 27413 26574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 27886 27437 gene locus_tag LOCUS_00860 27886 27437 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286465.1 protein_id gnl|my_center|LOCUS_00860 27994 28422 gene locus_tag LOCUS_00870 27994 28422 CDS product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836561.1 protein_id gnl|my_center|LOCUS_00870 28975 28415 gene locus_tag LOCUS_00880 28975 28415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 29604 28972 gene locus_tag LOCUS_00890 29604 28972 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646364.1 protein_id gnl|my_center|LOCUS_00890 30546 29752 gene locus_tag LOCUS_00900 30546 29752 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548752.1 protein_id gnl|my_center|LOCUS_00900 30963 30616 gene locus_tag LOCUS_00910 gene eutS 30963 30616 CDS product ethanolamine utilization microcompartment protein EutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721543.1 protein_id gnl|my_center|LOCUS_00910 32166 30979 gene locus_tag LOCUS_00920 32166 30979 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 protein_id gnl|my_center|LOCUS_00920 33311 32190 gene locus_tag LOCUS_00930 33311 32190 CDS product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989698.1 protein_id gnl|my_center|LOCUS_00930 34756 33329 gene locus_tag LOCUS_00940 34756 33329 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989697.1 protein_id gnl|my_center|LOCUS_00940 35232 34759 gene locus_tag LOCUS_00950 35232 34759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00950 35822 35235 gene locus_tag LOCUS_00960 35822 35235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 36121 35843 gene locus_tag LOCUS_00970 36121 35843 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736331.1 protein_id gnl|my_center|LOCUS_00970 36606 36103 gene locus_tag LOCUS_00980 36606 36103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 37281 36637 gene locus_tag LOCUS_00990 37281 36637 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816695.1 protein_id gnl|my_center|LOCUS_00990 37591 37304 gene locus_tag LOCUS_01000 gene eutM 37591 37304 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895463.1 protein_id gnl|my_center|LOCUS_01000 38173 37604 gene locus_tag LOCUS_01010 gene pduK 38173 37604 CDS product propanediol utilization microcompartment protein PduK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284376.1 protein_id gnl|my_center|LOCUS_01010 38537 38181 gene locus_tag LOCUS_01020 38537 38181 CDS product glycerol dehydratase reactivase beta/small subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444012.1 protein_id gnl|my_center|LOCUS_01020 40374 38527 gene locus_tag LOCUS_01030 40374 38527 CDS product diol dehydratase reactivase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931948.1 protein_id gnl|my_center|LOCUS_01030 40917 40402 gene locus_tag LOCUS_01040 40917 40402 CDS product diol dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836574.1 protein_id gnl|my_center|LOCUS_01040 41641 40931 gene locus_tag LOCUS_01050 41641 40931 CDS product propanediol/glycerol family dehydratase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836573.1 protein_id gnl|my_center|LOCUS_01050 43335 41659 gene locus_tag LOCUS_01060 43335 41659 CDS product propanediol/glycerol family dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008947521.1 protein_id gnl|my_center|LOCUS_01060 44076 43360 gene locus_tag LOCUS_01070 gene pduB 44076 43360 CDS product propanediol utilization microcompartment protein PduB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721551.1 protein_id gnl|my_center|LOCUS_01070 44452 44174 gene locus_tag LOCUS_01080 gene pduA 44452 44174 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388660.1 protein_id gnl|my_center|LOCUS_01080 44707 45801 gene locus_tag LOCUS_01090 44707 45801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 >Feature sequence003 238 59 gene locus_tag LOCUS_01100 238 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 1038 589 gene locus_tag LOCUS_01110 1038 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 1450 1064 gene locus_tag LOCUS_01120 1450 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 1830 1453 gene locus_tag LOCUS_01130 1830 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 2140 1868 gene locus_tag LOCUS_01140 2140 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 2022 2861 gene locus_tag LOCUS_01150 2022 2861 CDS product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254624.1 protein_id gnl|my_center|LOCUS_01150 3866 3009 gene locus_tag LOCUS_01160 3866 3009 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549634.1 protein_id gnl|my_center|LOCUS_01160 5227 3869 gene locus_tag LOCUS_01170 5227 3869 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549632.1 protein_id gnl|my_center|LOCUS_01170 6528 5302 gene locus_tag LOCUS_01180 6528 5302 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549630.1 protein_id gnl|my_center|LOCUS_01180 7749 6643 gene locus_tag LOCUS_01190 7749 6643 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549629.1 protein_id gnl|my_center|LOCUS_01190 8433 7771 gene locus_tag LOCUS_01200 gene pgmB 8433 7771 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549628.1 protein_id gnl|my_center|LOCUS_01200 10690 8426 gene locus_tag LOCUS_01210 10690 8426 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549627.1 protein_id gnl|my_center|LOCUS_01210 12583 10862 gene locus_tag LOCUS_01220 12583 10862 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549626.1 protein_id gnl|my_center|LOCUS_01220 14248 12587 gene locus_tag LOCUS_01230 14248 12587 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254601.1 protein_id gnl|my_center|LOCUS_01230 14789 14361 gene locus_tag LOCUS_01240 14789 14361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 15965 14790 gene locus_tag LOCUS_01250 15965 14790 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254602.1 protein_id gnl|my_center|LOCUS_01250 17044 16094 gene locus_tag LOCUS_01260 17044 16094 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549622.1 protein_id gnl|my_center|LOCUS_01260 17825 17052 gene locus_tag LOCUS_01270 17825 17052 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549621.1 protein_id gnl|my_center|LOCUS_01270 19380 17881 gene locus_tag LOCUS_01280 gene glpK 19380 17881 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549614.1 protein_id gnl|my_center|LOCUS_01280 19505 20320 gene locus_tag LOCUS_01290 gene thiD 19505 20320 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549612.1 protein_id gnl|my_center|LOCUS_01290 21087 20662 gene locus_tag LOCUS_01300 21087 20662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 21984 21151 gene locus_tag LOCUS_01310 21984 21151 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548592.1 protein_id gnl|my_center|LOCUS_01310 22343 22086 gene locus_tag LOCUS_01320 22343 22086 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588503.1 protein_id gnl|my_center|LOCUS_01320 22615 22340 gene locus_tag LOCUS_01330 22615 22340 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125586694.1 protein_id gnl|my_center|LOCUS_01330 24035 22809 gene locus_tag LOCUS_01340 24035 22809 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254348.1 protein_id gnl|my_center|LOCUS_01340 25867 24263 gene locus_tag LOCUS_01350 25867 24263 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673980.1 protein_id gnl|my_center|LOCUS_01350 26062 26472 gene locus_tag LOCUS_01360 26062 26472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 26478 26669 gene locus_tag LOCUS_01370 26478 26669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 26841 27527 gene locus_tag LOCUS_01380 26841 27527 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549605.1 protein_id gnl|my_center|LOCUS_01380 28057 27572 gene locus_tag LOCUS_01390 28057 27572 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254605.1 protein_id gnl|my_center|LOCUS_01390 28252 28602 gene locus_tag LOCUS_01400 28252 28602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 28693 29010 gene locus_tag LOCUS_01410 28693 29010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 29000 29281 gene locus_tag LOCUS_01420 29000 29281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 30184 29300 gene locus_tag LOCUS_01430 30184 29300 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549601.1 protein_id gnl|my_center|LOCUS_01430 31227 30307 gene locus_tag LOCUS_01440 31227 30307 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549600.1 protein_id gnl|my_center|LOCUS_01440 31975 31310 gene locus_tag LOCUS_01450 31975 31310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 32685 32041 gene locus_tag LOCUS_01460 32685 32041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 33332 32700 gene locus_tag LOCUS_01470 33332 32700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549596.1 protein_id gnl|my_center|LOCUS_01470 33444 34475 gene locus_tag LOCUS_01480 33444 34475 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549434.1 protein_id gnl|my_center|LOCUS_01480 34655 36052 gene locus_tag LOCUS_01490 gene abc-f 34655 36052 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153754.1 protein_id gnl|my_center|LOCUS_01490 36572 36078 gene locus_tag LOCUS_01500 36572 36078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 37035 36676 gene locus_tag LOCUS_01510 37035 36676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254606.1 protein_id gnl|my_center|LOCUS_01510 37448 37128 gene locus_tag LOCUS_01520 37448 37128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 38116 37451 gene locus_tag LOCUS_01530 38116 37451 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921830.1 protein_id gnl|my_center|LOCUS_01530 40109 38127 gene locus_tag LOCUS_01540 40109 38127 CDS product DUF1430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862013.1 protein_id gnl|my_center|LOCUS_01540 40454 40164 gene locus_tag LOCUS_01550 40454 40164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 41419 40604 gene locus_tag LOCUS_01560 41419 40604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 >Feature sequence004 169 375 gene locus_tag LOCUS_01570 169 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 2396 960 gene locus_tag LOCUS_01580 2396 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 2829 2389 gene locus_tag LOCUS_01590 2829 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 3143 2826 gene locus_tag LOCUS_01600 3143 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 3644 3156 gene locus_tag LOCUS_01610 3644 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 3842 3657 gene locus_tag LOCUS_01620 3842 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 4331 3855 gene locus_tag LOCUS_01630 4331 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 4592 4344 gene locus_tag LOCUS_01640 4592 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 4776 4606 gene locus_tag LOCUS_01650 4776 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 8779 4808 gene locus_tag LOCUS_01660 8779 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 11447 8781 gene locus_tag LOCUS_01670 11447 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 12335 11460 gene locus_tag LOCUS_01680 12335 11460 CDS product phage tail family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475662.1 protein_id gnl|my_center|LOCUS_01680 16940 12351 gene locus_tag LOCUS_01690 16940 12351 CDS product tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475661.1 protein_id gnl|my_center|LOCUS_01690 17561 17211 gene locus_tag LOCUS_01700 17561 17211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 18286 17669 gene locus_tag LOCUS_01710 18286 17669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 18698 18321 gene locus_tag LOCUS_01720 18698 18321 CDS product DUF806 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475656.1 protein_id gnl|my_center|LOCUS_01720 19132 18695 gene locus_tag LOCUS_01730 19132 18695 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905382.1 protein_id gnl|my_center|LOCUS_01730 19487 19125 gene locus_tag LOCUS_01740 19487 19125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 19827 19477 gene locus_tag LOCUS_01750 19827 19477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 21022 19841 gene locus_tag LOCUS_01760 21022 19841 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475652.1 protein_id gnl|my_center|LOCUS_01760 21645 21022 gene locus_tag LOCUS_01770 21645 21022 CDS product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080656303.1 protein_id gnl|my_center|LOCUS_01770 22238 21651 gene locus_tag LOCUS_01780 22238 21651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01780 22824 22249 gene locus_tag LOCUS_01790 22824 22249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01790 23020 22841 gene locus_tag LOCUS_01800 23020 22841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 24884 23013 gene locus_tag LOCUS_01810 24884 23013 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475648.1 protein_id gnl|my_center|LOCUS_01810 25336 24881 gene locus_tag LOCUS_01820 25336 24881 CDS product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475647.1 protein_id gnl|my_center|LOCUS_01820 25916 25461 gene locus_tag LOCUS_01830 25916 25461 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475646.1 protein_id gnl|my_center|LOCUS_01830 26065 26241 gene locus_tag LOCUS_01840 26065 26241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 26300 26683 gene locus_tag LOCUS_01850 26300 26683 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_01850 26807 26673 gene locus_tag LOCUS_01860 26807 26673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 27017 26835 gene locus_tag LOCUS_01870 27017 26835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 27391 27023 gene locus_tag LOCUS_01880 27391 27023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 28823 28401 gene locus_tag LOCUS_01890 28823 28401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 29231 29031 gene locus_tag LOCUS_01900 29231 29031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 29474 29319 gene locus_tag LOCUS_01910 29474 29319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 29886 29461 gene locus_tag LOCUS_01920 29886 29461 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101098.1 protein_id gnl|my_center|LOCUS_01920 30137 29943 gene locus_tag LOCUS_01930 30137 29943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 30325 30137 gene locus_tag LOCUS_01940 30325 30137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 30558 30325 gene locus_tag LOCUS_01950 30558 30325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 30752 30558 gene locus_tag LOCUS_01960 30752 30558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 30948 30796 gene locus_tag LOCUS_01970 30948 30796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 31223 30945 gene locus_tag LOCUS_01980 31223 30945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 31563 31210 gene locus_tag LOCUS_01990 31563 31210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 31972 31553 gene locus_tag LOCUS_02000 31972 31553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 32682 31984 gene locus_tag LOCUS_02010 32682 31984 CDS product phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286562.1 protein_id gnl|my_center|LOCUS_02010 33175 32786 gene locus_tag LOCUS_02020 33175 32786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 33501 33172 gene locus_tag LOCUS_02030 33501 33172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 34357 33494 gene locus_tag LOCUS_02040 34357 33494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 34679 34344 gene locus_tag LOCUS_02050 34679 34344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 35599 34682 gene locus_tag LOCUS_02060 35599 34682 CDS product PD-(D/E)XK nuclease-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021732641.1 protein_id gnl|my_center|LOCUS_02060 36422 35490 gene locus_tag LOCUS_02070 36422 35490 CDS product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101092.1 protein_id gnl|my_center|LOCUS_02070 36598 36422 gene locus_tag LOCUS_02080 36598 36422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 >Feature sequence005 2160 823 gene locus_tag LOCUS_02090 2160 823 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107343.1 protein_id gnl|my_center|LOCUS_02090 3301 2168 gene locus_tag LOCUS_02100 3301 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 4202 3279 gene locus_tag LOCUS_02110 4202 3279 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765273.1 protein_id gnl|my_center|LOCUS_02110 5338 4199 gene locus_tag LOCUS_02120 5338 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 6358 5372 gene locus_tag LOCUS_02130 6358 5372 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970524.1 protein_id gnl|my_center|LOCUS_02130 6751 6365 gene locus_tag LOCUS_02140 6751 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 7392 6955 gene locus_tag LOCUS_02150 7392 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 8425 7367 gene locus_tag LOCUS_02160 8425 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 8849 8388 gene locus_tag LOCUS_02170 8849 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 8923 9213 gene locus_tag LOCUS_02180 8923 9213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 10022 9612 gene locus_tag LOCUS_02190 10022 9612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 11218 10256 gene locus_tag LOCUS_02200 11218 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 12142 11243 gene locus_tag LOCUS_02210 12142 11243 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202469.1 protein_id gnl|my_center|LOCUS_02210 13656 12682 gene locus_tag LOCUS_02220 13656 12682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008619648.1 protein_id gnl|my_center|LOCUS_02220 14426 13668 gene locus_tag LOCUS_02230 14426 13668 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547977.1 protein_id gnl|my_center|LOCUS_02230 14742 14482 gene locus_tag LOCUS_02240 14742 14482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 16829 15540 gene locus_tag LOCUS_02250 16829 15540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 18365 16833 gene locus_tag LOCUS_02260 18365 16833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039965.1 protein_id gnl|my_center|LOCUS_02260 19480 18365 gene locus_tag LOCUS_02270 19480 18365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 21274 19481 gene locus_tag LOCUS_02280 21274 19481 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202462.1 protein_id gnl|my_center|LOCUS_02280 22731 21277 gene locus_tag LOCUS_02290 22731 21277 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117645.1 protein_id gnl|my_center|LOCUS_02290 23025 22762 gene locus_tag LOCUS_02300 23025 22762 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032551169.1 protein_id gnl|my_center|LOCUS_02300 23306 23022 gene locus_tag LOCUS_02310 23306 23022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 23488 23321 gene locus_tag LOCUS_02320 23488 23321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 24475 23501 gene locus_tag LOCUS_02330 24475 23501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 26435 24468 gene locus_tag LOCUS_02340 26435 24468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 28804 26432 gene locus_tag LOCUS_02350 28804 26432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 29792 28893 gene locus_tag LOCUS_02360 29792 28893 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658378.1 protein_id gnl|my_center|LOCUS_02360 30185 29829 gene locus_tag LOCUS_02370 30185 29829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 >Feature sequence006 544 1176 gene locus_tag LOCUS_02380 544 1176 CDS product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531736.1 protein_id gnl|my_center|LOCUS_02380 1241 1525 gene locus_tag LOCUS_02390 1241 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 1864 1706 gene locus_tag LOCUS_02400 1864 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 2038 3264 gene locus_tag LOCUS_02410 gene acmB 2038 3264 CDS product beta-N-acetylglucosaminidase AcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548795.1 protein_id gnl|my_center|LOCUS_02410 3284 3493 gene locus_tag LOCUS_02420 3284 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02420 3623 4372 gene locus_tag LOCUS_02430 3623 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02430 4462 6300 gene locus_tag LOCUS_02440 4462 6300 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254067.1 protein_id gnl|my_center|LOCUS_02440 6992 6345 gene locus_tag LOCUS_02450 gene pcp 6992 6345 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592791.1 protein_id gnl|my_center|LOCUS_02450 7991 7026 gene locus_tag LOCUS_02460 7991 7026 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548798.1 protein_id gnl|my_center|LOCUS_02460 8805 7999 gene locus_tag LOCUS_02470 8805 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548799.1 protein_id gnl|my_center|LOCUS_02470 9375 8890 gene locus_tag LOCUS_02480 9375 8890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 9563 9339 gene locus_tag LOCUS_02490 9563 9339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 9719 10411 gene locus_tag LOCUS_02500 9719 10411 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548802.1 protein_id gnl|my_center|LOCUS_02500 10689 11249 gene locus_tag LOCUS_02510 10689 11249 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548814.1 protein_id gnl|my_center|LOCUS_02510 11355 12455 gene locus_tag LOCUS_02520 11355 12455 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548816.1 protein_id gnl|my_center|LOCUS_02520 12455 13069 gene locus_tag LOCUS_02530 12455 13069 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548818.1 protein_id gnl|my_center|LOCUS_02530 13239 16097 gene locus_tag LOCUS_02540 13239 16097 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548819.1 protein_id gnl|my_center|LOCUS_02540 16217 17593 gene locus_tag LOCUS_02550 16217 17593 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254068.1 protein_id gnl|my_center|LOCUS_02550 17847 19109 gene locus_tag LOCUS_02560 gene tyrS 17847 19109 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548823.1 protein_id gnl|my_center|LOCUS_02560 19526 19882 gene locus_tag LOCUS_02570 19526 19882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549279.1 protein_id gnl|my_center|LOCUS_02570 20000 20072 gene locus_tag LOCUS_t00010 20000 20072 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 20107 21420 gene locus_tag LOCUS_02580 20107 21420 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254069.1 protein_id gnl|my_center|LOCUS_02580 21420 22073 gene locus_tag LOCUS_02590 21420 22073 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254070.1 protein_id gnl|my_center|LOCUS_02590 22241 23860 gene locus_tag LOCUS_02600 22241 23860 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548835.1 protein_id gnl|my_center|LOCUS_02600 24049 25677 gene locus_tag LOCUS_02610 24049 25677 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254071.1 protein_id gnl|my_center|LOCUS_02610 25850 26992 gene locus_tag LOCUS_02620 25850 26992 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254072.1 protein_id gnl|my_center|LOCUS_02620 27161 28090 gene locus_tag LOCUS_02630 27161 28090 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254073.1 protein_id gnl|my_center|LOCUS_02630 28099 29130 gene locus_tag LOCUS_02640 28099 29130 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254074.1 protein_id gnl|my_center|LOCUS_02640 >Feature sequence007 438 58 gene locus_tag LOCUS_02650 438 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 1147 431 gene locus_tag LOCUS_02660 1147 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 1875 1144 gene locus_tag LOCUS_02670 1875 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 2205 1930 gene locus_tag LOCUS_02680 2205 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 4354 2957 gene locus_tag LOCUS_02690 4354 2957 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549571.1 protein_id gnl|my_center|LOCUS_02690 5098 4367 gene locus_tag LOCUS_02700 5098 4367 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254611.1 protein_id gnl|my_center|LOCUS_02700 6678 5305 gene locus_tag LOCUS_02710 6678 5305 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549564.1 protein_id gnl|my_center|LOCUS_02710 8100 6751 gene locus_tag LOCUS_02720 8100 6751 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549562.1 protein_id gnl|my_center|LOCUS_02720 8895 8263 gene locus_tag LOCUS_02730 gene lepB 8895 8263 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549558.1 protein_id gnl|my_center|LOCUS_02730 10566 8980 gene locus_tag LOCUS_02740 10566 8980 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033165.1 protein_id gnl|my_center|LOCUS_02740 13058 10932 gene locus_tag LOCUS_02750 13058 10932 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254615.1 protein_id gnl|my_center|LOCUS_02750 14280 13390 gene locus_tag LOCUS_02760 14280 13390 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549553.1 protein_id gnl|my_center|LOCUS_02760 15484 14261 gene locus_tag LOCUS_02770 15484 14261 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549552.1 protein_id gnl|my_center|LOCUS_02770 15659 16363 gene locus_tag LOCUS_02780 15659 16363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549550.1 protein_id gnl|my_center|LOCUS_02780 16373 18913 gene locus_tag LOCUS_02790 16373 18913 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613435.1 protein_id gnl|my_center|LOCUS_02790 18960 19196 gene locus_tag LOCUS_02800 18960 19196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549540.1 protein_id gnl|my_center|LOCUS_02800 20915 19299 gene locus_tag LOCUS_02810 20915 19299 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254617.1 protein_id gnl|my_center|LOCUS_02810 21205 22134 gene locus_tag LOCUS_02820 21205 22134 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254618.1 protein_id gnl|my_center|LOCUS_02820 22922 22206 gene locus_tag LOCUS_02830 22922 22206 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254619.1 protein_id gnl|my_center|LOCUS_02830 24179 23238 gene locus_tag LOCUS_02840 24179 23238 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549527.1 protein_id gnl|my_center|LOCUS_02840 25465 24179 gene locus_tag LOCUS_02850 gene dltD 25465 24179 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549525.1 protein_id gnl|my_center|LOCUS_02850 25697 25458 gene locus_tag LOCUS_02860 gene dltC 25697 25458 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549523.1 protein_id gnl|my_center|LOCUS_02860 <26893 25756 gene locus_tag LOCUS_02870 <26893 25756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254621.1:D-alanyl-lipoteichoic acid biosynthesis protein DltB >Feature sequence008 1656 253 gene locus_tag LOCUS_02880 1656 253 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965834.1 protein_id gnl|my_center|LOCUS_02880 2049 1864 gene locus_tag LOCUS_02890 2049 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549727.1 protein_id gnl|my_center|LOCUS_02890 2255 2064 gene locus_tag LOCUS_02900 2255 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 2953 2630 gene locus_tag LOCUS_02910 2953 2630 CDS product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549725.1 protein_id gnl|my_center|LOCUS_02910 3844 3095 gene locus_tag LOCUS_02920 3844 3095 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549723.1 protein_id gnl|my_center|LOCUS_02920 5425 3854 gene locus_tag LOCUS_02930 5425 3854 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254584.1 protein_id gnl|my_center|LOCUS_02930 6632 5478 gene locus_tag LOCUS_02940 6632 5478 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549721.1 protein_id gnl|my_center|LOCUS_02940 7320 6634 gene locus_tag LOCUS_02950 7320 6634 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549720.1 protein_id gnl|my_center|LOCUS_02950 7508 7801 gene locus_tag LOCUS_02960 7508 7801 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993678.1 protein_id gnl|my_center|LOCUS_02960 9266 8025 gene locus_tag LOCUS_02970 9266 8025 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476549.1 protein_id gnl|my_center|LOCUS_02970 9735 9403 gene locus_tag LOCUS_02980 9735 9403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 11664 9799 gene locus_tag LOCUS_02990 11664 9799 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721608.1 protein_id gnl|my_center|LOCUS_02990 13398 11674 gene locus_tag LOCUS_03000 13398 11674 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254586.1 protein_id gnl|my_center|LOCUS_03000 14330 13545 gene locus_tag LOCUS_03010 14330 13545 CDS product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549711.1 protein_id gnl|my_center|LOCUS_03010 15439 14339 gene locus_tag LOCUS_03020 gene ychF 15439 14339 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549709.1 protein_id gnl|my_center|LOCUS_03020 15756 15493 gene locus_tag LOCUS_03030 15756 15493 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549703.1 protein_id gnl|my_center|LOCUS_03030 16636 15749 gene locus_tag LOCUS_03040 16636 15749 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549701.1 protein_id gnl|my_center|LOCUS_03040 17402 16614 gene locus_tag LOCUS_03050 17402 16614 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254587.1 protein_id gnl|my_center|LOCUS_03050 18248 17412 gene locus_tag LOCUS_03060 gene noc 18248 17412 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254588.1 protein_id gnl|my_center|LOCUS_03060 18988 18266 gene locus_tag LOCUS_03070 gene rsmG 18988 18266 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 protein_id gnl|my_center|LOCUS_03070 19150 19686 gene locus_tag LOCUS_03080 19150 19686 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549693.1 protein_id gnl|my_center|LOCUS_03080 20912 19983 gene locus_tag LOCUS_03090 20912 19983 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549691.1 protein_id gnl|my_center|LOCUS_03090 21706 20915 gene locus_tag LOCUS_03100 21706 20915 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549690.1 protein_id gnl|my_center|LOCUS_03100 22346 21798 gene locus_tag LOCUS_03110 22346 21798 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549689.1 protein_id gnl|my_center|LOCUS_03110 22899 22360 gene locus_tag LOCUS_03120 22899 22360 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549688.1 protein_id gnl|my_center|LOCUS_03120 23675 23052 gene locus_tag LOCUS_03130 23675 23052 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549687.1 protein_id gnl|my_center|LOCUS_03130 24045 23803 gene locus_tag LOCUS_03140 24045 23803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007126009.1 protein_id gnl|my_center|LOCUS_03140 24154 25566 gene locus_tag LOCUS_03150 24154 25566 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549685.1 protein_id gnl|my_center|LOCUS_03150 >Feature sequence009 13 88 gene locus_tag LOCUS_t00020 13 88 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 161 805 gene locus_tag LOCUS_03160 161 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 828 971 gene locus_tag LOCUS_03170 828 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 958 2232 gene locus_tag LOCUS_03180 958 2232 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_03180 2248 3747 gene locus_tag LOCUS_03190 2248 3747 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921892.1 protein_id gnl|my_center|LOCUS_03190 3677 3964 gene locus_tag LOCUS_03200 3677 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 3971 5074 gene locus_tag LOCUS_03210 3971 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 5067 5273 gene locus_tag LOCUS_03220 5067 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 5443 6093 gene locus_tag LOCUS_03230 5443 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 6096 6461 gene locus_tag LOCUS_03240 6096 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076614581.1 protein_id gnl|my_center|LOCUS_03240 6482 7531 gene locus_tag LOCUS_03250 6482 7531 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674646.1 protein_id gnl|my_center|LOCUS_03250 7550 7858 gene locus_tag LOCUS_03260 7550 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 7855 8208 gene locus_tag LOCUS_03270 7855 8208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 8201 8749 gene locus_tag LOCUS_03280 8201 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 8750 9118 gene locus_tag LOCUS_03290 8750 9118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 9121 9618 gene locus_tag LOCUS_03300 9121 9618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 9686 10099 gene locus_tag LOCUS_03310 9686 10099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 10192 10479 gene locus_tag LOCUS_03320 10192 10479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 10479 15632 gene locus_tag LOCUS_03330 10479 15632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 15619 16521 gene locus_tag LOCUS_03340 15619 16521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 16539 16895 gene locus_tag LOCUS_03350 16539 16895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 16907 22243 gene locus_tag LOCUS_03360 16907 22243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 22236 22394 gene locus_tag LOCUS_03370 22236 22394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 22378 22638 gene locus_tag LOCUS_03380 22378 22638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905730.1 protein_id gnl|my_center|LOCUS_03380 22638 23036 gene locus_tag LOCUS_03390 22638 23036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 23050 23268 gene locus_tag LOCUS_03400 23050 23268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 23265 23609 gene locus_tag LOCUS_03410 23265 23609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 23613 24548 gene locus_tag LOCUS_03420 23613 24548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 24974 25192 gene locus_tag LOCUS_03430 24974 25192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 >Feature sequence010 363 202 gene locus_tag LOCUS_03440 363 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 918 517 gene locus_tag LOCUS_03450 918 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 1759 1487 gene locus_tag LOCUS_03460 1759 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 2125 2526 gene locus_tag LOCUS_03470 2125 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 3089 3226 gene locus_tag LOCUS_03480 3089 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 3546 3698 gene locus_tag LOCUS_03490 3546 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 4169 4477 gene locus_tag LOCUS_03500 4169 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 4786 4962 gene locus_tag LOCUS_03510 4786 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 5097 5255 gene locus_tag LOCUS_03520 5097 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 5316 5630 gene locus_tag LOCUS_03530 5316 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 6171 6347 gene locus_tag LOCUS_03540 6171 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 6476 6652 gene locus_tag LOCUS_03550 6476 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 6676 6981 gene locus_tag LOCUS_03560 6676 6981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 7757 8194 gene locus_tag LOCUS_03570 7757 8194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 8292 8474 gene locus_tag LOCUS_03580 8292 8474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 8492 9160 gene locus_tag LOCUS_03590 8492 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 9172 9525 gene locus_tag LOCUS_03600 9172 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 9666 10118 gene locus_tag LOCUS_03610 9666 10118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 10295 10453 gene locus_tag LOCUS_03620 10295 10453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 10511 10729 gene locus_tag LOCUS_03630 10511 10729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 10787 10966 gene locus_tag LOCUS_03640 10787 10966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 