>Feature sequence001 20 349 gene locus_tag LOCUS_00010 20 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 421 1212 gene locus_tag LOCUS_00020 421 1212 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254431.1 protein_id gnl|my_center|LOCUS_00020 1537 3114 gene locus_tag LOCUS_00030 1537 3114 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254430.1 protein_id gnl|my_center|LOCUS_00030 3114 4694 gene locus_tag LOCUS_00040 3114 4694 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547992.1 protein_id gnl|my_center|LOCUS_00040 4869 4793 gene locus_tag LOCUS_t00010 4869 4793 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5020 5916 gene locus_tag LOCUS_00050 5020 5916 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547989.1 protein_id gnl|my_center|LOCUS_00050 5918 6274 gene locus_tag LOCUS_00060 5918 6274 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254429.1 protein_id gnl|my_center|LOCUS_00060 6448 7677 gene locus_tag LOCUS_00070 6448 7677 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254350.1 protein_id gnl|my_center|LOCUS_00070 7904 8743 gene locus_tag LOCUS_00080 7904 8743 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254425.1 protein_id gnl|my_center|LOCUS_00080 8967 9146 gene locus_tag LOCUS_00090 8967 9146 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547962.1 protein_id gnl|my_center|LOCUS_00090 10227 9202 gene locus_tag LOCUS_00100 10227 9202 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547958.1 protein_id gnl|my_center|LOCUS_00100 10380 11753 gene locus_tag LOCUS_00110 10380 11753 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254421.1 protein_id gnl|my_center|LOCUS_00110 11917 12228 gene locus_tag LOCUS_00120 gene rplU 11917 12228 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_00120 12243 12539 gene locus_tag LOCUS_00130 gene rpmA 12243 12539 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254420.1 protein_id gnl|my_center|LOCUS_00130 12666 13775 gene locus_tag LOCUS_00140 12666 13775 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547949.1 protein_id gnl|my_center|LOCUS_00140 13856 14425 gene locus_tag LOCUS_00150 gene efp 13856 14425 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547948.1 protein_id gnl|my_center|LOCUS_00150 14444 14878 gene locus_tag LOCUS_00160 14444 14878 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547946.1 protein_id gnl|my_center|LOCUS_00160 14878 15270 gene locus_tag LOCUS_00170 gene nusB 14878 15270 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547945.1 protein_id gnl|my_center|LOCUS_00170 15327 16178 gene locus_tag LOCUS_00180 15327 16178 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547942.1 protein_id gnl|my_center|LOCUS_00180 16165 17523 gene locus_tag LOCUS_00190 gene xseA 16165 17523 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547941.1 protein_id gnl|my_center|LOCUS_00190 17513 17755 gene locus_tag LOCUS_00200 17513 17755 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547938.1 protein_id gnl|my_center|LOCUS_00200 17758 18627 gene locus_tag LOCUS_00210 17758 18627 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547935.1 protein_id gnl|my_center|LOCUS_00210 18628 19440 gene locus_tag LOCUS_00220 18628 19440 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547933.1 protein_id gnl|my_center|LOCUS_00220 19451 21133 gene locus_tag LOCUS_00230 gene recN 19451 21133 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547931.1 protein_id gnl|my_center|LOCUS_00230 21126 21566 gene locus_tag LOCUS_00240 21126 21566 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254419.1 protein_id gnl|my_center|LOCUS_00240 21851 21567 gene locus_tag LOCUS_00250 21851 21567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 22017 22631 gene locus_tag LOCUS_00260 gene gmk 22017 22631 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547929.1 protein_id gnl|my_center|LOCUS_00260 22634 22858 gene locus_tag LOCUS_00270 gene rpoZ 22634 22858 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547927.1 protein_id gnl|my_center|LOCUS_00270 22909 25308 gene locus_tag LOCUS_00280 gene priA 22909 25308 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547921.1 protein_id gnl|my_center|LOCUS_00280 25322 26266 gene locus_tag LOCUS_00290 gene fmt 25322 26266 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547919.1 protein_id gnl|my_center|LOCUS_00290 26253 27581 gene locus_tag LOCUS_00300 gene rsmB 26253 27581 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254418.1 protein_id gnl|my_center|LOCUS_00300 27586 28341 gene locus_tag LOCUS_00310 27586 28341 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254417.1 protein_id gnl|my_center|LOCUS_00310 28331 30358 gene locus_tag LOCUS_00320 gene pknB 28331 30358 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_056938256.1 protein_id gnl|my_center|LOCUS_00320 30359 31249 gene locus_tag LOCUS_00330 gene rsgA 30359 31249 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547915.1 protein_id gnl|my_center|LOCUS_00330 31261 31911 gene locus_tag LOCUS_00340 gene rpe 31261 31911 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547914.1 protein_id gnl|my_center|LOCUS_00340 31911 32597 gene locus_tag LOCUS_00350 31911 32597 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254415.1 protein_id gnl|my_center|LOCUS_00350 32642 32947 gene locus_tag LOCUS_00360 32642 32947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547912.1 protein_id gnl|my_center|LOCUS_00360 33231 33046 gene locus_tag LOCUS_00370 gene rpmB 33231 33046 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547911.1 protein_id gnl|my_center|LOCUS_00370 33399 33761 gene locus_tag LOCUS_00380 33399 33761 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547910.1 protein_id gnl|my_center|LOCUS_00380 33783 35444 gene locus_tag LOCUS_00390 33783 35444 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547907.1 protein_id gnl|my_center|LOCUS_00390 35446 37482 gene locus_tag LOCUS_00400 gene recG 35446 37482 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254414.1 protein_id gnl|my_center|LOCUS_00400 37505 38506 gene locus_tag LOCUS_00410 gene plsX 37505 38506 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547901.1 protein_id gnl|my_center|LOCUS_00410 38540 38782 gene locus_tag LOCUS_00420 gene acpP 38540 38782 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547899.1 protein_id gnl|my_center|LOCUS_00420 38904 39932 gene locus_tag LOCUS_00430 38904 39932 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547898.1 protein_id gnl|my_center|LOCUS_00430 39936 40922 gene locus_tag LOCUS_00440 39936 40922 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547895.1 protein_id gnl|my_center|LOCUS_00440 40925 41884 gene locus_tag LOCUS_00450 40925 41884 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547894.1 protein_id gnl|my_center|LOCUS_00450 41899 42831 gene locus_tag LOCUS_00460 41899 42831 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547893.1 protein_id gnl|my_center|LOCUS_00460 43050 44801 gene locus_tag LOCUS_00470 43050 44801 CDS product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254450.1 protein_id gnl|my_center|LOCUS_00470 45014 46786 gene locus_tag LOCUS_00480 45014 46786 CDS product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254413.1 protein_id gnl|my_center|LOCUS_00480 46900 47586 gene locus_tag LOCUS_00490 gene rnc 46900 47586 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547887.1 protein_id gnl|my_center|LOCUS_00490 47599 51168 gene locus_tag LOCUS_00500 gene smc 47599 51168 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254411.1 protein_id gnl|my_center|LOCUS_00500 51169 52497 gene locus_tag LOCUS_00510 51169 52497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 52543 53964 gene locus_tag LOCUS_00520 52543 53964 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254410.1 protein_id gnl|my_center|LOCUS_00520 54024 54431 gene locus_tag LOCUS_00530 54024 54431 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547879.1 protein_id gnl|my_center|LOCUS_00530 55921 54494 gene locus_tag LOCUS_00540 55921 54494 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254409.1 protein_id gnl|my_center|LOCUS_00540 56065 56739 gene locus_tag LOCUS_00550 56065 56739 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475462.1 protein_id gnl|my_center|LOCUS_00550 56711 56848 gene locus_tag LOCUS_00560 56711 56848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 56899 57240 gene locus_tag LOCUS_00570 56899 57240 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547875.1 protein_id gnl|my_center|LOCUS_00570 57244 58674 gene locus_tag LOCUS_00580 gene ffh 57244 58674 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547873.1 protein_id gnl|my_center|LOCUS_00580 58763 59035 gene locus_tag LOCUS_00590 gene rpsP 58763 59035 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547870.1 protein_id gnl|my_center|LOCUS_00590 59102 59617 gene locus_tag LOCUS_00600 gene rimM 59102 59617 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254408.1 protein_id gnl|my_center|LOCUS_00600 59607 60341 gene locus_tag LOCUS_00610 gene trmD 59607 60341 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254407.1 protein_id gnl|my_center|LOCUS_00610 >Feature sequence002 1054 503 gene locus_tag LOCUS_00620 1054 503 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254121.1 protein_id gnl|my_center|LOCUS_00620 1186 1491 gene locus_tag LOCUS_00630 1186 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549078.1 protein_id gnl|my_center|LOCUS_00630 1553 2902 gene locus_tag LOCUS_00640 gene pepC 1553 2902 CDS product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549077.1 protein_id gnl|my_center|LOCUS_00640 3903 2968 gene locus_tag LOCUS_00650 3903 2968 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549076.1 protein_id gnl|my_center|LOCUS_00650 4685 4008 gene locus_tag LOCUS_00660 4685 4008 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721658.1 protein_id gnl|my_center|LOCUS_00660 4878 4690 gene locus_tag LOCUS_00670 4878 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 5786 4887 gene locus_tag LOCUS_00680 5786 4887 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549073.1 protein_id gnl|my_center|LOCUS_00680 6528 5848 gene locus_tag LOCUS_00690 6528 5848 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549072.1 protein_id gnl|my_center|LOCUS_00690 7329 6571 gene locus_tag LOCUS_00700 7329 6571 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549071.1 protein_id gnl|my_center|LOCUS_00700 7403 8059 gene locus_tag LOCUS_00710 7403 8059 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549070.1 protein_id gnl|my_center|LOCUS_00710 8099 8683 gene locus_tag LOCUS_00720 8099 8683 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549069.1 protein_id gnl|my_center|LOCUS_00720 9490 8726 gene locus_tag LOCUS_00730 gene fetB 9490 8726 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254483.1 protein_id gnl|my_center|LOCUS_00730 10122 9487 gene locus_tag LOCUS_00740 10122 9487 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548243.1 protein_id gnl|my_center|LOCUS_00740 10676 10281 gene locus_tag LOCUS_00750 gene rpsI 10676 10281 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549055.1 protein_id gnl|my_center|LOCUS_00750 11131 10688 gene locus_tag LOCUS_00760 gene rplM 11131 10688 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549054.1 protein_id gnl|my_center|LOCUS_00760 11845 11327 gene locus_tag LOCUS_00770 11845 11327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 12679 11885 gene locus_tag LOCUS_00780 gene truA 12679 11885 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549053.1 protein_id gnl|my_center|LOCUS_00780 13479 12682 gene locus_tag LOCUS_00790 13479 12682 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549052.1 protein_id gnl|my_center|LOCUS_00790 14329 13472 gene locus_tag LOCUS_00800 14329 13472 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549051.1 protein_id gnl|my_center|LOCUS_00800 15156 14305 gene locus_tag LOCUS_00810 15156 14305 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549050.1 protein_id gnl|my_center|LOCUS_00810 15719 15336 gene locus_tag LOCUS_00820 gene rplQ 15719 15336 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549049.1 protein_id gnl|my_center|LOCUS_00820 16684 15746 gene locus_tag LOCUS_00830 16684 15746 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549048.1 protein_id gnl|my_center|LOCUS_00830 17122 16733 gene locus_tag LOCUS_00840 gene rpsK 17122 16733 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613292.1 protein_id gnl|my_center|LOCUS_00840 17497 17147 gene locus_tag LOCUS_00850 gene rpsM 17497 17147 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549046.1 protein_id gnl|my_center|LOCUS_00850 17876 17655 gene locus_tag LOCUS_00860 gene infA 17876 17655 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878178.1 protein_id gnl|my_center|LOCUS_00860 18607 17951 gene locus_tag LOCUS_00870 18607 17951 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549045.1 protein_id gnl|my_center|LOCUS_00870 19914 18619 gene locus_tag LOCUS_00880 gene secY 19914 18619 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549044.1 protein_id gnl|my_center|LOCUS_00880 20354 19914 gene locus_tag LOCUS_00890 gene rplO 20354 19914 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549043.1 protein_id gnl|my_center|LOCUS_00890 20564 20379 gene locus_tag LOCUS_00900 gene rpmD 20564 20379 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549042.1 protein_id gnl|my_center|LOCUS_00900 21087 20581 gene locus_tag LOCUS_00910 gene rpsE 21087 20581 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549041.1 protein_id gnl|my_center|LOCUS_00910 21463 21104 gene locus_tag LOCUS_00920 gene rplR 21463 21104 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549040.1 protein_id gnl|my_center|LOCUS_00920 22020 21490 gene locus_tag LOCUS_00930 gene rplF 22020 21490 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549039.1 protein_id gnl|my_center|LOCUS_00930 22443 22045 gene locus_tag LOCUS_00940 gene rpsH 22443 22045 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 protein_id gnl|my_center|LOCUS_00940 22653 22468 gene locus_tag LOCUS_00950 22653 22468 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549037.1 protein_id gnl|my_center|LOCUS_00950 23208 22666 gene locus_tag LOCUS_00960 gene rplE 23208 22666 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549036.1 protein_id gnl|my_center|LOCUS_00960 23456 23223 gene locus_tag LOCUS_00970 23456 23223 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549035.1 protein_id gnl|my_center|LOCUS_00970 23844 23476 gene locus_tag LOCUS_00980 gene rplN 23844 23476 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549034.1 protein_id gnl|my_center|LOCUS_00980 24142 23876 gene locus_tag LOCUS_00990 gene rpsQ 24142 23876 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254114.1 protein_id gnl|my_center|LOCUS_00990 24358 24161 gene locus_tag LOCUS_01000 gene rpmC 24358 24161 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549032.1 protein_id gnl|my_center|LOCUS_01000 24788 24348 gene locus_tag LOCUS_01010 gene rplP 24788 24348 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549031.1 protein_id gnl|my_center|LOCUS_01010 25411 24788 gene locus_tag LOCUS_01020 gene rpsC 25411 24788 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254113.1 protein_id gnl|my_center|LOCUS_01020 25778 25425 gene locus_tag LOCUS_01030 gene rplV 25778 25425 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549029.1 protein_id gnl|my_center|LOCUS_01030 26082 25798 gene locus_tag LOCUS_01040 gene rpsS 26082 25798 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638064.1 protein_id gnl|my_center|LOCUS_01040 26937 26101 gene locus_tag LOCUS_01050 gene rplB 26937 26101 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254111.1 protein_id gnl|my_center|LOCUS_01050 27258 26953 gene locus_tag LOCUS_01060 gene rplW 27258 26953 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549026.1 protein_id gnl|my_center|LOCUS_01060 27875 27258 gene locus_tag LOCUS_01070 gene rplD 27875 27258 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549025.1 protein_id gnl|my_center|LOCUS_01070 28528 27890 gene locus_tag LOCUS_01080 gene rplC 28528 27890 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549024.1 protein_id gnl|my_center|LOCUS_01080 28863 28555 gene locus_tag LOCUS_01090 gene rpsJ 28863 28555 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549023.1 protein_id gnl|my_center|LOCUS_01090 31273 29180 gene locus_tag LOCUS_01100 gene fusA 31273 29180 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549022.1 protein_id gnl|my_center|LOCUS_01100 31777 31307 gene locus_tag LOCUS_01110 gene rpsG 31777 31307 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549021.1 protein_id gnl|my_center|LOCUS_01110 32200 31793 gene locus_tag LOCUS_01120 gene rpsL 32200 31793 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549020.1 protein_id gnl|my_center|LOCUS_01120 32673 32494 gene locus_tag LOCUS_01130 32673 32494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 36775 33122 gene locus_tag LOCUS_01140 gene rpoC 36775 33122 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254109.1 protein_id gnl|my_center|LOCUS_01140 40432 36791 gene locus_tag LOCUS_01150 40432 36791 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254108.1 protein_id gnl|my_center|LOCUS_01150 43143 40654 gene locus_tag LOCUS_01160 43143 40654 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549016.1 protein_id gnl|my_center|LOCUS_01160 43705 43250 gene locus_tag LOCUS_01170 43705 43250 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549015.1 protein_id gnl|my_center|LOCUS_01170 43856 43781 gene locus_tag LOCUS_t00020 43856 43781 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 43965 43891 gene locus_tag LOCUS_t00030 43965 43891 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 44150 44076 gene locus_tag LOCUS_t00040 44150 44076 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 44363 44818 gene locus_tag LOCUS_01180 44363 44818 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254394.1 protein_id gnl|my_center|LOCUS_01180 46435 44885 gene locus_tag LOCUS_01190 gene lysS 46435 44885 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254107.1 protein_id gnl|my_center|LOCUS_01190 47477 46452 gene locus_tag LOCUS_01200 gene dusB 47477 46452 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254106.1 protein_id gnl|my_center|LOCUS_01200 48447 47557 gene locus_tag LOCUS_01210 gene hslO 48447 47557 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549012.1 protein_id gnl|my_center|LOCUS_01210 50669 48501 gene locus_tag LOCUS_01220 gene ftsH 50669 48501 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254105.1 protein_id gnl|my_center|LOCUS_01220 52023 50764 gene locus_tag LOCUS_01230 gene tilS 52023 50764 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549010.1 protein_id gnl|my_center|LOCUS_01230 52411 52049 gene locus_tag LOCUS_01240 52411 52049 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549009.1 protein_id gnl|my_center|LOCUS_01240 52785 52411 gene locus_tag LOCUS_01250 52785 52411 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254103.1 protein_id gnl|my_center|LOCUS_01250 53102 52860 gene locus_tag LOCUS_01260 53102 52860 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_01260 56612 53118 gene locus_tag LOCUS_01270 gene mfd 56612 53118 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254101.1 protein_id gnl|my_center|LOCUS_01270 57171 56614 gene locus_tag LOCUS_01280 gene pth 57171 56614 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549001.1 protein_id gnl|my_center|LOCUS_01280 57305 58276 gene locus_tag LOCUS_01290 57305 58276 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549000.1 protein_id gnl|my_center|LOCUS_01290 >Feature sequence003 263 1696 gene locus_tag LOCUS_01300 263 1696 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546599.1 protein_id gnl|my_center|LOCUS_01300 3385 1757 gene locus_tag LOCUS_01310 3385 1757 CDS product SH3-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613331.1 protein_id gnl|my_center|LOCUS_01310 3575 4159 gene locus_tag LOCUS_01320 gene clpP 3575 4159 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546597.1 protein_id gnl|my_center|LOCUS_01320 5154 4219 gene locus_tag LOCUS_01330 gene whiA 5154 4219 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546596.1 protein_id gnl|my_center|LOCUS_01330 6191 5154 gene locus_tag LOCUS_01340 6191 5154 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546595.1 protein_id gnl|my_center|LOCUS_01340 7081 6200 gene locus_tag LOCUS_01350 gene rapZ 7081 6200 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546593.1 protein_id gnl|my_center|LOCUS_01350 7713 7171 gene locus_tag LOCUS_01360 7713 7171 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546590.1 protein_id gnl|my_center|LOCUS_01360 10612 7772 gene locus_tag LOCUS_01370 gene uvrA 10612 7772 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546588.1 protein_id gnl|my_center|LOCUS_01370 12650 10602 gene locus_tag LOCUS_01380 gene uvrB 12650 10602 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546586.1 protein_id gnl|my_center|LOCUS_01380 14475 12751 gene locus_tag LOCUS_01390 14475 12751 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546584.1 protein_id gnl|my_center|LOCUS_01390 16377 14584 gene locus_tag LOCUS_01400 16377 14584 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254225.1 protein_id gnl|my_center|LOCUS_01400 18821 16377 gene locus_tag LOCUS_01410 18821 16377 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546577.1 protein_id gnl|my_center|LOCUS_01410 20244 18814 gene locus_tag LOCUS_01420 gene glgA 20244 18814 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546574.1 protein_id gnl|my_center|LOCUS_01420 21397 20255 gene locus_tag LOCUS_01430 gene glgD 21397 20255 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546573.1 protein_id gnl|my_center|LOCUS_01430 22532 21387 gene locus_tag LOCUS_01440 22532 21387 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546570.1 protein_id gnl|my_center|LOCUS_01440 24442 22544 gene locus_tag LOCUS_01450 gene glgB 24442 22544 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254224.1 protein_id gnl|my_center|LOCUS_01450 25561 24632 gene locus_tag LOCUS_01460 gene trxB 25561 24632 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254223.1 protein_id gnl|my_center|LOCUS_01460 26657 25638 gene locus_tag LOCUS_01470 26657 25638 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546563.1 protein_id gnl|my_center|LOCUS_01470 27543 26704 gene locus_tag LOCUS_01480 gene lgt 27543 26704 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613330.1 protein_id gnl|my_center|LOCUS_01480 28504 27536 gene locus_tag LOCUS_01490 gene hprK 28504 27536 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546560.1 protein_id gnl|my_center|LOCUS_01490 28798 28520 gene locus_tag LOCUS_01500 28798 28520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546557.1 protein_id gnl|my_center|LOCUS_01500 29805 28807 gene locus_tag LOCUS_01510 gene prfB 29805 28807 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095522727.1 protein_id gnl|my_center|LOCUS_01510 32380 29981 gene locus_tag LOCUS_01520 gene secA 32380 29981 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254222.1 protein_id gnl|my_center|LOCUS_01520 33065 32523 gene locus_tag LOCUS_01530 gene raiA 33065 32523 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254221.1 protein_id gnl|my_center|LOCUS_01530 33841 33146 gene locus_tag LOCUS_01540 33841 33146 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254220.1 protein_id gnl|my_center|LOCUS_01540 35124 33838 gene locus_tag LOCUS_01550 35124 33838 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546538.1 protein_id gnl|my_center|LOCUS_01550 35171 35833 gene locus_tag LOCUS_01560 35171 35833 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546537.1 protein_id gnl|my_center|LOCUS_01560 37033 35867 gene locus_tag LOCUS_01570 37033 35867 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546535.1 protein_id gnl|my_center|LOCUS_01570 38769 37138 gene locus_tag LOCUS_01580 gene rny 38769 37138 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254219.1 protein_id gnl|my_center|LOCUS_01580 39980 38886 gene locus_tag LOCUS_01590 gene recA 39980 38886 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546531.1 protein_id gnl|my_center|LOCUS_01590 40729 40169 gene locus_tag LOCUS_01600 gene pgsA 40729 40169 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546529.1 protein_id gnl|my_center|LOCUS_01600 41867 40752 gene locus_tag LOCUS_01610 41867 40752 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546527.1 protein_id gnl|my_center|LOCUS_01610 42663 41935 gene locus_tag LOCUS_01620 42663 41935 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546523.1 protein_id