11122 11367 gene locus_tag LOCUS_03650 11122 11367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 11360 11545 gene locus_tag LOCUS_03660 11360 11545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 11547 11738 gene locus_tag LOCUS_03670 11547 11738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 12107 12808 gene locus_tag LOCUS_03680 12107 12808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 13211 13561 gene locus_tag LOCUS_03690 13211 13561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 13864 14034 gene locus_tag LOCUS_03700 13864 14034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 14058 14234 gene locus_tag LOCUS_03710 14058 14234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 14354 14725 gene locus_tag LOCUS_03720 14354 14725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 14859 15089 gene locus_tag LOCUS_03730 14859 15089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 15120 15350 gene locus_tag LOCUS_03740 15120 15350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 15696 16070 gene locus_tag LOCUS_03750 15696 16070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 16219 16413 gene locus_tag LOCUS_03760 16219 16413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 16410 16556 gene locus_tag LOCUS_03770 16410 16556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 16549 16707 gene locus_tag LOCUS_03780 16549 16707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 17060 17419 gene locus_tag LOCUS_03790 17060 17419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 18163 18549 gene locus_tag LOCUS_03800 18163 18549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 18841 19074 gene locus_tag LOCUS_03810 18841 19074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 19189 19566 gene locus_tag LOCUS_03820 19189 19566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 19618 19881 gene locus_tag LOCUS_03830 19618 19881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 20043 20588 gene locus_tag LOCUS_03840 20043 20588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 20875 21078 gene locus_tag LOCUS_03850 20875 21078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 21093 21368 gene locus_tag LOCUS_03860 21093 21368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 22784 22614 gene locus_tag LOCUS_03870 22784 22614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 23453 23223 gene locus_tag LOCUS_03880 23453 23223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 23727 23470 gene locus_tag LOCUS_03890 23727 23470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 >Feature sequence011 1608 94 gene locus_tag LOCUS_03900 gene dltA 1608 94 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549519.1 protein_id gnl|my_center|LOCUS_03900 1776 1624 gene locus_tag LOCUS_03910 1776 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 3383 2247 gene locus_tag LOCUS_03920 3383 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549513.1 protein_id gnl|my_center|LOCUS_03920 4058 3783 gene locus_tag LOCUS_03930 4058 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 3967 4437 gene locus_tag LOCUS_03940 3967 4437 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549510.1 protein_id gnl|my_center|LOCUS_03940 4566 6428 gene locus_tag LOCUS_03950 4566 6428 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549508.1 protein_id gnl|my_center|LOCUS_03950 6575 7231 gene locus_tag LOCUS_03960 6575 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548446.1 protein_id gnl|my_center|LOCUS_03960 7387 8556 gene locus_tag LOCUS_03970 7387 8556 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549506.1 protein_id gnl|my_center|LOCUS_03970 8664 8972 gene locus_tag LOCUS_03980 8664 8972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 8959 9228 gene locus_tag LOCUS_03990 8959 9228 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775363.1 protein_id gnl|my_center|LOCUS_03990 10821 9253 gene locus_tag LOCUS_04000 10821 9253 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254623.1 protein_id gnl|my_center|LOCUS_04000 11776 11159 gene locus_tag LOCUS_04010 11776 11159 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254622.1 protein_id gnl|my_center|LOCUS_04010 11871 12731 gene locus_tag LOCUS_04020 11871 12731 CDS product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254624.1 protein_id gnl|my_center|LOCUS_04020 13165 12809 gene locus_tag LOCUS_04030 13165 12809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549279.1 protein_id gnl|my_center|LOCUS_04030 14662 13394 gene locus_tag LOCUS_04040 14662 13394 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837568.1 protein_id gnl|my_center|LOCUS_04040 14769 15638 gene locus_tag LOCUS_04050 14769 15638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 16275 15667 gene locus_tag LOCUS_04060 16275 15667 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549496.1 protein_id gnl|my_center|LOCUS_04060 16412 17515 gene locus_tag LOCUS_04070 16412 17515 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254625.1 protein_id gnl|my_center|LOCUS_04070 17530 19869 gene locus_tag LOCUS_04080 17530 19869 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254626.1 protein_id gnl|my_center|LOCUS_04080 19976 22714 gene locus_tag LOCUS_04090 gene ppc 19976 22714 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254335.1 protein_id gnl|my_center|LOCUS_04090 >Feature sequence012 847 2244 gene locus_tag LOCUS_04100 847 2244 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_04100 2313 2483 gene locus_tag LOCUS_04110 2313 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 3090 2614 gene locus_tag LOCUS_04120 3090 2614 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613286.1 protein_id gnl|my_center|LOCUS_04120 3205 3702 gene locus_tag LOCUS_04130 3205 3702 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548750.1 protein_id gnl|my_center|LOCUS_04130 4523 3720 gene locus_tag LOCUS_04140 4523 3720 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548752.1 protein_id gnl|my_center|LOCUS_04140 4673 5167 gene locus_tag LOCUS_04150 4673 5167 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548753.1 protein_id gnl|my_center|LOCUS_04150 5290 5430 gene locus_tag LOCUS_04160 5290 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 5518 6447 gene locus_tag LOCUS_04170 5518 6447 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254057.1 protein_id gnl|my_center|LOCUS_04170 6476 7249 gene locus_tag LOCUS_04180 gene phnC 6476 7249 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548759.1 protein_id gnl|my_center|LOCUS_04180 7249 8046 gene locus_tag LOCUS_04190 gene phnE 7249 8046 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254058.1 protein_id gnl|my_center|LOCUS_04190 8046 8858 gene locus_tag LOCUS_04200 gene phnE 8046 8858 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548762.1 protein_id gnl|my_center|LOCUS_04200 9482 8913 gene locus_tag LOCUS_04210 9482 8913 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254059.1 protein_id gnl|my_center|LOCUS_04210 9642 10127 gene locus_tag LOCUS_04220 9642 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548767.1 protein_id gnl|my_center|LOCUS_04220 10184 11581 gene locus_tag LOCUS_04230 10184 11581 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254060.1 protein_id gnl|my_center|LOCUS_04230 11709 13658 gene locus_tag LOCUS_04240 gene asnB 11709 13658 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548773.1 protein_id gnl|my_center|LOCUS_04240 13680 14963 gene locus_tag LOCUS_04250 13680 14963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548775.1 protein_id gnl|my_center|LOCUS_04250 15138 17345 gene locus_tag LOCUS_04260 gene nrdD 15138 17345 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254061.1 protein_id gnl|my_center|LOCUS_04260 17345 18058 gene locus_tag LOCUS_04270 gene nrdG 17345 18058 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548777.1 protein_id gnl|my_center|LOCUS_04270 18110 18688 gene locus_tag LOCUS_04280 18110 18688 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254062.1 protein_id gnl|my_center|LOCUS_04280 18681 19877 gene locus_tag LOCUS_04290 18681 19877 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548779.1 protein_id gnl|my_center|LOCUS_04290 19999 22530 gene locus_tag LOCUS_04300 19999 22530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 >Feature sequence013 195 431 gene locus_tag LOCUS_04310 195 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 484 1002 gene locus_tag LOCUS_04320 484 1002 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004039686.1 protein_id gnl|my_center|LOCUS_04320 989 1777 gene locus_tag LOCUS_04330 989 1777 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548681.1 protein_id gnl|my_center|LOCUS_04330 2139 1774 gene locus_tag LOCUS_04340 2139 1774 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548679.1 protein_id gnl|my_center|LOCUS_04340 2172 2804 gene locus_tag LOCUS_04350 2172 2804 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254043.1 protein_id gnl|my_center|LOCUS_04350 3137 4750 gene locus_tag LOCUS_04360 3137 4750 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254042.1 protein_id gnl|my_center|LOCUS_04360 4750 5505 gene locus_tag LOCUS_04370 4750 5505 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548674.1 protein_id gnl|my_center|LOCUS_04370 5587 6057 gene locus_tag LOCUS_04380 5587 6057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 6975 6127 gene locus_tag LOCUS_04390 6975 6127 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254041.1 protein_id gnl|my_center|LOCUS_04390 7686 7042 gene locus_tag LOCUS_04400 7686 7042 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254040.1 protein_id gnl|my_center|LOCUS_04400 8211 7771 gene locus_tag LOCUS_04410 8211 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04410 8872 8195 gene locus_tag LOCUS_04420 8872 8195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04420 10188 8881 gene locus_tag LOCUS_04430 10188 8881 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267735.1 protein_id gnl|my_center|LOCUS_04430 11144 10323 gene locus_tag LOCUS_04440 11144 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254037.1 protein_id gnl|my_center|LOCUS_04440 11443 11303 gene locus_tag LOCUS_04450 11443 11303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548644.1 protein_id gnl|my_center|LOCUS_04450 13293 11515 gene locus_tag LOCUS_04460 13293 11515 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548622.1 protein_id gnl|my_center|LOCUS_04460 13790 13386 gene locus_tag LOCUS_04470 13790 13386 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548621.1 protein_id gnl|my_center|LOCUS_04470 13990 15096 gene locus_tag LOCUS_04480 13990 15096 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254034.1 protein_id gnl|my_center|LOCUS_04480 15193 15753 gene locus_tag LOCUS_04490 15193 15753 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254033.1 protein_id gnl|my_center|LOCUS_04490 15772 16668 gene locus_tag LOCUS_04500 gene htpX 15772 16668 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254032.1 protein_id gnl|my_center|LOCUS_04500 17476 16772 gene locus_tag LOCUS_04510 17476 16772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 18119 17502 gene locus_tag LOCUS_04520 18119 17502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 18656 18381 gene locus_tag LOCUS_04530 18656 18381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 19361 18672 gene locus_tag LOCUS_04540 19361 18672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 20366 19542 gene locus_tag LOCUS_04550 20366 19542 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549642.1 protein_id gnl|my_center|LOCUS_04550 21669 20728 gene locus_tag LOCUS_04560 21669 20728 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548611.1 protein_id gnl|my_center|LOCUS_04560 >Feature sequence014 1670 744 gene locus_tag LOCUS_04570 1670 744 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548688.1 protein_id gnl|my_center|LOCUS_04570 1766 2536 gene locus_tag LOCUS_04580 1766 2536 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548691.1 protein_id gnl|my_center|LOCUS_04580 3517 2564 gene locus_tag LOCUS_04590 3517 2564 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548693.1 protein_id gnl|my_center|LOCUS_04590 3678 4490 gene locus_tag LOCUS_04600 3678 4490 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254046.1 protein_id gnl|my_center|LOCUS_04600 4499 5155 gene locus_tag LOCUS_04610 4499 5155 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254047.1 protein_id gnl|my_center|LOCUS_04610 5157 5570 gene locus_tag LOCUS_04620 5157 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 5667 6653 gene locus_tag LOCUS_04630 5667 6653 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548712.1 protein_id gnl|my_center|LOCUS_04630 6818 7501 gene locus_tag LOCUS_04640 6818 7501 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254049.1 protein_id gnl|my_center|LOCUS_04640 7514 8338 gene locus_tag LOCUS_04650 7514 8338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548717.1 protein_id gnl|my_center|LOCUS_04650 8465 9949 gene locus_tag LOCUS_04660 8465 9949 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548719.1 protein_id gnl|my_center|LOCUS_04660 9942 10679 gene locus_tag LOCUS_04670 9942 10679 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254050.1 protein_id gnl|my_center|LOCUS_04670 11965 10715 gene locus_tag LOCUS_04680 11965 10715 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254051.1 protein_id gnl|my_center|LOCUS_04680 12118 13200 gene locus_tag LOCUS_04690 12118 13200 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548727.1 protein_id gnl|my_center|LOCUS_04690 13228 13977 gene locus_tag LOCUS_04700 13228 13977 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254052.1 protein_id gnl|my_center|LOCUS_04700 14068 15201 gene locus_tag LOCUS_04710 14068 15201 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548730.1 protein_id gnl|my_center|LOCUS_04710 15198 15983 gene locus_tag LOCUS_04720 15198 15983 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548732.1 protein_id gnl|my_center|LOCUS_04720 15955 16788 gene locus_tag LOCUS_04730 15955 16788 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254053.1 protein_id gnl|my_center|LOCUS_04730 20087 17079 gene locus_tag LOCUS_04740 20087 17079 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548741.1 protein_id gnl|my_center|LOCUS_04740 20241 21395 gene locus_tag LOCUS_04750 gene nagA 20241 21395 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254054.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence015 70 1014 gene locus_tag LOCUS_04760 70 1014 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548861.1 protein_id gnl|my_center|LOCUS_04760 2426 1110 gene locus_tag LOCUS_04770 2426 1110 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254075.1 protein_id gnl|my_center|LOCUS_04770 2993 2568 gene locus_tag LOCUS_04780 2993 2568 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254076.1 protein_id gnl|my_center|LOCUS_04780 3235 3696 gene locus_tag LOCUS_04790 gene greA 3235 3696 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548866.1 protein_id gnl|my_center|LOCUS_04790 3776 4438 gene locus_tag LOCUS_04800 3776 4438 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254077.1 protein_id gnl|my_center|LOCUS_04800 4556 4486 gene locus_tag LOCUS_t00030 4556 4486 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5159 4566 gene locus_tag LOCUS_04810 5159 4566 CDS product SOS response-associated peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548869.1 protein_id gnl|my_center|LOCUS_04810 5277 6299 gene locus_tag LOCUS_04820 gene trpS 5277 6299 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548870.1 protein_id gnl|my_center|LOCUS_04820 6315 6794 gene locus_tag LOCUS_04830 6315 6794 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548871.1 protein_id gnl|my_center|LOCUS_04830 6808 7392 gene locus_tag LOCUS_04840 6808 7392 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548872.1 protein_id gnl|my_center|LOCUS_04840 7688 10357 gene locus_tag LOCUS_04850 gene mgtA 7688 10357 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548873.1 protein_id gnl|my_center|LOCUS_04850 10686 12275 gene locus_tag LOCUS_04860 10686 12275 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547992.1 protein_id gnl|my_center|LOCUS_04860 12294 14513 gene locus_tag LOCUS_04870 12294 14513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 14501 16090 gene locus_tag LOCUS_04880 14501 16090 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548575.1 protein_id gnl|my_center|LOCUS_04880 16200 18176 gene locus_tag LOCUS_04890 gene metG 16200 18176 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254078.1 protein_id gnl|my_center|LOCUS_04890 18176 18943 gene locus_tag LOCUS_04900 18176 18943 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548876.1 protein_id gnl|my_center|LOCUS_04900 18930 19496 gene locus_tag LOCUS_04910 gene rnmV 18930 19496 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548877.1 protein_id gnl|my_center|LOCUS_04910 19486 20370 gene locus_tag LOCUS_04920 gene rsmA 19486 20370 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548878.1 protein_id gnl|my_center|LOCUS_04920 >Feature sequence016 3729 70 gene locus_tag LOCUS_04930 gene rpoC 3729 70 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254109.1 protein_id gnl|my_center|LOCUS_04930 7383 3745 gene locus_tag LOCUS_04940 7383 3745 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254108.1 protein_id gnl|my_center|LOCUS_04940 10085 7605 gene locus_tag LOCUS_04950 10085 7605 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549016.1 protein_id gnl|my_center|LOCUS_04950 10646 10191 gene locus_tag LOCUS_04960 10646 10191 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549015.1 protein_id gnl|my_center|LOCUS_04960 10794 10721 gene locus_tag LOCUS_t00040 10794 10721 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10905 10831 gene locus_tag LOCUS_t00050 10905 10831 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12867 11008 gene locus_tag LOCUS_04970 12867 11008 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922164.1 protein_id gnl|my_center|LOCUS_04970 13153 13081 gene locus_tag LOCUS_t00060 13153 13081 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13366 13821 gene locus_tag LOCUS_04980 13366 13821 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254394.1 protein_id gnl|my_center|LOCUS_04980 15438 13888 gene locus_tag LOCUS_04990 gene lysS 15438 13888 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254107.1 protein_id gnl|my_center|LOCUS_04990 16479 15454 gene locus_tag LOCUS_05000 gene dusB 16479 15454 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254106.1 protein_id gnl|my_center|LOCUS_05000 17447 16557 gene locus_tag LOCUS_05010 gene hslO 17447 16557 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549012.1 protein_id gnl|my_center|LOCUS_05010 19668 17500 gene locus_tag LOCUS_05020 gene ftsH 19668 17500 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254105.1 protein_id gnl|my_center|LOCUS_05020 <20462 19763 gene locus_tag LOCUS_05030 <20462 19763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549010.1:tRNA lysidine(34) synthetase TilS >Feature sequence017 342 43 gene locus_tag LOCUS_05040 342 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 495 998 gene locus_tag LOCUS_05050 495 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05050 1908 1495 gene locus_tag LOCUS_05060 1908 1495 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546138.1 protein_id gnl|my_center|LOCUS_05060 2285 2058 gene locus_tag LOCUS_05070 2285 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549087.1 protein_id gnl|my_center|LOCUS_05070 3103 2372 gene locus_tag LOCUS_05080 3103 2372 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254163.1 protein_id gnl|my_center|LOCUS_05080 4433 3264 gene locus_tag LOCUS_05090 4433 3264 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476472.1 protein_id gnl|my_center|LOCUS_05090 4888 4436 gene locus_tag LOCUS_05100 4888 4436 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701041.1 protein_id gnl|my_center|LOCUS_05100 6685 4904 gene locus_tag LOCUS_05110 6685 4904 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476473.1 protein_id gnl|my_center|LOCUS_05110 8874 6820 gene locus_tag LOCUS_05120 8874 6820 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476476.1 protein_id gnl|my_center|LOCUS_05120 10786 8975 gene locus_tag LOCUS_05130 gene glmS 10786 8975 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546133.1 protein_id gnl|my_center|LOCUS_05130 13607 10983 gene locus_tag LOCUS_05140 gene adhE 13607 10983 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546132.1 protein_id gnl|my_center|LOCUS_05140 13921 15294 gene locus_tag LOCUS_05150 13921 15294 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546123.1 protein_id gnl|my_center|LOCUS_05150 15843 15313 gene locus_tag LOCUS_05160 15843 15313 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254161.1 protein_id gnl|my_center|LOCUS_05160 15952 16833 gene locus_tag LOCUS_05170 15952 16833 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254160.1 protein_id gnl|my_center|LOCUS_05170 17244 16876 gene locus_tag LOCUS_05180 17244 16876 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546115.1 protein_id gnl|my_center|LOCUS_05180 18168 17248 gene locus_tag LOCUS_05190 18168 17248 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254159.1 protein_id gnl|my_center|LOCUS_05190 19006 18197 gene locus_tag LOCUS_05200 19006 18197 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254158.1 protein_id gnl|my_center|LOCUS_05200 20035 19028 gene locus_tag LOCUS_05210 20035 19028 CDS product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546107.1 protein_id gnl|my_center|LOCUS_05210 >Feature sequence018 1450 62 gene locus_tag LOCUS_05220 gene rlmD 1450 62 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546467.1 protein_id gnl|my_center|LOCUS_05220 1575 2387 gene locus_tag LOCUS_05230 gene recX 1575 2387 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546469.1 protein_id gnl|my_center|LOCUS_05230 2396 2878 gene locus_tag LOCUS_05240 2396 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254210.1 protein_id gnl|my_center|LOCUS_05240 3340 2879 gene locus_tag LOCUS_05250 3340 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 3443 4309 gene locus_tag LOCUS_05260 3443 4309 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546472.1 protein_id gnl|my_center|LOCUS_05260 4309 5880 gene locus_tag LOCUS_05270 4309 5880 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546473.1 protein_id gnl|my_center|LOCUS_05270 5895 6704 gene locus_tag LOCUS_05280 5895 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 6806 8374 gene locus_tag LOCUS_05290 6806 8374 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254623.1 protein_id gnl|my_center|LOCUS_05290 8498 9178 gene locus_tag LOCUS_05300 8498 9178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 9607 9771 gene locus_tag LOCUS_05310 9607 9771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05310 9883 10215 gene locus_tag LOCUS_05320 9883 10215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 10227 10424 gene locus_tag LOCUS_05330 10227 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 10885 10604 gene locus_tag LOCUS_05340 10885 10604 CDS product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546474.1 protein_id gnl|my_center|LOCUS_05340 13223 11031 gene locus_tag LOCUS_05350 13223 11031 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254211.1 protein_id gnl|my_center|LOCUS_05350 13428 13610 gene locus_tag LOCUS_05360 13428 13610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 13723 13989 gene locus_tag LOCUS_05370 13723 13989 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546482.1 protein_id gnl|my_center|LOCUS_05370 13989 15722 gene locus_tag LOCUS_05380 gene ptsP 13989 15722 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254212.1 protein_id gnl|my_center|LOCUS_05380 15947 16345 gene locus_tag LOCUS_05390 gene spxA 15947 16345 CDS product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254213.1 protein_id gnl|my_center|LOCUS_05390 16450 17196 gene locus_tag LOCUS_05400 16450 17196 CDS product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546487.1 protein_id gnl|my_center|LOCUS_05400 17268 18116 gene locus_tag LOCUS_05410 17268 18116 CDS product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254214.1 protein_id gnl|my_center|LOCUS_05410 18375 18124 gene locus_tag LOCUS_05420 18375 18124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence019 121 34 gene locus_tag LOCUS_t00070 121 34 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 625 212 gene locus_tag LOCUS_05430 625 212 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546324.1 protein_id gnl|my_center|LOCUS_05430 2064 715 gene locus_tag LOCUS_05440 gene rlmD 2064 715 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546298.1 protein_id gnl|my_center|LOCUS_05440 3181 2147 gene locus_tag LOCUS_05450 3181 2147 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254513.1 protein_id gnl|my_center|LOCUS_05450 3582 4943 gene locus_tag LOCUS_05460 gene nhaC 3582 4943 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546295.1 protein_id gnl|my_center|LOCUS_05460 6438 6037 gene locus_tag LOCUS_05470 6438 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546292.1 protein_id gnl|my_center|LOCUS_05470 6547 7257 gene locus_tag LOCUS_05480 6547 7257 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640270.1 protein_id gnl|my_center|LOCUS_05480 8247 7327 gene locus_tag LOCUS_05490 8247 7327 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546288.1 protein_id gnl|my_center|LOCUS_05490 9702 8272 gene locus_tag LOCUS_05500 gene gatB 9702 8272 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254176.1 protein_id gnl|my_center|LOCUS_05500 11146 9707 gene locus_tag LOCUS_05510 gene gatA 11146 9707 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546285.1 protein_id gnl|my_center|LOCUS_05510 11454 11146 gene locus_tag LOCUS_05520 gene gatC 11454 11146 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546283.1 protein_id gnl|my_center|LOCUS_05520 12614 11466 gene locus_tag LOCUS_05530 12614 11466 CDS product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546280.1 protein_id gnl|my_center|LOCUS_05530 14630 12627 gene locus_tag LOCUS_05540 gene ligA 14630 12627 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546277.1 protein_id gnl|my_center|LOCUS_05540 16911 14665 gene locus_tag LOCUS_05550 gene pcrA 16911 14665 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546275.1 protein_id gnl|my_center|LOCUS_05550 17644 16997 gene locus_tag LOCUS_05560 17644 16997 CDS product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546273.1 protein_id gnl|my_center|LOCUS_05560 17814 17729 gene locus_tag LOCUS_t00080 17814 17729 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence020 1102 1566 gene locus_tag LOCUS_05570 gene tnpA 1102 1566 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703269.1 protein_id gnl|my_center|LOCUS_05570 1832 1563 gene locus_tag LOCUS_05580 1832 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 2350 1871 gene locus_tag LOCUS_05590 gene rlmH 2350 1871 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548590.1 protein_id gnl|my_center|LOCUS_05590 4130 2868 gene locus_tag LOCUS_05600 4130 2868 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613276.1 protein_id gnl|my_center|LOCUS_05600 5007 4210 gene locus_tag LOCUS_05610 5007 4210 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254029.1 protein_id gnl|my_center|LOCUS_05610 5844 5020 gene locus_tag LOCUS_05620 5844 5020 CDS product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548584.1 protein_id gnl|my_center|LOCUS_05620 7199 5847 gene locus_tag LOCUS_05630 7199 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548582.1 protein_id gnl|my_center|LOCUS_05630 9042 7189 gene locus_tag LOCUS_05640 gene walK 9042 7189 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254027.1 protein_id gnl|my_center|LOCUS_05640 9829 9113 gene locus_tag LOCUS_05650 gene yycF 9829 9113 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548578.1 protein_id gnl|my_center|LOCUS_05650 9966 10040 gene locus_tag LOCUS_t00090 9966 10040 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 10158 10379 gene locus_tag LOCUS_05660 10158 10379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 10511 10585 gene locus_tag LOCUS_t00100 10511 10585 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 10763 11524 gene locus_tag LOCUS_05670 10763 11524 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254023.1 protein_id gnl|my_center|LOCUS_05670 11541 12377 gene locus_tag LOCUS_05680 11541 12377 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254021.1 protein_id gnl|my_center|LOCUS_05680 12395 13348 gene locus_tag LOCUS_05690 12395 13348 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548569.1 protein_id gnl|my_center|LOCUS_05690 13362 14309 gene locus_tag LOCUS_05700 13362 14309 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254020.1 protein_id gnl|my_center|LOCUS_05700 14306 15175 gene locus_tag LOCUS_05710 14306 15175 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548564.1 protein_id gnl|my_center|LOCUS_05710 15268 15489 gene locus_tag LOCUS_05720 15268 15489 CDS product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548562.1 protein_id gnl|my_center|LOCUS_05720 16142 15708 gene locus_tag LOCUS_05730 16142 15708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 >Feature sequence021 181 1101 gene locus_tag LOCUS_05740 181 1101 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546370.1 protein_id gnl|my_center|LOCUS_05740 1645 1148 gene locus_tag LOCUS_05750 1645 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254493.1 protein_id gnl|my_center|LOCUS_05750 1796 3196 gene locus_tag LOCUS_05760 1796 3196 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254421.1 protein_id gnl|my_center|LOCUS_05760 4189 3260 gene locus_tag LOCUS_05770 4189 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05770 4556 4173 gene locus_tag LOCUS_05780 4556 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05780 4720 5523 gene locus_tag LOCUS_05790 4720 5523 CDS product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546373.1 protein_id gnl|my_center|LOCUS_05790 5613 6539 gene locus_tag LOCUS_05800 gene rbsK 5613 6539 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254195.1 protein_id gnl|my_center|LOCUS_05800 6539 7231 gene locus_tag LOCUS_05810 gene rpiA 6539 7231 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254196.1 protein_id gnl|my_center|LOCUS_05810 7363 9372 gene locus_tag LOCUS_05820 7363 9372 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254197.1 protein_id gnl|my_center|LOCUS_05820 9454 10380 gene locus_tag LOCUS_05830 9454 10380 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546379.1 protein_id gnl|my_center|LOCUS_05830 10380 10928 gene locus_tag LOCUS_05840 10380 10928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05840 11986 11159 gene locus_tag LOCUS_05850 11986 11159 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546391.1 protein_id gnl|my_center|LOCUS_05850 12467 12108 gene locus_tag LOCUS_05860 12467 12108 CDS product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546398.1 protein_id gnl|my_center|LOCUS_05860 13237 12473 gene locus_tag LOCUS_05870 13237 12473 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546400.1 protein_id gnl|my_center|LOCUS_05870 >Feature sequence022 534 82 gene locus_tag LOCUS_05880 534 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 1151 534 gene locus_tag LOCUS_05890 1151 534 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939892.1 protein_id gnl|my_center|LOCUS_05890 2096 1263 gene locus_tag LOCUS_05900 2096 1263 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548701.1 protein_id gnl|my_center|LOCUS_05900 3776 2469 gene locus_tag LOCUS_05910 3776 2469 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549459.1 protein_id gnl|my_center|LOCUS_05910 4005 4805 gene locus_tag LOCUS_05920 4005 4805 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549462.1 protein_id gnl|my_center|LOCUS_05920 5311 4853 gene locus_tag LOCUS_05930 5311 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 6112 5426 gene locus_tag LOCUS_05940 6112 5426 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549464.1 protein_id gnl|my_center|LOCUS_05940 6777 6130 gene locus_tag LOCUS_05950 6777 6130 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549467.1 protein_id gnl|my_center|LOCUS_05950 7672 6953 gene locus_tag LOCUS_05960 gene nagB 7672 6953 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549469.1 protein_id gnl|my_center|LOCUS_05960 7799 8626 gene locus_tag LOCUS_05970 7799 8626 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549471.1 protein_id gnl|my_center|LOCUS_05970 9686 8730 gene locus_tag LOCUS_05980 9686 8730 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549473.1 protein_id gnl|my_center|LOCUS_05980 10834 9686 gene locus_tag LOCUS_05990 10834 9686 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549477.1 protein_id gnl|my_center|LOCUS_05990 12365 10827 gene locus_tag LOCUS_06000 12365 10827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549479.1 protein_id gnl|my_center|LOCUS_06000 13532 12447 gene locus_tag LOCUS_06010 13532 12447 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549489.1 protein_id gnl|my_center|LOCUS_06010 14769 13675 gene locus_tag LOCUS_06020 14769 13675 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549489.1 protein_id gnl|my_center|LOCUS_06020 15073 15678 gene locus_tag LOCUS_06030 15073 15678 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254627.1 protein_id gnl|my_center|LOCUS_06030 >Feature sequence023 760 1290 gene locus_tag LOCUS_06040 760 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254564.1 protein_id gnl|my_center|LOCUS_06040 2265 1330 gene locus_tag LOCUS_06050 2265 1330 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254563.1 protein_id gnl|my_center|LOCUS_06050 2714 2268 gene locus_tag LOCUS_06060 gene nrdI 2714 2268 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549835.1 protein_id gnl|my_center|LOCUS_06060 3007 4158 gene locus_tag LOCUS_06070 3007 4158 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254472.1 protein_id gnl|my_center|LOCUS_06070 4347 4973 gene locus_tag LOCUS_06080 4347 4973 CDS product LVIS_2131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549837.1 protein_id gnl|my_center|LOCUS_06080 6496 4988 gene locus_tag LOCUS_06090 6496 4988 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549839.1 protein_id gnl|my_center|LOCUS_06090 6884 6582 gene locus_tag LOCUS_06100 6884 6582 CDS product DUF2187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549842.1 protein_id gnl|my_center|LOCUS_06100 6980 7522 gene locus_tag LOCUS_06110 6980 7522 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041814911.1 protein_id gnl|my_center|LOCUS_06110 7695 8246 gene locus_tag LOCUS_06120 7695 8246 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254561.1 protein_id gnl|my_center|LOCUS_06120 8516 9259 gene locus_tag LOCUS_06130 8516 9259 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549854.1 protein_id gnl|my_center|LOCUS_06130 9429 10322 gene locus_tag LOCUS_06140 9429 10322 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549855.1 protein_id gnl|my_center|LOCUS_06140 12570 11542 gene locus_tag LOCUS_06150 12570 11542 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549859.1 protein_id gnl|my_center|LOCUS_06150 13852 12587 gene locus_tag LOCUS_06160 gene hflX 13852 12587 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549861.1 protein_id gnl|my_center|LOCUS_06160 14121 13996 gene locus_tag LOCUS_06170 14121 13996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 14232 14492 gene locus_tag LOCUS_06180 14232 14492 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812262.1 protein_id gnl|my_center|LOCUS_06180 14492 14764 gene locus_tag LOCUS_06190 14492 14764 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_06190 >Feature sequence024 2949 121 gene locus_tag LOCUS_06200 2949 121 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254017.1 protein_id gnl|my_center|LOCUS_06200 4457 3015 gene locus_tag LOCUS_06210 4457 3015 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549250.1 protein_id gnl|my_center|LOCUS_06210 5358 4531 gene locus_tag LOCUS_06220 5358 4531 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549252.1 protein_id gnl|my_center|LOCUS_06220 6581 5913 gene locus_tag LOCUS_06230 6581 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 6792 6541 gene locus_tag LOCUS_06240 6792 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 7151 8164 gene locus_tag LOCUS_06250 7151 8164 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613274.1 protein_id gnl|my_center|LOCUS_06250 8590 9474 gene locus_tag LOCUS_06260 8590 9474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 9604 10140 gene locus_tag LOCUS_06270 9604 10140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 10720 10526 gene locus_tag LOCUS_06280 10720 10526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 11025 10774 gene locus_tag LOCUS_06290 11025 10774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 11351 11019 gene locus_tag LOCUS_06300 11351 11019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 12382 11564 gene locus_tag LOCUS_06310 12382 11564 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254015.1 protein_id gnl|my_center|LOCUS_06310 14512 12587 gene locus_tag LOCUS_06320 14512 12587 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254014.1 protein_id gnl|my_center|LOCUS_06320 15212 14595 gene locus_tag LOCUS_06330 15212 14595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence025 915 118 gene locus_tag LOCUS_06340 915 118 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100893.1 protein_id gnl|my_center|LOCUS_06340 1579 917 gene locus_tag LOCUS_06350 1579 917 CDS product malonate decarboxylase holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287544.1 protein_id gnl|my_center|LOCUS_06350 3234 1567 gene locus_tag LOCUS_06360 gene mdcD 3234 1567 CDS product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287546.1 protein_id gnl|my_center|LOCUS_06360 3523 3224 gene locus_tag LOCUS_06370 3523 3224 CDS product malonate decarboxylase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287548.1 protein_id gnl|my_center|LOCUS_06370 5185 3542 gene locus_tag LOCUS_06380 gene mdcA 5185 3542 CDS product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287549.1 protein_id gnl|my_center|LOCUS_06380 6093 5185 gene locus_tag LOCUS_06390 6093 5185 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329655.1 protein_id gnl|my_center|LOCUS_06390 6205 7092 gene locus_tag LOCUS_06400 6205 7092 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421907.1 protein_id gnl|my_center|LOCUS_06400 7177 8286 gene locus_tag LOCUS_06410 7177 8286 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254598.1 protein_id gnl|my_center|LOCUS_06410 9670 8366 gene locus_tag LOCUS_06420 gene celB 9670 8366 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384702.1 protein_id gnl|my_center|LOCUS_06420 9845 10612 gene locus_tag LOCUS_06430 9845 10612 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254082.1 protein_id gnl|my_center|LOCUS_06430 10850 10662 gene locus_tag LOCUS_06440 10850 10662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 11673 11032 gene locus_tag LOCUS_06450 11673 11032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 12580 11807 gene locus_tag LOCUS_06460 12580 11807 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254200.1 protein_id gnl|my_center|LOCUS_06460 13911 12577 gene locus_tag LOCUS_06470 13911 12577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 14290 13901 gene locus_tag LOCUS_06480 14290 13901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 14710 14387 gene locus_tag LOCUS_06490 14710 14387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 15176 14781 gene locus_tag LOCUS_06500 15176 14781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 >Feature sequence026 115 2781 gene locus_tag LOCUS_06510 115 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 2848 3576 gene locus_tag LOCUS_06520 2848 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 3580 4365 gene locus_tag LOCUS_06530 3580 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 5039 4368 gene locus_tag LOCUS_06540 5039 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 5115 6758 gene locus_tag LOCUS_06550 5115 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 6932 7312 gene locus_tag LOCUS_06560 6932 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 7328 8227 gene locus_tag LOCUS_06570 7328 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 8811 8269 gene locus_tag LOCUS_06580 8811 8269 CDS product NUMOD4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006993.1 protein_id gnl|my_center|LOCUS_06580 8886 10151 gene locus_tag LOCUS_06590 8886 10151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 10836 10162 gene locus_tag LOCUS_06600 10836 10162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 10914 11450 gene locus_tag LOCUS_06610 10914 11450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 12501 11596 gene locus_tag LOCUS_06620 12501 11596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 13562 13062 gene locus_tag LOCUS_06630 13562 13062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 14205 13741 gene locus_tag LOCUS_06640 14205 13741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 14460 14290 gene locus_tag LOCUS_06650 14460 14290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 >Feature sequence027 875 312 gene locus_tag LOCUS_06660 875 312 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254344.1 protein_id gnl|my_center|LOCUS_06660 1668 1027 gene locus_tag LOCUS_06670 1668 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 2577 1690 gene locus_tag LOCUS_06680 2577 1690 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547149.1 protein_id gnl|my_center|LOCUS_06680 3999 2605 gene locus_tag LOCUS_06690 gene hslU 3999 2605 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254308.1 protein_id gnl|my_center|LOCUS_06690 4534 4010 gene locus_tag LOCUS_06700 gene hslV 4534 4010 CDS product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254307.1 protein_id gnl|my_center|LOCUS_06700 5462 4539 gene locus_tag LOCUS_06710 5462 4539 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547143.1 protein_id gnl|my_center|LOCUS_06710 6781 5465 gene locus_tag LOCUS_06720 gene trmFO 6781 5465 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547141.1 protein_id gnl|my_center|LOCUS_06720 8960 6879 gene locus_tag LOCUS_06730 gene topA 8960 6879 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547140.1 protein_id gnl|my_center|LOCUS_06730 9871 9026 gene locus_tag LOCUS_06740 gene dprA 9871 9026 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547135.1 protein_id gnl|my_center|LOCUS_06740 10676 9924 gene locus_tag LOCUS_06750 10676 9924 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254306.1 protein_id gnl|my_center|LOCUS_06750 11512 10673 gene locus_tag LOCUS_06760 gene ylqF 11512 10673 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547131.1 protein_id gnl|my_center|LOCUS_06760 12966 11515 gene locus_tag LOCUS_06770 12966 11515 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101574.1 protein_id gnl|my_center|LOCUS_06770 13201 12974 gene locus_tag LOCUS_06780 13201 12974 CDS product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547128.1 protein_id gnl|my_center|LOCUS_06780 14058 13201 gene locus_tag LOCUS_06790 14058 13201 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254305.1 protein_id gnl|my_center|LOCUS_06790 14203 14868 gene locus_tag LOCUS_06800 14203 14868 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254304.1 protein_id gnl|my_center|LOCUS_06800 >Feature sequence028 92 1039 gene locus_tag LOCUS_06810 92 1039 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641588.1 protein_id gnl|my_center|LOCUS_06810 1055 1975 gene locus_tag LOCUS_06820 1055 1975 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643598.1 protein_id gnl|my_center|LOCUS_06820 1998 3461 gene locus_tag LOCUS_06830 1998 3461 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641586.1 protein_id gnl|my_center|LOCUS_06830 3555 4160 gene locus_tag LOCUS_06840 3555 4160 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922522.1 protein_id gnl|my_center|LOCUS_06840 4162 5838 gene locus_tag LOCUS_06850 4162 5838 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102273.1 protein_id gnl|my_center|LOCUS_06850 5848 7251 gene locus_tag LOCUS_06860 5848 7251 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304851.1 protein_id gnl|my_center|LOCUS_06860 7254 8078 gene locus_tag LOCUS_06870 7254 8078 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383772.1 protein_id gnl|my_center|LOCUS_06870 8174 9277 gene locus_tag LOCUS_06880 gene ugpC 8174 9277 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546234.1 protein_id gnl|my_center|LOCUS_06880 9292 9462 gene locus_tag LOCUS_06890 9292 9462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 10213 9560 gene locus_tag LOCUS_06900 gene rpe 10213 9560 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547914.1 protein_id gnl|my_center|LOCUS_06900 10863 10213 gene locus_tag LOCUS_06910 10863 10213 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862015.1 protein_id gnl|my_center|LOCUS_06910 11764 10874 gene locus_tag LOCUS_06920 gene dapA 11764 10874 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435760.1 protein_id gnl|my_center|LOCUS_06920 12383 11757 gene locus_tag LOCUS_06930 12383 11757 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432026.1 protein_id gnl|my_center|LOCUS_06930 12571 13017 gene locus_tag LOCUS_06940 12571 13017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 13027 13326 gene locus_tag LOCUS_06950 13027 13326 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435756.1 protein_id gnl|my_center|LOCUS_06950 >Feature sequence029 27 950 gene locus_tag LOCUS_06960 27 950 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548278.1 protein_id gnl|my_center|LOCUS_06960 1219 1467 gene locus_tag LOCUS_06970 1219 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 1470 1763 gene locus_tag LOCUS_06980 1470 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 1987 1853 gene locus_tag LOCUS_06990 1987 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 2511 2795 gene locus_tag LOCUS_07000 2511 2795 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476580.1 protein_id gnl|my_center|LOCUS_07000 3614 2841 gene locus_tag LOCUS_07010 3614 2841 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009914264.1 protein_id gnl|my_center|LOCUS_07010 4533 3607 gene locus_tag LOCUS_07020 4533 3607 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989919.1 protein_id gnl|my_center|LOCUS_07020 5420 4539 gene locus_tag LOCUS_07030 gene isdE 5420 4539 CDS product heme ABC transporter substrate-binding protein IsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163510.1 protein_id gnl|my_center|LOCUS_07030 6136 5417 gene locus_tag LOCUS_07040 6136 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 6735 6136 gene locus_tag LOCUS_07050 6735 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 7444 6851 gene locus_tag LOCUS_07060 7444 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 7649 8428 gene locus_tag LOCUS_07070 7649 8428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 8998 8513 gene locus_tag LOCUS_07080 8998 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 9599 9108 gene locus_tag LOCUS_07090 9599 9108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 10410 9592 gene locus_tag LOCUS_07100 10410 9592 CDS product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016874.1 protein_id gnl|my_center|LOCUS_07100 11678 10407 gene locus_tag LOCUS_07110 11678 10407 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 protein_id gnl|my_center|LOCUS_07110 13079 11874 gene locus_tag LOCUS_07120 13079 11874 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188891678.1 protein_id gnl|my_center|LOCUS_07120 14223 13090 gene locus_tag LOCUS_07130 14223 13090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence030 273 1562 gene locus_tag LOCUS_07140 273 1562 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_07140 1562 3019 gene locus_tag LOCUS_07150 1562 3019 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674652.1 protein_id gnl|my_center|LOCUS_07150 2970 4589 gene locus_tag LOCUS_07160 2970 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 4577 4876 gene locus_tag LOCUS_07170 4577 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 5009 5647 gene locus_tag LOCUS_07180 5009 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 5651 6682 gene locus_tag LOCUS_07190 5651 6682 CDS product N4-gp56 family major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922080.1 protein_id gnl|my_center|LOCUS_07190 6682 6888 gene locus_tag LOCUS_07200 6682 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 6863 7204 gene locus_tag LOCUS_07210 6863 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 7214 7648 gene locus_tag LOCUS_07220 7214 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 7650 8033 gene locus_tag LOCUS_07230 7650 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 8017 8487 gene locus_tag LOCUS_07240 8017 8487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 8480 9583 gene locus_tag LOCUS_07250 8480 9583 CDS product DUF3383 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010717321.1 protein_id gnl|my_center|LOCUS_07250 9595 9993 gene locus_tag LOCUS_07260 9595 9993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377526.1 protein_id gnl|my_center|LOCUS_07260 10060 10392 gene locus_tag LOCUS_07270 10060 10392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 10358 10579 gene locus_tag LOCUS_07280 10358 10579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 >Feature sequence031 3 542 gene locus_tag LOCUS_07290 gene rpsC 3 542 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254113.1 protein_id gnl|my_center|LOCUS_07290 542 982 gene locus_tag LOCUS_07300 gene rplP 542 982 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549031.1 protein_id gnl|my_center|LOCUS_07300 972 1169 gene locus_tag LOCUS_07310 gene rpmC 972 1169 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549032.1 protein_id gnl|my_center|LOCUS_07310 1188 1454 gene locus_tag LOCUS_07320 gene rpsQ 1188 1454 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254114.1 protein_id gnl|my_center|LOCUS_07320 1486 1854 gene locus_tag LOCUS_07330 gene rplN 1486 1854 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549034.1 protein_id gnl|my_center|LOCUS_07330 1874 2110 gene locus_tag LOCUS_07340 1874 2110 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549035.1 protein_id gnl|my_center|LOCUS_07340 2125 2667 gene locus_tag LOCUS_07350 gene rplE 2125 2667 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549036.1 protein_id gnl|my_center|LOCUS_07350 2680 2865 gene locus_tag LOCUS_07360 2680 2865 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549037.1 protein_id gnl|my_center|LOCUS_07360 2890 3288 gene locus_tag LOCUS_07370 gene rpsH 2890 3288 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 protein_id gnl|my_center|LOCUS_07370 3313 3843 gene locus_tag LOCUS_07380 gene rplF 3313 3843 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549039.1 protein_id gnl|my_center|LOCUS_07380 3870 4226 gene locus_tag LOCUS_07390 gene rplR 3870 4226 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549040.1 protein_id gnl|my_center|LOCUS_07390 4244 4750 gene locus_tag LOCUS_07400 gene rpsE 4244 4750 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549041.1 protein_id gnl|my_center|LOCUS_07400 4768 4953 gene locus_tag LOCUS_07410 gene rpmD 4768 4953 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549042.1 protein_id gnl|my_center|LOCUS_07410 4977 5417 gene locus_tag LOCUS_07420 gene rplO 4977 5417 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549043.1 protein_id gnl|my_center|LOCUS_07420 5417 6712 gene locus_tag LOCUS_07430 gene secY 5417 6712 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549044.1 protein_id gnl|my_center|LOCUS_07430 6723 7379 gene locus_tag LOCUS_07440 6723 7379 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549045.1 protein_id gnl|my_center|LOCUS_07440 7455 7676 gene locus_tag LOCUS_07450 gene infA 7455 7676 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878178.1 protein_id gnl|my_center|LOCUS_07450 7830 8180 gene locus_tag LOCUS_07460 gene rpsM 7830 8180 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549046.1 protein_id gnl|my_center|LOCUS_07460 8205 8594 gene locus_tag LOCUS_07470 gene rpsK 8205 8594 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613292.1 protein_id gnl|my_center|LOCUS_07470 8640 9578 gene locus_tag LOCUS_07480 8640 9578 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549048.1 protein_id gnl|my_center|LOCUS_07480 9606 9989 gene locus_tag LOCUS_07490 gene rplQ 9606 9989 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549049.1 protein_id gnl|my_center|LOCUS_07490 10173 11024 gene locus_tag LOCUS_07500 10173 11024 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549050.1 protein_id gnl|my_center|LOCUS_07500 11000 11845 gene locus_tag LOCUS_07510 11000 11845 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549051.1 protein_id gnl|my_center|LOCUS_07510 11849 12646 gene locus_tag LOCUS_07520 11849 12646 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549052.1 protein_id gnl|my_center|LOCUS_07520 12651 13439 gene locus_tag LOCUS_07530 gene truA 12651 13439 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549053.1 protein_id gnl|my_center|LOCUS_07530 13544 13987 gene locus_tag LOCUS_07540 gene rplM 13544 13987 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549054.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence032 1239 97 gene locus_tag LOCUS_07550 gene wecB 1239 97 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254207.1 protein_id gnl|my_center|LOCUS_07550 1832 1692 gene locus_tag LOCUS_07560 1832 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 2297 1899 gene locus_tag LOCUS_07570 2297 1899 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961810.1 protein_id gnl|my_center|LOCUS_07570 2703 2497 gene locus_tag LOCUS_07580 2703 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 3091 2900 gene locus_tag LOCUS_07590 3091 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023376657.1 protein_id gnl|my_center|LOCUS_07590 4119 3217 gene locus_tag LOCUS_07600 4119 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 4528 4121 gene locus_tag LOCUS_07610 4528 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 4685 4515 gene locus_tag LOCUS_07620 4685 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 5062 4685 gene locus_tag LOCUS_07630 5062 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 5298 5074 gene locus_tag LOCUS_07640 5298 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 5759 5298 gene locus_tag LOCUS_07650 5759 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 6124 5831 gene locus_tag LOCUS_07660 6124 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 6802 6167 gene locus_tag LOCUS_07670 6802 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 7220 6846 gene locus_tag LOCUS_07680 7220 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 7672 7220 gene locus_tag LOCUS_07690 7672 7220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 8324 7686 gene locus_tag LOCUS_07700 8324 7686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 9243 8335 gene locus_tag LOCUS_07710 9243 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 10388 9240 gene locus_tag LOCUS_07720 10388 9240 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390596.1 protein_id gnl|my_center|LOCUS_07720 10716 10381 gene locus_tag LOCUS_07730 10716 10381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 11068 10703 gene locus_tag LOCUS_07740 11068 10703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377515.1 protein_id gnl|my_center|LOCUS_07740 11931 11068 gene locus_tag LOCUS_07750 11931 11068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390593.1 protein_id gnl|my_center|LOCUS_07750 12259 11924 gene locus_tag LOCUS_07760 12259 11924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377517.1 protein_id gnl|my_center|LOCUS_07760 12822 12259 gene locus_tag LOCUS_07770 12822 12259 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386767.1 protein_id gnl|my_center|LOCUS_07770 >Feature sequence033 914 531 gene locus_tag LOCUS_07780 914 531 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701043.1 protein_id gnl|my_center|LOCUS_07780 4839 1057 gene locus_tag LOCUS_07790 4839 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 7807 5090 gene locus_tag LOCUS_07800 7807 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 9171 7882 gene locus_tag LOCUS_07810 9171 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 10621 9212 gene locus_tag LOCUS_07820 10621 9212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 12566 11454 gene locus_tag LOCUS_07830 12566 11454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 <13198 12577 gene locus_tag LOCUS_07840 <13198 12577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003643227.1:peptide chain release factor 3 >Feature sequence034 1854 235 gene locus_tag LOCUS_07850 1854 235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674012.1 protein_id gnl|my_center|LOCUS_07850 3620 1974 gene locus_tag LOCUS_07860 3620 1974 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550020.1 protein_id gnl|my_center|LOCUS_07860 3921 4316 gene locus_tag LOCUS_07870 3921 4316 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550019.1 protein_id gnl|my_center|LOCUS_07870 4443 5030 gene locus_tag LOCUS_07880 4443 5030 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550018.1 protein_id gnl|my_center|LOCUS_07880 5652 5077 gene locus_tag LOCUS_07890 gene efp 5652 5077 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550017.1 protein_id gnl|my_center|LOCUS_07890 6684 5770 gene locus_tag LOCUS_07900 gene coaA 6684 5770 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550009.1 protein_id gnl|my_center|LOCUS_07900 6744 7301 gene locus_tag LOCUS_07910 6744 7301 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550008.1 protein_id gnl|my_center|LOCUS_07910 7747 7298 gene locus_tag LOCUS_07920 7747 7298 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550006.1 protein_id gnl|my_center|LOCUS_07920 8564 7749 gene locus_tag LOCUS_07930 8564 7749 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550005.1 protein_id gnl|my_center|LOCUS_07930 9188 8568 gene locus_tag LOCUS_07940 9188 8568 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254538.1 protein_id gnl|my_center|LOCUS_07940 9849 9202 gene locus_tag LOCUS_07950 9849 9202 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549992.1 protein_id gnl|my_center|LOCUS_07950 12589 10283 gene locus_tag LOCUS_07960 gene helD 12589 10283 CDS product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_056990024.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence035 512 586 gene locus_tag LOCUS_t00110 512 586 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 729 998 gene locus_tag LOCUS_07970 729 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 1144 2211 gene locus_tag LOCUS_07980 1144 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 2310 3083 gene locus_tag LOCUS_07990 2310 3083 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549297.1 protein_id gnl|my_center|LOCUS_07990 3711 3151 gene locus_tag LOCUS_08000 3711 3151 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254011.1 protein_id gnl|my_center|LOCUS_08000 4243 3704 gene locus_tag LOCUS_08010 4243 3704 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549293.1 protein_id gnl|my_center|LOCUS_08010 4628 4245 gene locus_tag LOCUS_08020 4628 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 5045 4647 gene locus_tag LOCUS_08030 5045 4647 CDS product DUF4430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759944.1 protein_id gnl|my_center|LOCUS_08030 7297 5066 gene locus_tag LOCUS_08040 gene nrdJ 7297 5066 CDS product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549289.1 protein_id gnl|my_center|LOCUS_08040 9332 7572 gene locus_tag LOCUS_08050 9332 7572 CDS product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547891.1 protein_id gnl|my_center|LOCUS_08050 9529 10563 gene locus_tag LOCUS_08060 9529 10563 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549287.1 protein_id gnl|my_center|LOCUS_08060 10563 11135 gene locus_tag LOCUS_08070 10563 11135 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549286.1 protein_id gnl|my_center|LOCUS_08070 11351 11169 gene locus_tag LOCUS_08080 11351 11169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 11535 12869 gene locus_tag LOCUS_08090 11535 12869 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613273.1 protein_id gnl|my_center|LOCUS_08090 >Feature sequence036 1785 667 gene locus_tag LOCUS_08100 gene dinB 1785 667 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549172.1 protein_id gnl|my_center|LOCUS_08100 3229 1778 gene locus_tag LOCUS_08110 gene zwf 3229 1778 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549170.1 protein_id gnl|my_center|LOCUS_08110 3725 3333 gene locus_tag LOCUS_08120 3725 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 4795 3785 gene locus_tag LOCUS_08130 gene ruvB 4795 3785 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549167.1 protein_id gnl|my_center|LOCUS_08130 5431 4844 gene locus_tag LOCUS_08140 gene ruvA 5431 4844 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549165.1 protein_id gnl|my_center|LOCUS_08140 7356 5431 gene locus_tag LOCUS_08150 gene mutL 7356 5431 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549162.1 protein_id gnl|my_center|LOCUS_08150 9953 7356 gene locus_tag LOCUS_08160 gene mutS 9953 7356 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254144.1 protein_id gnl|my_center|LOCUS_08160 11816 10191 gene locus_tag LOCUS_08170 gene groL 11816 10191 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549158.1 protein_id gnl|my_center|LOCUS_08170 12154 11870 gene locus_tag LOCUS_08180 gene groES 12154 11870 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549156.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence037 283 456 gene locus_tag LOCUS_08190 283 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08190 690 1268 gene locus_tag LOCUS_08200 690 1268 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254090.1 protein_id gnl|my_center|LOCUS_08200 1275 2561 gene locus_tag LOCUS_08210 1275 2561 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548915.1 protein_id gnl|my_center|LOCUS_08210 4137 2845 gene locus_tag LOCUS_08220 4137 2845 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254482.1 protein_id gnl|my_center|LOCUS_08220 4782 4168 gene locus_tag LOCUS_08230 4782 4168 CDS product IS607 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496365.1 protein_id gnl|my_center|LOCUS_08230 4908 5732 gene locus_tag LOCUS_08240 4908 5732 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548912.1 protein_id gnl|my_center|LOCUS_08240 5819 7243 gene locus_tag LOCUS_08250 5819 7243 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674698.1 protein_id gnl|my_center|LOCUS_08250 7789 7298 gene locus_tag LOCUS_08260 7789 7298 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547510.1 protein_id gnl|my_center|LOCUS_08260 8304 7786 gene locus_tag LOCUS_08270 8304 7786 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254447.1 protein_id gnl|my_center|LOCUS_08270 9668 8373 gene locus_tag LOCUS_08280 9668 8373 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254086.1 protein_id gnl|my_center|LOCUS_08280 11419 9800 gene locus_tag LOCUS_08290 11419 9800 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254085.1 protein_id gnl|my_center|LOCUS_08290 <12156 11536 gene locus_tag LOCUS_08300 <12156 11536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548904.1:DNA-directed RNA polymerase subunit delta >Feature sequence038 3920 189 gene locus_tag LOCUS_08310 3920 189 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864285.1 protein_id gnl|my_center|LOCUS_08310 4317 3946 gene locus_tag LOCUS_08320 4317 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 5204 4317 gene locus_tag LOCUS_08330 5204 4317 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239313.1 protein_id gnl|my_center|LOCUS_08330 6725 6426 gene locus_tag LOCUS_08340 6725 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 7201 6728 gene locus_tag LOCUS_08350 7201 6728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 8666 7356 gene locus_tag LOCUS_08360 8666 7356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 9198 8653 gene locus_tag LOCUS_08370 9198 8653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 10929 10339 gene locus_tag LOCUS_08380 10929 10339 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050340461.1 protein_id gnl|my_center|LOCUS_08380 <12030 11088 gene locus_tag LOCUS_08390 <12030 11088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010945911.1:P-loop NTPase fold protein >Feature sequence039 1121 1906 gene locus_tag LOCUS_08400 1121 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 2377 2838 gene locus_tag LOCUS_08410 2377 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 4790 4083 gene locus_tag LOCUS_08420 4790 4083 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546169.1 protein_id gnl|my_center|LOCUS_08420 9229 4790 gene locus_tag LOCUS_08430 9229 4790 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025079793.1 protein_id gnl|my_center|LOCUS_08430 9556 9308 gene locus_tag LOCUS_08440 9556 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 10250 10702 gene locus_tag LOCUS_08450 10250 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 10788 11582 gene locus_tag LOCUS_08460 10788 11582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 >Feature sequence040 384 626 gene locus_tag LOCUS_08470 384 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 610 906 gene locus_tag LOCUS_08480 610 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 922 1140 gene locus_tag LOCUS_08490 922 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08490 1169 3037 gene locus_tag LOCUS_08500 1169 3037 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08500 3178 4068 gene locus_tag LOCUS_08510 3178 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 4129 4926 gene locus_tag LOCUS_08520 4129 4926 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404660.1 protein_id gnl|my_center|LOCUS_08520 4987 5601 gene locus_tag LOCUS_08530 4987 5601 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963888.1 protein_id gnl|my_center|LOCUS_08530 5719 6375 gene locus_tag LOCUS_08540 5719 6375 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072772897.1 protein_id gnl|my_center|LOCUS_08540 6440 6802 gene locus_tag LOCUS_08550 6440 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 7619 8878 gene locus_tag LOCUS_08560 7619 8878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 8905 9594 gene locus_tag LOCUS_08570 8905 9594 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404711.1 protein_id gnl|my_center|LOCUS_08570 9607 11019 gene locus_tag LOCUS_08580 9607 11019 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948715.1 protein_id gnl|my_center|LOCUS_08580 11016 11936 gene locus_tag LOCUS_08590 11016 11936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence041 287 69 gene locus_tag LOCUS_08600 287 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 490 702 gene locus_tag LOCUS_08610 490 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08610 878 1501 gene locus_tag LOCUS_08620 878 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08620 6581 1563 gene locus_tag LOCUS_08630 6581 1563 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548280.1 protein_id gnl|my_center|LOCUS_08630 7455 6856 gene locus_tag LOCUS_08640 7455 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 7993 7484 gene locus_tag LOCUS_08650 7993 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254548.1 protein_id gnl|my_center|LOCUS_08650 8589 8182 gene locus_tag LOCUS_08660 8589 8182 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869856.1 protein_id gnl|my_center|LOCUS_08660 8840 8586 gene locus_tag LOCUS_08670 8840 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 9411 8830 gene locus_tag LOCUS_08680 9411 8830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 10613 9630 gene locus_tag LOCUS_08690 gene rfbD 10613 9630 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_08690 11238 10630 gene locus_tag LOCUS_08700 gene rfbC 11238 10630 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_08700 <11920 11264 gene locus_tag LOCUS_08710 <11920 11264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389370.1:glucose-1-phosphate thymidylyltransferase RfbA >Feature sequence042 1298 999 gene locus_tag LOCUS_08720 1298 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549078.1 protein_id gnl|my_center|LOCUS_08720 1430 1981 gene locus_tag LOCUS_08730 1430 1981 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254121.1 protein_id gnl|my_center|LOCUS_08730 1981 3357 gene locus_tag LOCUS_08740 gene radA 1981 3357 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549080.1 protein_id gnl|my_center|LOCUS_08740 3435 4934 gene locus_tag LOCUS_08750 gene gltX 3435 4934 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254122.1 protein_id gnl|my_center|LOCUS_08750 5025 6458 gene locus_tag LOCUS_08760 gene cysS 5025 6458 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549082.1 protein_id gnl|my_center|LOCUS_08760 6451 6894 gene locus_tag LOCUS_08770 6451 6894 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549083.1 protein_id gnl|my_center|LOCUS_08770 6881 7636 gene locus_tag LOCUS_08780 gene rlmB 6881 7636 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254123.1 protein_id gnl|my_center|LOCUS_08780 7770 8315 gene locus_tag LOCUS_08790 7770 8315 CDS product DNA-directed RNA polymerase subunit sigma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254124.1 protein_id gnl|my_center|LOCUS_08790 8379 8597 gene locus_tag LOCUS_08800 8379 8597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549087.1 protein_id gnl|my_center|LOCUS_08800 8714 10222 gene locus_tag LOCUS_08810 8714 10222 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549089.1 protein_id gnl|my_center|LOCUS_08810 <11814 10269 gene locus_tag LOCUS_08820 <11814 10269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549091.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence043 152 706 gene locus_tag LOCUS_08830 152 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 710 1534 gene locus_tag LOCUS_08840 710 1534 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254529.1 protein_id gnl|my_center|LOCUS_08840 1518 2795 gene locus_tag LOCUS_08850 1518 2795 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550067.1 protein_id gnl|my_center|LOCUS_08850 2849 4150 gene locus_tag LOCUS_08860 2849 4150 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550069.1 protein_id gnl|my_center|LOCUS_08860 4269 5186 gene locus_tag LOCUS_08870 4269 5186 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721382.1 protein_id gnl|my_center|LOCUS_08870 5202 6146 gene locus_tag LOCUS_08880 5202 6146 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254527.1 protein_id gnl|my_center|LOCUS_08880 6279 6854 gene locus_tag LOCUS_08890 6279 6854 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254526.1 protein_id gnl|my_center|LOCUS_08890 6859 7920 gene locus_tag LOCUS_08900 6859 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08900 7932 10487 gene locus_tag LOCUS_08910 7932 10487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08910 10601 11617 gene locus_tag LOCUS_08920 10601 11617 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550081.