gnl|my_center|LOCUS_01620 43920 42670 gene locus_tag LOCUS_01630 43920 42670 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546521.1 protein_id gnl|my_center|LOCUS_01630 45131 43917 gene locus_tag LOCUS_01640 45131 43917 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254218.1 protein_id gnl|my_center|LOCUS_01640 47553 45118 gene locus_tag LOCUS_01650 47553 45118 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546517.1 protein_id gnl|my_center|LOCUS_01650 47963 47574 gene locus_tag LOCUS_01660 47963 47574 CDS product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546515.1 protein_id gnl|my_center|LOCUS_01660 48523 47963 gene locus_tag LOCUS_01670 48523 47963 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546513.1 protein_id gnl|my_center|LOCUS_01670 49777 48575 gene locus_tag LOCUS_01680 49777 48575 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546511.1 protein_id gnl|my_center|LOCUS_01680 50174 49794 gene locus_tag LOCUS_01690 50174 49794 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546509.1 protein_id gnl|my_center|LOCUS_01690 53011 50243 gene locus_tag LOCUS_01700 53011 50243 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546507.1 protein_id gnl|my_center|LOCUS_01700 53162 54190 gene locus_tag LOCUS_01710 53162 54190 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546505.1 protein_id gnl|my_center|LOCUS_01710 >Feature sequence004 <1 913 gene locus_tag LOCUS_01720 <1 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546793.1:penicillin-binding protein 920 1888 gene locus_tag LOCUS_01730 gene mraY 920 1888 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546795.1 protein_id gnl|my_center|LOCUS_01730 1892 3271 gene locus_tag LOCUS_01740 gene murD 1892 3271 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546797.1 protein_id gnl|my_center|LOCUS_01740 3273 4379 gene locus_tag LOCUS_01750 gene murG 3273 4379 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254256.1 protein_id gnl|my_center|LOCUS_01750 4396 5253 gene locus_tag LOCUS_01760 4396 5253 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546801.1 protein_id gnl|my_center|LOCUS_01760 5316 6671 gene locus_tag LOCUS_01770 gene ftsA 5316 6671 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254257.1 protein_id gnl|my_center|LOCUS_01770 6687 8045 gene locus_tag LOCUS_01780 gene ftsZ 6687 8045 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546805.1 protein_id gnl|my_center|LOCUS_01780 8065 8502 gene locus_tag LOCUS_01790 gene sepF 8065 8502 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254258.1 protein_id gnl|my_center|LOCUS_01790 8502 8804 gene locus_tag LOCUS_01800 8502 8804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 8804 9604 gene locus_tag LOCUS_01810 8804 9604 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546811.1 protein_id gnl|my_center|LOCUS_01810 9580 10062 gene locus_tag LOCUS_01820 9580 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01820 10049 10444 gene locus_tag LOCUS_01830 10049 10444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01830 10664 13453 gene locus_tag LOCUS_01840 gene ileS 10664 13453 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254260.1 protein_id gnl|my_center|LOCUS_01840 13453 13656 gene locus_tag LOCUS_01850 13453 13656 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546816.1 protein_id gnl|my_center|LOCUS_01850 13675 14244 gene locus_tag LOCUS_01860 13675 14244 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254261.1 protein_id gnl|my_center|LOCUS_01860 14244 14558 gene locus_tag LOCUS_01870 14244 14558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 14578 15273 gene locus_tag LOCUS_01880 14578 15273 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254262.1 protein_id gnl|my_center|LOCUS_01880 15277 16434 gene locus_tag LOCUS_01890 15277 16434 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101678.1 protein_id gnl|my_center|LOCUS_01890 16482 16823 gene locus_tag LOCUS_01900 16482 16823 CDS product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546822.1 protein_id gnl|my_center|LOCUS_01900 16831 17958 gene locus_tag LOCUS_01910 gene mnmA 16831 17958 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546824.1 protein_id gnl|my_center|LOCUS_01910 18054 18713 gene locus_tag LOCUS_01920 18054 18713 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546826.1 protein_id gnl|my_center|LOCUS_01920 18713 19357 gene locus_tag LOCUS_01930 18713 19357 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546828.1 protein_id gnl|my_center|LOCUS_01930 19357 21708 gene locus_tag LOCUS_01940 19357 21708 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546830.1 protein_id gnl|my_center|LOCUS_01940 21897 23462 gene locus_tag LOCUS_01950 21897 23462 CDS product nuclease-related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613343.1 protein_id gnl|my_center|LOCUS_01950 24434 23487 gene locus_tag LOCUS_01960 24434 23487 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546833.1 protein_id gnl|my_center|LOCUS_01960 26164 24482 gene locus_tag LOCUS_01970 26164 24482 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546834.1 protein_id gnl|my_center|LOCUS_01970 26392 26171 gene locus_tag LOCUS_01980 26392 26171 CDS product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546835.1 protein_id gnl|my_center|LOCUS_01980 26693 26508 gene locus_tag LOCUS_01990 26693 26508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 27277 26723 gene locus_tag LOCUS_02000 gene def 27277 26723 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546838.1 protein_id gnl|my_center|LOCUS_02000 27531 29375 gene locus_tag LOCUS_02010 gene typA 27531 29375 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254264.1 protein_id gnl|my_center|LOCUS_02010 29474 30658 gene locus_tag LOCUS_02020 29474 30658 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254265.1 protein_id gnl|my_center|LOCUS_02020 30655 30999 gene locus_tag LOCUS_02030 30655 30999 CDS product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546844.1 protein_id gnl|my_center|LOCUS_02030 30996 31547 gene locus_tag LOCUS_02040 gene rsmD 30996 31547 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546846.1 protein_id gnl|my_center|LOCUS_02040 31547 32041 gene locus_tag LOCUS_02050 gene coaD 31547 32041 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546847.1 protein_id gnl|my_center|LOCUS_02050 32025 33059 gene locus_tag LOCUS_02060 32025 33059 CDS product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546849.1 protein_id gnl|my_center|LOCUS_02060 33133 33816 gene locus_tag LOCUS_02070 33133 33816 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546852.1 protein_id gnl|my_center|LOCUS_02070 33785 36070 gene locus_tag LOCUS_02080 33785 36070 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546854.1 protein_id gnl|my_center|LOCUS_02080 36067 37053 gene locus_tag LOCUS_02090 gene holA 36067 37053 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546856.1 protein_id gnl|my_center|LOCUS_02090 37379 37122 gene locus_tag LOCUS_02100 gene rpsT 37379 37122 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546858.1 protein_id gnl|my_center|LOCUS_02100 37579 37848 gene locus_tag LOCUS_02110 gene rpsO 37579 37848 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546859.1 protein_id gnl|my_center|LOCUS_02110 37991 39796 gene locus_tag LOCUS_02120 37991 39796 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546860.1 protein_id gnl|my_center|LOCUS_02120 39802 40635 gene locus_tag LOCUS_02130 39802 40635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254267.1 protein_id gnl|my_center|LOCUS_02130 40824 42014 gene locus_tag LOCUS_02140 gene tuf 40824 42014 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546862.1 protein_id gnl|my_center|LOCUS_02140 42162 43493 gene locus_tag LOCUS_02150 gene tig 42162 43493 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546863.1 protein_id gnl|my_center|LOCUS_02150 43624 44895 gene locus_tag LOCUS_02160 gene clpX 43624 44895 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546864.1 protein_id gnl|my_center|LOCUS_02160 44885 45475 gene locus_tag LOCUS_02170 gene yihA 44885 45475 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546867.1 protein_id gnl|my_center|LOCUS_02170 45595 47106 gene locus_tag LOCUS_02180 gene yjeM 45595 47106 CDS product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476411.1 protein_id gnl|my_center|LOCUS_02180 48151 47147 gene locus_tag LOCUS_02190 gene dapF 48151 47147 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546870.1 protein_id gnl|my_center|LOCUS_02190 49518 48163 gene locus_tag LOCUS_02200 49518 48163 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546873.1 protein_id gnl|my_center|LOCUS_02200 >Feature sequence005 220 672 gene locus_tag LOCUS_02210 220 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 2355 730 gene locus_tag LOCUS_02220 2355 730 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546656.1 protein_id gnl|my_center|LOCUS_02220 2603 2728 gene locus_tag LOCUS_02230 2603 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 2738 2923 gene locus_tag LOCUS_02240 2738 2923 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546664.1 protein_id gnl|my_center|LOCUS_02240 3051 3572 gene locus_tag LOCUS_02250 3051 3572 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254234.1 protein_id gnl|my_center|LOCUS_02250 3657 4385 gene locus_tag LOCUS_02260 3657 4385 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546668.1 protein_id gnl|my_center|LOCUS_02260 4572 5546 gene locus_tag LOCUS_02270 gene comGA 4572 5546 CDS product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546670.1 protein_id gnl|my_center|LOCUS_02270 5515 6516 gene locus_tag LOCUS_02280 5515 6516 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721297.1 protein_id gnl|my_center|LOCUS_02280 6527 6871 gene locus_tag LOCUS_02290 gene comGC 6527 6871 CDS product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546673.1 protein_id gnl|my_center|LOCUS_02290 6852 7271 gene locus_tag LOCUS_02300 6852 7271 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546675.1 protein_id gnl|my_center|LOCUS_02300 7268 7537 gene locus_tag LOCUS_02310 7268 7537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 7491 8051 gene locus_tag LOCUS_02320 7491 8051 CDS product ComGF family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546679.1 protein_id gnl|my_center|LOCUS_02320 8225 9226 gene locus_tag LOCUS_02330 8225 9226 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546680.1 protein_id gnl|my_center|LOCUS_02330 9272 10456 gene locus_tag LOCUS_02340 9272 10456 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546683.1 protein_id gnl|my_center|LOCUS_02340 10509 10872 gene locus_tag LOCUS_tm00010 10509 10872 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 11053 11946 gene locus_tag LOCUS_02350 11053 11946 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546685.1 protein_id gnl|my_center|LOCUS_02350 11951 13126 gene locus_tag LOCUS_02360 11951 13126 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201247498.1 protein_id gnl|my_center|LOCUS_02360 13207 14172 gene locus_tag LOCUS_02370 gene manA 13207 14172 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546690.1 protein_id gnl|my_center|LOCUS_02370 14208 14600 gene locus_tag LOCUS_02380 14208 14600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 14600 15322 gene locus_tag LOCUS_02390 14600 15322 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254236.1 protein_id gnl|my_center|LOCUS_02390 15322 16773 gene locus_tag LOCUS_02400 15322 16773 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546698.1 protein_id gnl|my_center|LOCUS_02400 18987 16807 gene locus_tag LOCUS_02410 18987 16807 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546703.1 protein_id gnl|my_center|LOCUS_02410 19131 19733 gene locus_tag LOCUS_02420 19131 19733 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254238.1 protein_id gnl|my_center|LOCUS_02420 19821 21158 gene locus_tag LOCUS_02430 19821 21158 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546706.1 protein_id gnl|my_center|LOCUS_02430 21286 22665 gene locus_tag LOCUS_02440 21286 22665 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254239.1 protein_id gnl|my_center|LOCUS_02440 23773 22760 gene locus_tag LOCUS_02450 23773 22760 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546711.1 protein_id gnl|my_center|LOCUS_02450 23861 23934 gene locus_tag LOCUS_t00050 23861 23934 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 23939 24011 gene locus_tag LOCUS_t00060 23939 24011 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 25456 24104 gene locus_tag LOCUS_02460 25456 24104 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546733.1 protein_id gnl|my_center|LOCUS_02460 25592 26191 gene locus_tag LOCUS_02470 25592 26191 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613340.1 protein_id gnl|my_center|LOCUS_02470 26208 27296 gene locus_tag LOCUS_02480 gene prfA 26208 27296 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546735.1 protein_id gnl|my_center|LOCUS_02480 27289 28134 gene locus_tag LOCUS_02490 gene prmC 27289 28134 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546736.1 protein_id gnl|my_center|LOCUS_02490 28137 29138 gene locus_tag LOCUS_02500 28137 29138 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546737.1 protein_id gnl|my_center|LOCUS_02500 29225 29854 gene locus_tag LOCUS_02510 gene upp 29225 29854 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546738.1 protein_id gnl|my_center|LOCUS_02510 29979 30692 gene locus_tag LOCUS_02520 gene atpB 29979 30692 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546739.1 protein_id gnl|my_center|LOCUS_02520 30713 30946 gene locus_tag LOCUS_02530 gene atpE 30713 30946 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029779745.1 protein_id gnl|my_center|LOCUS_02530 30997 31506 gene locus_tag LOCUS_02540 gene atpF 30997 31506 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546741.1 protein_id gnl|my_center|LOCUS_02540 31506 32054 gene locus_tag LOCUS_02550 31506 32054 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546742.1 protein_id gnl|my_center|LOCUS_02550 32069 33580 gene locus_tag LOCUS_02560 gene atpA 32069 33580 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254246.1 protein_id gnl|my_center|LOCUS_02560 33591 34553 gene locus_tag LOCUS_02570 33591 34553 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546744.1 protein_id gnl|my_center|LOCUS_02570 34587 36026 gene locus_tag LOCUS_02580 gene atpD 34587 36026 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254247.1 protein_id gnl|my_center|LOCUS_02580 36038 36478 gene locus_tag LOCUS_02590 36038 36478 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546746.1 protein_id gnl|my_center|LOCUS_02590 36539 36769 gene locus_tag LOCUS_02600 36539 36769 CDS product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564975.1 protein_id gnl|my_center|LOCUS_02600 36853 37842 gene locus_tag LOCUS_02610 36853 37842 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546749.1 protein_id gnl|my_center|LOCUS_02610 37856 38149 gene locus_tag LOCUS_02620 gene yidD 37856 38149 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564982.1 protein_id gnl|my_center|LOCUS_02620 38158 38385 gene locus_tag LOCUS_02630 38158 38385 CDS product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546751.1 protein_id gnl|my_center|LOCUS_02630 38407 39600 gene locus_tag LOCUS_02640 38407 39600 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546752.1 protein_id gnl|my_center|LOCUS_02640 40797 39655 gene locus_tag LOCUS_02650 40797 39655 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476434.1 protein_id gnl|my_center|LOCUS_02650 41379 40915 gene locus_tag LOCUS_02660 41379 40915 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546753.1 protein_id gnl|my_center|LOCUS_02660 41635 41441 gene locus_tag LOCUS_02670 41635 41441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 43324 42020 gene locus_tag LOCUS_02680 43324 42020 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546755.1 protein_id gnl|my_center|LOCUS_02680 43794 43324 gene locus_tag LOCUS_02690 43794 43324 CDS product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254248.1 protein_id gnl|my_center|LOCUS_02690 44494 43883 gene locus_tag LOCUS_02700 gene rpsD 44494 43883 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254249.1 protein_id gnl|my_center|LOCUS_02700 44777 46486 gene locus_tag LOCUS_02710 gene ezrA 44777 46486 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546759.1 protein_id gnl|my_center|LOCUS_02710 46577 47737 gene locus_tag LOCUS_02720 46577 47737 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546760.1 protein_id gnl|my_center|LOCUS_02720 >Feature sequence006 248 1018 gene locus_tag LOCUS_02730 248 1018 CDS product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548885.1 protein_id gnl|my_center|LOCUS_02730 1152 2900 gene locus_tag LOCUS_02740 1152 2900 CDS product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548886.1 protein_id gnl|my_center|LOCUS_02740 3141 4115 gene locus_tag LOCUS_02750 3141 4115 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254080.1 protein_id gnl|my_center|LOCUS_02750 5645 4218 gene locus_tag LOCUS_02760 5645 4218 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254081.1 protein_id gnl|my_center|LOCUS_02760 6507 5785 gene locus_tag LOCUS_02770 6507 5785 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254082.1 protein_id gnl|my_center|LOCUS_02770 6611 7948 gene locus_tag LOCUS_02780 6611 7948 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254083.1 protein_id gnl|my_center|LOCUS_02780 8026 8937 gene locus_tag LOCUS_02790 8026 8937 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254084.1 protein_id gnl|my_center|LOCUS_02790 9242 8979 gene locus_tag LOCUS_02800 9242 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548898.1 protein_id gnl|my_center|LOCUS_02800 10641 9271 gene locus_tag LOCUS_02810 10641 9271 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548899.1 protein_id gnl|my_center|LOCUS_02810 10750 11151 gene locus_tag LOCUS_02820 10750 11151 CDS product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548902.1 protein_id gnl|my_center|LOCUS_02820 11198 11755 gene locus_tag LOCUS_02830 gene rpoE 11198 11755 CDS product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548904.1 protein_id gnl|my_center|LOCUS_02830 11881 13500 gene locus_tag LOCUS_02840 11881 13500 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254085.1 protein_id gnl|my_center|LOCUS_02840 13630 14925 gene locus_tag LOCUS_02850 13630 14925 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254086.1 protein_id gnl|my_center|LOCUS_02850 16494 15070 gene locus_tag LOCUS_02860 16494 15070 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674698.1 protein_id gnl|my_center|LOCUS_02860 17379 16555 gene locus_tag LOCUS_02870 17379 16555 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548912.1 protein_id gnl|my_center|LOCUS_02870 17449 17994 gene locus_tag LOCUS_02880 17449 17994 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721265.1 protein_id gnl|my_center|LOCUS_02880 19376 18093 gene locus_tag LOCUS_02890 19376 18093 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548915.1 protein_id gnl|my_center|LOCUS_02890 19962 19384 gene locus_tag LOCUS_02900 19962 19384 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254090.1 protein_id gnl|my_center|LOCUS_02900 20695 20177 gene locus_tag LOCUS_02910 20695 20177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 20673 20825 gene locus_tag LOCUS_02920 20673 20825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 21331 20822 gene locus_tag LOCUS_02930 21331 20822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 21556 23106 gene locus_tag LOCUS_02940 gene guaA 21556 23106 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548925.1 protein_id gnl|my_center|LOCUS_02940 23304 24062 gene locus_tag LOCUS_02950 23304 24062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 24090 27683 gene locus_tag LOCUS_02960 24090 27683 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766276.1 protein_id gnl|my_center|LOCUS_02960 28806 27673 gene locus_tag LOCUS_02970 28806 27673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 29048 29464 gene locus_tag LOCUS_02980 29048 29464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 29464 30033 gene locus_tag LOCUS_02990 29464 30033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 30044 30874 gene locus_tag LOCUS_03000 30044 30874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 30973 31881 gene locus_tag LOCUS_03010 30973 31881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 31865 32062 gene locus_tag LOCUS_03020 31865 32062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 32062 33303 gene locus_tag LOCUS_03030 32062 33303 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237797.1 protein_id gnl|my_center|LOCUS_03030 33560 34084 gene locus_tag LOCUS_03040 33560 34084 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548951.1 protein_id gnl|my_center|LOCUS_03040 35137 34256 gene locus_tag LOCUS_03050 35137 34256 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642687.1 protein_id gnl|my_center|LOCUS_03050 35854 35339 gene locus_tag LOCUS_03060 35854 35339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613291.1 protein_id gnl|my_center|LOCUS_03060 36334 35972 gene locus_tag LOCUS_03070 36334 35972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 >Feature sequence007 2039 657 gene locus_tag LOCUS_03080 2039 657 CDS product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254371.1 protein_id gnl|my_center|LOCUS_03080 2934 2014 gene locus_tag LOCUS_03090 2934 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547594.1 protein_id gnl|my_center|LOCUS_03090 3744 3136 gene locus_tag LOCUS_03100 3744 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254372.