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence044 2864 1950 gene locus_tag LOCUS_08930 gene pfkB 2864 1950 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549796.1 protein_id gnl|my_center|LOCUS_08930 3624 2866 gene locus_tag LOCUS_08940 3624 2866 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549794.1 protein_id gnl|my_center|LOCUS_08940 3831 4025 gene locus_tag LOCUS_08950 3831 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 5153 3930 gene locus_tag LOCUS_08960 5153 3930 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549790.1 protein_id gnl|my_center|LOCUS_08960 6042 5146 gene locus_tag LOCUS_08970 6042 5146 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549788.1 protein_id gnl|my_center|LOCUS_08970 6317 6081 gene locus_tag LOCUS_08980 6317 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 6554 6393 gene locus_tag LOCUS_08990 6554 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 6995 6573 gene locus_tag LOCUS_09000 6995 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549784.1 protein_id gnl|my_center|LOCUS_09000 7216 7022 gene locus_tag LOCUS_09010 7216 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549781.1 protein_id gnl|my_center|LOCUS_09010 8563 7409 gene locus_tag LOCUS_09020 8563 7409 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254482.1 protein_id gnl|my_center|LOCUS_09020 9173 8538 gene locus_tag LOCUS_09030 9173 8538 CDS product IS607-like element ISTko1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 protein_id gnl|my_center|LOCUS_09030 9587 9378 gene locus_tag LOCUS_09040 9587 9378 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549779.1 protein_id gnl|my_center|LOCUS_09040 10141 9602 gene locus_tag LOCUS_09050 10141 9602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549769.1 protein_id gnl|my_center|LOCUS_09050 10328 10146 gene locus_tag LOCUS_09060 10328 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549768.1 protein_id gnl|my_center|LOCUS_09060 10713 10498 gene locus_tag LOCUS_09070 10713 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 <11622 10995 gene locus_tag LOCUS_09080 <11622 10995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674571.1:IS30 family transposase >Feature sequence045 441 211 gene locus_tag LOCUS_09090 441 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 836 453 gene locus_tag LOCUS_09100 836 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 1224 853 gene locus_tag LOCUS_09110 1224 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 2336 1359 gene locus_tag LOCUS_09120 2336 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 2665 2363 gene locus_tag LOCUS_09130 2665 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 3272 2667 gene locus_tag LOCUS_09140 3272 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 4204 3269 gene locus_tag LOCUS_09150 4204 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 4706 4197 gene locus_tag LOCUS_09160 4706 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 6829 4685 gene locus_tag LOCUS_09170 6829 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 8016 6931 gene locus_tag LOCUS_09180 8016 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 8569 8009 gene locus_tag LOCUS_09190 8569 8009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 9725 8553 gene locus_tag LOCUS_09200 9725 8553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 10242 9745 gene locus_tag LOCUS_09210 10242 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 10563 10399 gene locus_tag LOCUS_09220 10563 10399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 10820 10560 gene locus_tag LOCUS_09230 10820 10560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 11058 10813 gene locus_tag LOCUS_09240 11058 10813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence046 943 581 gene locus_tag LOCUS_09250 943 581 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549009.1 protein_id gnl|my_center|LOCUS_09250 1320 943 gene locus_tag LOCUS_09260 1320 943 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254103.1 protein_id gnl|my_center|LOCUS_09260 1630 1388 gene locus_tag LOCUS_09270 1630 1388 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_09270 5140 1646 gene locus_tag LOCUS_09280 gene mfd 5140 1646 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254101.1 protein_id gnl|my_center|LOCUS_09280 5699 5142 gene locus_tag LOCUS_09290 gene pth 5699 5142 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549001.1 protein_id gnl|my_center|LOCUS_09290 5836 6807 gene locus_tag LOCUS_09300 5836 6807 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549000.1 protein_id gnl|my_center|LOCUS_09300 6979 7686 gene locus_tag LOCUS_09310 gene cbpA 6979 7686 CDS product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254100.1 protein_id gnl|my_center|LOCUS_09310 8881 7751 gene locus_tag LOCUS_09320 gene alr 8881 7751 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548996.1 protein_id gnl|my_center|LOCUS_09320 9242 8886 gene locus_tag LOCUS_09330 gene acpS 9242 8886 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254099.1 protein_id gnl|my_center|LOCUS_09330 10812 9325 gene locus_tag LOCUS_09340 10812 9325 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548992.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence047 1057 473 gene locus_tag LOCUS_09350 1057 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1095 1433 gene locus_tag LOCUS_09360 1095 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1426 1959 gene locus_tag LOCUS_09370 1426 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 1961 2033 gene locus_tag LOCUS_t00120 1961 2033 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2053 2205 gene locus_tag LOCUS_09380 2053 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 2198 2707 gene locus_tag LOCUS_09390 2198 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 2735 3787 gene locus_tag LOCUS_09400 2735 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 3862 4812 gene locus_tag LOCUS_09410 3862 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 4970 5500 gene locus_tag LOCUS_09420 4970 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 5759 5601 gene locus_tag LOCUS_09430 5759 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 5841 8990 gene locus_tag LOCUS_09440 5841 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 10368 10731 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atagtgttacaagtattgg >Feature sequence048 378 1202 gene locus_tag LOCUS_09450 378 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09450 1361 1675 gene locus_tag LOCUS_09460 1361 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09460 1720 3141 gene locus_tag LOCUS_09470 1720 3141 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254410.1 protein_id gnl|my_center|LOCUS_09470 3687 4433 gene locus_tag LOCUS_09480 3687 4433 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549987.1 protein_id gnl|my_center|LOCUS_09480 4448 6274 gene locus_tag LOCUS_09490 4448 6274 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549988.1 protein_id gnl|my_center|LOCUS_09490 7761 6331 gene locus_tag LOCUS_09500 7761 6331 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254409.1 protein_id gnl|my_center|LOCUS_09500 7934 8275 gene locus_tag LOCUS_09510 7934 8275 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547875.1 protein_id gnl|my_center|LOCUS_09510 8279 9709 gene locus_tag LOCUS_09520 gene ffh 8279 9709 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547873.1 protein_id gnl|my_center|LOCUS_09520 9797 10069 gene locus_tag LOCUS_09530 gene rpsP 9797 10069 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547870.1 protein_id gnl|my_center|LOCUS_09530 10136 10651 gene locus_tag LOCUS_09540 gene rimM 10136 10651 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254408.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence049 750 52 gene locus_tag LOCUS_09550 750 52 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546270.1 protein_id gnl|my_center|LOCUS_09550 2183 753 gene locus_tag LOCUS_09560 2183 753 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254175.1 protein_id gnl|my_center|LOCUS_09560 3339 2185 gene locus_tag LOCUS_09570 3339 2185 CDS product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546266.1 protein_id gnl|my_center|LOCUS_09570 6098 3429 gene locus_tag LOCUS_09580 6098 3429 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546265.1 protein_id gnl|my_center|LOCUS_09580 7115 6285 gene locus_tag LOCUS_09590 gene nadE 7115 6285 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546262.1 protein_id gnl|my_center|LOCUS_09590 8590 7112 gene locus_tag LOCUS_09600 8590 7112 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254174.1 protein_id gnl|my_center|LOCUS_09600 9768 8677 gene locus_tag LOCUS_09610 9768 8677 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546257.1 protein_id gnl|my_center|LOCUS_09610 10510 9779 gene locus_tag LOCUS_09620 10510 9779 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546254.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence050 1178 216 gene locus_tag LOCUS_09630 1178 216 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546744.1 protein_id gnl|my_center|LOCUS_09630 2700 1189 gene locus_tag LOCUS_09640 gene atpA 2700 1189 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254246.1 protein_id gnl|my_center|LOCUS_09640 3263 2715 gene locus_tag LOCUS_09650 3263 2715 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546742.1 protein_id gnl|my_center|LOCUS_09650 3772 3263 gene locus_tag LOCUS_09660 gene atpF 3772 3263 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546741.1 protein_id gnl|my_center|LOCUS_09660 4057 3824 gene locus_tag LOCUS_09670 gene atpE 4057 3824 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029779745.1 protein_id gnl|my_center|LOCUS_09670 4791 4078 gene locus_tag LOCUS_09680 gene atpB 4791 4078 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546739.1 protein_id gnl|my_center|LOCUS_09680 5543 4914 gene locus_tag LOCUS_09690 gene upp 5543 4914 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546738.1 protein_id gnl|my_center|LOCUS_09690 6632 5628 gene locus_tag LOCUS_09700 6632 5628 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546737.1 protein_id gnl|my_center|LOCUS_09700 7480 6635 gene locus_tag LOCUS_09710 gene prmC 7480 6635 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546736.1 protein_id gnl|my_center|LOCUS_09710 8561 7473 gene locus_tag LOCUS_09720 gene prfA 8561 7473 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546735.1 protein_id gnl|my_center|LOCUS_09720 9177 8578 gene locus_tag LOCUS_09730 9177 8578 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613340.1 protein_id gnl|my_center|LOCUS_09730 9313 10665 gene locus_tag LOCUS_09740 9313 10665 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546733.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence051 223 408 gene locus_tag LOCUS_09750 223 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 435 581 gene locus_tag LOCUS_09760 435 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1754 666 gene locus_tag LOCUS_09770 1754 666 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613274.1 protein_id gnl|my_center|LOCUS_09770 1974 2432 gene locus_tag LOCUS_09780 1974 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 2429 4171 gene locus_tag LOCUS_09790 2429 4171 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475588.1 protein_id gnl|my_center|LOCUS_09790 4164 5984 gene locus_tag LOCUS_09800 4164 5984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564926.1 protein_id gnl|my_center|LOCUS_09800 8261 6057 gene locus_tag LOCUS_09810 gene nrdJ 8261 6057 CDS product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549289.1 protein_id gnl|my_center|LOCUS_09810 9836 8400 gene locus_tag LOCUS_09820 9836 8400 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643748.1 protein_id gnl|my_center|LOCUS_09820 10430 9924 gene locus_tag LOCUS_09830 gene ybaK 10430 9924 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101872.1 protein_id gnl|my_center|LOCUS_09830 >Feature sequence052 87 12 gene locus_tag LOCUS_t00130 87 12 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1487 927 gene locus_tag LOCUS_09840 1487 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1694 1503 gene locus_tag LOCUS_09850 1694 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1837 1694 gene locus_tag LOCUS_09860 1837 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 2055 1837 gene locus_tag LOCUS_09870 2055 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 2516 2055 gene locus_tag LOCUS_09880 2516 2055 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047623.1 protein_id gnl|my_center|LOCUS_09880 2812 2513 gene locus_tag LOCUS_09890 2812 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 3188 2886 gene locus_tag LOCUS_09900 3188 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 3434 3192 gene locus_tag LOCUS_09910 3434 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 3694 3431 gene locus_tag LOCUS_09920 3694 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 3894 3697 gene locus_tag LOCUS_09930 3894 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 4099 3887 gene locus_tag LOCUS_09940 4099 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 4294 4109 gene locus_tag LOCUS_09950 4294 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 5144 4308 gene locus_tag LOCUS_09960 5144 4308 CDS product phage antirepressor Ant inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389859.1 protein_id gnl|my_center|LOCUS_09960 5712 5137 gene locus_tag LOCUS_09970 5712 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 6050 5733 gene locus_tag LOCUS_09980 6050 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 6775 6056 gene locus_tag LOCUS_09990 6775 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 7592 6789 gene locus_tag LOCUS_10000 7592 6789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 7876 7598 gene locus_tag LOCUS_10010 7876 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 8202 7876 gene locus_tag LOCUS_10020 8202 7876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 8401 8240 gene locus_tag LOCUS_10030 8401 8240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 8553 8422 gene locus_tag LOCUS_10040 8553 8422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 8717 8568 gene locus_tag LOCUS_10050 8717 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 8923 8714 gene locus_tag LOCUS_10060 8923 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 9070 8939 gene locus_tag LOCUS_10070 9070 8939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 9263 9048 gene locus_tag LOCUS_10080 9263 9048 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475619.1 protein_id gnl|my_center|LOCUS_10080 9556 9783 gene locus_tag LOCUS_10090 9556 9783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 10306 9896 gene locus_tag LOCUS_10100 10306 9896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 >Feature sequence053 1984 557 gene locus_tag LOCUS_10110 1984 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 3619 2081 gene locus_tag LOCUS_10120 gene citF 3619 2081 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547016.1 protein_id gnl|my_center|LOCUS_10120 4514 3609 gene locus_tag LOCUS_10130 gene citE 4514 3609 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644111.1 protein_id gnl|my_center|LOCUS_10130 4810 4517 gene locus_tag LOCUS_10140 gene citD 4810 4517 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547011.1 protein_id gnl|my_center|LOCUS_10140 5853 4810 gene locus_tag LOCUS_10150 gene citC 5853 4810 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092462393.1 protein_id gnl|my_center|LOCUS_10150 7021 5864 gene locus_tag LOCUS_10160 7021 5864 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641301.1 protein_id gnl|my_center|LOCUS_10160 7159 8100 gene locus_tag LOCUS_10170 7159 8100 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641300.1 protein_id gnl|my_center|LOCUS_10170 9552 8134 gene locus_tag LOCUS_10180 9552 8134 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641299.1 protein_id gnl|my_center|LOCUS_10180 <10342 9575 gene locus_tag LOCUS_10190 <10342 9575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547001.1:L-lactate dehydrogenase >Feature sequence054 1287 199 gene locus_tag LOCUS_10200 1287 199 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254531.1 protein_id gnl|my_center|LOCUS_10200 2970 1543 gene locus_tag LOCUS_10210 2970 1543 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550057.1 protein_id gnl|my_center|LOCUS_10210 3881 3027 gene locus_tag LOCUS_10220 3881 3027 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550055.1 protein_id gnl|my_center|LOCUS_10220 4847 3891 gene locus_tag LOCUS_10230 4847 3891 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550053.1 protein_id gnl|my_center|LOCUS_10230 5684 4863 gene locus_tag LOCUS_10240 5684 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550052.1 protein_id gnl|my_center|LOCUS_10240 6333 5686 gene locus_tag LOCUS_10250 6333 5686 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550051.1 protein_id gnl|my_center|LOCUS_10250 6782 6333 gene locus_tag LOCUS_10260 6782 6333 CDS product DUF3290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550049.1 protein_id gnl|my_center|LOCUS_10260 7626 6886 gene locus_tag LOCUS_10270 gene pnuC 7626 6886 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550046.1 protein_id gnl|my_center|LOCUS_10270 7913 9820 gene locus_tag LOCUS_10280 7913 9820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 9888 10184 gene locus_tag LOCUS_10290 9888 10184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550042.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence055 163 1140 gene locus_tag LOCUS_10300 163 1140 CDS product class III bacteriocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548389.1 protein_id gnl|my_center|LOCUS_10300 1377 1219 gene locus_tag LOCUS_10310 1377 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1547 1861 gene locus_tag LOCUS_10320 1547 1861 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254498.1 protein_id gnl|my_center|LOCUS_10320 1879 2760 gene locus_tag LOCUS_10330 1879 2760 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548384.1 protein_id gnl|my_center|LOCUS_10330 2904 4547 gene locus_tag LOCUS_10340 2904 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 4861 5190 gene locus_tag LOCUS_10350 4861 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 5466 6605 gene locus_tag LOCUS_10360 5466 6605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence056 <1 1055 gene locus_tag LOCUS_10370 <1 1055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000169948.1:PBSX family phage terminase large subunit 1067 2503 gene locus_tag LOCUS_10380 1067 2503 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674652.1 protein_id gnl|my_center|LOCUS_10380 2487 3944 gene locus_tag LOCUS_10390 2487 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 3937 4110 gene locus_tag LOCUS_10400 3937 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 4119 4454 gene locus_tag LOCUS_10410 4119 4454 CDS product YjcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549065.1 protein_id gnl|my_center|LOCUS_10410 4563 5177 gene locus_tag LOCUS_10420 4563 5177 CDS product DUF4355 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674648.1 protein_id gnl|my_center|LOCUS_10420 5193 6071 gene locus_tag LOCUS_10430 5193 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 6080 6475 gene locus_tag LOCUS_10440 6080 6475 CDS product phage head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674645.1 protein_id gnl|my_center|LOCUS_10440 6453 6767 gene locus_tag LOCUS_10450 6453 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674644.1 protein_id gnl|my_center|LOCUS_10450 6760 7158 gene locus_tag LOCUS_10460 6760 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 7167 7559 gene locus_tag LOCUS_10470 7167 7559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 7572 8159 gene locus_tag LOCUS_10480 7572 8159 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674642.1 protein_id gnl|my_center|LOCUS_10480 8174 8509 gene locus_tag LOCUS_10490 8174 8509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 8563 8928 gene locus_tag LOCUS_10500 8563 8928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674641.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence057 324 872 gene locus_tag LOCUS_10510 324 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 875 1315 gene locus_tag LOCUS_10520 875 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1312 2739 gene locus_tag LOCUS_10530 1312 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 2742 5723 gene locus_tag LOCUS_10540 2742 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 >Feature sequence058 808 32 gene locus_tag LOCUS_10550 808 32 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655572.1 protein_id gnl|my_center|LOCUS_10550 2415 841 gene locus_tag LOCUS_10560 2415 841 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626662.1 protein_id gnl|my_center|LOCUS_10560 3656 2718 gene locus_tag LOCUS_10570 3656 2718 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702985.1 protein_id gnl|my_center|LOCUS_10570 4498 3704 gene locus_tag LOCUS_10580 4498 3704 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_10580 4865 5620 gene locus_tag LOCUS_10590 4865 5620 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643022.1 protein_id gnl|my_center|LOCUS_10590 5699 6496 gene locus_tag LOCUS_10600 5699 6496 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547007.1 protein_id gnl|my_center|LOCUS_10600 9387 7300 gene locus_tag LOCUS_10610 9387 7300 CDS product putative ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475545.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence059 102 1049 gene locus_tag LOCUS_10620 102 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 1826 1437 gene locus_tag LOCUS_10630 1826 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1979 1893 gene locus_tag LOCUS_t00140 1979 1893 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2067 3368 gene locus_tag LOCUS_10640 2067 3368 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254512.1 protein_id gnl|my_center|LOCUS_10640 3371 4219 gene locus_tag LOCUS_10650 3371 4219 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254511.1 protein_id gnl|my_center|LOCUS_10650 4345 5031 gene locus_tag LOCUS_10660 4345 5031 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548465.1 protein_id gnl|my_center|LOCUS_10660 5395 7080 gene locus_tag LOCUS_10670 gene argS 5395 7080 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548463.1 protein_id gnl|my_center|LOCUS_10670 7191 8102 gene locus_tag LOCUS_10680 gene fba 7191 8102 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254510.1 protein_id gnl|my_center|LOCUS_10680 8166 8702 gene locus_tag LOCUS_10690 8166 8702 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679290.1 protein_id gnl|my_center|LOCUS_10690 8981 9508 gene locus_tag LOCUS_10700 8981 9508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence060 1691 1885 gene locus_tag LOCUS_10710 1691 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 2261 2398 gene locus_tag LOCUS_10720 2261 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 2402 2656 gene locus_tag LOCUS_10730 2402 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3308 3517 gene locus_tag LOCUS_10740 3308 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 3587 3820 gene locus_tag LOCUS_10750 3587 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 3890 4993 gene locus_tag LOCUS_10760 3890 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 5213 5563 gene locus_tag LOCUS_10770 5213 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 5984 6202 gene locus_tag LOCUS_10780 5984 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 6419 7477 gene locus_tag LOCUS_10790 6419 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 7490 7756 gene locus_tag LOCUS_10800 7490 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 8328 8456 gene locus_tag LOCUS_10810 8328 8456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 8955 9200 gene locus_tag LOCUS_10820 8955 9200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 >Feature sequence061 209 913 gene locus_tag LOCUS_10830 209 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 901 1941 gene locus_tag LOCUS_10840 901 1941 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228262.1 protein_id gnl|my_center|LOCUS_10840 2298 3269 gene locus_tag LOCUS_10850 2298 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 3272 4297 gene locus_tag LOCUS_10860 3272 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 5046 5426 gene locus_tag LOCUS_10870 5046 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 5429 6226 gene locus_tag LOCUS_10880 gene epsE 5429 6226 CDS product glycosyltransferase EpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244557.1 protein_id gnl|my_center|LOCUS_10880 6873 7943 gene locus_tag LOCUS_10890 6873 7943 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010147499.1 protein_id gnl|my_center|LOCUS_10890 7947 8540 gene locus_tag LOCUS_10900 7947 8540 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640644.1 protein_id gnl|my_center|LOCUS_10900 8537 9415 gene locus_tag LOCUS_10910 8537 9415 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence062 206 5518 gene locus_tag LOCUS_10920 206 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 6182 7114 gene locus_tag LOCUS_10930 gene mmuM 6182 7114 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476521.1 protein_id gnl|my_center|LOCUS_10930 7107 8510 gene locus_tag LOCUS_10940 7107 8510 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476522.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence063 <1 908 gene locus_tag LOCUS_10950 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548899.1:HD domain-containing protein 943 1218 gene locus_tag LOCUS_10960 943 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548898.1 protein_id gnl|my_center|LOCUS_10960 2199 1279 gene locus_tag LOCUS_10970 2199 1279 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254084.1 protein_id gnl|my_center|LOCUS_10970 3334 2360 gene locus_tag LOCUS_10980 3334 2360 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254080.1 protein_id gnl|my_center|LOCUS_10980 5331 3562 gene locus_tag LOCUS_10990 5331 3562 CDS product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548886.1 protein_id gnl|my_center|LOCUS_10990 6214 5462 gene locus_tag LOCUS_11000 6214 5462 CDS product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548885.1 protein_id gnl|my_center|LOCUS_11000 7728 6343 gene locus_tag LOCUS_11010 gene glmU 7728 6343 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548882.1 protein_id gnl|my_center|LOCUS_11010 8605 7775 gene locus_tag LOCUS_11020 gene purR 8605 7775 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548880.1 protein_id gnl|my_center|LOCUS_11020 8971 8714 gene locus_tag LOCUS_11030 8971 8714 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548879.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence064 550 35 gene locus_tag LOCUS_11040 550 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1564 596 gene locus_tag LOCUS_11050 1564 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 3669 1720 gene locus_tag LOCUS_11060 3669 1720 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254141.1 protein_id gnl|my_center|LOCUS_11060 3881 5338 gene locus_tag LOCUS_11070 3881 5338 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549147.1 protein_id gnl|my_center|LOCUS_11070 5354 6340 gene locus_tag LOCUS_11080 5354 6340 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549144.1 protein_id gnl|my_center|LOCUS_11080 7013 6378 gene locus_tag LOCUS_11090 7013 6378 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549143.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence065 2799 160 gene locus_tag LOCUS_11100 2799 160 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254252.1 protein_id gnl|my_center|LOCUS_11100 3651 3115 gene locus_tag LOCUS_11110 3651 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 4852 3644 gene locus_tag LOCUS_11120 4852 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 7600 4985 gene locus_tag LOCUS_11130 7600 4985 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254445.1 protein_id gnl|my_center|LOCUS_11130 8036 7806 gene locus_tag LOCUS_11140 8036 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 8345 8070 gene locus_tag LOCUS_11150 8345 8070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 8854 8342 gene locus_tag LOCUS_11160 8854 8342 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390171.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence066 382 609 gene locus_tag LOCUS_11170 382 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 963 1283 gene locus_tag LOCUS_11180 963 1283 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254504.1 protein_id gnl|my_center|LOCUS_11180 1303 1950 gene locus_tag LOCUS_11190 1303 1950 CDS product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548415.1 protein_id gnl|my_center|LOCUS_11190 2238 3551 gene locus_tag LOCUS_11200 gene murC 2238 3551 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548413.1 protein_id gnl|my_center|LOCUS_11200 4437 3607 gene locus_tag LOCUS_11210 4437 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 4424 4546 gene locus_tag LOCUS_11220 4424 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 4656 5279 gene locus_tag LOCUS_11230 4656 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 5263 6591 gene locus_tag LOCUS_11240 5263 6591 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254458.1 protein_id gnl|my_center|LOCUS_11240 7206 6775 gene locus_tag LOCUS_11250 7206 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 8291 7314 gene locus_tag LOCUS_11260 8291 7314 CDS product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613398.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence067 1552 1016 gene locus_tag LOCUS_11270 1552 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 3076 1595 gene locus_tag LOCUS_11280 3076 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 6059 3888 gene locus_tag LOCUS_11290 6059 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 7859 6792 gene locus_tag LOCUS_11300 7859 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 <8755 7843 gene locus_tag LOCUS_11310 <8755 7843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003690807.1:N-6 DNA methylase >Feature sequence068 1775 282 gene locus_tag LOCUS_11320 1775 282 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254595.1 protein_id gnl|my_center|LOCUS_11320 4427 1890 gene locus_tag LOCUS_11330 4427 1890 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549665.1 protein_id gnl|my_center|LOCUS_11330 4641 5003 gene locus_tag LOCUS_11340 4641 5003 CDS product aggregation promoting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549663.1 protein_id gnl|my_center|LOCUS_11340 6058 5075 gene locus_tag LOCUS_11350 6058 5075 CDS product cytochrome C5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549662.1 protein_id gnl|my_center|LOCUS_11350 6252 7457 gene locus_tag LOCUS_11360 6252 7457 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044005378.1 protein_id gnl|my_center|LOCUS_11360 8086 7556 gene locus_tag LOCUS_11370 8086 7556 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549649.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence069 613 173 gene locus_tag LOCUS_11380 613 173 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804879.1 protein_id gnl|my_center|LOCUS_11380 1845 1510 gene locus_tag LOCUS_11390 1845 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 2018 2275 gene locus_tag LOCUS_11400 2018 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 2719 2297 gene locus_tag LOCUS_11410 2719 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 3932 2826 gene locus_tag LOCUS_11420 3932 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 4293 3943 gene locus_tag LOCUS_11430 4293 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11430 4817 4332 gene locus_tag LOCUS_11440 4817 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11440 6370 4829 gene locus_tag LOCUS_11450 6370 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 8455 6371 gene locus_tag LOCUS_11460 8455 6371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence070 1421 846 gene locus_tag LOCUS_11470 1421 846 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948640.1 protein_id gnl|my_center|LOCUS_11470 1606 2313 gene locus_tag LOCUS_11480 1606 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 2316 2558 gene locus_tag LOCUS_11490 2316 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 3046 3444 gene locus_tag LOCUS_11500 3046 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 3562 4332 gene locus_tag LOCUS_11510 3562 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 4394 5380 gene locus_tag LOCUS_11520 4394 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 5371 5790 gene locus_tag LOCUS_11530 5371 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 5848 6666 gene locus_tag LOCUS_11540 5848 6666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 6668 6997 gene locus_tag LOCUS_11550 6668 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 7084 7314 gene locus_tag LOCUS_11560 7084 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 7315 8148 gene locus_tag LOCUS_11570 7315 8148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 8142 8558 gene locus_tag LOCUS_11580 8142 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence071 286 993 gene locus_tag LOCUS_11590 286 993 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548130.1 protein_id gnl|my_center|LOCUS_11590 2064 1060 gene locus_tag LOCUS_11600 2064 1060 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613274.1 protein_id gnl|my_center|LOCUS_11600 2233 3975 gene locus_tag LOCUS_11610 2233 3975 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475588.1 protein_id gnl|my_center|LOCUS_11610 3968 5791 gene locus_tag LOCUS_11620 3968 5791 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641422.1 protein_id gnl|my_center|LOCUS_11620 7284 5848 gene locus_tag LOCUS_11630 7284 5848 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643748.1 protein_id gnl|my_center|LOCUS_11630 7878 7372 gene locus_tag LOCUS_11640 gene ybaK 7878 7372 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101872.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence072 326 1408 gene locus_tag LOCUS_11650 326 1408 CDS product M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546357.1 protein_id gnl|my_center|LOCUS_11650 1502 3124 gene locus_tag LOCUS_11660 1502 3124 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546358.1 protein_id gnl|my_center|LOCUS_11660 3212 4132 gene locus_tag LOCUS_11670 3212 4132 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642346.1 protein_id gnl|my_center|LOCUS_11670 4227 5030 gene locus_tag LOCUS_11680 4227 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546359.1 protein_id gnl|my_center|LOCUS_11680 6346 5027 gene locus_tag LOCUS_11690 6346 5027 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547412.1 protein_id gnl|my_center|LOCUS_11690 7904 6573 gene locus_tag LOCUS_11700 7904 6573 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547412.