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03100 3832 4398 gene locus_tag LOCUS_03110 gene lepB 3832 4398 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547598.1 protein_id gnl|my_center|LOCUS_03110 4462 4653 gene locus_tag LOCUS_03120 4462 4653 CDS product LBP_cg2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547599.1 protein_id gnl|my_center|LOCUS_03120 5606 4710 gene locus_tag LOCUS_03130 5606 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03130 5842 5573 gene locus_tag LOCUS_03140 5842 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03140 6690 5902 gene locus_tag LOCUS_03150 6690 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547600.1 protein_id gnl|my_center|LOCUS_03150 7580 6738 gene locus_tag LOCUS_03160 7580 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547601.1 protein_id gnl|my_center|LOCUS_03160 8426 7590 gene locus_tag LOCUS_03170 8426 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254375.1 protein_id gnl|my_center|LOCUS_03170 9133 8426 gene locus_tag LOCUS_03180 9133 8426 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547603.1 protein_id gnl|my_center|LOCUS_03180 9500 9126 gene locus_tag LOCUS_03190 9500 9126 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547604.1 protein_id gnl|my_center|LOCUS_03190 11029 9785 gene locus_tag LOCUS_03200 gene pepT 11029 9785 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547606.1 protein_id gnl|my_center|LOCUS_03200 11846 11049 gene locus_tag LOCUS_03210 11846 11049 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547612.1 protein_id gnl|my_center|LOCUS_03210 12525 11839 gene locus_tag LOCUS_03220 12525 11839 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547613.1 protein_id gnl|my_center|LOCUS_03220 12628 13068 gene locus_tag LOCUS_03230 12628 13068 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547614.1 protein_id gnl|my_center|LOCUS_03230 13069 13737 gene locus_tag LOCUS_03240 13069 13737 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547616.1 protein_id gnl|my_center|LOCUS_03240 14907 13795 gene locus_tag LOCUS_03250 gene rpoD 14907 13795 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254377.1 protein_id gnl|my_center|LOCUS_03250 16755 14923 gene locus_tag LOCUS_03260 gene dnaG 16755 14923 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547619.1 protein_id gnl|my_center|LOCUS_03260 18846 16783 gene locus_tag LOCUS_03270 gene glyS 18846 16783 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547620.1 protein_id gnl|my_center|LOCUS_03270 19756 18839 gene locus_tag LOCUS_03280 gene glyQ 19756 18839 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547621.1 protein_id gnl|my_center|LOCUS_03280 20768 20016 gene locus_tag LOCUS_03290 gene recO 20768 20016 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547622.1 protein_id gnl|my_center|LOCUS_03290 21673 20768 gene locus_tag LOCUS_03300 gene era 21673 20768 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254378.1 protein_id gnl|my_center|LOCUS_03300 22197 21673 gene locus_tag LOCUS_03310 gene ybeY 22197 21673 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547628.1 protein_id gnl|my_center|LOCUS_03310 23159 22200 gene locus_tag LOCUS_03320 23159 22200 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254379.1 protein_id gnl|my_center|LOCUS_03320 23634 23191 gene locus_tag LOCUS_03330 23634 23191 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547630.1 protein_id gnl|my_center|LOCUS_03330 24663 23815 gene locus_tag LOCUS_03340 24663 23815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03340 25285 24653 gene locus_tag LOCUS_03350 25285 24653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03350 25645 25322 gene locus_tag LOCUS_03360 25645 25322 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549827.1 protein_id gnl|my_center|LOCUS_03360 27048 25645 gene locus_tag LOCUS_03370 gene sufB 27048 25645 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014567504.1 protein_id gnl|my_center|LOCUS_03370 27491 27051 gene locus_tag LOCUS_03380 27491 27051 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640266.1 protein_id gnl|my_center|LOCUS_03380 28710 27478 gene locus_tag LOCUS_03390 28710 27478 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101419.1 protein_id gnl|my_center|LOCUS_03390 29899 28676 gene locus_tag LOCUS_03400 gene sufD 29899 28676 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101418.1 protein_id gnl|my_center|LOCUS_03400 30703 29909 gene locus_tag LOCUS_03410 gene sufC 30703 29909 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004894681.1 protein_id gnl|my_center|LOCUS_03410 31134 30958 gene locus_tag LOCUS_03420 gene rpsU 31134 30958 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002880182.1 protein_id gnl|my_center|LOCUS_03420 31311 32147 gene locus_tag LOCUS_03430 31311 32147 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547712.1 protein_id gnl|my_center|LOCUS_03430 32527 32829 gene locus_tag LOCUS_03440 32527 32829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03440 32937 33464 gene locus_tag LOCUS_03450 gene msrA 32937 33464 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547717.1 protein_id gnl|my_center|LOCUS_03450 33558 34436 gene locus_tag LOCUS_03460 33558 34436 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547719.1 protein_id gnl|my_center|LOCUS_03460 >Feature sequence008 1032 49 gene locus_tag LOCUS_03470 1032 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 2025 1129 gene locus_tag LOCUS_03480 2025 1129 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547149.1 protein_id gnl|my_center|LOCUS_03480 3562 2165 gene locus_tag LOCUS_03490 gene hslU 3562 2165 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254308.1 protein_id gnl|my_center|LOCUS_03490 4098 3574 gene locus_tag LOCUS_03500 gene hslV 4098 3574 CDS product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254307.1 protein_id gnl|my_center|LOCUS_03500 5016 4108 gene locus_tag LOCUS_03510 5016 4108 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547143.1 protein_id gnl|my_center|LOCUS_03510 6332 5016 gene locus_tag LOCUS_03520 gene trmFO 6332 5016 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547141.1 protein_id gnl|my_center|LOCUS_03520 8481 6364 gene locus_tag LOCUS_03530 gene topA 8481 6364 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547140.1 protein_id gnl|my_center|LOCUS_03530 9399 8551 gene locus_tag LOCUS_03540 gene dprA 9399 8551 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547135.1 protein_id gnl|my_center|LOCUS_03540 10210 9452 gene locus_tag LOCUS_03550 10210 9452 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254306.1 protein_id gnl|my_center|LOCUS_03550 11046 10207 gene locus_tag LOCUS_03560 gene ylqF 11046 10207 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547131.1 protein_id gnl|my_center|LOCUS_03560 12669 11071 gene locus_tag LOCUS_03570 12669 11071 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547129.1 protein_id gnl|my_center|LOCUS_03570 12952 12722 gene locus_tag LOCUS_03580 12952 12722 CDS product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547128.1 protein_id gnl|my_center|LOCUS_03580 13807 12956 gene locus_tag LOCUS_03590 13807 12956 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254305.1 protein_id gnl|my_center|LOCUS_03590 13925 14590 gene locus_tag LOCUS_03600 13925 14590 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254304.1 protein_id gnl|my_center|LOCUS_03600 15946 14747 gene locus_tag LOCUS_03610 15946 14747 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547116.1 protein_id gnl|my_center|LOCUS_03610 16026 16913 gene locus_tag LOCUS_03620 16026 16913 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547115.1 protein_id gnl|my_center|LOCUS_03620 18192 16945 gene locus_tag LOCUS_03630 18192 16945 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547113.1 protein_id gnl|my_center|LOCUS_03630 18556 18281 gene locus_tag LOCUS_03640 18556 18281 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547110.1 protein_id gnl|my_center|LOCUS_03640 20026 18719 gene locus_tag LOCUS_03650 gene der 20026 18719 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254303.1 protein_id gnl|my_center|LOCUS_03650 21305 20094 gene locus_tag LOCUS_03660 gene rpsA 21305 20094 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547091.1 protein_id gnl|my_center|LOCUS_03660 22050 21376 gene locus_tag LOCUS_03670 gene cmk 22050 21376 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 protein_id gnl|my_center|LOCUS_03670 22566 22102 gene locus_tag LOCUS_03680 22566 22102 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547087.1 protein_id gnl|my_center|LOCUS_03680 23358 22669 gene locus_tag LOCUS_03690 23358 22669 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547084.1 protein_id gnl|my_center|LOCUS_03690 24294 23578 gene locus_tag LOCUS_03700 24294 23578 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547082.1 protein_id gnl|my_center|LOCUS_03700 24884 24294 gene locus_tag LOCUS_03710 gene scpB 24884 24294 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547080.1 protein_id gnl|my_center|LOCUS_03710 25614 24874 gene locus_tag LOCUS_03720 25614 24874 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547078.1 protein_id gnl|my_center|LOCUS_03720 25960 25607 gene locus_tag LOCUS_03730 25960 25607 CDS product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254301.1 protein_id gnl|my_center|LOCUS_03730 26875 25970 gene locus_tag LOCUS_03740 gene xerD 26875 25970 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547075.1 protein_id gnl|my_center|LOCUS_03740 27755 26865 gene locus_tag LOCUS_03750 27755 26865 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254300.1 protein_id gnl|my_center|LOCUS_03750 29650 27881 gene locus_tag LOCUS_03760 gene pyk 29650 27881 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547072.1 protein_id gnl|my_center|LOCUS_03760 30646 29684 gene locus_tag LOCUS_03770 gene pfkA 30646 29684 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547070.1 protein_id gnl|my_center|LOCUS_03770 <33261 30812 gene locus_tag LOCUS_03780 <33261 30812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547069.1:DNA polymerase III subunit alpha >Feature sequence009 275 1987 gene locus_tag LOCUS_03790 gene oxc 275 1987 CDS product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044304031.1 protein_id gnl|my_center|LOCUS_03790 2022 3365 gene locus_tag LOCUS_03800 gene frc 2022 3365 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549137.1 protein_id gnl|my_center|LOCUS_03800 3434 4621 gene locus_tag LOCUS_03810 3434 4621 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549134.1 protein_id gnl|my_center|LOCUS_03810 5732 4683 gene locus_tag LOCUS_03820 gene tsaD 5732 4683 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549127.1 protein_id gnl|my_center|LOCUS_03820 6301 5729 gene locus_tag LOCUS_03830 gene rimI 6301 5729 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549125.1 protein_id gnl|my_center|LOCUS_03830 7019 6285 gene locus_tag LOCUS_03840 gene tsaB 7019 6285 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549123.1 protein_id gnl|my_center|LOCUS_03840 7564 7046 gene locus_tag LOCUS_03850 7564 7046 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613301.1 protein_id gnl|my_center|LOCUS_03850 8353 7619 gene locus_tag LOCUS_03860 8353 7619 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254136.1 protein_id gnl|my_center|LOCUS_03860 9214 8360 gene locus_tag LOCUS_03870 gene rsmI 9214 8360 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549119.1 protein_id gnl|my_center|LOCUS_03870 9565 9215 gene locus_tag LOCUS_03880 gene yabA 9565 9215 CDS product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254135.1 protein_id gnl|my_center|LOCUS_03880 10433 9576 gene locus_tag LOCUS_03890 10433 9576 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549117.1 protein_id gnl|my_center|LOCUS_03890 10753 10433 gene locus_tag LOCUS_03900 10753 10433 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549116.1 protein_id gnl|my_center|LOCUS_03900 11403 10765 gene locus_tag LOCUS_03910 gene tmk 11403 10765 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254134.1 protein_id gnl|my_center|LOCUS_03910 11742 11506 gene locus_tag LOCUS_03920 11742 11506 CDS product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549114.1 protein_id gnl|my_center|LOCUS_03920 12341 11742 gene locus_tag LOCUS_03930 gene recR 12341 11742 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549113.1 protein_id gnl|my_center|LOCUS_03930 12671 12342 gene locus_tag LOCUS_03940 12671 12342 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549112.1 protein_id gnl|my_center|LOCUS_03940 12963 12685 gene locus_tag LOCUS_03950 12963 12685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03950 14437 12941 gene locus_tag LOCUS_03960 gene dnaX 14437 12941 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549111.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03960 15117 14632 gene locus_tag LOCUS_03970 gene tadA 15117 14632 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 protein_id gnl|my_center|LOCUS_03970 15398 15216 gene locus_tag LOCUS_03980 15398 15216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613299.1 protein_id gnl|my_center|LOCUS_03980 16147 15527 gene locus_tag LOCUS_03990 16147 15527 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254130.1 protein_id gnl|my_center|LOCUS_03990 16993 16148 gene locus_tag LOCUS_04000 16993 16148 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549107.1 protein_id gnl|my_center|LOCUS_04000 17430 17068 gene locus_tag LOCUS_04010 gene rplL 17430 17068 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254128.1 protein_id gnl|my_center|LOCUS_04010 17993 17481 gene locus_tag LOCUS_04020 gene rplJ 17993 17481 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549105.1 protein_id gnl|my_center|LOCUS_04020 18249 18620 gene locus_tag LOCUS_04030 18249 18620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 20109 18934 gene locus_tag LOCUS_04040 20109 18934 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549103.1 protein_id gnl|my_center|LOCUS_04040 20979 20302 gene locus_tag LOCUS_04050 gene phoU 20979 20302 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549102.1 protein_id gnl|my_center|LOCUS_04050 21751 20996 gene locus_tag LOCUS_04060 gene pstB 21751 20996 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549101.1 protein_id gnl|my_center|LOCUS_04060 22547 21753 gene locus_tag LOCUS_04070 gene pstB 22547 21753 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613297.1 protein_id gnl|my_center|LOCUS_04070 23444 22557 gene locus_tag LOCUS_04080 gene pstA 23444 22557 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549099.1 protein_id gnl|my_center|LOCUS_04080 24441 23446 gene locus_tag LOCUS_04090 gene pstC 24441 23446 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549098.1 protein_id gnl|my_center|LOCUS_04090 25200 24445 gene locus_tag LOCUS_04100 25200 24445 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254125.1 protein_id gnl|my_center|LOCUS_04100 25722 25501 gene locus_tag LOCUS_04110 25722 25501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04110 26260 25688 gene locus_tag LOCUS_04120 26260 25688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04120 26658 26257 gene locus_tag LOCUS_04130 26658 26257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04130 27618 26926 gene locus_tag LOCUS_04140 gene rplA 27618 26926 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549096.1 protein_id gnl|my_center|LOCUS_04140 28120 27695 gene locus_tag LOCUS_04150 gene rplK 28120 27695 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549095.1 protein_id gnl|my_center|LOCUS_04150 28804 28247 gene locus_tag LOCUS_04160 gene nusG 28804 28247 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549094.1 protein_id gnl|my_center|LOCUS_04160 29083 28913 gene locus_tag LOCUS_04170 gene secE 29083 28913 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549093.1 protein_id gnl|my_center|LOCUS_04170 29427 31169 gene locus_tag LOCUS_04180 29427 31169 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549091.1 protein_id gnl|my_center|LOCUS_04180 32820 31336 gene locus_tag LOCUS_04190 32820 31336 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549089.1 protein_id gnl|my_center|LOCUS_04190 >Feature sequence010 <1 744 gene locus_tag LOCUS_04200 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549665.1:M1 family metallopeptidase 853 2346 gene locus_tag LOCUS_04210 853 2346 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254595.1 protein_id gnl|my_center|LOCUS_04210 2689 2961 gene locus_tag LOCUS_04220 2689 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04220 3605 3408 gene locus_tag LOCUS_04230 3605 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549669.1 protein_id gnl|my_center|LOCUS_04230 4897 3689 gene locus_tag LOCUS_04240 4897 3689 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549671.1 protein_id gnl|my_center|LOCUS_04240 5042 5836 gene locus_tag LOCUS_04250 5042 5836 CDS product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549672.1 protein_id gnl|my_center|LOCUS_04250 6506 5868 gene locus_tag LOCUS_04260 6506 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549674.1 protein_id gnl|my_center|LOCUS_04260 6559 7320 gene locus_tag LOCUS_04270 gene yaaA 6559 7320 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254594.1 protein_id gnl|my_center|LOCUS_04270 8060 7317 gene locus_tag LOCUS_04280 8060 7317 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254593.1 protein_id gnl|my_center|LOCUS_04280 8200 8799 gene locus_tag LOCUS_04290 8200 8799 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549678.1 protein_id gnl|my_center|LOCUS_04290 8912 9439 gene locus_tag LOCUS_04300 8912 9439 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254592.1 protein_id gnl|my_center|LOCUS_04300 9440 10501 gene locus_tag LOCUS_04310 9440 10501 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254591.1 protein_id gnl|my_center|LOCUS_04310 10503 11177 gene locus_tag LOCUS_04320 10503 11177 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254590.1 protein_id gnl|my_center|LOCUS_04320 12630 11218 gene locus_tag LOCUS_04330 12630 11218 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549685.1 protein_id gnl|my_center|LOCUS_04330 12721 12963 gene locus_tag LOCUS_04340 12721 12963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007126009.1 protein_id gnl|my_center|LOCUS_04340 13073 13696 gene locus_tag LOCUS_04350 13073 13696 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549687.1 protein_id gnl|my_center|LOCUS_04350 13846 14385 gene locus_tag LOCUS_04360 13846 14385 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549688.1 protein_id gnl|my_center|LOCUS_04360 14399 14947 gene locus_tag LOCUS_04370 14399 14947 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549689.1 protein_id gnl|my_center|LOCUS_04370 15044 15835 gene locus_tag LOCUS_04380 15044 15835 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549690.1 protein_id gnl|my_center|LOCUS_04380 15841 16770 gene locus_tag LOCUS_04390 15841 16770 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549691.1 protein_id gnl|my_center|LOCUS_04390 17354 16818 gene locus_tag LOCUS_04400 17354 16818 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549693.1 protein_id gnl|my_center|LOCUS_04400 17515 18237 gene locus_tag LOCUS_04410 gene rsmG 17515 18237 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 protein_id gnl|my_center|LOCUS_04410 18254 19090 gene locus_tag LOCUS_04420 gene noc 18254 19090 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254588.1 protein_id gnl|my_center|LOCUS_04420 19096 19884 gene locus_tag LOCUS_04430 19096 19884 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254587.1 protein_id gnl|my_center|LOCUS_04430 19862 20746 gene locus_tag LOCUS_04440 19862 20746 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549701.1 protein_id gnl|my_center|LOCUS_04440 20739 21002 gene locus_tag LOCUS_04450 20739 21002 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549703.1 protein_id gnl|my_center|LOCUS_04450 21059 22159 gene locus_tag LOCUS_04460 gene ychF 21059 22159 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549709.1 protein_id gnl|my_center|LOCUS_04460 22168 22944 gene locus_tag LOCUS_04470 22168 22944 CDS product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549711.1 protein_id gnl|my_center|LOCUS_04470 23064 24788 gene locus_tag LOCUS_04480 23064 24788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254586.1 protein_id gnl|my_center|LOCUS_04480 24798 26657 gene locus_tag LOCUS_04490 24798 26657 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721608.1 protein_id gnl|my_center|LOCUS_04490 26839 27525 gene locus_tag LOCUS_04500 26839 27525 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549720.1 protein_id gnl|my_center|LOCUS_04500 27529 28683 gene locus_tag LOCUS_04510 27529 28683 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549721.1 protein_id gnl|my_center|LOCUS_04510 28729 30303 gene locus_tag LOCUS_04520 28729 30303 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254584.1 protein_id gnl|my_center|LOCUS_04520 30315 30869 gene locus_tag LOCUS_04530 30315 30869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04530 30839 31072 gene locus_tag LOCUS_04540 30839 31072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04540 31145 31435 gene locus_tag LOCUS_04550 31145 31435 CDS product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613423.1 protein_id gnl|my_center|LOCUS_04550 31720 31884 gene locus_tag LOCUS_04560 31720 31884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 >Feature sequence011 50 1072 gene locus_tag LOCUS_04570 gene tsf 50 1072 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547835.1 protein_id gnl|my_center|LOCUS_04570 1210 1935 gene locus_tag LOCUS_04580 gene pyrH 1210 1935 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254400.1 protein_id gnl|my_center|LOCUS_04580 1935 2492 gene locus_tag LOCUS_04590 gene frr 1935 2492 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095341972.1 protein_id gnl|my_center|LOCUS_04590 2495 3229 gene locus_tag LOCUS_04600 2495 3229 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547825.1 protein_id gnl|my_center|LOCUS_04600 3231 4046 gene locus_tag LOCUS_04610 3231 4046 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547823.1 protein_id gnl|my_center|LOCUS_04610 4057 5313 gene locus_tag LOCUS_04620 gene rseP 4057 5313 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547820.1 protein_id gnl|my_center|LOCUS_04620 5363 6964 gene locus_tag LOCUS_04630 5363 6964 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547819.1 protein_id gnl|my_center|LOCUS_04630 6999 11306 gene locus_tag LOCUS_04640 6999 11306 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547817.1 protein_id gnl|my_center|LOCUS_04640 11417 11893 gene locus_tag LOCUS_04650 gene rimP 11417 11893 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254398.1 protein_id gnl|my_center|LOCUS_04650 11913 13100 gene locus_tag LOCUS_04660 gene nusA 11913 13100 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254397.1 protein_id gnl|my_center|LOCUS_04660 13109 13405 gene locus_tag LOCUS_04670 13109 13405 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547812.1 protein_id gnl|my_center|LOCUS_04670 13408 13719 gene locus_tag LOCUS_04680 13408 13719 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547810.1 protein_id gnl|my_center|LOCUS_04680 13724 16327 gene locus_tag LOCUS_04690 gene infB 13724 16327 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254396.1 protein_id gnl|my_center|LOCUS_04690 16346 16711 gene locus_tag LOCUS_04700 16346 16711 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547807.1 protein_id gnl|my_center|LOCUS_04700 16761 17654 gene locus_tag LOCUS_04710 gene truB 16761 17654 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547805.1 protein_id gnl|my_center|LOCUS_04710 17675 18604 gene locus_tag LOCUS_04720 gene ribF 17675 18604 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547803.1 protein_id gnl|my_center|LOCUS_04720 18857 20365 gene locus_tag LOCUS_04730 18857 20365 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547799.1 protein_id gnl|my_center|LOCUS_04730 20459 21508 gene locus_tag LOCUS_04740 gene hrcA 20459 21508 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547794.1 protein_id gnl|my_center|LOCUS_04740 21521 22105 gene locus_tag LOCUS_04750 gene grpE 21521 22105 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547792.1 protein_id gnl|my_center|LOCUS_04750 22122 23984 gene locus_tag LOCUS_04760 gene dnaK 22122 23984 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547791.1 protein_id gnl|my_center|LOCUS_04760 24068 25222 gene locus_tag LOCUS_04770 gene dnaJ 24068 25222 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547790.1 protein_id gnl|my_center|LOCUS_04770 25322 27160 gene locus_tag LOCUS_04780 gene lepA 25322 27160 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254395.1 protein_id gnl|my_center|LOCUS_04780 27163 27852 gene locus_tag LOCUS_04790 27163 27852 CDS product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547788.1 protein_id gnl|my_center|LOCUS_04790 27963 30236 gene locus_tag LOCUS_04800 gene recJ 27963 30236 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547786.1 protein_id gnl|my_center|LOCUS_04800 30341 30868 gene locus_tag LOCUS_04810 30341 30868 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547784.1 protein_id gnl|my_center|LOCUS_04810 30962 31330 gene locus_tag LOCUS_04820 30962 31330 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254394.