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence073 55 978 gene locus_tag LOCUS_11710 gene rbsK 55 978 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548221.1 protein_id gnl|my_center|LOCUS_11710 983 1378 gene locus_tag LOCUS_11720 gene rbsD 983 1378 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254480.1 protein_id gnl|my_center|LOCUS_11720 1394 2872 gene locus_tag LOCUS_11730 1394 2872 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254479.1 protein_id gnl|my_center|LOCUS_11730 2874 3836 gene locus_tag LOCUS_11740 gene rbsC 2874 3836 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209687196.1 protein_id gnl|my_center|LOCUS_11740 3870 4868 gene locus_tag LOCUS_11750 3870 4868 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548215.1 protein_id gnl|my_center|LOCUS_11750 5073 6356 gene locus_tag LOCUS_11760 5073 6356 CDS product DUF4038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254478.1 protein_id gnl|my_center|LOCUS_11760 6535 7371 gene locus_tag LOCUS_11770 6535 7371 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254477.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence074 776 93 gene locus_tag LOCUS_11780 776 93 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254110.1 protein_id gnl|my_center|LOCUS_11780 958 1365 gene locus_tag LOCUS_11790 gene rpsL 958 1365 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549020.1 protein_id gnl|my_center|LOCUS_11790 1381 1851 gene locus_tag LOCUS_11800 gene rpsG 1381 1851 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549021.1 protein_id gnl|my_center|LOCUS_11800 1885 3978 gene locus_tag LOCUS_11810 gene fusA 1885 3978 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549022.1 protein_id gnl|my_center|LOCUS_11810 4294 4602 gene locus_tag LOCUS_11820 gene rpsJ 4294 4602 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549023.1 protein_id gnl|my_center|LOCUS_11820 4626 5264 gene locus_tag LOCUS_11830 gene rplC 4626 5264 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549024.1 protein_id gnl|my_center|LOCUS_11830 5279 5896 gene locus_tag LOCUS_11840 gene rplD 5279 5896 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549025.1 protein_id gnl|my_center|LOCUS_11840 5896 6201 gene locus_tag LOCUS_11850 gene rplW 5896 6201 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549026.1 protein_id gnl|my_center|LOCUS_11850 6217 7053 gene locus_tag LOCUS_11860 gene rplB 6217 7053 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254111.1 protein_id gnl|my_center|LOCUS_11860 7072 7356 gene locus_tag LOCUS_11870 gene rpsS 7072 7356 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638064.1 protein_id gnl|my_center|LOCUS_11870 7376 7729 gene locus_tag LOCUS_11880 gene rplV 7376 7729 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549029.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence075 636 175 gene locus_tag LOCUS_11890 636 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 935 633 gene locus_tag LOCUS_11900 935 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1306 1106 gene locus_tag LOCUS_11910 1306 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1640 1299 gene locus_tag LOCUS_11920 1640 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 2088 1660 gene locus_tag LOCUS_11930 2088 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 2233 2568 gene locus_tag LOCUS_11940 2233 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 2579 2881 gene locus_tag LOCUS_11950 2579 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 2928 3737 gene locus_tag LOCUS_11960 2928 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 3750 4286 gene locus_tag LOCUS_11970 3750 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 4292 4411 gene locus_tag LOCUS_11980 4292 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 4472 4981 gene locus_tag LOCUS_11990 4472 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 5074 5817 gene locus_tag LOCUS_12000 5074 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 5831 7462 gene locus_tag LOCUS_12010 5831 7462 CDS product DUF4041 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860984.1 protein_id gnl|my_center|LOCUS_12010 7534 7674 gene locus_tag LOCUS_12020 7534 7674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence076 1366 323 gene locus_tag LOCUS_12030 1366 323 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549580.1 protein_id gnl|my_center|LOCUS_12030 3412 1421 gene locus_tag LOCUS_12040 gene pbp4b 3412 1421 CDS product penicillin binding protein PBP4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679898.1 protein_id gnl|my_center|LOCUS_12040 4380 3484 gene locus_tag LOCUS_12050 gene murQ 4380 3484 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254545.1 protein_id gnl|my_center|LOCUS_12050 6374 4404 gene locus_tag LOCUS_12060 6374 4404 CDS product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549932.1 protein_id gnl|my_center|LOCUS_12060 <7674 6610 gene locus_tag LOCUS_12070 <7674 6610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548513.1:MDR family MFS transporter >Feature sequence077 161 568 gene locus_tag LOCUS_12080 161 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 575 1522 gene locus_tag LOCUS_12090 575 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 2050 4002 gene locus_tag LOCUS_12100 2050 4002 CDS product glycoside hydrolase family 68 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262343.1 protein_id gnl|my_center|LOCUS_12100 4487 4681 gene locus_tag LOCUS_12110 4487 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 4681 4986 gene locus_tag LOCUS_12120 4681 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 5086 6258 gene locus_tag LOCUS_12130 5086 6258 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948530.1 protein_id gnl|my_center|LOCUS_12130 6345 7382 gene locus_tag LOCUS_12140 gene rfbB 6345 7382 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence078 1 1806 gene locus_tag LOCUS_12150 gene dnaX 1 1806 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549111.1 protein_id gnl|my_center|LOCUS_12150 1813 2403 gene locus_tag LOCUS_12160 1813 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12160 2292 2642 gene locus_tag LOCUS_12170 2292 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12170 2658 2993 gene locus_tag LOCUS_12180 2658 2993 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549112.1 protein_id gnl|my_center|LOCUS_12180 2994 3593 gene locus_tag LOCUS_12190 gene recR 2994 3593 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549113.1 protein_id gnl|my_center|LOCUS_12190 3593 3832 gene locus_tag LOCUS_12200 3593 3832 CDS product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549114.1 protein_id gnl|my_center|LOCUS_12200 3935 4573 gene locus_tag LOCUS_12210 gene tmk 3935 4573 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254134.1 protein_id gnl|my_center|LOCUS_12210 4586 4906 gene locus_tag LOCUS_12220 4586 4906 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549116.1 protein_id gnl|my_center|LOCUS_12220 4906 5763 gene locus_tag LOCUS_12230 4906 5763 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549117.1 protein_id gnl|my_center|LOCUS_12230 5773 6123 gene locus_tag LOCUS_12240 gene yabA 5773 6123 CDS product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254135.1 protein_id gnl|my_center|LOCUS_12240 6123 6974 gene locus_tag LOCUS_12250 gene rsmI 6123 6974 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549119.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence079 261 548 gene locus_tag LOCUS_12260 261 548 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549800.1 protein_id gnl|my_center|LOCUS_12260 801 1697 gene locus_tag LOCUS_12270 801 1697 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254571.1 protein_id gnl|my_center|LOCUS_12270 1724 2371 gene locus_tag LOCUS_12280 1724 2371 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254570.1 protein_id gnl|my_center|LOCUS_12280 2371 3165 gene locus_tag LOCUS_12290 2371 3165 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613417.1 protein_id gnl|my_center|LOCUS_12290 3422 4936 gene locus_tag LOCUS_12300 3422 4936 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549809.1 protein_id gnl|my_center|LOCUS_12300 5498 5022 gene locus_tag LOCUS_12310 5498 5022 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057799316.1 protein_id gnl|my_center|LOCUS_12310 6674 5556 gene locus_tag LOCUS_12320 6674 5556 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547400.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence080 970 590 gene locus_tag LOCUS_12330 970 590 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546509.1 protein_id gnl|my_center|LOCUS_12330 1150 1302 gene locus_tag LOCUS_12340 1150 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12340 1440 2177 gene locus_tag LOCUS_12350 1440 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12350 2289 2981 gene locus_tag LOCUS_12360 2289 2981 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254217.1 protein_id gnl|my_center|LOCUS_12360 4791 3016 gene locus_tag LOCUS_12370 4791 3016 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254216.1 protein_id gnl|my_center|LOCUS_12370 5802 4897 gene locus_tag LOCUS_12380 5802 4897 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546500.1 protein_id gnl|my_center|LOCUS_12380 5950 5795 gene locus_tag LOCUS_12390 5950 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12390 6598 5984 gene locus_tag LOCUS_12400 6598 5984 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254215.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12400 6954 6595 gene locus_tag LOCUS_12410 6954 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 7144 6935 gene locus_tag LOCUS_12420 7144 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence081 78 539 gene locus_tag LOCUS_12430 78 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 536 733 gene locus_tag LOCUS_12440 536 733 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982695.1 protein_id gnl|my_center|LOCUS_12440 749 1546 gene locus_tag LOCUS_12450 749 1546 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254183.1 protein_id gnl|my_center|LOCUS_12450 1624 1896 gene locus_tag LOCUS_12460 1624 1896 CDS product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549730.1 protein_id gnl|my_center|LOCUS_12460 2367 1960 gene locus_tag LOCUS_12470 2367 1960 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549313.1 protein_id gnl|my_center|LOCUS_12470 2586 2371 gene locus_tag LOCUS_12480 2586 2371 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549314.1 protein_id gnl|my_center|LOCUS_12480 2913 2734 gene locus_tag LOCUS_12490 2913 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 4783 2987 gene locus_tag LOCUS_12500 gene pepF 4783 2987 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549813.1 protein_id gnl|my_center|LOCUS_12500 4950 6188 gene locus_tag LOCUS_12510 4950 6188 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549814.1 protein_id gnl|my_center|LOCUS_12510 6253 6942 gene locus_tag LOCUS_12520 6253 6942 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943875.1 protein_id gnl|my_center|LOCUS_12520 7193 6939 gene locus_tag LOCUS_12530 7193 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence082 821 486 gene locus_tag LOCUS_12540 821 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 2328 1021 gene locus_tag LOCUS_12550 gene serS 2328 1021 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254519.1 protein_id gnl|my_center|LOCUS_12550 3110 2559 gene locus_tag LOCUS_12560 3110 2559 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550097.1 protein_id gnl|my_center|LOCUS_12560 3715 3110 gene locus_tag LOCUS_12570 3715 3110 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550094.1 protein_id gnl|my_center|LOCUS_12570 3873 4667 gene locus_tag LOCUS_12580 3873 4667 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254520.1 protein_id gnl|my_center|LOCUS_12580 4670 5530 gene locus_tag LOCUS_12590 4670 5530 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550089.1 protein_id gnl|my_center|LOCUS_12590 6061 5558 gene locus_tag LOCUS_12600 6061 5558 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254521.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence083 187 1239 gene locus_tag LOCUS_12610 187 1239 CDS product Rep family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546178.1 protein_id gnl|my_center|LOCUS_12610 1286 1480 gene locus_tag LOCUS_12620 1286 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549318.1 protein_id gnl|my_center|LOCUS_12620 1551 2753 gene locus_tag LOCUS_12630 1551 2753 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546183.1 protein_id gnl|my_center|LOCUS_12630 3482 3075 gene locus_tag LOCUS_12640 gene psiE 3482 3075 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905975.1 protein_id gnl|my_center|LOCUS_12640 3623 4225 gene locus_tag LOCUS_12650 3623 4225 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588841.1 protein_id gnl|my_center|LOCUS_12650 4672 4277 gene locus_tag LOCUS_12660 4672 4277 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546185.1 protein_id gnl|my_center|LOCUS_12660 4769 4999 gene locus_tag LOCUS_12670 4769 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 5246 5046 gene locus_tag LOCUS_12680 5246 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721275.1 protein_id gnl|my_center|LOCUS_12680 5390 6262 gene locus_tag LOCUS_12690 5390 6262 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546191.1 protein_id gnl|my_center|LOCUS_12690 6649 7290 gene locus_tag LOCUS_12700 6649 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence084 187 954 gene locus_tag LOCUS_12710 187 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 954 1538 gene locus_tag LOCUS_12720 954 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1556 1858 gene locus_tag LOCUS_12730 1556 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 1861 2670 gene locus_tag LOCUS_12740 1861 2670 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232980.1 protein_id gnl|my_center|LOCUS_12740 2663 3976 gene locus_tag LOCUS_12750 2663 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 4238 4528 gene locus_tag LOCUS_12760 4238 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 4530 4808 gene locus_tag LOCUS_12770 4530 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4805 5014 gene locus_tag LOCUS_12780 4805 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 5014 5334 gene locus_tag LOCUS_12790 5014 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 5327 5590 gene locus_tag LOCUS_12800 5327 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 5594 5809 gene locus_tag LOCUS_12810 5594 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 5811 6017 gene locus_tag LOCUS_12820 5811 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 6004 6165 gene locus_tag LOCUS_12830 6004 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 6167 6358 gene locus_tag LOCUS_12840 6167 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 6359 6700 gene locus_tag LOCUS_12850 6359 6700 CDS product VRR-NUC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834374.1 protein_id gnl|my_center|LOCUS_12850 6693 7238 gene locus_tag LOCUS_12860 6693 7238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence085 2000 2173 gene locus_tag LOCUS_12870 2000 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 2170 2823 gene locus_tag LOCUS_12880 2170 2823 CDS product SEC10/PgrA surface exclusion domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549962.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12880 3280 3822 gene locus_tag LOCUS_12890 3280 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 4381 3848 gene locus_tag LOCUS_12900 gene hpt 4381 3848 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567626.1 protein_id gnl|my_center|LOCUS_12900 5186 4620 gene locus_tag LOCUS_12910 5186 4620 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254542.1 protein_id gnl|my_center|LOCUS_12910 7087 5204 gene locus_tag LOCUS_12920 7087 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence086 193 486 gene locus_tag LOCUS_12930 193 486 CDS product type II toxin-antitoxin system MqsR family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254439.1 protein_id gnl|my_center|LOCUS_12930 504 887 gene locus_tag LOCUS_12940 504 887 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254438.1 protein_id gnl|my_center|LOCUS_12940 2339 948 gene locus_tag LOCUS_12950 2339 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 3023 2445 gene locus_tag LOCUS_12960 3023 2445 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546364.1 protein_id gnl|my_center|LOCUS_12960 4973 3204 gene locus_tag LOCUS_12970 4973 3204 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254194.1 protein_id gnl|my_center|LOCUS_12970 6707 4974 gene locus_tag LOCUS_12980 6707 4974 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254193.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence087 384 250 gene locus_tag LOCUS_12990 384 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1739 528 gene locus_tag LOCUS_13000 1739 528 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549732.1 protein_id gnl|my_center|LOCUS_13000 2059 1841 gene locus_tag LOCUS_13010 2059 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 2476 2069 gene locus_tag LOCUS_13020 2476 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549784.1 protein_id gnl|my_center|LOCUS_13020 2793 2608 gene locus_tag LOCUS_13030 2793 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 5264 2958 gene locus_tag LOCUS_13040 5264 2958 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254583.1 protein_id gnl|my_center|LOCUS_13040 6883 5552 gene locus_tag LOCUS_13050 6883 5552 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476585.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence088 1051 779 gene locus_tag LOCUS_13060 1051 779 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548299.1 protein_id gnl|my_center|LOCUS_13060 1151 1918 gene locus_tag LOCUS_13070 1151 1918 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548298.1 protein_id gnl|my_center|LOCUS_13070 2026 2376 gene locus_tag LOCUS_13080 2026 2376 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254487.1 protein_id gnl|my_center|LOCUS_13080 2677 3336 gene locus_tag LOCUS_13090 2677 3336 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547323.1 protein_id gnl|my_center|LOCUS_13090 3317 3988 gene locus_tag LOCUS_13100 3317 3988 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547325.1 protein_id gnl|my_center|LOCUS_13100 3998 4738 gene locus_tag LOCUS_13110 3998 4738 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547328.1 protein_id gnl|my_center|LOCUS_13110 4748 5614 gene locus_tag LOCUS_13120 4748 5614 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254325.1 protein_id gnl|my_center|LOCUS_13120 5897 6946 gene locus_tag LOCUS_13130 gene pheS 5897 6946 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548296.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence089 <1 515 gene locus_tag LOCUS_13140 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548117.1:MFS transporter 525 929 gene locus_tag LOCUS_13150 525 929 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548115.1 protein_id gnl|my_center|LOCUS_13150 933 1445 gene locus_tag LOCUS_13160 933 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1497 2249 gene locus_tag LOCUS_13170 1497 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548110.1 protein_id gnl|my_center|LOCUS_13170 2395 3894 gene locus_tag LOCUS_13180 2395 3894 CDS product SH3-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254386.1 protein_id gnl|my_center|LOCUS_13180 3908 4084 gene locus_tag LOCUS_13190 3908 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 4120 4437 gene locus_tag LOCUS_13200 4120 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 4663 6057 gene locus_tag LOCUS_13210 gene yjeM 4663 6057 CDS product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548106.1 protein_id gnl|my_center|LOCUS_13210 <6807 6113 gene locus_tag LOCUS_13220 <6807 6113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548234.1:acetate kinase >Feature sequence090 82 1131 gene locus_tag LOCUS_13230 82 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1136 2464 gene locus_tag LOCUS_13240 1136 2464 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546148.1 protein_id gnl|my_center|LOCUS_13240 2474 4711 gene locus_tag LOCUS_13250 2474 4711 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546149.1 protein_id gnl|my_center|LOCUS_13250 4756 5127 gene locus_tag LOCUS_13260 4756 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613312.1 protein_id gnl|my_center|LOCUS_13260 5159 5515 gene locus_tag LOCUS_13270 5159 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13270 5582 6010 gene locus_tag LOCUS_13280 5582 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13280 6085 6158 gene locus_tag LOCUS_t00150 6085 6158 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence091 524 2077 gene locus_tag LOCUS_13290 524 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352237.1 protein_id gnl|my_center|LOCUS_13290 2299 2748 gene locus_tag LOCUS_13300 2299 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 3361 2777 gene locus_tag LOCUS_13310 3361 2777 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549069.1 protein_id gnl|my_center|LOCUS_13310 4057 3398 gene locus_tag LOCUS_13320 4057 3398 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549070.1 protein_id gnl|my_center|LOCUS_13320 4131 4889 gene locus_tag LOCUS_13330 4131 4889 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549071.1 protein_id gnl|my_center|LOCUS_13330 4932 5612 gene locus_tag LOCUS_13340 4932 5612 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549072.1 protein_id gnl|my_center|LOCUS_13340 5673 6572 gene locus_tag LOCUS_13350 5673 6572 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549073.1 protein_id gnl|my_center|LOCUS_13350 6581 6763 gene locus_tag LOCUS_13360 6581 6763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence092 1159 437 gene locus_tag LOCUS_13370 1159 437 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254236.1 protein_id gnl|my_center|LOCUS_13370 1551 1162 gene locus_tag LOCUS_13380 1551 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 2549 1587 gene locus_tag LOCUS_13390 gene manA 2549 1587 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546690.1 protein_id gnl|my_center|LOCUS_13390 3805 2642 gene locus_tag LOCUS_13400 3805 2642 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158181789.1 protein_id gnl|my_center|LOCUS_13400 4701 3814 gene locus_tag LOCUS_13410 4701 3814 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546685.1 protein_id gnl|my_center|LOCUS_13410 5251 4886 gene locus_tag LOCUS_tm00010 5251 4886 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 6489 5305 gene locus_tag LOCUS_13420 6489 5305 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546683.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence093 <1 873 gene locus_tag LOCUS_13430 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549215.1:glycerophosphodiester phosphodiesterase 1916 915 gene locus_tag LOCUS_13440 1916 915 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549214.1 protein_id gnl|my_center|LOCUS_13440 2067 3173 gene locus_tag LOCUS_13450 2067 3173 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549213.1 protein_id gnl|my_center|LOCUS_13450 3601 3233 gene locus_tag LOCUS_13460 3601 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549212.1 protein_id gnl|my_center|LOCUS_13460 4044 3619 gene locus_tag LOCUS_13470 4044 3619 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549209.1 protein_id gnl|my_center|LOCUS_13470 4153 5004 gene locus_tag LOCUS_13480 4153 5004 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674287.1 protein_id gnl|my_center|LOCUS_13480 6326 5451 gene locus_tag LOCUS_13490 6326 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence094 685 170 gene locus_tag LOCUS_13500 685 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1220 945 gene locus_tag LOCUS_13510 1220 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1681 1316 gene locus_tag LOCUS_13520 1681 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 2376 1837 gene locus_tag LOCUS_13530 2376 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 3324 2521 gene locus_tag LOCUS_13540 3324 2521 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766263.1 protein_id gnl|my_center|LOCUS_13540 5579 4764 gene locus_tag LOCUS_13550 5579 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 6234 5602 gene locus_tag LOCUS_13560 6234 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 6508 6224 gene locus_tag LOCUS_13570 6508 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence095 985 491 gene locus_tag LOCUS_13580 985 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1904 1176 gene locus_tag LOCUS_13590 gene tatC 1904 1176 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801307.1 protein_id gnl|my_center|LOCUS_13590 2196 1945 gene locus_tag LOCUS_13600 2196 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 2475 2200 gene locus_tag LOCUS_13610 2475 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 3490 2480 gene locus_tag LOCUS_13620 3490 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 4706 3450 gene locus_tag LOCUS_13630 4706 3450 CDS product 4Fe-4S cluster-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460830.1 protein_id gnl|my_center|LOCUS_13630 4999 4847 gene locus_tag LOCUS_13640 4999 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 5702 5175 gene locus_tag LOCUS_13650 5702 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence096 212 862 gene locus_tag LOCUS_13660 212 862 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549989.1 protein_id gnl|my_center|LOCUS_13660 2276 1005 gene locus_tag LOCUS_13670 2276 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549986.1 protein_id gnl|my_center|LOCUS_13670 2417 3103 gene locus_tag LOCUS_13680 2417 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549985.1 protein_id gnl|my_center|LOCUS_13680 3283 5934 gene locus_tag LOCUS_13690 3283 5934 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254541.1 protein_id gnl|my_center|LOCUS_13690 6382 5984 gene locus_tag LOCUS_13700 6382 5984 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549981.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence097 <1 602 gene locus_tag LOCUS_13710 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254469.1:galactose mutarotase 735 968 gene locus_tag LOCUS_13720 735 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254332.1 protein_id gnl|my_center|LOCUS_13720 1981 1025 gene locus_tag LOCUS_13730 1981 1025 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363973.1 protein_id gnl|my_center|LOCUS_13730 2168 3424 gene locus_tag LOCUS_13740 2168 3424 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254464.1 protein_id gnl|my_center|LOCUS_13740 3437 4312 gene locus_tag LOCUS_13750 3437 4312 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548142.1 protein_id gnl|my_center|LOCUS_13750 4327 5160 gene locus_tag LOCUS_13760 4327 5160 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254463.1 protein_id gnl|my_center|LOCUS_13760 5187 6299 gene locus_tag LOCUS_13770 gene ugpC 5187 6299 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548138.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence098 1497 1030 gene locus_tag LOCUS_13780 1497 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 2138 1866 gene locus_tag LOCUS_13790 2138 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 2709 2314 gene locus_tag LOCUS_13800 2709 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 3156 2836 gene locus_tag LOCUS_13810 3156 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 3444 3169 gene locus_tag LOCUS_13820 3444 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 4493 3459 gene locus_tag LOCUS_13830 4493 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 4804 4574 gene locus_tag LOCUS_13840 4804 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 5513 5256 gene locus_tag LOCUS_13850 5513 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence099 1588 701 gene locus_tag LOCUS_13860 gene pstA 1588 701 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549099.1 protein_id gnl|my_center|LOCUS_13860 2585 1590 gene locus_tag LOCUS_13870 gene pstC 2585 1590 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549098.1 protein_id gnl|my_center|LOCUS_13870 3455 2589 gene locus_tag LOCUS_13880 3455 2589 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254125.1 protein_id gnl|my_center|LOCUS_13880 4267 3575 gene locus_tag LOCUS_13890 gene rplA 4267 3575 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549096.1 protein_id gnl|my_center|LOCUS_13890 4770 4345 gene locus_tag LOCUS_13900 gene rplK 4770 4345 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549095.1 protein_id gnl|my_center|LOCUS_13900 5458 4901 gene locus_tag LOCUS_13910 gene nusG 5458 4901 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549094.1 protein_id gnl|my_center|LOCUS_13910 5737 5567 gene locus_tag LOCUS_13920 gene secE 5737 5567 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549093.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence100 2496 139 gene locus_tag LOCUS_13930 2496 139 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549197.1 protein_id gnl|my_center|LOCUS_13930 2865 2554 gene locus_tag LOCUS_13940 2865 2554 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549194.1 protein_id gnl|my_center|LOCUS_13940 3295 2867 gene locus_tag LOCUS_13950 gene ruvX 3295 2867 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549192.1 protein_id gnl|my_center|LOCUS_13950 3552 3295 gene locus_tag LOCUS_13960 3552 3295 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549189.1 protein_id gnl|my_center|LOCUS_13960 <6201 3613 gene locus_tag LOCUS_13970 <6201 3613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549179.1:alanine--tRNA ligase >Feature sequence101 1515 1270 gene locus_tag LOCUS_13980 1515 1270 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548978.1 protein_id gnl|my_center|LOCUS_13980 3244 1625 gene locus_tag LOCUS_13990 3244 1625 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254098.1 protein_id gnl|my_center|LOCUS_13990 3360 4187 gene locus_tag LOCUS_14000 3360 4187 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548975.1 protein_id gnl|my_center|LOCUS_14000 5825 4233 gene locus_tag LOCUS_14010 5825 4233 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254096.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence102 858 5069 gene locus_tag LOCUS_14020 858 5069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 5095 5850 gene locus_tag LOCUS_14030 5095 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 >Feature sequence103 741 1658 gene locus_tag LOCUS_14040 741 1658 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550037.1 protein_id gnl|my_center|LOCUS_14040 1716 2435 gene locus_tag LOCUS_14050 1716 2435 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550031.1 protein_id gnl|my_center|LOCUS_14050 2413 3756 gene locus_tag LOCUS_14060 2413 3756 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254535.1 protein_id gnl|my_center|LOCUS_14060 3875 4423 gene locus_tag LOCUS_14070 3875 4423 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254536.1 protein_id gnl|my_center|LOCUS_14070 4441 5052 gene locus_tag LOCUS_14080 4441 5052 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550024.1 protein_id gnl|my_center|LOCUS_14080 5638 5114 gene locus_tag LOCUS_14090 5638 5114 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550021.1 protein_id gnl|my_center|LOCUS_14090 6021 5638 gene locus_tag LOCUS_14100 6021 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence104 1322 507 gene locus_tag LOCUS_14110 1322 507 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254228.1 protein_id gnl|my_center|LOCUS_14110 2131 1319 gene locus_tag LOCUS_14120 2131 1319 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546626.1 protein_id gnl|my_center|LOCUS_14120 3218 2121 gene locus_tag LOCUS_14130 3218 2121 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546625.1 protein_id gnl|my_center|LOCUS_14130 4121 3285 gene locus_tag LOCUS_14140 gene murB 4121 3285 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546624.1 protein_id gnl|my_center|LOCUS_14140 4217 4750 gene locus_tag LOCUS_14150 4217 4750 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546623.1 protein_id gnl|my_center|LOCUS_14150 5267 4788 gene locus_tag LOCUS_14160 gene tsaE 5267 4788 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546616.1 protein_id gnl|my_center|LOCUS_14160 <6064 5267 gene locus_tag LOCUS_14170 <6064 5267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254227.1:phosphate acetyltransferase >Feature sequence105 1787 594 gene locus_tag LOCUS_14180 1787 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 2664 1780 gene locus_tag LOCUS_14190 2664 1780 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_14190 3427 2648 gene locus_tag LOCUS_14200 3427 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 3953 3414 gene locus_tag LOCUS_14210 3953 3414 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861377.1 protein_id gnl|my_center|LOCUS_14210 4693 4031 gene locus_tag LOCUS_14220 4693 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 4998 5915 gene locus_tag LOCUS_14230 4998 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 >Feature sequence106 1342 86 gene locus_tag LOCUS_14240 gene rseP 1342 86 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547820.1 protein_id gnl|my_center|LOCUS_14240 2095 1355 gene locus_tag LOCUS_14250 2095 1355 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547823.1 protein_id gnl|my_center|LOCUS_14250 2907 2173 gene locus_tag LOCUS_14260 2907 2173 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547825.1 protein_id gnl|my_center|LOCUS_14260 3467 2910 gene locus_tag LOCUS_14270 gene frr 3467 2910 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095341972.1 protein_id gnl|my_center|LOCUS_14270 4192 3467 gene locus_tag LOCUS_14280 gene pyrH 4192 3467 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254400.1 protein_id gnl|my_center|LOCUS_14280 5362 4337 gene locus_tag LOCUS_14290 gene tsf 5362 4337 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547835.1 protein_id gnl|my_center|LOCUS_14290 <5977 5396 gene locus_tag LOCUS_14300 <5977 5396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547837.1:30S ribosomal protein S2 >Feature sequence107 20 874 gene locus_tag LOCUS_14310 20 874 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548928.1 protein_id gnl|my_center|LOCUS_14310 874 1728 gene locus_tag LOCUS_14320 874 1728 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548929.1 protein_id gnl|my_center|LOCUS_14320 1732 2184 gene locus_tag LOCUS_14330 1732 2184 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548931.1 protein_id gnl|my_center|LOCUS_14330 2186 2590 gene locus_tag LOCUS_14340 2186 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 2678 3463 gene locus_tag LOCUS_14350 2678 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 4963 3530 gene locus_tag LOCUS_14360 4963 3530 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546599.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence108 927 67 gene locus_tag LOCUS_14370 gene eutJ 927 67 CDS product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989696.1 protein_id gnl|my_center|LOCUS_14370 1707 1000 gene locus_tag LOCUS_14380 1707 1000 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548130.1 protein_id gnl|my_center|LOCUS_14380 2715 1885 gene locus_tag LOCUS_14390 2715 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 2892 3722 gene locus_tag LOCUS_14400 2892 3722 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660564.1 protein_id gnl|my_center|LOCUS_14400 3734 4834 gene locus_tag LOCUS_14410 3734 4834 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262240.1 protein_id gnl|my_center|LOCUS_14410 5613 4888 gene locus_tag LOCUS_14420 5613 4888 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296773.