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04820 31425 31706 gene locus_tag LOCUS_04830 31425 31706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 >Feature sequence012 540 208 gene locus_tag LOCUS_04840 540 208 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547029.1 protein_id gnl|my_center|LOCUS_04840 1494 556 gene locus_tag LOCUS_04850 1494 556 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547030.1 protein_id gnl|my_center|LOCUS_04850 1683 3029 gene locus_tag LOCUS_04860 1683 3029 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547031.1 protein_id gnl|my_center|LOCUS_04860 3557 3123 gene locus_tag LOCUS_04870 3557 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 4520 4011 gene locus_tag LOCUS_04880 gene ybaK 4520 4011 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254291.1 protein_id gnl|my_center|LOCUS_04880 4583 5527 gene locus_tag LOCUS_04890 gene prmA 4583 5527 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547033.1 protein_id gnl|my_center|LOCUS_04890 5583 5945 gene locus_tag LOCUS_04900 5583 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 5951 8200 gene locus_tag LOCUS_04910 5951 8200 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254292.1 protein_id gnl|my_center|LOCUS_04910 8200 8637 gene locus_tag LOCUS_04920 gene dtd 8200 8637 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547036.1 protein_id gnl|my_center|LOCUS_04920 8929 10215 gene locus_tag LOCUS_04930 gene hisS 8929 10215 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547037.1 protein_id gnl|my_center|LOCUS_04930 10218 12071 gene locus_tag LOCUS_04940 gene aspS 10218 12071 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547039.1 protein_id gnl|my_center|LOCUS_04940 13322 12138 gene locus_tag LOCUS_04950 13322 12138 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547041.1 protein_id gnl|my_center|LOCUS_04950 13685 13428 gene locus_tag LOCUS_04960 13685 13428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 13782 14978 gene locus_tag LOCUS_04970 gene coaBC 13782 14978 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254293.1 protein_id gnl|my_center|LOCUS_04970 15467 15637 gene locus_tag LOCUS_04980 15467 15637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 15694 16302 gene locus_tag LOCUS_04990 15694 16302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04990 16349 17158 gene locus_tag LOCUS_05000 gene yidA 16349 17158 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547047.1 protein_id gnl|my_center|LOCUS_05000 17183 18148 gene locus_tag LOCUS_05010 17183 18148 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254294.1 protein_id gnl|my_center|LOCUS_05010 19581 18196 gene locus_tag LOCUS_05020 19581 18196 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613351.1 protein_id gnl|my_center|LOCUS_05020 20299 19685 gene locus_tag LOCUS_05030 20299 19685 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254296.1 protein_id gnl|my_center|LOCUS_05030 20437 22239 gene locus_tag LOCUS_05040 gene uvrC 20437 22239 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547051.1 protein_id gnl|my_center|LOCUS_05040 22318 23622 gene locus_tag LOCUS_05050 gene obgE 22318 23622 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254297.1 protein_id gnl|my_center|LOCUS_05050 23754 25562 gene locus_tag LOCUS_05060 23754 25562 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025015105.1 protein_id gnl|my_center|LOCUS_05060 25581 26516 gene locus_tag LOCUS_05070 gene rnz 25581 26516 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547055.1 protein_id gnl|my_center|LOCUS_05070 26516 27310 gene locus_tag LOCUS_05080 26516 27310 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547056.1 protein_id gnl|my_center|LOCUS_05080 27316 27567 gene locus_tag LOCUS_05090 27316 27567 CDS product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547057.1 protein_id gnl|my_center|LOCUS_05090 27668 27856 gene locus_tag LOCUS_05100 gene rpmF 27668 27856 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547064.1 protein_id gnl|my_center|LOCUS_05100 27916 29472 gene locus_tag LOCUS_05110 27916 29472 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547066.1 protein_id gnl|my_center|LOCUS_05110 29752 29534 gene locus_tag LOCUS_05120 29752 29534 CDS product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254299.1 protein_id gnl|my_center|LOCUS_05120 29868 30311 gene locus_tag LOCUS_05130 29868 30311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 31069 30332 gene locus_tag LOCUS_05140 gene fabG 31069 30332 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762708.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence013 1004 123 gene locus_tag LOCUS_05150 1004 123 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254160.1 protein_id gnl|my_center|LOCUS_05150 1111 1317 gene locus_tag LOCUS_05160 1111 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05160 1314 1598 gene locus_tag LOCUS_05170 1314 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05170 3002 1629 gene locus_tag LOCUS_05180 3002 1629 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546123.1 protein_id gnl|my_center|LOCUS_05180 3302 5929 gene locus_tag LOCUS_05190 gene adhE 3302 5929 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546132.1 protein_id gnl|my_center|LOCUS_05190 6131 7942 gene locus_tag LOCUS_05200 gene glmS 6131 7942 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546133.1 protein_id gnl|my_center|LOCUS_05200 8263 9456 gene locus_tag LOCUS_05210 8263 9456 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254162.1 protein_id gnl|my_center|LOCUS_05210 9558 10289 gene locus_tag LOCUS_05220 9558 10289 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254163.1 protein_id gnl|my_center|LOCUS_05220 10407 10634 gene locus_tag LOCUS_05230 10407 10634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549087.1 protein_id gnl|my_center|LOCUS_05230 10784 11197 gene locus_tag LOCUS_05240 10784 11197 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546138.1 protein_id gnl|my_center|LOCUS_05240 12930 11272 gene locus_tag LOCUS_05250 12930 11272 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546143.1 protein_id gnl|my_center|LOCUS_05250 13143 14975 gene locus_tag LOCUS_05260 13143 14975 CDS product TerB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546145.1 protein_id gnl|my_center|LOCUS_05260 14980 16305 gene locus_tag LOCUS_05270 14980 16305 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546148.1 protein_id gnl|my_center|LOCUS_05270 16316 18547 gene locus_tag LOCUS_05280 16316 18547 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546149.1 protein_id gnl|my_center|LOCUS_05280 18579 18956 gene locus_tag LOCUS_05290 18579 18956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613312.1 protein_id gnl|my_center|LOCUS_05290 19042 19752 gene locus_tag LOCUS_05300 19042 19752 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546159.1 protein_id gnl|my_center|LOCUS_05300 19924 20181 gene locus_tag LOCUS_05310 19924 20181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 20284 20577 gene locus_tag LOCUS_05320 20284 20577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 22103 20775 gene locus_tag LOCUS_05330 22103 20775 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254458.1 protein_id gnl|my_center|LOCUS_05330 22710 22087 gene locus_tag LOCUS_05340 22710 22087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 23534 22824 gene locus_tag LOCUS_05350 23534 22824 CDS product IS30-like element ISLpl1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003561810.1 protein_id gnl|my_center|LOCUS_05350 23755 24216 gene locus_tag LOCUS_05360 23755 24216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 24257 25066 gene locus_tag LOCUS_05370 24257 25066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 25906 25055 gene locus_tag LOCUS_05380 25906 25055 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674639.1 protein_id gnl|my_center|LOCUS_05380 26119 26418 gene locus_tag LOCUS_05390 26119 26418 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595454.1 protein_id gnl|my_center|LOCUS_05390 27202 28119 gene locus_tag LOCUS_05400 27202 28119 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570727.1 protein_id gnl|my_center|LOCUS_05400 28199 29722 gene locus_tag LOCUS_05410 28199 29722 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674618.1 protein_id gnl|my_center|LOCUS_05410 29719 30357 gene locus_tag LOCUS_05420 29719 30357 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566214.1 protein_id gnl|my_center|LOCUS_05420 >Feature sequence014 16 423 gene locus_tag LOCUS_05430 16 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 518 1219 gene locus_tag LOCUS_05440 518 1219 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546250.1 protein_id gnl|my_center|LOCUS_05440 1669 1283 gene locus_tag LOCUS_05450 gene tagD 1669 1283 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254173.1 protein_id gnl|my_center|LOCUS_05450 1799 2527 gene locus_tag LOCUS_05460 1799 2527 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546254.1 protein_id gnl|my_center|LOCUS_05460 2535 3623 gene locus_tag LOCUS_05470 2535 3623 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546257.1 protein_id gnl|my_center|LOCUS_05470 3705 5183 gene locus_tag LOCUS_05480 3705 5183 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254174.1 protein_id gnl|my_center|LOCUS_05480 5180 6010 gene locus_tag LOCUS_05490 gene nadE 5180 6010 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546262.1 protein_id gnl|my_center|LOCUS_05490 6203 8851 gene locus_tag LOCUS_05500 6203 8851 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546265.1 protein_id gnl|my_center|LOCUS_05500 8943 10094 gene locus_tag LOCUS_05510 8943 10094 CDS product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546266.1 protein_id gnl|my_center|LOCUS_05510 10098 11528 gene locus_tag LOCUS_05520 10098 11528 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254175.1 protein_id gnl|my_center|LOCUS_05520 11531 12229 gene locus_tag LOCUS_05530 11531 12229 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546270.1 protein_id gnl|my_center|LOCUS_05530 12226 12681 gene locus_tag LOCUS_05540 12226 12681 CDS product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700699.1 protein_id gnl|my_center|LOCUS_05540 12763 12848 gene locus_tag LOCUS_t00070 12763 12848 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12934 13581 gene locus_tag LOCUS_05550 12934 13581 CDS product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546273.1 protein_id gnl|my_center|LOCUS_05550 13667 15913 gene locus_tag LOCUS_05560 gene pcrA 13667 15913 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546275.1 protein_id gnl|my_center|LOCUS_05560 15949 17952 gene locus_tag LOCUS_05570 gene ligA 15949 17952 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546277.1 protein_id gnl|my_center|LOCUS_05570 17945 19114 gene locus_tag LOCUS_05580 17945 19114 CDS product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546280.1 protein_id gnl|my_center|LOCUS_05580 19126 19434 gene locus_tag LOCUS_05590 gene gatC 19126 19434 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546283.1 protein_id gnl|my_center|LOCUS_05590 19434 20873 gene locus_tag LOCUS_05600 gene gatA 19434 20873 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546285.1 protein_id gnl|my_center|LOCUS_05600 20878 22308 gene locus_tag LOCUS_05610 gene gatB 20878 22308 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254176.1 protein_id gnl|my_center|LOCUS_05610 22334 23254 gene locus_tag LOCUS_05620 22334 23254 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546288.1 protein_id gnl|my_center|LOCUS_05620 24507 23797 gene locus_tag LOCUS_05630 24507 23797 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824482.1 protein_id gnl|my_center|LOCUS_05630 24648 24995 gene locus_tag LOCUS_05640 24648 24995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546292.1 protein_id gnl|my_center|LOCUS_05640 26423 25047 gene locus_tag LOCUS_05650 gene nhaC 26423 25047 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546295.1 protein_id gnl|my_center|LOCUS_05650 26793 28139 gene locus_tag LOCUS_05660 gene rlmD 26793 28139 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546298.1 protein_id gnl|my_center|LOCUS_05660 28149 28649 gene locus_tag LOCUS_05670 28149 28649 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546324.1 protein_id gnl|my_center|LOCUS_05670 28751 28837 gene locus_tag LOCUS_t00080 28751 28837 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 28843 28918 gene locus_tag LOCUS_t00090 28843 28918 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 28925 29000 gene locus_tag LOCUS_t00100 28925 29000 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 29004 29078 gene locus_tag LOCUS_t00110 29004 29078 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence015 280 107 gene locus_tag LOCUS_05680 280 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05680 1441 326 gene locus_tag LOCUS_05690 1441 326 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548719.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05690 2544 1720 gene locus_tag LOCUS_05700 2544 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548717.1 protein_id gnl|my_center|LOCUS_05700 3240 2557 gene locus_tag LOCUS_05710 3240 2557 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254049.1 protein_id gnl|my_center|LOCUS_05710 4386 3400 gene locus_tag LOCUS_05720 4386 3400 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548712.1 protein_id gnl|my_center|LOCUS_05720 5324 4473 gene locus_tag LOCUS_05730 5324 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 5562 5275 gene locus_tag LOCUS_05740 5562 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05740 6420 5782 gene locus_tag LOCUS_05750 6420 5782 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642965.1 protein_id gnl|my_center|LOCUS_05750 7160 6504 gene locus_tag LOCUS_05760 7160 6504 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254047.1 protein_id gnl|my_center|LOCUS_05760 7990 7172 gene locus_tag LOCUS_05770 7990 7172 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254046.1 protein_id gnl|my_center|LOCUS_05770 8141 9100 gene locus_tag LOCUS_05780 8141 9100 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548693.1 protein_id gnl|my_center|LOCUS_05780 9910 9146 gene locus_tag LOCUS_05790 9910 9146 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548691.1 protein_id gnl|my_center|LOCUS_05790 10004 10930 gene locus_tag LOCUS_05800 10004 10930 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548688.1 protein_id gnl|my_center|LOCUS_05800 10949 12406 gene locus_tag LOCUS_05810 gene cls 10949 12406 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548687.1 protein_id gnl|my_center|LOCUS_05810 12883 12407 gene locus_tag LOCUS_05820 12883 12407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254045.1 protein_id gnl|my_center|LOCUS_05820 12971 13675 gene locus_tag LOCUS_05830 12971 13675 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613281.1 protein_id gnl|my_center|LOCUS_05830 13863 14240 gene locus_tag LOCUS_05840 13863 14240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05840 14227 15018 gene locus_tag LOCUS_05850 14227 15018 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548681.1 protein_id gnl|my_center|LOCUS_05850 15418 15059 gene locus_tag LOCUS_05860 15418 15059 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548679.1 protein_id gnl|my_center|LOCUS_05860 15486 16118 gene locus_tag LOCUS_05870 15486 16118 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254043.1 protein_id gnl|my_center|LOCUS_05870 16450 18063 gene locus_tag LOCUS_05880 16450 18063 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254042.1 protein_id gnl|my_center|LOCUS_05880 18063 18818 gene locus_tag LOCUS_05890 18063 18818 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548674.1 protein_id gnl|my_center|LOCUS_05890 18899 19831 gene locus_tag LOCUS_05900 18899 19831 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548672.1 protein_id gnl|my_center|LOCUS_05900 20778 19930 gene locus_tag LOCUS_05910 20778 19930 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254041.1 protein_id gnl|my_center|LOCUS_05910 21489 20845 gene locus_tag LOCUS_05920 21489 20845 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254040.1 protein_id gnl|my_center|LOCUS_05920 21715 22947 gene locus_tag LOCUS_05930 21715 22947 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476517.1 protein_id gnl|my_center|LOCUS_05930 23885 22986 gene locus_tag LOCUS_05940 23885 22986 CDS product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548666.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05940 24703 24128 gene locus_tag LOCUS_05950 24703 24128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05950 25431 24685 gene locus_tag LOCUS_05960 25431 24685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05960 25793 25557 gene locus_tag LOCUS_05970 25793 25557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05970 26095 25790 gene locus_tag LOCUS_05980 26095 25790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05980 26410 26105 gene locus_tag LOCUS_05990 26410 26105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05990 26654 26514 gene locus_tag LOCUS_06000 26654 26514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548644.1 protein_id gnl|my_center|LOCUS_06000 28466 26715 gene locus_tag LOCUS_06010 28466 26715 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548622.1 protein_id gnl|my_center|LOCUS_06010 28878 28477 gene locus_tag LOCUS_06020 28878 28477 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548621.1 protein_id gnl|my_center|LOCUS_06020 29076 30182 gene locus_tag LOCUS_06030 29076 30182 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254034.1 protein_id gnl|my_center|LOCUS_06030 >Feature sequence016 629 108 gene locus_tag LOCUS_06040 629 108 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546446.1 protein_id gnl|my_center|LOCUS_06040 1068 622 gene locus_tag LOCUS_06050 1068 622 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546448.1 protein_id gnl|my_center|LOCUS_06050 1204 2031 gene locus_tag LOCUS_06060 gene map 1204 2031 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254208.1 protein_id gnl|my_center|LOCUS_06060 2040 2957 gene locus_tag LOCUS_06070 2040 2957 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546451.1 protein_id gnl|my_center|LOCUS_06070 3023 3922 gene locus_tag LOCUS_06080 gene galU 3023 3922 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546456.1 protein_id gnl|my_center|LOCUS_06080 4039 5199 gene locus_tag LOCUS_06090 4039 5199 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546457.1 protein_id gnl|my_center|LOCUS_06090 5199 6410 gene locus_tag LOCUS_06100 5199 6410 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546459.1 protein_id gnl|my_center|LOCUS_06100 6410 7573 gene locus_tag LOCUS_06110 6410 7573 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546460.1 protein_id gnl|my_center|LOCUS_06110 7905 7621 gene locus_tag LOCUS_06120 7905 7621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254209.1 protein_id gnl|my_center|LOCUS_06120 8002 8922 gene locus_tag LOCUS_06130 8002 8922 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546465.1 protein_id gnl|my_center|LOCUS_06130 10740 9361 gene locus_tag LOCUS_06140 gene rlmD 10740 9361 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546467.1 protein_id gnl|my_center|LOCUS_06140 10921 11679 gene locus_tag LOCUS_06150 gene recX 10921 11679 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546469.1 protein_id gnl|my_center|LOCUS_06150 11693 12172 gene locus_tag LOCUS_06160 11693 12172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254210.1 protein_id gnl|my_center|LOCUS_06160 12641 12180 gene locus_tag LOCUS_06170 12641 12180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 12746 13612 gene locus_tag LOCUS_06180 12746 13612 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546472.1 protein_id gnl|my_center|LOCUS_06180 13612 15183 gene locus_tag LOCUS_06190 13612 15183 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546473.1 protein_id gnl|my_center|LOCUS_06190 15526 15245 gene locus_tag LOCUS_06200 15526 15245 CDS product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546474.1 protein_id gnl|my_center|LOCUS_06200 17760 15712 gene locus_tag LOCUS_06210 17760 15712 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254211.1 protein_id gnl|my_center|LOCUS_06210 18080 18268 gene locus_tag LOCUS_06220 18080 18268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 18382 18648 gene locus_tag LOCUS_06230 18382 18648 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546482.1 protein_id gnl|my_center|LOCUS_06230 18648 20381 gene locus_tag LOCUS_06240 gene ptsP 18648 20381 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254212.1 protein_id gnl|my_center|LOCUS_06240 20616 21014 gene locus_tag LOCUS_06250 gene spxA 20616 21014 CDS product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254213.1 protein_id gnl|my_center|LOCUS_06250 21109 21855 gene locus_tag LOCUS_06260 21109 21855 CDS product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546487.1 protein_id gnl|my_center|LOCUS_06260 21932 22792 gene locus_tag LOCUS_06270 21932 22792 CDS product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254214.1 protein_id gnl|my_center|LOCUS_06270 23406 22789 gene locus_tag LOCUS_06280 23406 22789 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546492.1 protein_id gnl|my_center|LOCUS_06280 24100 23492 gene locus_tag LOCUS_06290 24100 23492 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546493.1 protein_id gnl|my_center|LOCUS_06290 24174 24806 gene locus_tag LOCUS_06300 24174 24806 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546495.1 protein_id gnl|my_center|LOCUS_06300 24803 25603 gene locus_tag LOCUS_06310 24803 25603 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254215.1 protein_id gnl|my_center|LOCUS_06310 25596 26501 gene locus_tag LOCUS_06320 25596 26501 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546500.1 protein_id gnl|my_center|LOCUS_06320 26606 28381 gene locus_tag LOCUS_06330 26606 28381 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254216.1 protein_id gnl|my_center|LOCUS_06330 29111 28419 gene locus_tag LOCUS_06340 29111 28419 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254217.1 protein_id gnl|my_center|LOCUS_06340 <29833 29204 gene locus_tag LOCUS_06350 <29833 29204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546505.1:lactonase family protein >Feature sequence017 <1 1863 gene locus_tag LOCUS_06360 <1 1863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254197.1:KUP/HAK/KT family potassium transporter 4157 2205 gene locus_tag LOCUS_06370 4157 2205 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548782.1 protein_id gnl|my_center|LOCUS_06370 5459 4242 gene locus_tag LOCUS_06380 5459 4242 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548780.1 protein_id gnl|my_center|LOCUS_06380 6766 5558 gene locus_tag LOCUS_06390 6766 5558 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548779.1 protein_id gnl|my_center|LOCUS_06390 7347 6766 gene locus_tag LOCUS_06400 7347 6766 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254062.1 protein_id gnl|my_center|LOCUS_06400 8131 7418 gene locus_tag LOCUS_06410 gene nrdG 8131 7418 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548777.1 protein_id gnl|my_center|LOCUS_06410 10310 8115 gene locus_tag LOCUS_06420 gene nrdD 10310 8115 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254061.1 protein_id gnl|my_center|LOCUS_06420 10879 10331 gene locus_tag LOCUS_06430 10879 10331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 11161 11003 gene locus_tag LOCUS_06440 11161 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 12546 11278 gene locus_tag LOCUS_06450 12546 11278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548775.1 protein_id gnl|my_center|LOCUS_06450 14517 12568 gene locus_tag LOCUS_06460 gene asnB 14517 12568 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548773.1 protein_id gnl|my_center|LOCUS_06460 16032 14635 gene locus_tag LOCUS_06470 16032 14635 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254060.1 protein_id gnl|my_center|LOCUS_06470 16573 16088 gene locus_tag LOCUS_06480 16573 16088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548767.1 protein_id gnl|my_center|LOCUS_06480 16724 17296 gene locus_tag LOCUS_06490 16724 17296 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254059.1 protein_id gnl|my_center|LOCUS_06490 18141 17344 gene locus_tag LOCUS_06500 gene phnE 18141 17344 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548762.1 protein_id gnl|my_center|LOCUS_06500 18932 18141 gene locus_tag LOCUS_06510 gene phnE 18932 18141 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254058.1 protein_id gnl|my_center|LOCUS_06510 19705 18932 gene locus_tag LOCUS_06520 gene phnC 19705 18932 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548759.1 protein_id gnl|my_center|LOCUS_06520 20664 19735 gene locus_tag LOCUS_06530 20664 19735 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254057.1 protein_id gnl|my_center|LOCUS_06530 21503 21018 gene locus_tag LOCUS_06540 21503 21018 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548753.1 protein_id gnl|my_center|LOCUS_06540 21648 22451 gene locus_tag LOCUS_06550 21648 22451 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548752.1 protein_id gnl|my_center|LOCUS_06550 22958 22455 gene locus_tag LOCUS_06560 22958 22455 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548750.1 protein_id gnl|my_center|LOCUS_06560 23078 23554 gene locus_tag LOCUS_06570 23078 23554 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613286.1 protein_id gnl|my_center|LOCUS_06570 25096 23942 gene locus_tag LOCUS_06580 gene nagA 25096 23942 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254054.1 protein_id gnl|my_center|LOCUS_06580 25253 28264 gene locus_tag LOCUS_06590 25253 28264 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548741.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence018 205 277 gene locus_tag LOCUS_t00120 205 277 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 349 1662 gene locus_tag LOCUS_06600 349 1662 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254069.1 protein_id gnl|my_center|LOCUS_06600 1662 2315 gene locus_tag LOCUS_06610 1662 2315 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254070.1 protein_id gnl|my_center|LOCUS_06610 2486 4111 gene locus_tag LOCUS_06620 2486 4111 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548835.1 protein_id gnl|my_center|LOCUS_06620 4185 5819 gene locus_tag LOCUS_06630 4185 5819 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254071.1 protein_id gnl|my_center|LOCUS_06630 5967 7109 gene locus_tag LOCUS_06640 5967 7109 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254072.1 protein_id gnl|my_center|LOCUS_06640 7291 8220 gene locus_tag LOCUS_06650 7291 8220 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254073.1 protein_id gnl|my_center|LOCUS_06650 8229 9260 gene locus_tag LOCUS_06660 8229 9260 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254074.1 protein_id gnl|my_center|LOCUS_06660 9276 9749 gene locus_tag LOCUS_06670 9276 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06670 9746 10324 gene locus_tag LOCUS_06680 9746 10324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06680 10345 11289 gene locus_tag LOCUS_06690 10345 11289 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548861.1 protein_id gnl|my_center|LOCUS_06690 12693 11377 gene locus_tag LOCUS_06700 12693 11377 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254075.1 protein_id gnl|my_center|LOCUS_06700 13257 12832 gene locus_tag LOCUS_06710 13257 12832 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254076.1 protein_id gnl|my_center|LOCUS_06710 13492 13803 gene locus_tag LOCUS_06720 gene greA 13492 13803 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548866.1 protein_id gnl|my_center|LOCUS_06720 13880 14542 gene locus_tag LOCUS_06730 13880 14542 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254077.1 protein_id gnl|my_center|LOCUS_06730 14672 14601 gene locus_tag LOCUS_t00130 14672 14601 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15313 14714 gene locus_tag LOCUS_06740 15313 14714 CDS product SOS response-associated peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548869.1 protein_id gnl|my_center|LOCUS_06740 15416 16438 gene locus_tag LOCUS_06750 gene trpS 15416 16438 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548870.1 protein_id gnl|my_center|LOCUS_06750 16460 16939 gene locus_tag LOCUS_06760 16460 16939 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548871.1 protein_id gnl|my_center|LOCUS_06760 16962 17537 gene locus_tag LOCUS_06770 16962 17537 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548872.1 protein_id gnl|my_center|LOCUS_06770 17831 20494 gene locus_tag LOCUS_06780 gene mgtA 17831 20494 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548873.1 protein_id gnl|my_center|LOCUS_06780 20590 22566 gene locus_tag LOCUS_06790 gene metG 20590 22566 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254078.1 protein_id gnl|my_center|LOCUS_06790 22566 23333 gene locus_tag LOCUS_06800 22566 23333 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548876.1 protein_id gnl|my_center|LOCUS_06800 23320 23886 gene locus_tag LOCUS_06810 gene rnmV 23320 23886 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548877.1 protein_id gnl|my_center|LOCUS_06810 23876 24760 gene locus_tag LOCUS_06820 gene rsmA 23876 24760 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548878.1 protein_id gnl|my_center|LOCUS_06820 24822 25079 gene locus_tag LOCUS_06830 24822 25079 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548879.1 protein_id gnl|my_center|LOCUS_06830 25186 26016 gene locus_tag LOCUS_06840 gene purR 25186 26016 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548880.1 protein_id gnl|my_center|LOCUS_06840 26064 27449 gene locus_tag LOCUS_06850 gene glmU 26064 27449 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548882.1 protein_id gnl|my_center|LOCUS_06850 >Feature sequence019 506 273 gene locus_tag LOCUS_06860 506 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06860 1310 618 gene locus_tag LOCUS_06870 gene rpiA 1310 618 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254196.1 protein_id gnl|my_center|LOCUS_06870 2236 1310 gene locus_tag LOCUS_06880 gene rbsK 2236 1310 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254195.1 protein_id gnl|my_center|LOCUS_06880 3126 2323 gene locus_tag LOCUS_06890 3126 2323 CDS product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546373.1 protein_id gnl|my_center|LOCUS_06890 3284 4588 gene locus_tag LOCUS_06900 3284 4588 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546372.1 protein_id gnl|my_center|LOCUS_06900 5192 4749 gene locus_tag LOCUS_06910 5192 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546371.1 protein_id gnl|my_center|LOCUS_06910 5590 5189 gene locus_tag LOCUS_06920 5590 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06920 6101 5583 gene locus_tag LOCUS_06930 6101 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06930 6743 6180 gene locus_tag LOCUS_06940 6743 6180 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546369.1 protein_id gnl|my_center|LOCUS_06940 7432 6770 gene locus_tag LOCUS_06950 7432 6770 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546368.1 protein_id gnl|my_center|LOCUS_06950 8247 7432 gene locus_tag LOCUS_06960 8247 7432 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546367.1 protein_id gnl|my_center|LOCUS_06960 8999 8259 gene locus_tag LOCUS_06970 8999 8259 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546366.1 protein_id gnl|my_center|LOCUS_06970 9614 10252 gene locus_tag LOCUS_06980 gene udk 9614 10252 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546365.1 protein_id gnl|my_center|LOCUS_06980 10738 10304 gene locus_tag LOCUS_06990 10738 10304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 10851 10717 gene locus_tag LOCUS_07000 10851 10717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 11491 10913 gene locus_tag LOCUS_07010 11491 10913 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546364.1 protein_id gnl|my_center|LOCUS_07010 13430 11661 gene locus_tag LOCUS_07020 13430 11661 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254194.1 protein_id gnl|my_center|LOCUS_07020 15160 13430 gene locus_tag LOCUS_07030 15160 13430 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254193.1 protein_id gnl|my_center|LOCUS_07030 15600 15160 gene locus_tag LOCUS_07040 15600 15160 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254192.1 protein_id gnl|my_center|LOCUS_07040 15769 16587 gene locus_tag LOCUS_07050 15769 16587 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254191.1 protein_id gnl|my_center|LOCUS_07050 17463 16690 gene locus_tag LOCUS_07060 17463 16690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546359.1 protein_id gnl|my_center|LOCUS_07060 18462 17542 gene locus_tag LOCUS_07070 18462 17542 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642346.1 protein_id gnl|my_center|LOCUS_07070 20181 18559 gene locus_tag LOCUS_07080 20181 18559 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546358.1 protein_id gnl|my_center|LOCUS_07080 21361 20279 gene locus_tag LOCUS_07090 21361 20279 CDS product M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546357.1 protein_id gnl|my_center|LOCUS_07090 21453 22652 gene locus_tag LOCUS_07100 21453 22652 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254190.1 protein_id gnl|my_center|LOCUS_07100 24153 22684 gene locus_tag LOCUS_07110 24153 22684 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546350.1 protein_id gnl|my_center|LOCUS_07110 24376 24567 gene locus_tag LOCUS_07120 24376 24567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07120 24766 25296 gene locus_tag LOCUS_07130 gene pyrR 24766 25296 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546345.1 protein_id gnl|my_center|LOCUS_07130 25307 26635 gene locus_tag LOCUS_07140 25307 26635 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546343.1 protein_id gnl|my_center|LOCUS_07140 27503 26703 gene locus_tag LOCUS_07150 27503 26703 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546337.1 protein_id gnl|my_center|LOCUS_07150 >Feature sequence020 687 160 gene locus_tag LOCUS_07160 687 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 1067 948 gene locus_tag LOCUS_07170 1067 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 3365 1428 gene locus_tag LOCUS_07180 gene thrS 3365 1428 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548338.1 protein_id gnl|my_center|LOCUS_07180 4564 3647 gene locus_tag LOCUS_07190 gene dnaI 4564 3647 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254494.1 protein_id gnl|my_center|LOCUS_07190 5930 4581 gene locus_tag LOCUS_07200 5930 4581 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548343.1 protein_id gnl|my_center|LOCUS_07200 6400 5933 gene locus_tag LOCUS_07210 gene nrdR 6400 5933 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548345.1 protein_id gnl|my_center|LOCUS_07210 7005 6403 gene locus_tag LOCUS_07220 gene coaE 7005 6403 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548347.1 protein_id gnl|my_center|LOCUS_07220 7832 7002 gene locus_tag LOCUS_07230 gene mutM 7832 7002 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548349.1 protein_id gnl|my_center|LOCUS_07230 10504 7841 gene locus_tag LOCUS_07240 gene polA 10504 7841 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548351.1 protein_id gnl|my_center|LOCUS_07240 10725 14711 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttacatttctcttaagttaaataaaaac 15176 14895 gene locus_tag LOCUS_07250 gene cas2 15176 14895 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903132.1 protein_id gnl|my_center|LOCUS_07250 16171 15182 gene locus_tag LOCUS_07260 gene cas1b 16171 15182 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896423.1 protein_id gnl|my_center|LOCUS_07260 16672 16181 gene locus_tag LOCUS_07270 gene cas4 16672 16181 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016964.1 protein_id gnl|my_center|LOCUS_07270 19117 16688 gene locus_tag LOCUS_07280 19117 16688 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016965.1 protein_id gnl|my_center|LOCUS_07280 19148 19560 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttacattcctcttaagttagataaaaac 19795 20024 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aatttatattcctactaagtgagataaaaac 20916 20203 gene locus_tag LOCUS_07290 gene cas5b 20916 20203 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439785.1 protein_id gnl|my_center|LOCUS_07290 21805 20903 gene locus_tag LOCUS_07300 gene cas7i 21805 20903 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544921.1 protein_id gnl|my_center|LOCUS_07300 23581 21824 gene locus_tag LOCUS_07310 23581 21824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 24354 23599 gene locus_tag LOCUS_07320 gene cas6 24354 23599 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861560.1 protein_id gnl|my_center|LOCUS_07320 25839 24664 gene locus_tag LOCUS_07330 gene purD 25839 24664 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548355.1 protein_id gnl|my_center|LOCUS_07330 >Feature sequence021 1957 1079 gene locus_tag LOCUS_07340 1957 1079 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548242.1 protein_id gnl|my_center|LOCUS_07340 3498 2161 gene locus_tag LOCUS_07350 gene glnA 3498 2161 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003627067.1 protein_id gnl|my_center|LOCUS_07350 4887 3640 gene locus_tag LOCUS_07360 4887 3640 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548246.1 protein_id gnl|my_center|LOCUS_07360 5842 4880 gene locus_tag LOCUS_07370 gene miaA 5842 4880 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548247.1 protein_id gnl|my_center|LOCUS_07370 6279 5878 gene locus_tag LOCUS_07380 6279 5878 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548248.1 protein_id gnl|my_center|LOCUS_07380 6568 6338 gene locus_tag LOCUS_07390 6568 6338 CDS product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548250.1 protein_id gnl|my_center|LOCUS_07390 7258 6578 gene locus_tag LOCUS_07400 7258 6578 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254484.1 protein_id gnl|my_center|LOCUS_07400 7892 7296 gene locus_tag LOCUS_07410 7892 7296 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548253.1 protein_id gnl|my_center|LOCUS_07410 8063 7914 gene locus_tag LOCUS_07420 gene rpmG 8063 7914 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548272.1 protein_id gnl|my_center|LOCUS_07420 10247 8139 gene locus_tag LOCUS_07430 10247 8139 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254485.1 protein_id gnl|my_center|LOCUS_07430 10575 12926 gene locus_tag LOCUS_07440 10575 12926 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548276.1 protein_id gnl|my_center|LOCUS_07440 13036 13959 gene locus_tag LOCUS_07450 13036 13959 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548278.1 protein_id gnl|my_center|LOCUS_07450 14214 14017 gene locus_tag LOCUS_07460 14214 14017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 14674 14375 gene locus_tag LOCUS_07470 14674 14375 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548282.1 protein_id gnl|my_center|LOCUS_07470 16213 14930 gene locus_tag LOCUS_07480 gene pepT 16213 14930 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548288.1 protein_id gnl|my_center|LOCUS_07480 17238 16324 gene locus_tag LOCUS_07490 17238 16324 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548290.1 protein_id gnl|my_center|LOCUS_07490 17776 17300 gene locus_tag LOCUS_07500 gene greA 17776 17300 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548292.1 protein_id gnl|my_center|LOCUS_07500 20270 17856 gene locus_tag LOCUS_07510 gene pheT 20270 17856 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548294.1 protein_id gnl|my_center|LOCUS_07510 21323 20274 gene locus_tag LOCUS_07520 gene pheS 21323 20274 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548296.1 protein_id gnl|my_center|LOCUS_07520 21957 21607 gene locus_tag LOCUS_07530 21957 21607 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254487.1 protein_id gnl|my_center|LOCUS_07530 22817 22050 gene locus_tag LOCUS_07540 22817 22050 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548298.1 protein_id gnl|my_center|LOCUS_07540 22905 23177 gene locus_tag LOCUS_07550 22905 23177 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548299.1 protein_id gnl|my_center|LOCUS_07550 23218 24186 gene locus_tag LOCUS_07560 gene yidC 23218 24186 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254488.1 protein_id gnl|my_center|LOCUS_07560 <25494 24231 gene locus_tag LOCUS_07570 <25494 24231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254489.1:HAMP domain-containing histidine kinase >Feature sequence022 317 964 gene locus_tag LOCUS_07580 317 964 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549467.1 protein_id gnl|my_center|LOCUS_07580 1017 1703 gene locus_tag LOCUS_07590 1017 1703 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549464.1 protein_id gnl|my_center|LOCUS_07590 2574 1774 gene locus_tag LOCUS_07600 2574 1774 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549462.1 protein_id gnl|my_center|LOCUS_07600 2797 4104 gene locus_tag LOCUS_07610 2797 4104 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549459.1 protein_id gnl|my_center|LOCUS_07610 4245 4060 gene locus_tag LOCUS_07620 4245 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 5043 4312 gene locus_tag LOCUS_07630 5043 4312 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549457.1 protein_id gnl|my_center|LOCUS_07630 5224 6531 gene locus_tag LOCUS_07640 5224 6531 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025014283.1 protein_id gnl|my_center|LOCUS_07640 6833 8143 gene locus_tag LOCUS_07650 6833 8143 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025014283.1 protein_id gnl|my_center|LOCUS_07650 8238 8972 gene locus_tag LOCUS_07660 8238 8972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 9020 9274 gene locus_tag LOCUS_07670 9020 9274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 9642 11270 gene locus_tag LOCUS_07680 9642 11270 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254634.1 protein_id gnl|my_center|LOCUS_07680 12161 11301 gene locus_tag LOCUS_07690 12161 11301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 12726 13166 gene locus_tag LOCUS_07700 12726 13166 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549441.1 protein_id gnl|my_center|LOCUS_07700 13178 13555 gene locus_tag LOCUS_07710 13178 13555 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549440.1 protein_id gnl|my_center|LOCUS_07710 13555 13842 gene locus_tag LOCUS_07720 13555 13842 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549438.1 protein_id gnl|my_center|LOCUS_07720 13842 15770 gene locus_tag LOCUS_07730 13842 15770 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549436.1 protein_id gnl|my_center|LOCUS_07730 15877 16875 gene locus_tag LOCUS_07740 15877 16875 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549434.1 protein_id gnl|my_center|LOCUS_07740 17580 16927 gene locus_tag LOCUS_07750 17580 16927 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549430.1 protein_id gnl|my_center|LOCUS_07750 17784 17632 gene locus_tag LOCUS_07760 17784 17632 CDS product SPJ_0845 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549428.1 protein_id gnl|my_center|LOCUS_07760 18954 17845 gene locus_tag LOCUS_07770 18954 17845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254635.1 protein_id gnl|my_center|LOCUS_07770 20604 19045 gene locus_tag LOCUS_07780 20604 19045 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549425.1 protein_id gnl|my_center|LOCUS_07780 22112 20709 gene locus_tag LOCUS_07790 gene gndA 22112 20709 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254636.1 protein_id gnl|my_center|LOCUS_07790 24150 22342 gene locus_tag LOCUS_07800 gene spxB 24150 22342 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254637.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence023 1515 124 gene locus_tag LOCUS_07810 gene cls 1515 124 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547770.1 protein_id gnl|my_center|LOCUS_07810 1749 2246 gene locus_tag LOCUS_07820 1749 2246 CDS product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547769.1 protein_id gnl|my_center|LOCUS_07820 4579 2306 gene locus_tag LOCUS_07830 4579 2306 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254392.1 protein_id gnl|my_center|LOCUS_07830 4708 5559 gene locus_tag LOCUS_07840 4708 5559 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254391.1 protein_id gnl|my_center|LOCUS_07840 5636 6907 gene locus_tag LOCUS_07850 gene arcA 5636 6907 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288439.1 protein_id gnl|my_center|LOCUS_07850 6876 7916 gene locus_tag LOCUS_07860 gene argF 6876 7916 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254507.1 protein_id gnl|my_center|LOCUS_07860 7918 8853 gene locus_tag LOCUS_07870 gene arcC 7918 8853 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721662.1 protein_id gnl|my_center|LOCUS_07870 8864 9043 gene locus_tag LOCUS_07880 8864 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07880 9081 9401 gene locus_tag LOCUS_07890 9081 9401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07890 9518 10684 gene locus_tag LOCUS_07900 9518 10684 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254389.1 protein_id gnl|my_center|LOCUS_07900 10702 10863 gene locus_tag LOCUS_07910 10702 10863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547759.1 protein_id gnl|my_center|LOCUS_07910 10865 11470 gene locus_tag LOCUS_07920 10865 11470 CDS product LysR family transcriptional regulator substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547757.1 protein_id gnl|my_center|LOCUS_07920 11540 11896 gene locus_tag LOCUS_07930 11540 11896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613376.1 protein_id gnl|my_center|LOCUS_07930 12029 12682 gene locus_tag LOCUS_07940 12029 12682 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547751.1 protein_id gnl|my_center|LOCUS_07940 14155 12794 gene locus_tag LOCUS_07950 gene brnQ 14155 12794 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476479.1 protein_id gnl|my_center|LOCUS_07950 15837 14512 gene locus_tag LOCUS_07960 15837 14512 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254382.1 protein_id gnl|my_center|LOCUS_07960 16289 16462 gene locus_tag LOCUS_07970 16289 16462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 16416 16607 gene locus_tag LOCUS_07980 16416 16607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 16594 17049 gene locus_tag LOCUS_07990 16594 17049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 17515 18750 gene locus_tag LOCUS_08000 17515 18750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08000 18891 19355 gene locus_tag LOCUS_08010 18891 19355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08010 19427 19654 gene locus_tag LOCUS_08020 19427 19654 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546307.1 protein_id gnl|my_center|LOCUS_08020 19657 20214 gene locus_tag LOCUS_08030 19657 20214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546308.1 protein_id gnl|my_center|LOCUS_08030 20231 20857 gene locus_tag LOCUS_08040 20231 20857 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254180.1 protein_id gnl|my_center|LOCUS_08040 21344 20904 gene locus_tag LOCUS_08050 21344 20904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08050 21796 21563 gene locus_tag LOCUS_08060 21796 21563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08060 23306 21807 gene locus_tag LOCUS_08070 gene thrC 23306 21807 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547727.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence024 3173 2472 gene locus_tag LOCUS_08080 3173 2472 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549550.1 protein_id gnl|my_center|LOCUS_08080 3337 4566 gene locus_tag LOCUS_08090 3337 4566 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549552.1 protein_id gnl|my_center|LOCUS_08090 4547 5410 gene locus_tag LOCUS_08100 4547 5410 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549553.1 protein_id gnl|my_center|LOCUS_08100 5751 7880 gene locus_tag LOCUS_08110 5751 7880 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254615.1 protein_id gnl|my_center|LOCUS_08110 8000 8632 gene locus_tag LOCUS_08120 gene lepB 8000 8632 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549558.1 protein_id gnl|my_center|LOCUS_08120 8709 9455 gene locus_tag LOCUS_08130 8709 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613432.1 protein_id gnl|my_center|LOCUS_08130 9548 10900 gene locus_tag LOCUS_08140 9548 10900 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549562.1 protein_id gnl|my_center|LOCUS_08140 10937 12313 gene locus_tag LOCUS_08150 10937 12313 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549564.1 protein_id gnl|my_center|LOCUS_08150 12432 13160 gene locus_tag LOCUS_08160 12432 13160 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254611.1 protein_id gnl|my_center|LOCUS_08160 13177 14568 gene locus_tag LOCUS_08170 13177 14568 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549571.1 protein_id gnl|my_center|LOCUS_08170 15631 14618 gene locus_tag LOCUS_08180 gene asnA 15631 14618 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549578.1 protein_id gnl|my_center|LOCUS_08180 16069 17127 gene locus_tag LOCUS_08190 16069 17127 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549580.1 protein_id gnl|my_center|LOCUS_08190 17259 17186 gene locus_tag LOCUS_t00140 17259 17186 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 17341 17267 gene locus_tag LOCUS_t00150 17341 17267 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18547 17555 gene locus_tag LOCUS_08200 18547 17555 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254608.1 protein_id gnl|my_center|LOCUS_08200 18745 20034 gene locus_tag LOCUS_08210 18745 20034 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549585.1 protein_id gnl|my_center|LOCUS_08210 20038 21333 gene locus_tag LOCUS_08220 gene purB 20038 21333 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254607.1 protein_id gnl|my_center|LOCUS_08220 21419 21778 gene locus_tag LOCUS_08230 21419 21778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254606.1 protein_id gnl|my_center|LOCUS_08230 21871 22362 gene locus_tag LOCUS_08240 21871 22362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence025 797 147 gene locus_tag LOCUS_08250 797 147 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549989.1 protein_id gnl|my_center|LOCUS_08250 1555 869 gene locus_tag LOCUS_08260 1555 869 CDS product matrixin family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549990.1 protein_id gnl|my_center|LOCUS_08260 1709 4015 gene locus_tag LOCUS_08270 gene helD 1709 4015 CDS product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_056990024.1 protein_id gnl|my_center|LOCUS_08270 4433 5092 gene locus_tag LOCUS_08280 4433 5092 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549992.1 protein_id gnl|my_center|LOCUS_08280 5109 5729 gene locus_tag LOCUS_08290 5109 5729 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254538.1 protein_id gnl|my_center|LOCUS_08290 5733 6551 gene locus_tag LOCUS_08300 5733 6551 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550005.1 protein_id gnl|my_center|LOCUS_08300 6554 7006 gene locus_tag LOCUS_08310 6554 7006 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550006.1 protein_id gnl|my_center|LOCUS_08310 7563 7003 gene locus_tag LOCUS_08320 7563 7003 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550008.1 protein_id gnl|my_center|LOCUS_08320 7609 8523 gene locus_tag LOCUS_08330 gene coaA 7609 8523 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550009.1 protein_id gnl|my_center|LOCUS_08330 8661 9236 