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence109 862 482 gene locus_tag LOCUS_14430 862 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1636 1298 gene locus_tag LOCUS_14440 1636 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 2974 1670 gene locus_tag LOCUS_14450 2974 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 3231 2974 gene locus_tag LOCUS_14460 3231 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 5321 3759 gene locus_tag LOCUS_14470 5321 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence110 138 1640 gene locus_tag LOCUS_14480 138 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1640 5566 gene locus_tag LOCUS_14490 1640 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence111 102 29 gene locus_tag LOCUS_t00160 102 29 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 349 1380 gene locus_tag LOCUS_14500 349 1380 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546600.1 protein_id gnl|my_center|LOCUS_14500 1433 2449 gene locus_tag LOCUS_14510 gene gap 1433 2449 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546601.1 protein_id gnl|my_center|LOCUS_14510 2564 3775 gene locus_tag LOCUS_14520 2564 3775 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546602.1 protein_id gnl|my_center|LOCUS_14520 3800 4558 gene locus_tag LOCUS_14530 gene tpiA 3800 4558 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546605.1 protein_id gnl|my_center|LOCUS_14530 5560 5045 gene locus_tag LOCUS_14540 5560 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254226.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence112 127 1035 gene locus_tag LOCUS_14550 127 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1019 1216 gene locus_tag LOCUS_14560 1019 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1216 2457 gene locus_tag LOCUS_14570 1216 2457 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237797.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence113 171 626 gene locus_tag LOCUS_14580 171 626 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_14580 1795 665 gene locus_tag LOCUS_14590 1795 665 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546645.1 protein_id gnl|my_center|LOCUS_14590 2004 2837 gene locus_tag LOCUS_14600 2004 2837 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546647.1 protein_id gnl|my_center|LOCUS_14600 2964 4985 gene locus_tag LOCUS_14610 2964 4985 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254231.1 protein_id gnl|my_center|LOCUS_14610 >Feature sequence114 899 648 gene locus_tag LOCUS_14620 899 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1070 912 gene locus_tag LOCUS_14630 1070 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 2630 1215 gene locus_tag LOCUS_14640 2630 1215 CDS product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546245.1 protein_id gnl|my_center|LOCUS_14640 3792 2959 gene locus_tag LOCUS_14650 3792 2959 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547578.1 protein_id gnl|my_center|LOCUS_14650 3945 4628 gene locus_tag LOCUS_14660 3945 4628 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065989431.1 protein_id gnl|my_center|LOCUS_14660 4615 5604 gene locus_tag LOCUS_14670 4615 5604 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476338.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence115 <1 1317 gene locus_tag LOCUS_14680 <1 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003704100.1:APC family permease 4963 1439 gene locus_tag LOCUS_14690 gene pulA 4963 1439 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549917.1 protein_id gnl|my_center|LOCUS_14690 5572 5141 gene locus_tag LOCUS_14700 5572 5141 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986654.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence116 47 541 gene locus_tag LOCUS_14710 gene tpx 47 541 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547331.1 protein_id gnl|my_center|LOCUS_14710 2337 598 gene locus_tag LOCUS_14720 2337 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 3830 2454 gene locus_tag LOCUS_14730 gene brnQ 3830 2454 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254324.1 protein_id gnl|my_center|LOCUS_14730 4838 4215 gene locus_tag LOCUS_14740 4838 4215 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547344.1 protein_id gnl|my_center|LOCUS_14740 5418 4825 gene locus_tag LOCUS_14750 5418 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence117 2691 1429 gene locus_tag LOCUS_14760 2691 1429 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461387.1 protein_id gnl|my_center|LOCUS_14760 2805 3701 gene locus_tag LOCUS_14770 2805 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 3894 4169 gene locus_tag LOCUS_14780 3894 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14780 >Feature sequence118 670 3819 gene locus_tag LOCUS_14790 670 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence119 25 100 gene locus_tag LOCUS_t00170 25 100 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 104 187 gene locus_tag LOCUS_t00180 104 187 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 190 262 gene locus_tag LOCUS_t00190 190 262 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 274 347 gene locus_tag LOCUS_t00200 274 347 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 353 426 gene locus_tag LOCUS_t00210 353 426 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 449 519 gene locus_tag LOCUS_t00220 449 519 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 560 646 gene locus_tag LOCUS_t00230 560 646 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 767 1945 gene locus_tag LOCUS_14800 767 1945 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550126.1 protein_id gnl|my_center|LOCUS_14800 1946 2989 gene locus_tag LOCUS_14810 1946 2989 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550128.1 protein_id gnl|my_center|LOCUS_14810 2989 4014 gene locus_tag LOCUS_14820 2989 4014 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550130.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence120 87 1319 gene locus_tag LOCUS_14830 87 1319 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254218.1 protein_id gnl|my_center|LOCUS_14830 1316 2560 gene locus_tag LOCUS_14840 1316 2560 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546521.1 protein_id gnl|my_center|LOCUS_14840 2574 3302 gene locus_tag LOCUS_14850 2574 3302 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546523.1 protein_id gnl|my_center|LOCUS_14850 3370 4449 gene locus_tag LOCUS_14860 3370 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 4467 5027 gene locus_tag LOCUS_14870 gene pgsA 4467 5027 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546529.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence121 610 2727 gene locus_tag LOCUS_14880 610 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 3563 4021 gene locus_tag LOCUS_14890 3563 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence122 <1 1393 gene locus_tag LOCUS_14900 <1 1393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546418.1:alpha-glucoside-specific PTS transporter subunit IIBC 1407 2264 gene locus_tag LOCUS_14910 1407 2264 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254203.1 protein_id gnl|my_center|LOCUS_14910 2251 2748 gene locus_tag LOCUS_14920 2251 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254204.1 protein_id gnl|my_center|LOCUS_14920 2769 3254 gene locus_tag LOCUS_14930 2769 3254 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546424.1 protein_id gnl|my_center|LOCUS_14930 3373 3639 gene locus_tag LOCUS_14940 3373 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546427.1 protein_id gnl|my_center|LOCUS_14940 3711 4367 gene locus_tag LOCUS_14950 3711 4367 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546429.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence123 249 1358 gene locus_tag LOCUS_14960 gene yqeH 249 1358 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548317.1 protein_id gnl|my_center|LOCUS_14960 1369 2022 gene locus_tag LOCUS_14970 1369 2022 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548315.1 protein_id gnl|my_center|LOCUS_14970 2003 2596 gene locus_tag LOCUS_14980 gene yqeK 2003 2596 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548313.1 protein_id gnl|my_center|LOCUS_14980 2614 2961 gene locus_tag LOCUS_14990 gene rsfS 2614 2961 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548311.1 protein_id gnl|my_center|LOCUS_14990 2965 4116 gene locus_tag LOCUS_15000 2965 4116 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548309.1 protein_id gnl|my_center|LOCUS_15000 4119 4682 gene locus_tag LOCUS_15010 4119 4682 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548307.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence124 30 2231 gene locus_tag LOCUS_15020 30 2231 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548136.1 protein_id gnl|my_center|LOCUS_15020 2243 3685 gene locus_tag LOCUS_15030 gene gtfA 2243 3685 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254462.1 protein_id gnl|my_center|LOCUS_15030 3856 4470 gene locus_tag LOCUS_15040 3856 4470 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548123.1 protein_id gnl|my_center|LOCUS_15040 4477 5142 gene locus_tag LOCUS_15050 4477 5142 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548121.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence125 656 156 gene locus_tag LOCUS_15060 gene tadA 656 156 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 protein_id gnl|my_center|LOCUS_15060 913 731 gene locus_tag LOCUS_15070 913 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613299.1 protein_id gnl|my_center|LOCUS_15070 1661 1041 gene locus_tag LOCUS_15080 1661 1041 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254130.1 protein_id gnl|my_center|LOCUS_15080 2506 1667 gene locus_tag LOCUS_15090 2506 1667 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549107.1 protein_id gnl|my_center|LOCUS_15090 2948 2586 gene locus_tag LOCUS_15100 gene rplL 2948 2586 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254128.1 protein_id gnl|my_center|LOCUS_15100 3513 3001 gene locus_tag LOCUS_15110 gene rplJ 3513 3001 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549105.1 protein_id gnl|my_center|LOCUS_15110 3995 3792 gene locus_tag LOCUS_15120 3995 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 4100 4495 gene locus_tag LOCUS_15130 4100 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 <5298 4780 gene locus_tag LOCUS_15140 <5298 4780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549102.1:phosphate signaling complex protein PhoU >Feature sequence126 1274 930 gene locus_tag LOCUS_15150 1274 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1528 1271 gene locus_tag LOCUS_15160 1528 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 2231 1521 gene locus_tag LOCUS_15170 2231 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 2595 2206 gene locus_tag LOCUS_15180 2595 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 3193 2738 gene locus_tag LOCUS_15190 3193 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3561 3196 gene locus_tag LOCUS_15200 3561 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 3955 3566 gene locus_tag LOCUS_15210 3955 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 4762 4250 gene locus_tag LOCUS_15220 4762 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 >Feature sequence127 <1 706 gene locus_tag LOCUS_15230 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548230.1:transketolase C-terminal domain-containing protein 722 2173 gene locus_tag LOCUS_15240 722 2173 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548232.1 protein_id gnl|my_center|LOCUS_15240 <5121 2476 gene locus_tag LOCUS_15250 <5121 2476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548280.1:S8 family serine peptidase >Feature sequence128 580 107 gene locus_tag LOCUS_15260 580 107 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569926.1 protein_id gnl|my_center|LOCUS_15260 2264 1107 gene locus_tag LOCUS_15270 2264 1107 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546535.1 protein_id gnl|my_center|LOCUS_15270 4006 2369 gene locus_tag LOCUS_15280 gene rny 4006 2369 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254219.1 protein_id gnl|my_center|LOCUS_15280 <5082 4122 gene locus_tag LOCUS_15290 <5082 4122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546531.1:recombinase RecA >Feature sequence129 249 1118 gene locus_tag LOCUS_15300 249 1118 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296674.1 protein_id gnl|my_center|LOCUS_15300 1822 1115 gene locus_tag LOCUS_15310 1822 1115 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025079808.1 protein_id gnl|my_center|LOCUS_15310 2160 3152 gene locus_tag LOCUS_15320 gene trpX 2160 3152 CDS product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254013.1 protein_id gnl|my_center|LOCUS_15320 3149 4045 gene locus_tag LOCUS_15330 3149 4045 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 protein_id gnl|my_center|LOCUS_15330 4042 4803 gene locus_tag LOCUS_15340 4042 4803 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549277.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence130 82 585 gene locus_tag LOCUS_15350 gene coaD 82 585 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475856.1 protein_id gnl|my_center|LOCUS_15350 582 1196 gene locus_tag LOCUS_15360 582 1196 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254627.1 protein_id gnl|my_center|LOCUS_15360 1200 2114 gene locus_tag LOCUS_15370 gene coaA 1200 2114 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550009.1 protein_id gnl|my_center|LOCUS_15370 2569 5010 gene locus_tag LOCUS_15380 2569 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence131 <1 587 gene locus_tag LOCUS_15390 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003643070.1:FAD-dependent oxidoreductase 1209 667 gene locus_tag LOCUS_15400 1209 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1821 3701 gene locus_tag LOCUS_15410 1821 3701 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187364788.1 protein_id gnl|my_center|LOCUS_15410 <4968 3753 gene locus_tag LOCUS_15420 <4968 3753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254206.1:amino acid permease >Feature sequence132 959 285 gene locus_tag LOCUS_15430 959 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 2382 1162 gene locus_tag LOCUS_15440 2382 1162 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013853658.1 protein_id gnl|my_center|LOCUS_15440 2951 2397 gene locus_tag LOCUS_15450 2951 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15450 3296 3024 gene locus_tag LOCUS_15460 3296 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15460 3356 4345 gene locus_tag LOCUS_15470 3356 4345 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476124.1 protein_id gnl|my_center|LOCUS_15470 <4906 4342 gene locus_tag LOCUS_15480 <4906 4342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102162.1:demethylmenaquinone methyltransferase >Feature sequence133 650 519 gene locus_tag LOCUS_15490 650 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15490 3158 744 gene locus_tag LOCUS_15500 gene leuS 3158 744 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548508.1 protein_id gnl|my_center|LOCUS_15500 3448 4113 gene locus_tag LOCUS_15510 3448 4113 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254516.1 protein_id gnl|my_center|LOCUS_15510 <4893 4156 gene locus_tag LOCUS_15520 <4893 4156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057048.1:LysR family transcriptional regulator >Feature sequence134 1059 532 gene locus_tag LOCUS_15530 1059 532 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547784.1 protein_id gnl|my_center|LOCUS_15530 3437 1164 gene locus_tag LOCUS_15540 gene recJ 3437 1164 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547786.1 protein_id gnl|my_center|LOCUS_15540 4241 3558 gene locus_tag LOCUS_15550 4241 3558 CDS product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547788.1 protein_id gnl|my_center|LOCUS_15550 <4864 4243 gene locus_tag LOCUS_15560 <4864 4243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254395.1:translation elongation factor 4 >Feature sequence135 1336 86 gene locus_tag LOCUS_15570 1336 86 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548246.1 protein_id gnl|my_center|LOCUS_15570 2291 1329 gene locus_tag LOCUS_15580 gene miaA 2291 1329 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548247.1 protein_id gnl|my_center|LOCUS_15580 2728 2327 gene locus_tag LOCUS_15590 2728 2327 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548248.1 protein_id gnl|my_center|LOCUS_15590 3026 2787 gene locus_tag LOCUS_15600 3026 2787 CDS product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548250.1 protein_id gnl|my_center|LOCUS_15600 3712 3026 gene locus_tag LOCUS_15610 3712 3026 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254484.1 protein_id gnl|my_center|LOCUS_15610 4342 3746 gene locus_tag LOCUS_15620 4342 3746 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548253.1 protein_id gnl|my_center|LOCUS_15620 4513 4364 gene locus_tag LOCUS_15630 gene rpmG 4513 4364 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548272.1 protein_id gnl|my_center|LOCUS_15630 4846 4589 gene locus_tag LOCUS_15640 4846 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 >Feature sequence136 829 1392 gene locus_tag LOCUS_15650 gene lepB 829 1392 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547598.1 protein_id gnl|my_center|LOCUS_15650 1463 1651 gene locus_tag LOCUS_15660 1463 1651 CDS product LBP_cg2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547599.1 protein_id gnl|my_center|LOCUS_15660 2107 1784 gene locus_tag LOCUS_15670 2107 1784 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563651.1 protein_id gnl|my_center|LOCUS_15670 2640 2119 gene locus_tag LOCUS_15680 2640 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15680 3730 2927 gene locus_tag LOCUS_15690 3730 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547601.1 protein_id gnl|my_center|LOCUS_15690 4570 3740 gene locus_tag LOCUS_15700 4570 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254375.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence137 351 73 gene locus_tag LOCUS_15710 351 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 552 406 gene locus_tag LOCUS_15720 552 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1217 666 gene locus_tag LOCUS_15730 1217 666 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547351.1 protein_id gnl|my_center|LOCUS_15730 1362 1739 gene locus_tag LOCUS_15740 1362 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549816.1 protein_id gnl|my_center|LOCUS_15740 1753 3294 gene locus_tag LOCUS_15750 1753 3294 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549817.1 protein_id gnl|my_center|LOCUS_15750 3305 4075 gene locus_tag LOCUS_15760 3305 4075 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549818.1 protein_id gnl|my_center|LOCUS_15760 4078 4563 gene locus_tag LOCUS_15770 4078 4563 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549820.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence138 2330 1902 gene locus_tag LOCUS_15780 2330 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548785.1 protein_id gnl|my_center|LOCUS_15780 2522 3601 gene locus_tag LOCUS_15790 2522 3601 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804254.1 protein_id gnl|my_center|LOCUS_15790 3669 3875 gene locus_tag LOCUS_15800 3669 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 4394 4020 gene locus_tag LOCUS_15810 4394 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 4656 4381 gene locus_tag LOCUS_15820 4656 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence139 <1 524 gene locus_tag LOCUS_15830 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_095522727.1:peptide chain release factor 2 533 805 gene locus_tag LOCUS_15840 533 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546557.1 protein_id gnl|my_center|LOCUS_15840 820 1791 gene locus_tag LOCUS_15850 gene hprK 820 1791 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546560.1 protein_id gnl|my_center|LOCUS_15850 1784 2623 gene locus_tag LOCUS_15860 gene lgt 1784 2623 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613330.1 protein_id gnl|my_center|LOCUS_15860 2664 3683 gene locus_tag LOCUS_15870 2664 3683 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546563.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence140 158 523 gene locus_tag LOCUS_15880 158 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1164 565 gene locus_tag LOCUS_15890 1164 565 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547484.1 protein_id gnl|my_center|LOCUS_15890 2185 1250 gene locus_tag LOCUS_15900 2185 1250 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547481.1 protein_id gnl|my_center|LOCUS_15900 3189 2215 gene locus_tag LOCUS_15910 3189 2215 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547480.1 protein_id gnl|my_center|LOCUS_15910 <4672 3337 gene locus_tag LOCUS_15920 <4672 3337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547478.1:DNA topoisomerase IV subunit A >Feature sequence141 876 2534 gene locus_tag LOCUS_15930 876 2534 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546143.1 protein_id gnl|my_center|LOCUS_15930 4244 2625 gene locus_tag LOCUS_15940 4244 2625 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254603.1 protein_id gnl|my_center|LOCUS_15940 4582 4241 gene locus_tag LOCUS_15950 4582 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence142 <1 1345 gene locus_tag LOCUS_15960 <1 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547843.1:M13 family metallopeptidase 2583 1405 gene locus_tag LOCUS_15970 2583 1405 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254401.1 protein_id gnl|my_center|LOCUS_15970 3310 2696 gene locus_tag LOCUS_15980 3310 2696 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547840.1 protein_id gnl|my_center|LOCUS_15980 3384 4415 gene locus_tag LOCUS_15990 3384 4415 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547839.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence143 <1 675 gene locus_tag LOCUS_16000 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546337.1:aldo/keto reductase 757 1029 gene locus_tag LOCUS_16010 757 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 2613 1081 gene locus_tag LOCUS_16020 2613 1081 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109168.1 protein_id gnl|my_center|LOCUS_16020 4131 2800 gene locus_tag LOCUS_16030 4131 2800 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546343.1 protein_id gnl|my_center|LOCUS_16030 <4648 4143 gene locus_tag LOCUS_16040 <4648 4143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546345.1:bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR >Feature sequence144 205 894 gene locus_tag LOCUS_16050 205 894 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546852.1 protein_id gnl|my_center|LOCUS_16050 1013 3151 gene locus_tag LOCUS_16060 1013 3151 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546854.1 protein_id gnl|my_center|LOCUS_16060 3148 4134 gene locus_tag LOCUS_16070 gene holA 3148 4134 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546856.1 protein_id gnl|my_center|LOCUS_16070 4455 4198 gene locus_tag LOCUS_16080 gene rpsT 4455 4198 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546858.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence145 1107 226 gene locus_tag LOCUS_16090 1107 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1780 1319 gene locus_tag LOCUS_16100 1780 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence146 404 1393 gene locus_tag LOCUS_16110 gene add 404 1393 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548323.1 protein_id gnl|my_center|LOCUS_16110 1797 1441 gene locus_tag LOCUS_16120 gene rplT 1797 1441 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548326.1 protein_id gnl|my_center|LOCUS_16120 2042 1842 gene locus_tag LOCUS_16130 gene rpmI 2042 1842 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548328.1 protein_id gnl|my_center|LOCUS_16130 2513 2064 gene locus_tag LOCUS_16140 gene infC 2513 2064 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075917325.1 protein_id gnl|my_center|LOCUS_16140 3335 2805 gene locus_tag LOCUS_16150 3335 2805 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547298.1 protein_id gnl|my_center|LOCUS_16150 4130 3366 gene locus_tag LOCUS_16160 4130 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence147 187 369 gene locus_tag LOCUS_16170 187 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 382 588 gene locus_tag LOCUS_16180 382 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 585 1094 gene locus_tag LOCUS_16190 585 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1098 1409 gene locus_tag LOCUS_16200 1098 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 1533 1670 gene locus_tag LOCUS_16210 1533 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 2087 2278 gene locus_tag LOCUS_16220 2087 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 2330 2461 gene locus_tag LOCUS_16230 2330 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 2573 2761 gene locus_tag LOCUS_16240 2573 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2987 3382 gene locus_tag LOCUS_16250 2987 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 3425 3586 gene locus_tag LOCUS_16260 3425 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 3707 3850 gene locus_tag LOCUS_16270 3707 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 4069 4365 gene locus_tag LOCUS_16280 4069 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 >Feature sequence148 1785 838 gene locus_tag LOCUS_16290 gene cas1e 1785 838 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674075.1 protein_id gnl|my_center|LOCUS_16290 2446 1790 gene locus_tag LOCUS_16300 gene cas6e 2446 1790 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674074.1 protein_id gnl|my_center|LOCUS_16300 3181 2456 gene locus_tag LOCUS_16310 gene cas5e 3181 2456 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674073.1 protein_id gnl|my_center|LOCUS_16310 4271 3162 gene locus_tag LOCUS_16320 gene cas7e 4271 3162 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674072.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence149 2118 1141 gene locus_tag LOCUS_16330 2118 1141 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254506.1 protein_id gnl|my_center|LOCUS_16330 <4533 2111 gene locus_tag LOCUS_16340 <4533 2111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254507.1:AAA family ATPase >Feature sequence150 99 557 gene locus_tag LOCUS_16350 99 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 1133 714 gene locus_tag LOCUS_16360 1133 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1321 1485 gene locus_tag LOCUS_16370 1321 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 2166 1675 gene locus_tag LOCUS_16380 2166 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 3248 2379 gene locus_tag LOCUS_16390 3248 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 3441 4334 gene locus_tag LOCUS_16400 3441 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence151 2 256 gene locus_tag LOCUS_16410 2 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 253 1212 gene locus_tag LOCUS_16420 253 1212 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546633.1 protein_id gnl|my_center|LOCUS_16420 1235 2587 gene locus_tag LOCUS_16430 gene glmM 1235 2587 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546635.1 protein_id gnl|my_center|LOCUS_16430 2688 3503 gene locus_tag LOCUS_16440 2688 3503 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546636.1 protein_id gnl|my_center|LOCUS_16440 3534 3974 gene locus_tag LOCUS_16450 3534 3974 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549441.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence152 182 640 gene locus_tag LOCUS_16460 182 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 998 1597 gene locus_tag LOCUS_16470 998 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1907 2161 gene locus_tag LOCUS_16480 1907 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 2163 2666 gene locus_tag LOCUS_16490 2163 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 2656 3918 gene locus_tag LOCUS_16500 2656 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 3921 4466 gene locus_tag LOCUS_16510 3921 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence153 1 366 gene locus_tag LOCUS_16520 1 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 366 707 gene locus_tag LOCUS_16530 366 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 755 1057 gene locus_tag LOCUS_16540 755 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1145 1612 gene locus_tag LOCUS_16550 1145 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1612 1791 gene locus_tag LOCUS_16560 1612 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1763 2230 gene locus_tag LOCUS_16570 1763 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 2297 2482 gene locus_tag LOCUS_16580 2297 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2475 2837 gene locus_tag LOCUS_16590 2475 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 2821 3657 gene locus_tag LOCUS_16600 2821 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence154 1306 56 gene locus_tag LOCUS_16610 1306 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 1993 1448 gene locus_tag LOCUS_16620 gene raiA 1993 1448 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254221.1 protein_id gnl|my_center|LOCUS_16620 2769 2074 gene locus_tag LOCUS_16630 2769 2074 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254220.1 protein_id gnl|my_center|LOCUS_16630 4046 2766 gene locus_tag LOCUS_16640 4046 2766 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546538.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence155 1145 420 gene locus_tag LOCUS_16650 gene prdB 1145 420 CDS product D-proline reductase (dithiol) protein PrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861888.1 transl_except (pos:complement(693..695),aa:Sec) note codon on position 151 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_16650 1471 1148 gene locus_tag LOCUS_16660 1471 1148 CDS product CBO2463/CBO2479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422102.1 protein_id gnl|my_center|LOCUS_16660 3372 1471 gene locus_tag LOCUS_16670 gene prdA 3372 1471 CDS product D-proline reductase (dithiol) proprotein PrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422104.1 protein_id gnl|my_center|LOCUS_16670 <4403 3812 gene locus_tag LOCUS_16680 <4403 3812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548604.1:proline iminopeptidase-family hydrolase >Feature sequence156 881 1804 gene locus_tag LOCUS_16690 881 1804 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254443.1 protein_id gnl|my_center|LOCUS_16690 1973 2515 gene locus_tag LOCUS_16700 gene pyrR 1973 2515 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548034.1 protein_id gnl|my_center|LOCUS_16700 2656 3612 gene locus_tag LOCUS_16710 2656 3612 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548032.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence157 187 5 gene locus_tag LOCUS_16720 187 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 813 190 gene locus_tag LOCUS_16730 813 190 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188367817.1 protein_id gnl|my_center|LOCUS_16730 2414 1791 gene locus_tag LOCUS_16740 2414 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 3624 2407 gene locus_tag LOCUS_16750 3624 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 4140 3928 gene locus_tag LOCUS_16760 4140 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 >Feature sequence158 94 396 gene locus_tag LOCUS_16770 94 396 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221463.1 protein_id gnl|my_center|LOCUS_16770 396 1175 gene locus_tag LOCUS_16780 396 1175 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546811.1 protein_id gnl|my_center|LOCUS_16780 1172 1996 gene locus_tag LOCUS_16790 1172 1996 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254259.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence159 453 1925 gene locus_tag LOCUS_16800 453 1925 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254465.1 protein_id gnl|my_center|LOCUS_16800 1926 2486 gene locus_tag LOCUS_16810 1926 2486 CDS product DUF4811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548152.1 protein_id gnl|my_center|LOCUS_16810 3491 2733 gene locus_tag LOCUS_16820 gene fetB 3491 2733 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254483.1 protein_id gnl|my_center|LOCUS_16820 4126 3488 gene locus_tag LOCUS_16830 4126 3488 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548243.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence160 104 1303 gene locus_tag LOCUS_16840 104 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1316 2317 gene locus_tag LOCUS_16850 1316 2317 CDS product FMN-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254509.1 protein_id gnl|my_center|LOCUS_16850 2631 2975 gene locus_tag LOCUS_16860 2631 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548967.1 protein_id gnl|my_center|LOCUS_16860 2956 3231 gene locus_tag LOCUS_16870 2956 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254095.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence161 12 1514 gene locus_tag LOCUS_16880 gene abc-f 12 1514 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475486.1 protein_id gnl|my_center|LOCUS_16880 1860 1567 gene locus_tag LOCUS_16890 1860 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548058.1 protein_id gnl|my_center|LOCUS_16890 1989 2651 gene locus_tag LOCUS_16900 1989 2651 CDS product serine dehydratase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254449.1 protein_id gnl|my_center|LOCUS_16900 2666 3547 gene locus_tag LOCUS_16910 gene sdaAA 2666 3547 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548060.1 protein_id gnl|my_center|LOCUS_16910 3556 3870 gene locus_tag LOCUS_16920 3556 3870 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548061.1 protein_id gnl|my_center|LOCUS_16920 4211 3918 gene locus_tag LOCUS_16930 4211 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence162 2 586 gene locus_tag LOCUS_16940 gene grpE 2 586 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547792.1 protein_id gnl|my_center|LOCUS_16940 603 2468 gene locus_tag LOCUS_16950 gene dnaK 603 2468 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547791.1 protein_id gnl|my_center|LOCUS_16950 2551 3702 gene locus_tag LOCUS_16960 gene dnaJ 2551 3702 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547790.1 protein_id gnl|my_center|LOCUS_16960 4215 3760 gene locus_tag LOCUS_16970 4215 3760 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644009.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence163 1203 274 gene locus_tag LOCUS_16980 1203 274 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437151.1 protein_id gnl|my_center|LOCUS_16980 3270 1333 gene locus_tag LOCUS_16990 gene thrS 3270 1333 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548338.1 protein_id gnl|my_center|LOCUS_16990 <4198 3555 gene locus_tag LOCUS_17000 <4198 3555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254494.1:primosomal protein DnaI >Feature sequence164 1440 2219 gene locus_tag LOCUS_17010 1440 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence165 748 290 gene locus_tag LOCUS_17020 gene smpB 748 290 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550138.1 protein_id gnl|my_center|LOCUS_17020 3100 761 gene locus_tag LOCUS_17030 gene rnr 3100 761 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550136.1 protein_id gnl|my_center|LOCUS_17030 3406 3173 gene locus_tag LOCUS_17040 gene secG 3406 3173 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254157.1 protein_id gnl|my_center|LOCUS_17040 4142 3474 gene locus_tag LOCUS_17050 4142 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence166 774 652 gene locus_tag LOCUS_17060 774 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 934 782 gene locus_tag LOCUS_17070 934 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 1403 1723 gene locus_tag LOCUS_17080 1403 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 2283 1789 gene locus_tag LOCUS_17090 2283 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2905 2273 gene locus_tag LOCUS_17100 2905 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 3924 3064 gene locus_tag LOCUS_17110 3924 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence167 1114 1854 gene locus_tag LOCUS_17120 1114 1854 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546366.1 protein_id gnl|my_center|LOCUS_17120 1893 2684 gene locus_tag LOCUS_17130 1893 2684 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546367.1 protein_id gnl|my_center|LOCUS_17130 2684 3325 gene locus_tag LOCUS_17140 2684 3325 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546368.1 protein_id gnl|my_center|LOCUS_17140 3343 3996 gene locus_tag LOCUS_17150 3343 3996 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546369.