gene locus_tag LOCUS_08340 gene efp 8661 9236 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550017.1 protein_id gnl|my_center|LOCUS_08340 9872 9285 gene locus_tag LOCUS_08350 9872 9285 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550018.1 protein_id gnl|my_center|LOCUS_08350 10345 9977 gene locus_tag LOCUS_08360 10345 9977 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550019.1 protein_id gnl|my_center|LOCUS_08360 10662 12299 gene locus_tag LOCUS_08370 10662 12299 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550020.1 protein_id gnl|my_center|LOCUS_08370 12399 12854 gene locus_tag LOCUS_08380 12399 12854 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254537.1 protein_id gnl|my_center|LOCUS_08380 12854 13369 gene locus_tag LOCUS_08390 12854 13369 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550021.1 protein_id gnl|my_center|LOCUS_08390 14062 13424 gene locus_tag LOCUS_08400 14062 13424 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550024.1 protein_id gnl|my_center|LOCUS_08400 14629 14084 gene locus_tag LOCUS_08410 14629 14084 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254536.1 protein_id gnl|my_center|LOCUS_08410 16086 14743 gene locus_tag LOCUS_08420 16086 14743 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254535.1 protein_id gnl|my_center|LOCUS_08420 16789 16088 gene locus_tag LOCUS_08430 16789 16088 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550031.1 protein_id gnl|my_center|LOCUS_08430 17758 16841 gene locus_tag LOCUS_08440 17758 16841 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550037.1 protein_id gnl|my_center|LOCUS_08440 17876 19480 gene locus_tag LOCUS_08450 17876 19480 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254534.1 protein_id gnl|my_center|LOCUS_08450 19663 20406 gene locus_tag LOCUS_08460 19663 20406 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254533.1 protein_id gnl|my_center|LOCUS_08460 20758 20468 gene locus_tag LOCUS_08470 20758 20468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550042.1 protein_id gnl|my_center|LOCUS_08470 21035 20820 gene locus_tag LOCUS_08480 21035 20820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08480 <22490 21369 gene locus_tag LOCUS_08490 <22490 21369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254532.1:surface protein note possible pseudo, internal stop codon >Feature sequence026 989 132 gene locus_tag LOCUS_08500 989 132 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548442.1 protein_id gnl|my_center|LOCUS_08500 1071 3137 gene locus_tag LOCUS_08510 1071 3137 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548440.1 protein_id gnl|my_center|LOCUS_08510 3155 3505 gene locus_tag LOCUS_08520 3155 3505 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548438.1 protein_id gnl|my_center|LOCUS_08520 3514 4728 gene locus_tag LOCUS_08530 3514 4728 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548436.1 protein_id gnl|my_center|LOCUS_08530 4709 7204 gene locus_tag LOCUS_08540 4709 7204 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254507.1 protein_id gnl|my_center|LOCUS_08540 7197 8174 gene locus_tag LOCUS_08550 7197 8174 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254506.1 protein_id gnl|my_center|LOCUS_08550 9160 8255 gene locus_tag LOCUS_08560 9160 8255 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254505.1 protein_id gnl|my_center|LOCUS_08560 9634 9278 gene locus_tag LOCUS_08570 9634 9278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548427.1 protein_id gnl|my_center|LOCUS_08570 10077 9646 gene locus_tag LOCUS_08580 10077 9646 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548425.1 protein_id gnl|my_center|LOCUS_08580 10169 10912 gene locus_tag LOCUS_08590 10169 10912 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548423.1 protein_id gnl|my_center|LOCUS_08590 10905 12137 gene locus_tag LOCUS_08600 10905 12137 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613400.1 protein_id gnl|my_center|LOCUS_08600 12149 12805 gene locus_tag LOCUS_08610 gene trmB 12149 12805 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548419.1 protein_id gnl|my_center|LOCUS_08610 12871 13191 gene locus_tag LOCUS_08620 12871 13191 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254504.1 protein_id gnl|my_center|LOCUS_08620 13212 13859 gene locus_tag LOCUS_08630 13212 13859 CDS product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548415.1 protein_id gnl|my_center|LOCUS_08630 13974 14225 gene locus_tag LOCUS_08640 13974 14225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 14391 16292 gene locus_tag LOCUS_08650 14391 16292 CDS product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548886.1 protein_id gnl|my_center|LOCUS_08650 16344 17657 gene locus_tag LOCUS_08660 gene murC 16344 17657 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548413.1 protein_id gnl|my_center|LOCUS_08660 19106 17700 gene locus_tag LOCUS_08670 19106 17700 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548393.1 protein_id gnl|my_center|LOCUS_08670 20191 19214 gene locus_tag LOCUS_08680 20191 19214 CDS product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613398.1 protein_id gnl|my_center|LOCUS_08680 21594 20290 gene locus_tag LOCUS_08690 21594 20290 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548390.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence027 1538 591 gene locus_tag LOCUS_08700 gene phnD 1538 591 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254002.1 protein_id gnl|my_center|LOCUS_08700 3158 1764 gene locus_tag LOCUS_08710 gene dnaB 3158 1764 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549341.1 protein_id gnl|my_center|LOCUS_08710 3642 3187 gene locus_tag LOCUS_08720 gene rplI 3642 3187 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549343.1 protein_id gnl|my_center|LOCUS_08720 5678 3657 gene locus_tag LOCUS_08730 5678 3657 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549345.1 protein_id gnl|my_center|LOCUS_08730 6083 5847 gene locus_tag LOCUS_08740 gene rpsR 6083 5847 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549366.1 protein_id gnl|my_center|LOCUS_08740 6633 6112 gene locus_tag LOCUS_08750 gene ssb 6633 6112 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254001.1 protein_id gnl|my_center|LOCUS_08750 6975 6679 gene locus_tag LOCUS_08760 gene rpsF 6975 6679 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549370.1 protein_id gnl|my_center|LOCUS_08760 9659 7194 gene locus_tag LOCUS_08770 gene gyrA 9659 7194 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549372.1 protein_id gnl|my_center|LOCUS_08770 11634 9670 gene locus_tag LOCUS_08780 gene gyrB 11634 9670 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549374.1 protein_id gnl|my_center|LOCUS_08780 12762 11635 gene locus_tag LOCUS_08790 gene recF 12762 11635 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549377.1 protein_id gnl|my_center|LOCUS_08790 12986 12762 gene locus_tag LOCUS_08800 gene yaaA 12986 12762 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254000.1 protein_id gnl|my_center|LOCUS_08800 14348 13218 gene locus_tag LOCUS_08810 gene dnaN 14348 13218 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549381.1 protein_id gnl|my_center|LOCUS_08810 15892 14525 gene locus_tag LOCUS_08820 gene dnaA 15892 14525 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011253999.1 protein_id gnl|my_center|LOCUS_08820 16371 16511 gene locus_tag LOCUS_08830 gene rpmH 16371 16511 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549412.1 protein_id gnl|my_center|LOCUS_08830 16563 16931 gene locus_tag LOCUS_08840 gene rnpA 16563 16931 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549413.1 protein_id gnl|my_center|LOCUS_08840 16933 17808 gene locus_tag LOCUS_08850 16933 17808 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254638.1 protein_id gnl|my_center|LOCUS_08850 17919 19304 gene locus_tag LOCUS_08860 gene mnmE 17919 19304 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549418.1 protein_id gnl|my_center|LOCUS_08860 19313 21211 gene locus_tag LOCUS_08870 gene mnmG 19313 21211 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549419.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence028 38 457 gene locus_tag LOCUS_08880 38 457 CDS product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549202.1 protein_id gnl|my_center|LOCUS_08880 539 910 gene locus_tag LOCUS_08890 gene mscL 539 910 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254148.1 protein_id gnl|my_center|LOCUS_08890 1273 962 gene locus_tag LOCUS_08900 gene trxA 1273 962 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254147.1 protein_id gnl|my_center|LOCUS_08900 3711 1354 gene locus_tag LOCUS_08910 3711 1354 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549197.1 protein_id gnl|my_center|LOCUS_08910 4083 3772 gene locus_tag LOCUS_08920 4083 3772 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549194.1 protein_id gnl|my_center|LOCUS_08920 4481 4170 gene locus_tag LOCUS_08930 4481 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08930 4738 4481 gene locus_tag LOCUS_08940 4738 4481 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549189.1 protein_id gnl|my_center|LOCUS_08940 7438 4799 gene locus_tag LOCUS_08950 gene alaS 7438 4799 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549179.1 protein_id gnl|my_center|LOCUS_08950 9040 7679 gene locus_tag LOCUS_08960 9040 7679 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549176.1 protein_id gnl|my_center|LOCUS_08960 9989 9033 gene locus_tag LOCUS_08970 9989 9033 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254146.1 protein_id gnl|my_center|LOCUS_08970 11170 10049 gene locus_tag LOCUS_08980 gene dinB 11170 10049 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549172.1 protein_id gnl|my_center|LOCUS_08980 12614 11163 gene locus_tag LOCUS_08990 gene zwf 12614 11163 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549170.1 protein_id gnl|my_center|LOCUS_08990 13096 12722 gene locus_tag LOCUS_09000 gene yajC 13096 12722 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613305.1 protein_id gnl|my_center|LOCUS_09000 14177 13161 gene locus_tag LOCUS_09010 gene ruvB 14177 13161 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549167.1 protein_id gnl|my_center|LOCUS_09010 14816 14229 gene locus_tag LOCUS_09020 gene ruvA 14816 14229 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549165.1 protein_id gnl|my_center|LOCUS_09020 16699 14819 gene locus_tag LOCUS_09030 gene mutL 16699 14819 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549162.1 protein_id gnl|my_center|LOCUS_09030 19302 16702 gene locus_tag LOCUS_09040 gene mutS 19302 16702 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254144.1 protein_id gnl|my_center|LOCUS_09040 21112 19481 gene locus_tag LOCUS_09050 gene groL 21112 19481 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549158.1 protein_id gnl|my_center|LOCUS_09050 21418 21134 gene locus_tag LOCUS_09060 gene groES 21418 21134 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549156.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence029 97 432 gene locus_tag LOCUS_09070 97 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1650 616 gene locus_tag LOCUS_09080 1650 616 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547468.1 protein_id gnl|my_center|LOCUS_09080 1843 2496 gene locus_tag LOCUS_09090 1843 2496 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642467.1 protein_id gnl|my_center|LOCUS_09090 2684 2848 gene locus_tag LOCUS_09100 2684 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 4112 2850 gene locus_tag LOCUS_09110 4112 2850 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101454.1 protein_id gnl|my_center|LOCUS_09110 4295 5554 gene locus_tag LOCUS_09120 4295 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 5591 6364 gene locus_tag LOCUS_09130 gene proC 5591 6364 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025006378.1 protein_id gnl|my_center|LOCUS_09130 6878 6417 gene locus_tag LOCUS_09140 6878 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09140 8800 7430 gene locus_tag LOCUS_09150 8800 7430 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547458.1 protein_id gnl|my_center|LOCUS_09150 9277 8891 gene locus_tag LOCUS_09160 9277 8891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 9449 9216 gene locus_tag LOCUS_09170 9449 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 10220 9636 gene locus_tag LOCUS_09180 10220 9636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 10732 10505 gene locus_tag LOCUS_09190 10732 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 12248 10869 gene locus_tag LOCUS_09200 gene brnQ 12248 10869 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254324.1 protein_id gnl|my_center|LOCUS_09200 15132 12628 gene locus_tag LOCUS_09210 15132 12628 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254312.1 protein_id gnl|my_center|LOCUS_09210 15277 18015 gene locus_tag LOCUS_09220 gene ppc 15277 18015 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254335.1 protein_id gnl|my_center|LOCUS_09220 18323 19648 gene locus_tag LOCUS_09230 18323 19648 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547412.1 protein_id gnl|my_center|LOCUS_09230 20107 19697 gene locus_tag LOCUS_09240 20107 19697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548704.1 protein_id gnl|my_center|LOCUS_09240 20721 20119 gene locus_tag LOCUS_09250 20721 20119 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547397.1 protein_id gnl|my_center|LOCUS_09250 <21308 20775 gene locus_tag LOCUS_09260 <21308 20775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101592.1:DHA2 family efflux MFS transporter permease subunit >Feature sequence030 242 982 gene locus_tag LOCUS_09270 242 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 966 1361 gene locus_tag LOCUS_09280 966 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1358 2602 gene locus_tag LOCUS_09290 1358 2602 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_09290 2609 4042 gene locus_tag LOCUS_09300 2609 4042 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989955.1 protein_id gnl|my_center|LOCUS_09300 4046 4849 gene locus_tag LOCUS_09310 4046 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 5264 5788 gene locus_tag LOCUS_09320 5264 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 5818 6978 gene locus_tag LOCUS_09330 5818 6978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 6995 7366 gene locus_tag LOCUS_09340 6995 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 7371 7838 gene locus_tag LOCUS_09350 7371 7838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 7838 8197 gene locus_tag LOCUS_09360 7838 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 8190 8597 gene locus_tag LOCUS_09370 8190 8597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 8613 9176 gene locus_tag LOCUS_09380 8613 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 9180 9572 gene locus_tag LOCUS_09390 9180 9572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 9838 11205 gene locus_tag LOCUS_09400 9838 11205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 11208 11879 gene locus_tag LOCUS_09410 11208 11879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 11821 12015 gene locus_tag LOCUS_09420 11821 12015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 12015 13142 gene locus_tag LOCUS_09430 12015 13142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 13142 13708 gene locus_tag LOCUS_09440 13142 13708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 13740 14954 gene locus_tag LOCUS_09450 13740 14954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 14951 15418 gene locus_tag LOCUS_09460 14951 15418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 15432 15896 gene locus_tag LOCUS_09470 15432 15896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 15985 16671 gene locus_tag LOCUS_09480 15985 16671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 16723 16887 gene locus_tag LOCUS_09490 16723 16887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 16898 17338 gene locus_tag LOCUS_09500 16898 17338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 17342 18397 gene locus_tag LOCUS_09510 17342 18397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 18408 18827 gene locus_tag LOCUS_09520 18408 18827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 18836 19204 gene locus_tag LOCUS_09530 18836 19204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 19267 19530 gene locus_tag LOCUS_09540 19267 19530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 19631 19927 gene locus_tag LOCUS_09550 19631 19927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence031 967 203 gene locus_tag LOCUS_09560 967 203 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546400.1 protein_id gnl|my_center|LOCUS_09560 1261 3660 gene locus_tag LOCUS_09570 1261 3660 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254199.1 protein_id gnl|my_center|LOCUS_09570 3761 4576 gene locus_tag LOCUS_09580 3761 4576 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 protein_id gnl|my_center|LOCUS_09580 5708 7588 gene locus_tag LOCUS_09590 5708 7588 CDS product alpha-glucoside-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546418.1 protein_id gnl|my_center|LOCUS_09590 7649 8458 gene locus_tag LOCUS_09600 7649 8458 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254203.1 protein_id gnl|my_center|LOCUS_09600 8445 8942 gene locus_tag LOCUS_09610 8445 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254204.1 protein_id gnl|my_center|LOCUS_09610 8963 9448 gene locus_tag LOCUS_09620 8963 9448 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546424.1 protein_id gnl|my_center|LOCUS_09620 9593 9853 gene locus_tag LOCUS_09630 9593 9853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546427.1 protein_id gnl|my_center|LOCUS_09630 9892 10548 gene locus_tag LOCUS_09640 9892 10548 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546429.1 protein_id gnl|my_center|LOCUS_09640 10760 12001 gene locus_tag LOCUS_09650 10760 12001 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546431.1 protein_id gnl|my_center|LOCUS_09650 12106 12675 gene locus_tag LOCUS_09660 gene hpt 12106 12675 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254205.1 protein_id gnl|my_center|LOCUS_09660 14028 12724 gene locus_tag LOCUS_09670 14028 12724 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254206.1 protein_id gnl|my_center|LOCUS_09670 14136 14843 gene locus_tag LOCUS_09680 14136 14843 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546437.1 protein_id gnl|my_center|LOCUS_09680 14843 16084 gene locus_tag LOCUS_09690 14843 16084 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546440.1 protein_id gnl|my_center|LOCUS_09690 16081 17409 gene locus_tag LOCUS_09700 16081 17409 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546442.1 protein_id gnl|my_center|LOCUS_09700 17466 17541 gene locus_tag LOCUS_t00160 17466 17541 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 17767 17579 gene locus_tag LOCUS_09710 17767 17579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 17880 19022 gene locus_tag LOCUS_09720 gene wecB 17880 19022 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254207.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence032 667 3354 gene locus_tag LOCUS_09730 gene mgtA 667 3354 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548873.1 protein_id gnl|my_center|LOCUS_09730 3355 3672 gene locus_tag LOCUS_09740 3355 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 3772 4944 gene locus_tag LOCUS_09750 3772 4944 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475674.1 protein_id gnl|my_center|LOCUS_09750 5204 5731 gene locus_tag LOCUS_09760 5204 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 5963 7315 gene locus_tag LOCUS_09770 5963 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09770 7483 7779 gene locus_tag LOCUS_09780 7483 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 7947 8207 gene locus_tag LOCUS_09790 7947 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 8401 9441 gene locus_tag LOCUS_09800 8401 9441 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546242.1 protein_id gnl|my_center|LOCUS_09800 9741 11246 gene locus_tag LOCUS_09810 9741 11246 CDS product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546245.1 protein_id gnl|my_center|LOCUS_09810 12653 11367 gene locus_tag LOCUS_09820 gene eno 12653 11367 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101591.1 protein_id gnl|my_center|LOCUS_09820 13245 12883 gene locus_tag LOCUS_09830 13245 12883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566163.1 protein_id gnl|my_center|LOCUS_09830 14284 13238 gene locus_tag LOCUS_09840 14284 13238 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065904166.1 protein_id gnl|my_center|LOCUS_09840 14911 15309 gene locus_tag LOCUS_09850 14911 15309 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546185.1 protein_id gnl|my_center|LOCUS_09850 16054 16135 gene locus_tag LOCUS_t00170 16054 16135 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 16169 16242 gene locus_tag LOCUS_t00180 16169 16242 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 16430 17590 gene locus_tag LOCUS_09860 16430 17590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence033 1174 131 gene locus_tag LOCUS_09870 1174 131 CDS product FMN-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254509.1 protein_id gnl|my_center|LOCUS_09870 1367 2119 gene locus_tag LOCUS_09880 1367 2119 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254508.1 protein_id gnl|my_center|LOCUS_09880 3178 2171 gene locus_tag LOCUS_09890 3178 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09890 3510 3184 gene locus_tag LOCUS_09900 3510 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09900 3774 5201 gene locus_tag LOCUS_09910 3774 5201 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254081.1 protein_id gnl|my_center|LOCUS_09910 5596 5267 gene locus_tag LOCUS_09920 5596 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 6324 5842 gene locus_tag LOCUS_09930 6324 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 6761 7027 gene locus_tag LOCUS_09940 6761 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 7402 8511 gene locus_tag LOCUS_09950 7402 8511 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254598.1 protein_id gnl|my_center|LOCUS_09950 9895 8591 gene locus_tag LOCUS_09960 gene celB 9895 8591 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384702.1 protein_id gnl|my_center|LOCUS_09960 10070 10837 gene locus_tag LOCUS_09970 10070 10837 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254082.1 protein_id gnl|my_center|LOCUS_09970 11075 10887 gene locus_tag LOCUS_09980 11075 10887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 11404 11072 gene locus_tag LOCUS_09990 11404 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 11736 12221 gene locus_tag LOCUS_10000 11736 12221 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476576.1 protein_id gnl|my_center|LOCUS_10000 13903 12527 gene locus_tag LOCUS_10010 13903 12527 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 protein_id gnl|my_center|LOCUS_10010 14682 14041 gene locus_tag LOCUS_10020 14682 14041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 15589 14816 gene locus_tag LOCUS_10030 15589 14816 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254200.1 protein_id gnl|my_center|LOCUS_10030 17031 15586 gene locus_tag LOCUS_10040 17031 15586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 17312 17034 gene locus_tag LOCUS_10050 17312 17034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence034 298 32 gene locus_tag LOCUS_10060 298 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 845 312 gene locus_tag LOCUS_10070 845 312 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546623.1 protein_id gnl|my_center|LOCUS_10070 943 1839 gene locus_tag LOCUS_10080 gene murB 943 1839 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546624.1 protein_id gnl|my_center|LOCUS_10080 1889 2998 gene locus_tag LOCUS_10090 1889 2998 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546625.1 protein_id gnl|my_center|LOCUS_10090 2988 3800 gene locus_tag LOCUS_10100 2988 3800 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546626.1 protein_id gnl|my_center|LOCUS_10100 3797 4612 gene locus_tag LOCUS_10110 3797 4612 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254228.1 protein_id gnl|my_center|LOCUS_10110 4609 5682 gene locus_tag LOCUS_10120 4609 5682 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546630.1 protein_id gnl|my_center|LOCUS_10120 5721 6563 gene locus_tag LOCUS_10130 gene cdaA 5721 6563 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254229.1 protein_id gnl|my_center|LOCUS_10130 6560 7519 gene locus_tag LOCUS_10140 6560 7519 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546633.1 protein_id gnl|my_center|LOCUS_10140 7548 8903 gene locus_tag LOCUS_10150 gene glmM 7548 8903 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546635.1 protein_id gnl|my_center|LOCUS_10150 9002 9817 gene locus_tag LOCUS_10160 9002 9817 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546636.1 protein_id gnl|my_center|LOCUS_10160 9835 10641 gene locus_tag LOCUS_10170 9835 10641 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546639.1 protein_id gnl|my_center|LOCUS_10170 10662 11384 gene locus_tag LOCUS_10180 10662 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546642.1 protein_id gnl|my_center|LOCUS_10180 11381 11842 gene locus_tag LOCUS_10190 11381 11842 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_10190 12999 11866 gene locus_tag LOCUS_10200 12999 11866 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546645.1 protein_id gnl|my_center|LOCUS_10200 13220 13585 gene locus_tag LOCUS_10210 13220 13585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10210 13641 14030 gene locus_tag LOCUS_10220 13641 14030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10220 14061 14297 gene locus_tag LOCUS_10230 14061 14297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 14320 14616 gene locus_tag LOCUS_10240 14320 14616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10240 14613 15149 gene locus_tag LOCUS_10250 14613 15149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10250 15136 15282 gene locus_tag LOCUS_10260 15136 15282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10260 15365 16840 gene locus_tag LOCUS_10270 15365 16840 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546652.1 protein_id gnl|my_center|LOCUS_10270 16979 17410 gene locus_tag LOCUS_10280 16979 17410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 >Feature sequence035 1127 132 gene locus_tag LOCUS_10290 gene mmuM 1127 132 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547183.1 protein_id gnl|my_center|LOCUS_10290 1722 1270 gene locus_tag LOCUS_10300 1722 1270 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547179.1 protein_id gnl|my_center|LOCUS_10300 3581 1815 gene locus_tag LOCUS_10310 gene recQ 3581 1815 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547178.1 protein_id gnl|my_center|LOCUS_10310 3693 5033 gene locus_tag LOCUS_10320 3693 5033 CDS product Trk family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254311.1 protein_id gnl|my_center|LOCUS_10320 5026 5697 gene locus_tag LOCUS_10330 5026 5697 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547171.1 protein_id gnl|my_center|LOCUS_10330 7066 5804 gene locus_tag LOCUS_10340 7066 5804 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547168.1 protein_id gnl|my_center|LOCUS_10340 9178 7085 gene locus_tag LOCUS_10350 9178 7085 CDS product putative ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547166.1 protein_id gnl|my_center|LOCUS_10350 9416 10888 gene locus_tag LOCUS_10360 9416 10888 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254310.1 protein_id gnl|my_center|LOCUS_10360 11320 10958 gene locus_tag LOCUS_10370 11320 10958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 11553 11356 gene locus_tag LOCUS_10380 11553 11356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 11732 11565 gene locus_tag LOCUS_10390 11732 11565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 12605 12117 gene locus_tag LOCUS_10400 12605 12117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547433.1 protein_id gnl|my_center|LOCUS_10400 12784 14184 gene locus_tag LOCUS_10410 gene pepV 12784 14184 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547162.1 protein_id gnl|my_center|LOCUS_10410 14603 14226 gene locus_tag LOCUS_10420 gene crcB 14603 14226 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547161.1 protein_id gnl|my_center|LOCUS_10420 14994 14605 gene locus_tag LOCUS_10430 14994 14605 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254309.1 protein_id gnl|my_center|LOCUS_10430 15199 16008 gene locus_tag LOCUS_10440 15199 16008 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547157.1 protein_id gnl|my_center|LOCUS_10440 16908 16051 gene locus_tag LOCUS_10450 16908 16051 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547155.1 protein_id gnl|my_center|LOCUS_10450 17177 16905 gene locus_tag LOCUS_10460 17177 16905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence036 2044 680 gene locus_tag LOCUS_10470 2044 680 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254451.1 protein_id gnl|my_center|LOCUS_10470 2975 2337 gene locus_tag LOCUS_10480 2975 2337 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029779742.1 protein_id gnl|my_center|LOCUS_10480 3315 4856 gene locus_tag LOCUS_10490 3315 4856 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948261.1 protein_id gnl|my_center|LOCUS_10490 5340 4915 gene locus_tag LOCUS_10500 5340 4915 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254453.1 protein_id gnl|my_center|LOCUS_10500 6326 5376 gene locus_tag LOCUS_10510 6326 5376 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804173.1 protein_id gnl|my_center|LOCUS_10510 7737 6472 gene locus_tag LOCUS_10520 7737 6472 CDS product AbiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248015.1 protein_id gnl|my_center|LOCUS_10520 9201 7747 gene locus_tag LOCUS_10530 9201 7747 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680807.1 protein_id gnl|my_center|LOCUS_10530 10645 9191 gene locus_tag LOCUS_10540 10645 9191 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122925.1 protein_id gnl|my_center|LOCUS_10540 12115 10661 gene locus_tag LOCUS_10550 12115 10661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10550 13874 12078 gene locus_tag LOCUS_10560 13874 12078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10560 14505 14002 gene locus_tag LOCUS_10570 14505 14002 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254521.1 protein_id gnl|my_center|LOCUS_10570 14682 15767 gene locus_tag LOCUS_10580 14682 15767 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549489.1 protein_id gnl|my_center|LOCUS_10580 >Feature sequence037 387 1145 gene locus_tag LOCUS_10590 387 1145 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549794.1 protein_id gnl|my_center|LOCUS_10590 1147 2061 gene locus_tag LOCUS_10600 gene pfkB 1147 2061 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549796.1 protein_id gnl|my_center|LOCUS_10600 2085 4088 gene locus_tag LOCUS_10610 2085 4088 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549797.1 protein_id gnl|my_center|LOCUS_10610 4716 4303 gene locus_tag LOCUS_10620 4716 4303 CDS product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549798.1 protein_id gnl|my_center|LOCUS_10620 5156 4713 gene locus_tag LOCUS_10630 5156 4713 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549799.1 protein_id gnl|my_center|LOCUS_10630 5298 5576 gene locus_tag LOCUS_10640 5298 5576 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549800.1 protein_id gnl|my_center|LOCUS_10640 5817 6707 gene locus_tag LOCUS_10650 5817 6707 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254571.1 protein_id gnl|my_center|LOCUS_10650 6742 7389 gene locus_tag LOCUS_10660 6742 7389 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254570.1 protein_id gnl|my_center|LOCUS_10660 7386 8183 gene locus_tag LOCUS_10670 7386 8183 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613417.1 protein_id gnl|my_center|LOCUS_10670 8284 8577 gene locus_tag LOCUS_10680 8284 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 8645 9250 gene locus_tag LOCUS_10690 8645 9250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 9684 9319 gene locus_tag LOCUS_10700 9684 9319 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254569.1 protein_id gnl|my_center|LOCUS_10700 10037 11551 gene locus_tag LOCUS_10710 10037 11551 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549809.1 protein_id gnl|my_center|LOCUS_10710 11624 12454 gene locus_tag LOCUS_10720 11624 12454 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254183.1 protein_id gnl|my_center|LOCUS_10720 12619 12951 gene locus_tag LOCUS_10730 12619 12951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 14801 13005 gene locus_tag LOCUS_10740 gene pepF 14801 13005 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549813.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence038 1876 1280 gene locus_tag LOCUS_10750 gene purN 1876 1280 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548358.1 protein_id gnl|my_center|LOCUS_10750 2854 1886 gene locus_tag LOCUS_10760 gene purM 2854 1886 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254495.1 protein_id gnl|my_center|LOCUS_10760 4350 2872 gene locus_tag LOCUS_10770 gene purF 4350 2872 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548364.1 protein_id gnl|my_center|LOCUS_10770 6554 4326 gene locus_tag LOCUS_10780 gene purL 6554 4326 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548366.1 protein_id gnl|my_center|LOCUS_10780 7222 6551 gene locus_tag LOCUS_10790 gene purQ 7222 6551 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548368.1 protein_id gnl|my_center|LOCUS_10790 7473 7219 gene locus_tag LOCUS_10800 gene purS 7473 7219 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548369.1 protein_id gnl|my_center|LOCUS_10800 8190 7474 gene locus_tag LOCUS_10810 8190 7474 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548371.1 protein_id gnl|my_center|LOCUS_10810 9543 8395 gene locus_tag LOCUS_10820 gene purK 9543 8395 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254497.1 protein_id gnl|my_center|LOCUS_10820 10021 9536 gene locus_tag LOCUS_10830 gene purE 10021 9536 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548377.1 protein_id gnl|my_center|LOCUS_10830 11693 10032 gene locus_tag LOCUS_10840 11693 10032 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548380.1 protein_id gnl|my_center|LOCUS_10840 12795 11914 gene locus_tag LOCUS_10850 12795 11914 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548384.1 protein_id gnl|my_center|LOCUS_10850 13127 12813 gene locus_tag LOCUS_10860 13127 12813 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254498.1 protein_id gnl|my_center|LOCUS_10860 14499 13522 gene locus_tag LOCUS_10870 14499 13522 CDS product class III bacteriocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548389.1 protein_id gnl|my_center|LOCUS_10870 14633 14845 gene locus_tag LOCUS_10880 14633 14845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence039 1084 5 gene locus_tag LOCUS_10890 1084 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 2454 1423 gene locus_tag LOCUS_10900 2454 1423 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550081.1 protein_id gnl|my_center|LOCUS_10900 5460 2572 gene locus_tag LOCUS_10910 5460 2572 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254525.1 protein_id gnl|my_center|LOCUS_10910 6223 5393 gene locus_tag LOCUS_10920 6223 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 6803 6228 gene locus_tag LOCUS_10930 6803 6228 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254526.1 protein_id gnl|my_center|LOCUS_10930 7873 6926 gene locus_tag LOCUS_10940 7873 6926 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254527.1 protein_id gnl|my_center|LOCUS_10940 8806 7889 gene locus_tag LOCUS_10950 8806 7889 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721382.1 protein_id gnl|my_center|LOCUS_10950 10214 8910 gene locus_tag LOCUS_10960 10214 8910 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550069.1 protein_id gnl|my_center|LOCUS_10960 11563 10268 gene locus_tag LOCUS_10970 11563 10268 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550067.1 protein_id gnl|my_center|LOCUS_10970 12371 11547 gene locus_tag LOCUS_10980 12371 11547 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254529.1 protein_id gnl|my_center|LOCUS_10980 13241 12375 gene locus_tag LOCUS_10990 13241 12375 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550063.1 protein_id gnl|my_center|LOCUS_10990 14326 13241 gene locus_tag LOCUS_11000 14326 13241 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254531.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence040 1941 583 gene locus_tag LOCUS_11010 1941 583 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549632.1 protein_id gnl|my_center|LOCUS_11010 3247 2021 gene locus_tag LOCUS_11020 3247 2021 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549630.1 protein_id gnl|my_center|LOCUS_11020 4442 3336 gene locus_tag LOCUS_11030 4442 3336 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549629.1 protein_id gnl|my_center|LOCUS_11030 5130 4465 gene locus_tag LOCUS_11040 gene pgmB 5130 4465 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549628.1 protein_id gnl|my_center|LOCUS_11040 7387 5123 gene locus_tag LOCUS_11050 7387 5123 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549627.1 protein_id gnl|my_center|LOCUS_11050 9285 7564 gene locus_tag LOCUS_11060 9285 7564 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549626.1 protein_id gnl|my_center|LOCUS_11060 10947 9289 gene locus_tag LOCUS_11070 10947 9289 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254601.1 protein_id gnl|my_center|LOCUS_11070 12252 11074 gene locus_tag LOCUS_11080 12252 11074 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254602.1 protein_id gnl|my_center|LOCUS_11080 13337 12387 gene locus_tag LOCUS_11090 13337 12387 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549622.1 protein_id gnl|my_center|LOCUS_11090 <13996 13345 gene locus_tag LOCUS_11100 <13996 13345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549621.1:tyrosine-protein phosphatase >Feature sequence041 337 26 gene locus_tag LOCUS_11110 337 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 621 292 gene locus_tag LOCUS_11120 621 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1788 796 gene locus_tag LOCUS_11130 gene galE 1788 796 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548187.1 protein_id gnl|my_center|LOCUS_11130 2841 1891 gene locus_tag LOCUS_11140 2841 1891 CDS product beta-galactosidase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254473.1 protein_id gnl|my_center|LOCUS_11140 4705 2825 gene locus_tag LOCUS_11150 4705 2825 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548184.1 protein_id gnl|my_center|LOCUS_11150 4930 5937 gene locus_tag LOCUS_11160 4930 5937 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548182.1 protein_id gnl|my_center|LOCUS_11160 6131 8050 gene locus_tag LOCUS_11170 6131 8050 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254471.1 protein_id gnl|my_center|LOCUS_11170 8061 10067 gene locus_tag LOCUS_11180 8061 10067 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254470.1 protein_id gnl|my_center|LOCUS_11180 10593 11237 gene locus_tag LOCUS_11190 10593 11237 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702509.1 protein_id gnl|my_center|LOCUS_11190 11549 13174 gene locus_tag LOCUS_11200 11549 13174 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154881464.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence042 136 62 gene locus_tag LOCUS_t00190 136 62 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 471 250 gene locus_tag LOCUS_11210 471 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 665 591 gene locus_tag LOCUS_t00200 665 591 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 800 1516 gene locus_tag LOCUS_11220 gene yycF 800 1516 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548578.1 protein_id gnl|my_center|LOCUS_11220 1654 3435 gene locus_tag LOCUS_11230 gene walK 1654 3435 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254027.1 protein_id gnl|my_center|LOCUS_11230 3425 4780 gene locus_tag LOCUS_11240 3425 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548582.1 protein_id gnl|my_center|LOCUS_11240 4785 5609 gene locus_tag LOCUS_11250 4785 5609 CDS product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548584.1 protein_id gnl|my_center|LOCUS_11250 5619 6416 gene locus_tag LOCUS_11260 5619 6416 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254029.1 protein_id gnl|my_center|LOCUS_11260 6497 7741 gene locus_tag LOCUS_11270 6497 7741 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613276.1 protein_id gnl|my_center|LOCUS_11270 8201 8686 gene locus_tag LOCUS_11280 gene rlmH 8201 8686 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548590.1 protein_id gnl|my_center|LOCUS_11280 8773 9387 gene locus_tag LOCUS_11290 8773 9387 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254380.1 protein_id gnl|my_center|LOCUS_11290 10302 9421 gene locus_tag LOCUS_11300 10302 9421 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548604.1 protein_id gnl|my_center|LOCUS_11300 10964 10311 gene locus_tag LOCUS_11310 10964 10311 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548607.1 protein_id gnl|my_center|LOCUS_11310 12220 10967 gene locus_tag LOCUS_11320 12220 10967 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548609.1 protein_id gnl|my_center|LOCUS_11320 12475 13422 gene locus_tag LOCUS_11330 12475 13422 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548611.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence043 402 19 gene locus_tag LOCUS_11340 402 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 752 2026 gene locus_tag LOCUS_11350 752 2026 CDS product ISL3-like element ISP1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101247.1 protein_id gnl|my_center|LOCUS_11350 3023 2082 gene locus_tag LOCUS_11360 gene ppx 3023 2082 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641094.1 protein_id gnl|my_center|LOCUS_11360 4423 3020 gene locus_tag LOCUS_11370 4423 3020 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641832.1 protein_id gnl|my_center|LOCUS_11370 6608 4416 gene locus_tag LOCUS_11380 6608 4416 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641095.1 protein_id gnl|my_center|LOCUS_11380 8125 6605 gene locus_tag LOCUS_11390 8125 6605 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641096.1 protein_id gnl|my_center|LOCUS_11390 8628 8380 gene locus_tag LOCUS_11400 8628 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 8979 8740 gene locus_tag LOCUS_11410 8979 8740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 9332 9066 gene locus_tag LOCUS_11420 9332 9066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 10069 9536 gene locus_tag LOCUS_11430 gene hpt 10069 9536 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705261.1 protein_id gnl|my_center|LOCUS_11430 10478 10257 gene locus_tag LOCUS_11440 10478 10257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 10997 10575 gene locus_tag LOCUS_11450 10997 10575 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476578.1 protein_id gnl|my_center|LOCUS_11450 11332 11000 gene locus_tag LOCUS_11460 11332 11000 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355924.1 protein_id gnl|my_center|LOCUS_11460 11468 12247 gene locus_tag LOCUS_11470 11468 12247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548077.1 protein_id gnl|my_center|LOCUS_11470 12796 13407 gene locus_tag LOCUS_11480 12796 13407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11480 >Feature sequence044 1030 170 gene locus_tag LOCUS_11490 1030 170 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613346.1 protein_id gnl|my_center|LOCUS_11490 1164 1652 gene locus_tag LOCUS_11500 1164 1652 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546951.1 protein_id gnl|my_center|LOCUS_11500 1730 2353 gene locus_tag LOCUS_11510 1730 2353 CDS product DUF4767 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254283.1 protein_id gnl|my_center|LOCUS_11510 3715 2429 gene locus_tag LOCUS_11520 gene eno 3715 2429 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546959.1 protein_id gnl|my_center|LOCUS_11520 3942 4775 gene locus_tag LOCUS_11530 3942 4775 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546960.1 protein_id gnl|my_center|LOCUS_11530 5403 4828 gene locus_tag LOCUS_11540 5403 4828 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546962.1 protein_id gnl|my_center|LOCUS_11540 6484 5507 gene locus_tag LOCUS_11550 gene bsh 6484 5507 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546965.1 protein_id gnl|my_center|LOCUS_11550 6614 6702 gene locus_tag LOCUS_t00210 6614 6702 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6837 8225 gene locus_tag LOCUS_11560 6837 8225 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546978.1 protein_id gnl|my_center|LOCUS_11560 8353 9309 gene locus_tag LOCUS_11570 8353 9309 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546979.1 protein_id gnl|my_center|LOCUS_11570 9318 9824 gene locus_tag LOCUS_11580 9318 9824 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546982.1 protein_id gnl|my_center|LOCUS_11580 9906 12323 gene locus_tag LOCUS_11590 9906 12323 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546985.1 protein_id gnl|my_center|LOCUS_11590 12459 12689 gene locus_tag LOCUS_11600 12459 12689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence045 54 377 gene locus_tag LOCUS_11610 54 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 398 1336 gene locus_tag LOCUS_11620 398 1336 CDS product class III bacteriocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548389.1 protein_id gnl|my_center|LOCUS_11620 1422 2333 gene locus_tag LOCUS_11630 1422 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 2465 2959 gene locus_tag LOCUS_11640 2465 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 3681 2998 gene locus_tag LOCUS_11650 3681 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 3873 4433 gene locus_tag LOCUS_11660 3873 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 4430 4780 gene locus_tag LOCUS_11670 4430 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 6314 4821 gene locus_tag LOCUS_11680 6314 4821 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547799.1 protein_id gnl|my_center|LOCUS_11680 6889 6593 gene locus_tag LOCUS_11690 6889 6593 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965233.1 protein_id gnl|my_center|LOCUS_11690 7397 7002 gene locus_tag LOCUS_11700 7397 7002 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034532906.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11700 8142 7417 gene locus_tag LOCUS_11710 gene cofE 8142 7417 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921993.1 protein_id gnl|my_center|LOCUS_11710 8982 8359 gene locus_tag LOCUS_11720 8982 8359 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476045.1 protein_id gnl|my_center|LOCUS_11720 9746 8985 gene locus_tag LOCUS_11730 9746 8985 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547367.1 protein_id gnl|my_center|LOCUS_11730 10169 9762 gene locus_tag LOCUS_11740 10169 9762 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948047.1 protein_id gnl|my_center|LOCUS_11740 11036 10173 gene locus_tag LOCUS_11750 11036 10173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 12615 12028 gene locus_tag LOCUS_11760 12615 12028 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222018.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence046 875 69 gene locus_tag LOCUS_11770 875 69 CDS product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254274.1 protein_id gnl|my_center|LOCUS_11770 2380 878 gene locus_tag LOCUS_11780 gene glpK 2380 878 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549614.1 protein_id gnl|my_center|LOCUS_11780 2504 3322 gene locus_tag LOCUS_11790 gene thiD 2504 3322 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549612.1 protein_id gnl|my_center|LOCUS_11790 3939 3379 gene locus_tag LOCUS_11800 3939 3379 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254622.1 protein_id gnl|my_center|LOCUS_11800 4207 5508 gene locus_tag LOCUS_11810 4207 5508 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721673.1 protein_id gnl|my_center|LOCUS_11810 5508 6278 gene locus_tag LOCUS_11820 5508 6278 CDS product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100999.1 protein_id gnl|my_center|LOCUS_11820 6301 6519 gene locus_tag LOCUS_11830 6301 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548950.1 protein_id gnl|my_center|LOCUS_11830 6543 6746 gene locus_tag LOCUS_11840 6543 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 7137 6853 gene locus_tag LOCUS_11850 7137 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 7433 7239 gene locus_tag LOCUS_11860 7433 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 8410 7514 gene locus_tag LOCUS_11870 8410 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 8614 9300 gene locus_tag LOCUS_11880 8614 9300 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549605.1 protein_id gnl|my_center|LOCUS_11880 9847 9362 gene locus_tag LOCUS_11890 9847 9362 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254605.1 protein_id gnl|my_center|LOCUS_11890 10345 10169 gene locus_tag LOCUS_11900 10345 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 11368 10448 gene locus_tag LOCUS_11910 11368 10448 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549601.1 protein_id gnl|my_center|LOCUS_11910 12281 11361 gene locus_tag LOCUS_11920 12281 11361 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549600.