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence168 111 800 gene locus_tag LOCUS_17160 111 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 986 1477 gene locus_tag LOCUS_17170 986 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1598 2260 gene locus_tag LOCUS_17180 1598 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 3179 2460 gene locus_tag LOCUS_17190 3179 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 3713 3366 gene locus_tag LOCUS_17200 3713 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence169 1291 377 gene locus_tag LOCUS_17210 1291 377 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101571.1 protein_id gnl|my_center|LOCUS_17210 <4063 1316 gene locus_tag LOCUS_17220 <4063 1316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948403.1:DEAD/DEAH box helicase family protein >Feature sequence170 482 730 gene locus_tag LOCUS_17230 482 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17230 1044 1211 gene locus_tag LOCUS_17240 1044 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1195 1689 gene locus_tag LOCUS_17250 1195 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1711 1851 gene locus_tag LOCUS_17260 1711 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2794 1976 gene locus_tag LOCUS_17270 2794 1976 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547157.1 protein_id gnl|my_center|LOCUS_17270 3035 3433 gene locus_tag LOCUS_17280 3035 3433 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254309.1 protein_id gnl|my_center|LOCUS_17280 3430 3807 gene locus_tag LOCUS_17290 gene crcB 3430 3807 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547161.1 protein_id gnl|my_center|LOCUS_17290 3827 4048 gene locus_tag LOCUS_17300 3827 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 >Feature sequence171 2282 93 gene locus_tag LOCUS_17310 2282 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 3063 2362 gene locus_tag LOCUS_17320 3063 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence172 433 77 gene locus_tag LOCUS_17330 gene msrB 433 77 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548013.1 protein_id gnl|my_center|LOCUS_17330 730 449 gene locus_tag LOCUS_17340 730 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613385.1 protein_id gnl|my_center|LOCUS_17340 1674 856 gene locus_tag LOCUS_17350 1674 856 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548017.1 protein_id gnl|my_center|LOCUS_17350 3390 1864 gene locus_tag LOCUS_17360 3390 1864 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549809.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence173 1288 395 gene locus_tag LOCUS_17370 1288 395 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813616.1 protein_id gnl|my_center|LOCUS_17370 1773 1285 gene locus_tag LOCUS_17380 1773 1285 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249319.1 protein_id gnl|my_center|LOCUS_17380 2621 1776 gene locus_tag LOCUS_17390 2621 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 <4002 2635 gene locus_tag LOCUS_17400 <4002 2635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461245.1:MBOAT family protein >Feature sequence174 672 1613 gene locus_tag LOCUS_17410 672 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 1615 2334 gene locus_tag LOCUS_17420 1615 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 2347 3072 gene locus_tag LOCUS_17430 2347 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence175 1629 466 gene locus_tag LOCUS_17440 1629 466 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546457.1 protein_id gnl|my_center|LOCUS_17440 2642 1740 gene locus_tag LOCUS_17450 gene galU 2642 1740 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546456.1 protein_id gnl|my_center|LOCUS_17450 3626 2703 gene locus_tag LOCUS_17460 3626 2703 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546451.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence176 3460 1091 gene locus_tag LOCUS_17470 3460 1091 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546830.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence177 891 187 gene locus_tag LOCUS_17480 891 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1657 899 gene locus_tag LOCUS_17490 1657 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 2006 1719 gene locus_tag LOCUS_17500 2006 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2377 2228 gene locus_tag LOCUS_17510 2377 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 3346 2381 gene locus_tag LOCUS_17520 3346 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence178 <1 1099 gene locus_tag LOCUS_17530 <1 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254312.1:ATP-binding cassette domain-containing protein 1272 2261 gene locus_tag LOCUS_17540 gene mmuM 1272 2261 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547183.1 protein_id gnl|my_center|LOCUS_17540 3149 2517 gene locus_tag LOCUS_17550 3149 2517 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547184.1 protein_id gnl|my_center|LOCUS_17550 3245 3694 gene locus_tag LOCUS_17560 3245 3694 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797437.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence179 99 563 gene locus_tag LOCUS_17570 99 563 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641849.1 protein_id gnl|my_center|LOCUS_17570 556 924 gene locus_tag LOCUS_17580 556 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 1038 2336 gene locus_tag LOCUS_17590 1038 2336 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254333.1 protein_id gnl|my_center|LOCUS_17590 2418 3773 gene locus_tag LOCUS_17600 2418 3773 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460717.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence180 2360 414 gene locus_tag LOCUS_17610 2360 414 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548782.1 protein_id gnl|my_center|LOCUS_17610 3659 2442 gene locus_tag LOCUS_17620 3659 2442 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548780.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence181 404 249 gene locus_tag LOCUS_17630 404 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 834 391 gene locus_tag LOCUS_17640 834 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 1795 971 gene locus_tag LOCUS_17650 1795 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 2451 1990 gene locus_tag LOCUS_17660 2451 1990 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101758.1 protein_id gnl|my_center|LOCUS_17660 3047 2607 gene locus_tag LOCUS_17670 3047 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 3259 3047 gene locus_tag LOCUS_17680 3259 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 3432 3256 gene locus_tag LOCUS_17690 3432 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 3656 3432 gene locus_tag LOCUS_17700 3656 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence182 147 695 gene locus_tag LOCUS_17710 147 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1600 719 gene locus_tag LOCUS_17720 1600 719 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548604.1 protein_id gnl|my_center|LOCUS_17720 2262 1609 gene locus_tag LOCUS_17730 2262 1609 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548607.1 protein_id gnl|my_center|LOCUS_17730 3619 2267 gene locus_tag LOCUS_17740 3619 2267 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548609.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence183 >Feature sequence184 2617 1862 gene locus_tag LOCUS_17750 2617 1862 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254417.1 protein_id gnl|my_center|LOCUS_17750 <3763 2622 gene locus_tag LOCUS_17760 <3763 2622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254418.1:16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB >Feature sequence185 932 294 gene locus_tag LOCUS_17770 932 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 2826 2347 gene locus_tag LOCUS_17780 2826 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 3462 2947 gene locus_tag LOCUS_17790 3462 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 3611 3477 gene locus_tag LOCUS_17800 3611 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence186 2430 31 gene locus_tag LOCUS_17810 2430 31 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548276.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence187 3310 647 gene locus_tag LOCUS_17820 gene polA 3310 647 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548351.1 protein_id gnl|my_center|LOCUS_17820 >Feature sequence188 <1 565 gene locus_tag LOCUS_17830 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836747.1:accessory Sec system glycosylation chaperone GtfB 558 755 gene locus_tag LOCUS_17840 558 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 1011 1559 gene locus_tag LOCUS_17850 1011 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 2941 2567 gene locus_tag LOCUS_17860 2941 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 2928 3428 gene locus_tag LOCUS_17870 2928 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence189 1696 2745 gene locus_tag LOCUS_17880 1696 2745 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004270929.1 protein_id gnl|my_center|LOCUS_17880 2835 3410 gene locus_tag LOCUS_17890 2835 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 3435 3629 gene locus_tag LOCUS_17900 3435 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence190 146 484 gene locus_tag LOCUS_17910 146 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 474 779 gene locus_tag LOCUS_17920 474 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 772 1152 gene locus_tag LOCUS_17930 772 1152 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674643.1 protein_id gnl|my_center|LOCUS_17930 1149 1544 gene locus_tag LOCUS_17940 1149 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 1548 2156 gene locus_tag LOCUS_17950 1548 2156 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674642.1 protein_id gnl|my_center|LOCUS_17950 2214 2543 gene locus_tag LOCUS_17960 2214 2543 CDS product tail assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566397.1 protein_id gnl|my_center|LOCUS_17960 2639 2974 gene locus_tag LOCUS_17970 2639 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674641.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence191 76 3186 gene locus_tag LOCUS_17980 76 3186 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775680.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence192 1564 749 gene locus_tag LOCUS_17990 1564 749 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254431.1 protein_id gnl|my_center|LOCUS_17990 1950 1624 gene locus_tag LOCUS_18000 1950 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 2332 2072 gene locus_tag LOCUS_18010 2332 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 2700 2455 gene locus_tag LOCUS_18020 2700 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence193 249 770 gene locus_tag LOCUS_18030 249 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 1708 833 gene locus_tag LOCUS_18040 1708 833 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643641.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence194 3261 1543 gene locus_tag LOCUS_18050 gene cydD 3261 1543 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476126.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence195 329 1450 gene locus_tag LOCUS_18060 329 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 2730 1549 gene locus_tag LOCUS_18070 2730 1549 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010680900.1 protein_id gnl|my_center|LOCUS_18070 3014 3229 gene locus_tag LOCUS_18080 3014 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence196 1914 1027 gene locus_tag LOCUS_18090 1914 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 3404 1917 gene locus_tag LOCUS_18100 gene asp2 3404 1917 CDS product accessory Sec system protein Asp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032114.1 protein_id gnl|my_center|LOCUS_18100 3631 3416 gene locus_tag LOCUS_18110 3631 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence197 425 568 gene locus_tag LOCUS_18120 425 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence198 2328 553 gene locus_tag LOCUS_18130 2328 553 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101224.1 protein_id gnl|my_center|LOCUS_18130 <3577 2344 gene locus_tag LOCUS_18140 <3577 2344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003641669.1:DASS family sodium-coupled anion symporter >Feature sequence199 187 882 gene locus_tag LOCUS_18150 187 882 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254262.1 protein_id gnl|my_center|LOCUS_18150 885 2042 gene locus_tag LOCUS_18160 885 2042 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101678.1 protein_id gnl|my_center|LOCUS_18160 2090 2431 gene locus_tag LOCUS_18170 2090 2431 CDS product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546822.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence200 572 105 gene locus_tag LOCUS_18180 572 105 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549636.1 protein_id gnl|my_center|LOCUS_18180 1270 650 gene locus_tag LOCUS_18190 1270 650 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549206.1 protein_id gnl|my_center|LOCUS_18190 2076 1270 gene locus_tag LOCUS_18200 gene murI 2076 1270 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549203.1 protein_id gnl|my_center|LOCUS_18200 2153 2593 gene locus_tag LOCUS_18210 2153 2593 CDS product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549202.1 protein_id gnl|my_center|LOCUS_18210 2682 3056 gene locus_tag LOCUS_18220 gene mscL 2682 3056 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254148.1 protein_id gnl|my_center|LOCUS_18220 3421 3110 gene locus_tag LOCUS_18230 gene trxA 3421 3110 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254147.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence201 2144 2587 gene locus_tag LOCUS_18240 2144 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 <3546 2877 gene locus_tag LOCUS_18250 <3546 2877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102047.1:MBG domain-containing protein note possible pseudo, internal stop codon, frameshifted >Feature sequence202 570 890 gene locus_tag LOCUS_18260 570 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613308.1 protein_id gnl|my_center|LOCUS_18260 906 2288 gene locus_tag LOCUS_18270 906 2288 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254152.1 protein_id gnl|my_center|LOCUS_18270 2281 2871 gene locus_tag LOCUS_18280 2281 2871 CDS product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549221.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence203 475 1986 gene locus_tag LOCUS_18290 475 1986 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076996129.1 protein_id gnl|my_center|LOCUS_18290 2096 3211 gene locus_tag LOCUS_18300 2096 3211 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460717.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence204 351 52 gene locus_tag LOCUS_18310 351 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 672 379 gene locus_tag LOCUS_18320 672 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 944 708 gene locus_tag LOCUS_18330 944 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 1245 964 gene locus_tag LOCUS_18340 1245 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1553 1272 gene locus_tag LOCUS_18350 1553 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 1979 1620 gene locus_tag LOCUS_18360 1979 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 2381 2079 gene locus_tag LOCUS_18370 2381 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 2686 2366 gene locus_tag LOCUS_18380 2686 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence205 790 14 gene locus_tag LOCUS_18390 790 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1091 1333 gene locus_tag LOCUS_18400 1091 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 >Feature sequence206 <1 837 gene locus_tag LOCUS_18410 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547949.1:aminopeptidase P family protein 918 1487 gene locus_tag LOCUS_18420 gene efp 918 1487 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547948.1 protein_id gnl|my_center|LOCUS_18420 1506 1937 gene locus_tag LOCUS_18430 1506 1937 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547946.1 protein_id gnl|my_center|LOCUS_18430 1937 2332 gene locus_tag LOCUS_18440 gene nusB 1937 2332 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547945.1 protein_id gnl|my_center|LOCUS_18440 2389 3240 gene locus_tag LOCUS_18450 2389 3240 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547942.1 protein_id gnl|my_center|LOCUS_18450 >Feature sequence207 >Feature sequence208 1447 590 gene locus_tag LOCUS_18460 1447 590 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546801.1 protein_id gnl|my_center|LOCUS_18460 2570 1464 gene locus_tag LOCUS_18470 gene murG 2570 1464 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254256.1 protein_id gnl|my_center|LOCUS_18470 <3451 2572 gene locus_tag LOCUS_18480 <3451 2572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546797.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase >Feature sequence209 151 1875 gene locus_tag LOCUS_18490 151 1875 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546584.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence210 16 1356 gene locus_tag LOCUS_18500 16 1356 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254083.1 protein_id gnl|my_center|LOCUS_18500 2160 1408 gene locus_tag LOCUS_18510 2160 1408 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254508.1 protein_id gnl|my_center|LOCUS_18510 2592 3197 gene locus_tag LOCUS_18520 2592 3197 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546208.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence211 2929 1652 gene locus_tag LOCUS_18530 2929 1652 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016173124.1 protein_id gnl|my_center|LOCUS_18530 >Feature sequence212 <1 674 gene locus_tag LOCUS_18540 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254359.1:metallophosphoesterase 709 867 gene locus_tag LOCUS_18550 709 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 1012 3105 gene locus_tag LOCUS_18560 1012 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence213 <1 1539 gene locus_tag LOCUS_18570 <1 1539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254489.1:HAMP domain-containing histidine kinase 2067 2459 gene locus_tag LOCUS_18580 2067 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18580 >Feature sequence214 1553 147 gene locus_tag LOCUS_18590 gene pepV 1553 147 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547162.1 protein_id gnl|my_center|LOCUS_18590 1740 2246 gene locus_tag LOCUS_18600 1740 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547433.1 protein_id gnl|my_center|LOCUS_18600 2764 2294 gene locus_tag LOCUS_18610 2764 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 <3422 2749 gene locus_tag LOCUS_18620 <3422 2749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254310.1:amino acid permease >Feature sequence215 744 298 gene locus_tag LOCUS_18630 744 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 1404 829 gene locus_tag LOCUS_18640 1404 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 2109 1420 gene locus_tag LOCUS_18650 2109 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 2542 2228 gene locus_tag LOCUS_18660 2542 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 2824 2603 gene locus_tag LOCUS_18670 2824 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18670 3249 2866 gene locus_tag LOCUS_18680 3249 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence216 <1 1001 gene locus_tag LOCUS_18690 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546873.1:aspartate kinase 1010 2014 gene locus_tag LOCUS_18700 gene dapF 1010 2014 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546870.1 protein_id gnl|my_center|LOCUS_18700 2231 2058 gene locus_tag LOCUS_18710 2231 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18710 2824 2258 gene locus_tag LOCUS_18720 2824 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18720 3334 3074 gene locus_tag LOCUS_18730 3334 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18730 >Feature sequence217 2957 1011 gene locus_tag LOCUS_18740 2957 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence218 161 511 gene locus_tag LOCUS_18750 161 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 731 2039 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtattctccacgtatgtggaggtgatcc 2664 2798 gene locus_tag LOCUS_18760 2664 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2791 2958 gene locus_tag LOCUS_18770 2791 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023376657.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence219 106 765 gene locus_tag LOCUS_18780 gene yedF 106 765 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681889.1 protein_id gnl|my_center|LOCUS_18780 776 1045 gene locus_tag LOCUS_18790 776 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 1066 2940 gene locus_tag LOCUS_18800 gene selB 1066 2940 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454786.1 protein_id gnl|my_center|LOCUS_18800 2951 3304 gene locus_tag LOCUS_18810 2951 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence220 545 931 gene locus_tag LOCUS_18820 545 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18820 1005 1451 gene locus_tag LOCUS_18830 1005 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18830 1454 2758 gene locus_tag LOCUS_18840 1454 2758 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101340.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence221 <1 1731 gene locus_tag LOCUS_18850 <1 1731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962444.1:two-component regulator propeller domain-containing protein 1728 2453 gene locus_tag LOCUS_18860 1728 2453 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674022.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence222 712 41 gene locus_tag LOCUS_18870 712 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18870 1224 715 gene locus_tag LOCUS_18880 1224 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18880 1490 2716 gene locus_tag LOCUS_18890 1490 2716 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549893.1 protein_id gnl|my_center|LOCUS_18890 3206 2955 gene locus_tag LOCUS_18900 3206 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence223 417 1058 gene locus_tag LOCUS_18910 gene citG 417 1058 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547775.1 protein_id gnl|my_center|LOCUS_18910 1148 1477 gene locus_tag LOCUS_18920 1148 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2970 1543 gene locus_tag LOCUS_18930 2970 1543 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254081.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence224 <1 1060 gene locus_tag LOCUS_18940 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002285985.1:alpha-mannosidase 1098 2852 gene locus_tag LOCUS_18950 1098 2852 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254403.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence225 105 623 gene locus_tag LOCUS_18960 105 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 630 1364 gene locus_tag LOCUS_18970 630 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 1520 2329 gene locus_tag LOCUS_18980 1520 2329 CDS product abortive infection system antitoxin AbiGi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090290936.1 protein_id gnl|my_center|LOCUS_18980 2575 2970 gene locus_tag LOCUS_18990 2575 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 2996 3127 gene locus_tag LOCUS_19000 2996 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence226 401 66 gene locus_tag LOCUS_19010 401 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012477114.1 protein_id gnl|my_center|LOCUS_19010 907 401 gene locus_tag LOCUS_19020 gene nrdG 907 401 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_19020 2148 904 gene locus_tag LOCUS_19030 2148 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19030 2730 2200 gene locus_tag LOCUS_19040 2730 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19040 3171 2869 gene locus_tag LOCUS_19050 3171 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence227 1634 2218 gene locus_tag LOCUS_19060 gene clpP 1634 2218 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546597.1 protein_id gnl|my_center|LOCUS_19060 3218 2283 gene locus_tag LOCUS_19070 gene whiA 3218 2283 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546596.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence228 1428 2276 gene locus_tag LOCUS_19080 1428 2276 CDS product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116878224.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence229 >Feature sequence230 450 611 gene locus_tag LOCUS_19090 450 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547759.1 protein_id gnl|my_center|LOCUS_19090 613 1218 gene locus_tag LOCUS_19100 613 1218 CDS product LysR family transcriptional regulator substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547757.1 protein_id gnl|my_center|LOCUS_19100 1317 1856 gene locus_tag LOCUS_19110 1317 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613376.1 protein_id gnl|my_center|LOCUS_19110 1952 2614 gene locus_tag LOCUS_19120 1952 2614 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547751.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence231 21 96 gene locus_tag LOCUS_t00240 21 96 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 102 177 gene locus_tag LOCUS_t00250 102 177 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 181 255 gene locus_tag LOCUS_t00260 181 255 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 325 1791 gene locus_tag LOCUS_19130 325 1791 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254182.1 protein_id gnl|my_center|LOCUS_19130 2346 1834 gene locus_tag LOCUS_19140 2346 1834 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546330.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence232 2311 773 gene locus_tag LOCUS_19150 gene gtfA 2311 773 CDS product accessory Sec system glycosyltransferase GtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836746.1 protein_id gnl|my_center|LOCUS_19150 <3217 2324 gene locus_tag LOCUS_19160 <3217 2324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836745.1:accessory Sec system translocase SecA2 >Feature sequence233 942 316 gene locus_tag LOCUS_19170 gene lexA 942 316 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254404.1 protein_id gnl|my_center|LOCUS_19170 1099 1365 gene locus_tag LOCUS_19180 1099 1365 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547851.1 protein_id gnl|my_center|LOCUS_19180 1432 1650 gene locus_tag LOCUS_19190 1432 1650 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547849.1 protein_id gnl|my_center|LOCUS_19190 1729 3153 gene locus_tag LOCUS_19200 1729 3153 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254403.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence234 934 482 gene locus_tag LOCUS_19210 934 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 1738 1070 gene locus_tag LOCUS_19220 1738 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2944 1862 gene locus_tag LOCUS_19230 2944 1862 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548242.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence235 2543 954 gene locus_tag LOCUS_19240 2543 954 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109207.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence236 1699 365 gene locus_tag LOCUS_19250 gene prdC 1699 365 CDS product proline reductase-associated electron transfer protein PrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431873.1 protein_id gnl|my_center|LOCUS_19250 1873 2082 gene locus_tag LOCUS_19260 1873 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 2231 2542 gene locus_tag LOCUS_19270 2231 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 3120 2587 gene locus_tag LOCUS_19280 3120 2587 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643199.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence237 566 1117 gene locus_tag LOCUS_19290 566 1117 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476384.1 protein_id gnl|my_center|LOCUS_19290 1351 1587 gene locus_tag LOCUS_19300 1351 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 1663 2004 gene locus_tag LOCUS_19310 1663 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence238 <1 1491 gene locus_tag LOCUS_19320 <1 1491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476565.1:DEAD/DEAH box helicase family protein 1910 2476 gene locus_tag LOCUS_19330 1910 2476 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170424.1 protein_id gnl|my_center|LOCUS_19330 2968 2567 gene locus_tag LOCUS_19340 2968 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence239 319 1722 gene locus_tag LOCUS_19350 319 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 1725 2819 gene locus_tag LOCUS_19360 gene dcm 1725 2819 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734158.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence240 <1 529 gene locus_tag LOCUS_19370 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786605.1:Wzz/FepE/Etk N-terminal domain-containing protein 617 2092 gene locus_tag LOCUS_19380 617 2092 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267807.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence241 325 678 gene locus_tag LOCUS_19390 325 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19390 745 900 gene locus_tag LOCUS_19400 745 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19400 915 1379 gene locus_tag LOCUS_19410 gene ribE 915 1379 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099502.1 protein_id gnl|my_center|LOCUS_19410 1654 1457 gene locus_tag LOCUS_19420 1654 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 1878 1654 gene locus_tag LOCUS_19430 1878 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 2186 2004 gene locus_tag LOCUS_19440 2186 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 >Feature sequence242 49 1368 gene locus_tag LOCUS_19450 49 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210308580.1 protein_id gnl|my_center|LOCUS_19450 1380 2843 gene locus_tag LOCUS_19460 1380 2843 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109350.1 protein_id gnl|my_center|LOCUS_19460 >Feature sequence243 175 765 gene locus_tag LOCUS_19470 175 765 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287520.1 protein_id gnl|my_center|LOCUS_19470 762 1106 gene locus_tag LOCUS_19480 762 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19480 1284 1637 gene locus_tag LOCUS_19490 1284 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2740 1748 gene locus_tag LOCUS_19500 gene galE 2740 1748 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548187.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence244 60 2150 gene locus_tag LOCUS_19510 gene ppsA 60 2150 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646028.1 protein_id gnl|my_center|LOCUS_19510 <2974 2205 gene locus_tag LOCUS_19520 <2974 2205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548442.1:RluA family pseudouridine synthase >Feature sequence245 1543 74 gene locus_tag LOCUS_19530 1543 74 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548166.1 protein_id gnl|my_center|LOCUS_19530 2725 1562 gene locus_tag LOCUS_19540 2725 1562 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548167.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence246 392 1141 gene locus_tag LOCUS_19550 392 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence247 203 1606 gene locus_tag LOCUS_19560 gene selA 203 1606 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048015.1 protein_id gnl|my_center|LOCUS_19560 1611 2162 gene locus_tag LOCUS_19570 1611 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19570 2241 2849 gene locus_tag LOCUS_19580 2241 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19580 >Feature sequence248 314 931 gene locus_tag LOCUS_19590 gene rplJ 314 931 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832306.1 protein_id gnl|my_center|LOCUS_19590 972 1349 gene locus_tag LOCUS_19600 972 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 1400 2557 gene locus_tag LOCUS_19610 1400 2557 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence249 >Feature sequence250 <1 1338 gene locus_tag LOCUS_19620 <1 1338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146462232.1:zinc-ribbon domain-containing protein 1417 1890 gene locus_tag LOCUS_19630 1417 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 2433 1936 gene locus_tag LOCUS_19640 2433 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence251 1268 996 gene locus_tag LOCUS_19650 1268 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 2101 1313 gene locus_tag LOCUS_19660 2101 1313 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648604.1 protein_id gnl|my_center|LOCUS_19660 2777 2403 gene locus_tag LOCUS_19670 2777 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence252 1933 788 gene locus_tag LOCUS_19680 1933 788 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690973.1 protein_id gnl|my_center|LOCUS_19680 <2925 1930 gene locus_tag LOCUS_19690 <2925 1930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203519.1:glycosyltransferase >Feature sequence253 1911 535 gene locus_tag LOCUS_19700 1911 535 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence254 225 872 gene locus_tag LOCUS_19710 225 872 CDS product temperature-sensitive replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547721.1 protein_id gnl|my_center|LOCUS_19710 1762 899 gene locus_tag LOCUS_19720 gene thrB 1762 899 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547723.1 protein_id gnl|my_center|LOCUS_19720 2697 1777 gene locus_tag LOCUS_19730 2697 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 >Feature sequence255 2277 1327 gene locus_tag LOCUS_19740 2277 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence256 <1 2483 gene locus_tag LOCUS_19750 <1 2483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013246158.1:MBG domain-containing protein >Feature sequence257 71 1372 gene locus_tag LOCUS_19760 71 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence258 465 1136 gene locus_tag LOCUS_19770 465 1136 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546204.1 protein_id gnl|my_center|LOCUS_19770 1298 2362 gene locus_tag LOCUS_19780 1298 2362 CDS product SEC10/PgrA surface exclusion domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546206.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence259 2016 223 gene locus_tag LOCUS_19790 2016 223 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254424.1 protein_id gnl|my_center|LOCUS_19790 2676 2020 gene locus_tag LOCUS_19800 2676 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 >Feature sequence260 2605 1202 gene locus_tag LOCUS_19810 2605 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence261 176 18 gene locus_tag LOCUS_19820 176 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 153 998 gene locus_tag LOCUS_19830 153 998 CDS product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116878224.1 protein_id gnl|my_center|LOCUS_19830 1185 1994 gene locus_tag LOCUS_19840 1185 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19840 2651 2058 gene locus_tag LOCUS_19850 2651 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613359.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence262 223 1032 gene locus_tag LOCUS_19860 223 1032 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648604.1 protein_id gnl|my_center|LOCUS_19860 1042 1344 gene locus_tag LOCUS_19870 1042 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 1464 2699 gene locus_tag LOCUS_19880 1464 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 >Feature sequence263 637 756 gene locus_tag LOCUS_19890 637 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 1154 1510 gene locus_tag LOCUS_19900 1154 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 1479 1826 gene locus_tag LOCUS_19910 1479 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 1844 2029 gene locus_tag LOCUS_19920 1844 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2026 2382 gene locus_tag LOCUS_19930 2026 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2467 2540 gene locus_tag LOCUS_t00270 2467 2540 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence264 151 612 gene locus_tag LOCUS_19940 151 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 1617 721 gene locus_tag LOCUS_19950 1617 721 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254505.1 protein_id gnl|my_center|LOCUS_19950 2093 1737 gene locus_tag LOCUS_19960 2093 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548427.1 protein_id gnl|my_center|LOCUS_19960 2534 2103 gene locus_tag LOCUS_19970 2534 2103 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548425.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence265 238 675 gene locus_tag LOCUS_19980 238 675 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868208.1 protein_id gnl|my_center|LOCUS_19980 686 1117 gene locus_tag LOCUS_19990 686 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 1509 2081 gene locus_tag LOCUS_20000 1509 2081 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_20000 2657 2322 gene locus_tag LOCUS_20010 2657 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 >Feature sequence266 1820 618 gene locus_tag LOCUS_20020 1820 618 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925488.1 protein_id gnl|my_center|LOCUS_20020 2285 2539 gene locus_tag LOCUS_20030 2285 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 >Feature sequence267 1021 152 gene locus_tag LOCUS_20040 1021 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 1802 1104 gene locus_tag LOCUS_20050 1802 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 >Feature sequence268 <2775 735 gene locus_tag LOCUS_20060 <2775 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024166.1:leucine-rich repeat protein >Feature sequence269 486 830 gene locus_tag LOCUS_20070 486 830 CDS product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546844.1 protein_id gnl|my_center|LOCUS_20070 827 1375 gene locus_tag LOCUS_20080 gene rsmD 827 1375 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546846.1 protein_id gnl|my_center|LOCUS_20080 1378 1863 gene locus_tag LOCUS_20090 gene coaD 1378 1863 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546847.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence270 2048 1776 gene locus_tag LOCUS_20100 2048 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2489 2313 gene locus_tag LOCUS_20110 2489 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence271 578 105 gene locus_tag LOCUS_20120 578 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 1328 864 gene locus_tag LOCUS_20130 1328 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 2397 1411 gene locus_tag LOCUS_20140 2397 1411 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_20140 2709 2401 gene locus_tag LOCUS_20150 2709 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence272 >Feature sequence273 268 95 gene locus_tag LOCUS_20160 268 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 661 539 gene locus_tag LOCUS_20170 661 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 916 716 gene locus_tag LOCUS_20180 916 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 1357 1169 gene locus_tag LOCUS_20190 1357 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 1642 1469 gene locus_tag LOCUS_20200 1642 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 2227 1733 gene locus_tag LOCUS_20210 2227 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 2376 2227 gene locus_tag LOCUS_20220 2376 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 >Feature sequence274 2080 866 gene locus_tag LOCUS_20230 2080 866 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072530700.1 protein_id gnl|my_center|LOCUS_20230 >Feature sequence275 1428 1598 gene locus_tag LOCUS_20240 1428 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 1600 1842 gene locus_tag LOCUS_20250 1600 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 1846 2052 gene locus_tag LOCUS_20260 1846 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 2065 2430 gene locus_tag LOCUS_20270 2065 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 2417 2623 gene locus_tag LOCUS_20280 2417 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 >Feature sequence276 109 249 gene locus_tag LOCUS_20290 109 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 270 551 gene locus_tag LOCUS_20300 270 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 1134 1253 gene locus_tag LOCUS_20310 1134 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 1359 1478 gene locus_tag LOCUS_20320 1359 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 1623 2024 gene locus_tag LOCUS_20330 1623 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2465 2701 gene locus_tag LOCUS_20340 2465 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence277 1521 1126 gene locus_tag LOCUS_20350 1521 1126 CDS product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546515.1 protein_id gnl|my_center|LOCUS_20350 2081 1521 gene locus_tag LOCUS_20360 2081 1521 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546513.1 protein_id gnl|my_center|LOCUS_20360 <2714 2144 gene locus_tag LOCUS_20370 <2714 2144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546511.1:AI-2E family transporter >Feature sequence278 1 591 gene locus_tag LOCUS_20380 1 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 1562 588 gene locus_tag LOCUS_20390 1562 588 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101398.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence279 301 23 gene locus_tag LOCUS_20400 301 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225852600.1 protein_id gnl|my_center|LOCUS_20400 502 362 gene locus_tag LOCUS_20410 502 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549978.1 protein_id gnl|my_center|LOCUS_20410 1490 597 gene locus_tag LOCUS_20420 1490 597 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549977.1 protein_id gnl|my_center|LOCUS_20420 2375 1602 gene locus_tag LOCUS_20430 2375 1602 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613407.1 protein_id gnl|my_center|LOCUS_20430 >Feature sequence280 2601 664 gene locus_tag LOCUS_20440 2601 664 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025015105.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence281 41 1753 gene locus_tag LOCUS_20450 41 1753 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869266.1 protein_id gnl|my_center|LOCUS_20450 2435 1836 gene locus_tag LOCUS_20460 2435 1836 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643936.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence282 669 1100 gene locus_tag LOCUS_20470 669 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 1428 2249 gene locus_tag LOCUS_20480 1428 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence283 140 1924 gene locus_tag LOCUS_20490 140 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence284 1434 829 gene locus_tag LOCUS_20500 1434 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 1859 1536 gene locus_tag LOCUS_20510 1859 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 <2612 1840 gene locus_tag LOCUS_20520 <2612 1840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674651.1:minor capsid protein >Feature sequence285 194 121 gene locus_tag LOCUS_t00280 194 121 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1076 390 gene locus_tag LOCUS_20530 1076 390 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013854628.1 protein_id gnl|my_center|LOCUS_20530 1783 1124 gene locus_tag LOCUS_20540 1783 1124 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254170.1 protein_id gnl|my_center|LOCUS_20540 2442 1852 gene locus_tag LOCUS_20550 2442 1852 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546210.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence286 208 474 gene locus_tag LOCUS_20560 208 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 575 1153 gene locus_tag LOCUS_20570 575 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 2061 2258 gene locus_tag LOCUS_20580 2061 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 >Feature sequence287 879 1820 gene locus_tag LOCUS_20590 879 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2314 1862 gene locus_tag LOCUS_20600 2314 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 >Feature sequence288 479 916 gene locus_tag LOCUS_20610 gene dtd 479 916 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547036.1 protein_id gnl|my_center|LOCUS_20610 1212 2498 gene locus_tag LOCUS_20620 gene hisS 1212 2498 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547037.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence289 316 1458 gene locus_tag LOCUS_20630 316 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 1507 2322 gene locus_tag LOCUS_20640 1507 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 >Feature sequence290 2013 1252 gene locus_tag LOCUS_20650 2013 1252 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546204.1 protein_id gnl|my_center|LOCUS_20650 >Feature sequence291 514 386 gene locus_tag LOCUS_20660 514 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 <2590 544 gene locus_tag LOCUS_20670 <2590 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101486.1:KxYKxGKxW signal peptide domain-containing protein >Feature sequence292 236 1228 gene locus_tag LOCUS_20680 236 1228 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014565583.1 protein_id gnl|my_center|LOCUS_20680 1238 1888 gene locus_tag LOCUS_20690 1238 1888 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549229.1 protein_id gnl|my_center|LOCUS_20690 2508 1900 gene locus_tag LOCUS_20700 2508 1900 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254154.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence293 1623 79 gene locus_tag LOCUS_20710 1623 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 >Feature sequence294 >Feature sequence295 2486 1557 gene locus_tag LOCUS_20720 2486 1557 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547893.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence296 581 390 gene locus_tag LOCUS_20730 581 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 575 907 gene locus_tag LOCUS_20740 575 907 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003572184.1 protein_id gnl|my_center|LOCUS_20740 885 1019 gene locus_tag LOCUS_20750 885 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 1144 1016 gene locus_tag LOCUS_20760 1144 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 <2558 1364 gene locus_tag LOCUS_20770 <2558 1364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254524.1:Rib/alpha-like domain-containing protein >Feature sequence297 <1 634 gene locus_tag LOCUS_20780 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003585581.1:multicopper oxidase domain-containing protein 647 823 gene locus_tag LOCUS_20790 647 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 1174 2046 gene locus_tag LOCUS_20800 1174 2046 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254448.1 protein_id gnl|my_center|LOCUS_20800 2329 2111 gene locus_tag LOCUS_20810 2329 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 >Feature sequence298 573 343 gene locus_tag LOCUS_20820 573 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 1076 1195 gene locus_tag LOCUS_20830 1076 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence299 1727 549 gene locus_tag LOCUS_20840 1727 549 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426117.1 protein_id gnl|my_center|LOCUS_20840 1920 1753 gene locus_tag LOCUS_20850 1920 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence300 1105 1911 gene locus_tag LOCUS_20860 1105 1911 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254202.1 protein_id gnl|my_center|LOCUS_20860 <2530 1967 gene locus_tag LOCUS_20870 <2530 1967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546408.1:patatin family protein >Feature sequence301 <1 501 gene locus_tag LOCUS_20880 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546431.1:hemolysin family protein 608 1177 gene locus_tag LOCUS_20890 gene hpt 608 1177 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254205.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence302 1392 592 gene locus_tag LOCUS_20900 1392 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20900 1982 1410 gene locus_tag LOCUS_20910 1982 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20910 >Feature sequence303 <2503 828 gene locus_tag LOCUS_20920 <2503 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254264.1:translational GTPase TypA >Feature sequence304 538 1494 gene locus_tag LOCUS_20930 538 1494 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036951.1 protein_id gnl|my_center|LOCUS_20930 1846 2094 gene locus_tag LOCUS_20940 1846 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 >Feature sequence305 454 1980 gene locus_tag LOCUS_20950 454 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 >Feature sequence306 693 911 gene locus_tag LOCUS_20960 693 911 CDS product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254299.1 protein_id gnl|my_center|LOCUS_20960 <2476 973 gene locus_tag LOCUS_20970 <2476 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547066.1:bifunctional UDP-sugar hydrolase/5'-nucleotidase >Feature sequence307 1802 561 gene locus_tag LOCUS_20980 gene pepT 1802 561 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547606.1 protein_id gnl|my_center|LOCUS_20980 <2469 1821 gene locus_tag LOCUS_20990 <2469 1821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547612.1:Nif3-like dinuclear metal center hexameric protein >Feature sequence308 215 1942 gene locus_tag LOCUS_21000 215 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2235 2017 gene locus_tag LOCUS_21010 2235 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence309 1329 97 gene locus_tag LOCUS_21020 1329 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 1639 1322 gene locus_tag LOCUS_21030 1639 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2067 1711 gene locus_tag LOCUS_21040 gene tnpB 2067 1711 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014387108.1 protein_id gnl|my_center|LOCUS_21040 2245 2057 gene locus_tag LOCUS_21050 2245 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 >Feature sequence310 1857 448 gene locus_tag LOCUS_21060 1857 448 CDS product radical SAM peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797444.1 protein_id gnl|my_center|LOCUS_21060 2109 1918 gene locus_tag LOCUS_21070 2109 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2378 2145 gene locus_tag LOCUS_21080 2378 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 >Feature sequence311 79 372 gene locus_tag LOCUS_21090 79 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 732 1226 gene locus_tag LOCUS_21100 732 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 1314 1445 gene locus_tag LOCUS_21110 1314 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 1540 1899 gene locus_tag LOCUS_21120 1540 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence312 <2392 1594 gene locus_tag LOCUS_21130 <2392 1594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547819.1:proline--tRNA ligase >Feature sequence313 1325 303 gene locus_tag LOCUS_21140 gene trpS 1325 303 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567794.1 protein_id gnl|my_center|LOCUS_21140 >Feature sequence314 1081 80 gene locus_tag LOCUS_21150 1081 80 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546680.1 protein_id gnl|my_center|LOCUS_21150 1304 1140 gene locus_tag LOCUS_21160 1304 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 1749 1276 gene locus_tag LOCUS_21170 1749 1276 CDS product ComGF family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546679.1 protein_id gnl|my_center|LOCUS_21170 2026 1757 gene locus_tag LOCUS_21180 2026 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 >Feature sequence315 89 607 gene locus_tag LOCUS_21190 89 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 682 990 gene locus_tag LOCUS_21200 682 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence316 678 106 gene locus_tag LOCUS_21210 678 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 <2362 766 gene locus_tag LOCUS_21220 <2362 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546759.1:septation ring formation regulator EzrA >Feature sequence317 1780 176 gene locus_tag LOCUS_21230 1780 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence318 21 242 gene locus_tag LOCUS_21240 21 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 263 1198 gene locus_tag LOCUS_21250 gene ribF 263 1198 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547803.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence319 2314 761 gene locus_tag LOCUS_21260 2314 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 >Feature sequence320 128 1183 gene locus_tag LOCUS_21270 gene mcrC 128 1183 CDS product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922381.1 protein_id gnl|my_center|LOCUS_21270 2105 1287 gene locus_tag LOCUS_21280 2105 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence321 >Feature sequence322 450 599 gene locus_tag LOCUS_21290 450 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 648 1991 gene locus_tag LOCUS_21300 648 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence323 224 1339 gene locus_tag LOCUS_21310 224 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546248.1 protein_id gnl|my_center|LOCUS_21310 1427 2128 gene locus_tag LOCUS_21320 1427 2128 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546250.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence324 909 199 gene locus_tag LOCUS_21330 909 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 2104 887 gene locus_tag LOCUS_21340 2104 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 >Feature sequence325 305 1633 gene locus_tag LOCUS_21350 305 1633 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993582.1 protein_id gnl|my_center|LOCUS_21350 1809 1970 gene locus_tag LOCUS_21360 1809 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 1967 2104 gene locus_tag LOCUS_21370 1967 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 >Feature sequence326 2124 1333 gene locus_tag LOCUS_21380 2124 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence327 <1 950 gene locus_tag LOCUS_21390 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546670.1:competence type IV pilus ATPase ComGA 919 1920 gene locus_tag LOCUS_21400 919 1920 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721297.1 protein_id gnl|my_center|LOCUS_21400 >Feature sequence328 968 96 gene locus_tag LOCUS_21410 gene ant(6) 968 96 CDS product aminoglycoside nucleotidyltransferase ANT(6)-Ia inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255866.1 protein_id gnl|my_center|LOCUS_21410 1790 1023 gene locus_tag LOCUS_21420 1790 1023 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116438533.1 protein_id gnl|my_center|LOCUS_21420 >Feature sequence329 1651 440 gene locus_tag LOCUS_21430 1651 440 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613400.1 protein_id gnl|my_center|LOCUS_21430 <2258 1644 gene locus_tag LOCUS_21440 <2258 1644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548423.1:ABC transporter ATP-binding protein >Feature sequence330 >Feature sequence331 1451 516 gene locus_tag LOCUS_21450 1451 516 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549076.1 protein_id gnl|my_center|LOCUS_21450 <2252 1562 gene locus_tag LOCUS_21460 <2252 1562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021721658.1:2,3-bisphosphoglycerate-dependent phosphoglycerate mutase >Feature sequence332 939 2162 gene locus_tag LOCUS_21470 939 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 >Feature sequence333 351 527 gene locus_tag LOCUS_21480 351 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 549 1556 gene locus_tag LOCUS_21490 549 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 1556 1708 gene locus_tag LOCUS_21500 1556 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 1786 1932 gene locus_tag LOCUS_21510 1786 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 >Feature sequence334 182 412 gene locus_tag LOCUS_21520 182 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 496 1332 gene locus_tag LOCUS_21530 496 1332 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547954.1 protein_id gnl|my_center|LOCUS_21530 1491 1802 gene locus_tag LOCUS_21540 gene rplU 1491 1802 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_21540 1815 2111 gene locus_tag LOCUS_21550 gene rpmA 1815 2111 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254420.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence335 153 2189 gene locus_tag LOCUS_21560 gene recG 153 2189 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254414.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence336 761 988 gene locus_tag LOCUS_21570 761 988 CDS product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546751.1 protein_id gnl|my_center|LOCUS_21570 1010 2203 gene locus_tag LOCUS_21580 1010 2203 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546752.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence337 909 700 gene locus_tag LOCUS_21590 gene yidD 909 700 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081754.1 protein_id gnl|my_center|LOCUS_21590 1275 934 gene locus_tag LOCUS_21600 gene rnpA 1275 934 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_21600 1467 1333 gene locus_tag LOCUS_21610 gene rpmH 1467 1333 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831901.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence338 642 412 gene locus_tag LOCUS_21620 642 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 1149 709 gene locus_tag LOCUS_21630 1149 709 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546746.1 protein_id gnl|my_center|LOCUS_21630 <2231 1161 gene locus_tag LOCUS_21640 <2231 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254247.1:F0F1 ATP synthase subunit beta >Feature sequence339 608 378 gene locus_tag LOCUS_21650 608 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 758 615 gene locus_tag LOCUS_21660 758 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 1133 1618 gene locus_tag LOCUS_21670 1133 1618 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966038.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence340 247 1329 gene locus_tag LOCUS_21680 247 1329 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158181852.1 protein_id gnl|my_center|LOCUS_21680 1419 1910 gene locus_tag LOCUS_21690 1419 1910 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548936.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence341 281 69 gene locus_tag LOCUS_21700 281 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 559 350 gene locus_tag LOCUS_21710 559 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 1176 553 gene locus_tag LOCUS_21720 1176 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 1510 1403 gene locus_tag LOCUS_r00010 1510 1403 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1651 1577 gene locus_tag LOCUS_t00290 1651 1577 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1732 1657 gene locus_tag LOCUS_t00300 1732 1657 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence342 >Feature sequence343 276 1319 gene locus_tag LOCUS_21730 276 1319 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254271.1 protein_id gnl|my_center|LOCUS_21730 <2202 1362 gene locus_tag LOCUS_21740 <2202 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546894.1:DUF2974 domain-containing protein >Feature sequence344 2060 720 gene locus_tag LOCUS_21750 2060 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence345 203 565 gene locus_tag LOCUS_21760 203 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 1891 704 gene locus_tag LOCUS_21770 1891 704 CDS product IS256-like element ISSod18 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071025.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence346 >Feature sequence347 1740 424 gene locus_tag LOCUS_21780 1740 424 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547002.1 protein_id gnl|my_center|LOCUS_21780 >Feature sequence348 841 1350 gene locus_tag LOCUS_21790 gene ybaK 841 1350 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254291.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence349 1105 563 gene locus_tag LOCUS_21800 1105 563 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546590.1 protein_id gnl|my_center|LOCUS_21800 <2189 1178 gene locus_tag LOCUS_21810 <2189 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546588.1:excinuclease ABC subunit UvrA >Feature sequence350 885 145 gene locus_tag LOCUS_21820 885 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 1778 1705 gene locus_tag LOCUS_t00310 1778 1705 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence351 906 112 gene locus_tag LOCUS_21830 906 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 1437 1021 gene locus_tag LOCUS_21840 1437 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 2024 1542 gene locus_tag LOCUS_21850 2024 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence352 465 1649 gene locus_tag LOCUS_21860 465 1649 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903257.1 protein_id gnl|my_center|LOCUS_21860 1759 1833 gene locus_tag LOCUS_t00320 1759 1833 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence353 181 780 gene locus_tag LOCUS_21870 181 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 823 1554 gene locus_tag LOCUS_21880 823 1554 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821961.1 protein_id gnl|my_center|LOCUS_21880 1559 1894 gene locus_tag LOCUS_21890 1559 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 1909 2160 gene locus_tag LOCUS_21900 1909 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 >Feature sequence354 <2165 1617 gene locus_tag LOCUS_21910 <2165 1617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254411.1:chromosome segregation protein SMC note possible pseudo, frameshifted >Feature sequence355 2016 94 gene locus_tag LOCUS_21920 2016 94 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166034979.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence356 <1 675 gene locus_tag LOCUS_21930 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015613398.1:SLAP domain-containing protein 1371 883 gene locus_tag LOCUS_21940 1371 883 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428667.1 protein_id gnl|my_center|LOCUS_21940 <2161 1418 gene locus_tag LOCUS_21950 <2161 1418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254488.1:membrane protein insertase YidC >Feature sequence357 816 460 gene locus_tag LOCUS_21960 816 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 1142 888 gene locus_tag LOCUS_21970 1142 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 <2160 1294 gene locus_tag LOCUS_21980 <2160 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389917.1:GH25 family lysozyme >Feature sequence358 54 1475 gene locus_tag LOCUS_21990 gene guaA 54 1475 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548925.1 protein_id gnl|my_center|LOCUS_21990 1673 2089 gene locus_tag LOCUS_22000 1673 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence359 244 1665 gene locus_tag LOCUS_22010 244 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence360 <1 616 gene locus_tag LOCUS_22020 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476546.1:replication initiation protein 727 1134 gene locus_tag LOCUS_22030 727 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 1127 1714 gene locus_tag LOCUS_22040 1127 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence361 <1 716 gene locus_tag LOCUS_22050 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547931.1:DNA repair protein RecN 709 1146 gene locus_tag LOCUS_22060 709 1146 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254419.1 protein_id gnl|my_center|LOCUS_22060 1254 1868 gene locus_tag LOCUS_22070 gene gmk 1254 1868 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547929.1 protein_id gnl|my_center|LOCUS_22070 1874 2098 gene locus_tag LOCUS_22080 gene rpoZ 1874 2098 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547927.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence362 791 405 gene locus_tag LOCUS_22090 791 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence363 381 1505 gene locus_tag LOCUS_22100 381 1505 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475894.1 protein_id gnl|my_center|LOCUS_22100 >Feature sequence364 1553 177 gene locus_tag LOCUS_22110 1553 177 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281642.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence365 229 819 gene locus_tag LOCUS_22120 229 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 1938 928 gene locus_tag LOCUS_22130 1938 928 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546711.1 protein_id gnl|my_center|LOCUS_22130 2019 2092 gene locus_tag LOCUS_t00330 2019 2092 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence366 >Feature sequence367 160 1689 gene locus_tag LOCUS_22140 160 1689 CDS product IS66-like element short variant transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068990772.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence368 1245 505 gene locus_tag LOCUS_22150 1245 505 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549866.1 protein_id gnl|my_center|LOCUS_22150 <2106 1258 gene locus_tag LOCUS_22160 <2106 1258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549864.1:Wzz/FepE/Etk N-terminal domain-containing protein >Feature sequence369 1212 133 gene locus_tag LOCUS_22170 1212 133 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533549.1 protein_id gnl|my_center|LOCUS_22170 1576 1205 gene locus_tag LOCUS_22180 1576 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence370 432 803 gene locus_tag LOCUS_22190 432 803 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861104.1 protein_id gnl|my_center|LOCUS_22190 >Feature sequence371 >Feature sequence372 273 791 gene locus_tag LOCUS_22200 273 791 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613301.1 protein_id gnl|my_center|LOCUS_22200 821 1555 gene locus_tag LOCUS_22210 gene tsaB 821 1555 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549123.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence373 <1 1381 gene locus_tag LOCUS_22220 <1 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547921.1:primosomal protein N' >Feature sequence374 <2072 547 gene locus_tag LOCUS_22230 <2072 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547016.1:citrate lyase subunit alpha >Feature sequence375 216 1541 gene locus_tag LOCUS_22240 216 1541 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence376 1153 143 gene locus_tag LOCUS_22250 1153 143 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549863.1 protein_id gnl|my_center|LOCUS_22250 1841 1566 gene locus_tag LOCUS_22260 1841 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence377 >Feature sequence378 >Feature sequence379 203 988 gene locus_tag LOCUS_22270 203 988 CDS product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026965.1 protein_id gnl|my_center|LOCUS_22270 1142 1633 gene locus_tag LOCUS_22280 1142 1633 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721792.1 protein_id gnl|my_center|LOCUS_22280 2007 1732 gene locus_tag LOCUS_22290 2007 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 >Feature sequence380 >Feature sequence381 106 285 gene locus_tag LOCUS_22300 106 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 291 590 gene locus_tag LOCUS_22310 291 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 631 1587 gene locus_tag LOCUS_22320 631 1587 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904591.1 protein_id gnl|my_center|LOCUS_22320 1632 1958 gene locus_tag LOCUS_22330 1632 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence382 >Feature sequence383 1531 1671 gene locus_tag LOCUS_22340 1531 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence384 72 1397 gene locus_tag LOCUS_22350 72 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence385 1033 833 gene locus_tag LOCUS_22360 gene rpsT 1033 833 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_22360 1189 1117 gene locus_tag LOCUS_t00340 1189 1117 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence386 446 198 gene locus_tag LOCUS_22370 446 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 704 513 gene locus_tag LOCUS_22380 704 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 1076 894 gene locus_tag LOCUS_22390 1076 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 1817 1614 gene locus_tag LOCUS_22400 1817 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence387 241 1059 gene locus_tag LOCUS_22410 241 1059 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254191.1 protein_id gnl|my_center|LOCUS_22410 1769 1101 gene locus_tag LOCUS_22420 1769 1101 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003708379.1 protein_id gnl|my_center|LOCUS_22420 >Feature sequence388 <1 713 gene locus_tag LOCUS_22430 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546698.1:ATP-binding protein <2030 757 gene locus_tag LOCUS_22440 <2030 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546703.1:LTA synthase family protein >Feature sequence389 1311 280 gene locus_tag LOCUS_22450 1311 280 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547468.1 protein_id gnl|my_center|LOCUS_22450 1492 1580 gene locus_tag LOCUS_t00350 1492 1580 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1708 1899 gene locus_tag LOCUS_22460 1708 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22460 >Feature sequence390 1859 573 gene locus_tag LOCUS_22470 1859 573 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826425.1 protein_id gnl|my_center|LOCUS_22470 >Feature sequence391 1974 712 gene locus_tag LOCUS_22480 1974 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence392 <1 572 gene locus_tag LOCUS_22490 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254300.1:S1-like domain-containing RNA-binding protein 559 1464 gene locus_tag LOCUS_22500 gene xerD 559 1464 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547075.1 protein_id gnl|my_center|LOCUS_22500 1473 1847 gene locus_tag LOCUS_22510 1473 1847 CDS product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254301.1 protein_id gnl|my_center|LOCUS_22510 >Feature sequence393 1769 843 gene locus_tag LOCUS_22520 1769 843 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765275.1 protein_id gnl|my_center|LOCUS_22520 2002 1790 gene locus_tag LOCUS_22530 2002 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence394 761 474 gene locus_tag LOCUS_22540 761 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 >Feature sequence395 454 92 gene locus_tag LOCUS_22550 454 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 1674 859 gene locus_tag LOCUS_22560 1674 859 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476364.1 protein_id gnl|my_center|LOCUS_22560