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence047 179 388 gene locus_tag LOCUS_11930 179 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 848 393 gene locus_tag LOCUS_11940 848 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1075 1788 gene locus_tag LOCUS_11950 1075 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1895 2386 gene locus_tag LOCUS_11960 1895 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 2379 2957 gene locus_tag LOCUS_11970 2379 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 2950 3321 gene locus_tag LOCUS_11980 2950 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 3728 3892 gene locus_tag LOCUS_11990 3728 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 3889 4071 gene locus_tag LOCUS_12000 3889 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 4058 4210 gene locus_tag LOCUS_12010 4058 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 4285 4473 gene locus_tag LOCUS_12020 4285 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 4476 4763 gene locus_tag LOCUS_12030 4476 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 4763 5572 gene locus_tag LOCUS_12040 4763 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 5582 6283 gene locus_tag LOCUS_12050 5582 6283 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704952.1 protein_id gnl|my_center|LOCUS_12050 6298 6477 gene locus_tag LOCUS_12060 6298 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 6499 6942 gene locus_tag LOCUS_12070 6499 6942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 6944 7303 gene locus_tag LOCUS_12080 6944 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 7300 7503 gene locus_tag LOCUS_12090 7300 7503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 7505 8905 gene locus_tag LOCUS_12100 7505 8905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 8985 9287 gene locus_tag LOCUS_12110 8985 9287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 9289 9603 gene locus_tag LOCUS_12120 9289 9603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 9607 9816 gene locus_tag LOCUS_12130 9607 9816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 9842 10021 gene locus_tag LOCUS_12140 9842 10021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 10179 10673 gene locus_tag LOCUS_12150 10179 10673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence048 504 1358 gene locus_tag LOCUS_12160 504 1358 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254284.1 protein_id gnl|my_center|LOCUS_12160 1370 2431 gene locus_tag LOCUS_12170 1370 2431 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546989.1 protein_id gnl|my_center|LOCUS_12170 2424 3125 gene locus_tag LOCUS_12180 2424 3125 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254285.1 protein_id gnl|my_center|LOCUS_12180 3256 4659 gene locus_tag LOCUS_12190 3256 4659 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546995.1 protein_id gnl|my_center|LOCUS_12190 4754 6031 gene locus_tag LOCUS_12200 4754 6031 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546997.1 protein_id gnl|my_center|LOCUS_12200 6195 7121 gene locus_tag LOCUS_12210 6195 7121 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547001.1 protein_id gnl|my_center|LOCUS_12210 7247 8563 gene locus_tag LOCUS_12220 7247 8563 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547002.1 protein_id gnl|my_center|LOCUS_12220 8834 9271 gene locus_tag LOCUS_12230 8834 9271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12230 9290 9484 gene locus_tag LOCUS_12240 9290 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12240 9544 10335 gene locus_tag LOCUS_12250 9544 10335 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547007.1 protein_id gnl|my_center|LOCUS_12250 10578 10826 gene locus_tag LOCUS_12260 10578 10826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12260 10823 10975 gene locus_tag LOCUS_12270 10823 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 11057 11692 gene locus_tag LOCUS_12280 11057 11692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12280 11914 12183 gene locus_tag LOCUS_12290 11914 12183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence049 492 253 gene locus_tag LOCUS_12300 492 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 720 496 gene locus_tag LOCUS_12310 720 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1218 1015 gene locus_tag LOCUS_12320 1218 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1517 1320 gene locus_tag LOCUS_12330 1517 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1769 1527 gene locus_tag LOCUS_12340 1769 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 2222 2010 gene locus_tag LOCUS_12350 2222 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 3055 2246 gene locus_tag LOCUS_12360 3055 2246 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721605.1 protein_id gnl|my_center|LOCUS_12360 4382 3039 gene locus_tag LOCUS_12370 4382 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 4523 4389 gene locus_tag LOCUS_12380 4523 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 4793 4647 gene locus_tag LOCUS_12390 4793 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 5099 4827 gene locus_tag LOCUS_12400 5099 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 5315 5142 gene locus_tag LOCUS_12410 5315 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 6657 5446 gene locus_tag LOCUS_12420 6657 5446 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549732.1 protein_id gnl|my_center|LOCUS_12420 6985 6818 gene locus_tag LOCUS_12430 6985 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 8314 7115 gene locus_tag LOCUS_12440 8314 7115 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549732.1 protein_id gnl|my_center|LOCUS_12440 8670 8452 gene locus_tag LOCUS_12450 8670 8452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 9093 8686 gene locus_tag LOCUS_12460 9093 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549784.1 protein_id gnl|my_center|LOCUS_12460 9448 9263 gene locus_tag LOCUS_12470 9448 9263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 11916 9613 gene locus_tag LOCUS_12480 11916 9613 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254583.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence050 1892 975 gene locus_tag LOCUS_12490 gene fba 1892 975 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254510.1 protein_id gnl|my_center|LOCUS_12490 3687 2002 gene locus_tag LOCUS_12500 gene argS 3687 2002 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548463.1 protein_id gnl|my_center|LOCUS_12500 4665 3991 gene locus_tag LOCUS_12510 4665 3991 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548465.1 protein_id gnl|my_center|LOCUS_12510 5646 4798 gene locus_tag LOCUS_12520 5646 4798 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254511.1 protein_id gnl|my_center|LOCUS_12520 6946 5648 gene locus_tag LOCUS_12530 6946 5648 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254512.1 protein_id gnl|my_center|LOCUS_12530 7034 7119 gene locus_tag LOCUS_t00220 7034 7119 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7280 7597 gene locus_tag LOCUS_12540 7280 7597 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548471.1 protein_id gnl|my_center|LOCUS_12540 7670 8374 gene locus_tag LOCUS_12550 7670 8374 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241747.1 protein_id gnl|my_center|LOCUS_12550 8493 9926 gene locus_tag LOCUS_12560 8493 9926 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241746.1 protein_id gnl|my_center|LOCUS_12560 9936 10481 gene locus_tag LOCUS_12570 9936 10481 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476384.1 protein_id gnl|my_center|LOCUS_12570 10997 10737 gene locus_tag LOCUS_12580 10997 10737 CDS product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548482.1 protein_id gnl|my_center|LOCUS_12580 11701 11102 gene locus_tag LOCUS_12590 11701 11102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 >Feature sequence051 213 554 gene locus_tag LOCUS_12600 213 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549279.1 protein_id gnl|my_center|LOCUS_12600 1975 641 gene locus_tag LOCUS_12610 1975 641 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613273.1 protein_id gnl|my_center|LOCUS_12610 2180 2362 gene locus_tag LOCUS_12620 2180 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 2976 2404 gene locus_tag LOCUS_12630 2976 2404 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549286.1 protein_id gnl|my_center|LOCUS_12630 4010 2973 gene locus_tag LOCUS_12640 4010 2973 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549287.1 protein_id gnl|my_center|LOCUS_12640 4269 6503 gene locus_tag LOCUS_12650 gene nrdJ 4269 6503 CDS product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549289.1 protein_id gnl|my_center|LOCUS_12650 6521 6919 gene locus_tag LOCUS_12660 6521 6919 CDS product DUF4430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567167.1 protein_id gnl|my_center|LOCUS_12660 6923 7447 gene locus_tag LOCUS_12670 6923 7447 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549293.1 protein_id gnl|my_center|LOCUS_12670 7447 8010 gene locus_tag LOCUS_12680 7447 8010 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254011.1 protein_id gnl|my_center|LOCUS_12680 8825 8028 gene locus_tag LOCUS_12690 8825 8028 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549297.1 protein_id gnl|my_center|LOCUS_12690 9482 8919 gene locus_tag LOCUS_12700 9482 8919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 10245 9505 gene locus_tag LOCUS_12710 10245 9505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12710 <11790 10435 gene locus_tag LOCUS_12720 <11790 10435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254010.1:C69 family dipeptidase >Feature sequence052 758 1135 gene locus_tag LOCUS_12730 758 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 1151 1420 gene locus_tag LOCUS_12740 1151 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 2343 1492 gene locus_tag LOCUS_12750 2343 1492 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674287.1 protein_id gnl|my_center|LOCUS_12750 2452 2877 gene locus_tag LOCUS_12760 2452 2877 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549209.1 protein_id gnl|my_center|LOCUS_12760 2895 3251 gene locus_tag LOCUS_12770 2895 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549212.1 protein_id gnl|my_center|LOCUS_12770 4406 3300 gene locus_tag LOCUS_12780 4406 3300 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549213.1 protein_id gnl|my_center|LOCUS_12780 4546 5553 gene locus_tag LOCUS_12790 4546 5553 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549214.1 protein_id gnl|my_center|LOCUS_12790 6978 5608 gene locus_tag LOCUS_12800 6978 5608 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549215.1 protein_id gnl|my_center|LOCUS_12800 7072 7392 gene locus_tag LOCUS_12810 7072 7392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613308.1 protein_id gnl|my_center|LOCUS_12810 7407 8783 gene locus_tag LOCUS_12820 7407 8783 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254152.1 protein_id gnl|my_center|LOCUS_12820 8784 9413 gene locus_tag LOCUS_12830 8784 9413 CDS product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549221.1 protein_id gnl|my_center|LOCUS_12830 9413 10183 gene locus_tag LOCUS_12840 9413 10183 CDS product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549224.1 protein_id gnl|my_center|LOCUS_12840 10180 10788 gene locus_tag LOCUS_12850 10180 10788 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254154.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence053 1556 294 gene locus_tag LOCUS_12860 gene tyrS 1556 294 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548823.1 protein_id gnl|my_center|LOCUS_12860 2910 1816 gene locus_tag LOCUS_12870 2910 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 5998 3008 gene locus_tag LOCUS_12880 5998 3008 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548819.1 protein_id gnl|my_center|LOCUS_12880 6657 6040 gene locus_tag LOCUS_12890 6657 6040 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548818.1 protein_id gnl|my_center|LOCUS_12890 7754 6657 gene locus_tag LOCUS_12900 7754 6657 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548816.1 protein_id gnl|my_center|LOCUS_12900 8416 7856 gene locus_tag LOCUS_12910 8416 7856 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548814.1 protein_id gnl|my_center|LOCUS_12910 9081 8479 gene locus_tag LOCUS_12920 gene pcp 9081 8479 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548812.1 protein_id gnl|my_center|LOCUS_12920 9980 9288 gene locus_tag LOCUS_12930 9980 9288 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548802.1 protein_id gnl|my_center|LOCUS_12930 >Feature sequence054 67 201 gene locus_tag LOCUS_12940 67 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 736 891 gene locus_tag LOCUS_12950 736 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1138 1344 gene locus_tag LOCUS_12960 1138 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 2218 2433 gene locus_tag LOCUS_12970 2218 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2626 3183 gene locus_tag LOCUS_12980 2626 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 3427 3582 gene locus_tag LOCUS_12990 3427 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 3634 3915 gene locus_tag LOCUS_13000 3634 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 4984 5145 gene locus_tag LOCUS_13010 4984 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 5251 5385 gene locus_tag LOCUS_13020 5251 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 5593 5829 gene locus_tag LOCUS_13030 5593 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 5863 6126 gene locus_tag LOCUS_13040 5863 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 7024 7266 gene locus_tag LOCUS_13050 7024 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 7297 7434 gene locus_tag LOCUS_13060 7297 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 7690 7851 gene locus_tag LOCUS_13070 7690 7851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 7855 8034 gene locus_tag LOCUS_13080 7855 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 8652 8365 gene locus_tag LOCUS_13090 8652 8365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 >Feature sequence055 861 184 gene locus_tag LOCUS_13100 861 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13100 1005 883 gene locus_tag LOCUS_13110 1005 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13110 1220 1005 gene locus_tag LOCUS_13120 1220 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 2457 1588 gene locus_tag LOCUS_13130 2457 1588 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546191.1 protein_id gnl|my_center|LOCUS_13130 3402 2473 gene locus_tag LOCUS_13140 3402 2473 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547856.1 protein_id gnl|my_center|LOCUS_13140 3677 3432 gene locus_tag LOCUS_13150 3677 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 3823 4029 gene locus_tag LOCUS_13160 3823 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721275.1 protein_id gnl|my_center|LOCUS_13160 4110 4550 gene locus_tag LOCUS_13170 4110 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 5197 5039 gene locus_tag LOCUS_13180 5197 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 5493 5281 gene locus_tag LOCUS_13190 5493 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 5845 5660 gene locus_tag LOCUS_13200 5845 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 5913 6290 gene locus_tag LOCUS_13210 5913 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 10020 6427 gene locus_tag LOCUS_13220 gene pulA 10020 6427 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549917.1 protein_id gnl|my_center|LOCUS_13220 10368 10529 gene locus_tag LOCUS_13230 10368 10529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence056 <1 566 gene locus_tag LOCUS_13240 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546883.1:4-hydroxy-tetrahydrodipicolinate synthase 559 1338 gene locus_tag LOCUS_13250 gene dapB 559 1338 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546885.1 protein_id gnl|my_center|LOCUS_13250 1351 2526 gene locus_tag LOCUS_13260 1351 2526 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546886.1 protein_id gnl|my_center|LOCUS_13260 2526 3584 gene locus_tag LOCUS_13270 2526 3584 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254270.1 protein_id gnl|my_center|LOCUS_13270 3669 4772 gene locus_tag LOCUS_13280 3669 4772 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254271.1 protein_id gnl|my_center|LOCUS_13280 6355 4814 gene locus_tag LOCUS_13290 6355 4814 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546396.1 protein_id gnl|my_center|LOCUS_13290 6531 6319 gene locus_tag LOCUS_13300 6531 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13300 7114 6710 gene locus_tag LOCUS_13310 7114 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 7237 7575 gene locus_tag LOCUS_13320 7237 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 9224 7614 gene locus_tag LOCUS_13330 9224 7614 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546894.1 protein_id gnl|my_center|LOCUS_13330 9529 9798 gene locus_tag LOCUS_13340 9529 9798 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546896.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence057 750 526 gene locus_tag LOCUS_13350 750 526 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107539.1 protein_id gnl|my_center|LOCUS_13350 924 1655 gene locus_tag LOCUS_13360 924 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1639 2784 gene locus_tag LOCUS_13370 1639 2784 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861734.1 protein_id gnl|my_center|LOCUS_13370 3188 4225 gene locus_tag LOCUS_13380 3188 4225 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812952.1 protein_id gnl|my_center|LOCUS_13380 4299 5474 gene locus_tag LOCUS_13390 4299 5474 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948530.1 protein_id gnl|my_center|LOCUS_13390 5562 6599 gene locus_tag LOCUS_13400 gene rfbB 5562 6599 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_13400 6604 7488 gene locus_tag LOCUS_13410 gene rfbA 6604 7488 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389370.1 protein_id gnl|my_center|LOCUS_13410 7513 8121 gene locus_tag LOCUS_13420 gene rfbC 7513 8121 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_13420 8138 9124 gene locus_tag LOCUS_13430 gene rfbD 8138 9124 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476435.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence058 2546 276 gene locus_tag LOCUS_13440 2546 276 CDS product YadA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003780110.1 protein_id gnl|my_center|LOCUS_13440 3196 4107 gene locus_tag LOCUS_13450 3196 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 4118 4930 gene locus_tag LOCUS_13460 4118 4930 CDS product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721639.1 protein_id gnl|my_center|LOCUS_13460 4905 5720 gene locus_tag LOCUS_13470 4905 5720 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728733.1 protein_id gnl|my_center|LOCUS_13470 6217 5888 gene locus_tag LOCUS_13480 6217 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13480 6777 6307 gene locus_tag LOCUS_13490 6777 6307 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546335.1 protein_id gnl|my_center|LOCUS_13490 8745 6973 gene locus_tag LOCUS_13500 8745 6973 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546333.1 protein_id gnl|my_center|LOCUS_13500 8849 9136 gene locus_tag LOCUS_13510 8849 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13510 9133 9360 gene locus_tag LOCUS_13520 9133 9360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13520 >Feature sequence059 1139 126 gene locus_tag LOCUS_13530 1139 126 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613274.1 protein_id gnl|my_center|LOCUS_13530 1764 2591 gene locus_tag LOCUS_13540 1764 2591 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549252.1 protein_id gnl|my_center|LOCUS_13540 2877 3320 gene locus_tag LOCUS_13550 2877 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13550 3504 6329 gene locus_tag LOCUS_13560 3504 6329 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254017.1 protein_id gnl|my_center|LOCUS_13560 7473 6367 gene locus_tag LOCUS_13570 7473 6367 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025079807.1 protein_id gnl|my_center|LOCUS_13570 8817 7594 gene locus_tag LOCUS_13580 8817 7594 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100975.1 protein_id gnl|my_center|LOCUS_13580 8882 9295 gene locus_tag LOCUS_13590 8882 9295 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254019.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence060 22 94 gene locus_tag LOCUS_t00230 22 94 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 106 179 gene locus_tag LOCUS_t00240 106 179 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 185 258 gene locus_tag LOCUS_t00250 185 258 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 281 351 gene locus_tag LOCUS_t00260 281 351 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 391 478 gene locus_tag LOCUS_t00270 391 478 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 598 1761 gene locus_tag LOCUS_13600 598 1761 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550126.1 protein_id gnl|my_center|LOCUS_13600 1775 2818 gene locus_tag LOCUS_13610 1775 2818 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550128.1 protein_id gnl|my_center|LOCUS_13610 2818 3843 gene locus_tag LOCUS_13620 2818 3843 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550130.1 protein_id gnl|my_center|LOCUS_13620 4363 4199 gene locus_tag LOCUS_13630 4363 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 4428 5975 gene locus_tag LOCUS_13640 4428 5975 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254156.1 protein_id gnl|my_center|LOCUS_13640 6043 6276 gene locus_tag LOCUS_13650 gene secG 6043 6276 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254157.1 protein_id gnl|my_center|LOCUS_13650 6347 8689 gene locus_tag LOCUS_13660 gene rnr 6347 8689 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550136.1 protein_id gnl|my_center|LOCUS_13660 8702 9160 gene locus_tag LOCUS_13670 gene smpB 8702 9160 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550138.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence061 1255 770 gene locus_tag LOCUS_13680 1255 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1454 1801 gene locus_tag LOCUS_13690 gene rplS 1454 1801 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003629071.1 protein_id gnl|my_center|LOCUS_13690 2143 2790 gene locus_tag LOCUS_13700 2143 2790 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547855.1 protein_id gnl|my_center|LOCUS_13700 2790 3578 gene locus_tag LOCUS_13710 2790 3578 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547854.1 protein_id gnl|my_center|LOCUS_13710 4239 3613 gene locus_tag LOCUS_13720 gene lexA 4239 3613 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254404.1 protein_id gnl|my_center|LOCUS_13720 4391 4654 gene locus_tag LOCUS_13730 4391 4654 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547851.1 protein_id gnl|my_center|LOCUS_13730 4720 4938 gene locus_tag LOCUS_13740 4720 4938 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547849.1 protein_id gnl|my_center|LOCUS_13740 5022 6788 gene locus_tag LOCUS_13750 5022 6788 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254403.1 protein_id gnl|my_center|LOCUS_13750 6781 8577 gene locus_tag LOCUS_13760 6781 8577 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613381.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence062 306 67 gene locus_tag LOCUS_13770 306 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 588 331 gene locus_tag LOCUS_13780 588 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13780 794 2143 gene locus_tag LOCUS_13790 gene pcaB 794 2143 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090665.1 protein_id gnl|my_center|LOCUS_13790 3579 2197 gene locus_tag LOCUS_13800 3579 2197 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254522.1 protein_id gnl|my_center|LOCUS_13800 3737 4240 gene locus_tag LOCUS_13810 3737 4240 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254521.1 protein_id gnl|my_center|LOCUS_13810 5134 4277 gene locus_tag LOCUS_13820 5134 4277 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550089.1 protein_id gnl|my_center|LOCUS_13820 5931 5137 gene locus_tag LOCUS_13830 5931 5137 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254520.1 protein_id gnl|my_center|LOCUS_13830 6101 6709 gene locus_tag LOCUS_13840 6101 6709 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550094.1 protein_id gnl|my_center|LOCUS_13840 6709 7260 gene locus_tag LOCUS_13850 6709 7260 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550097.1 protein_id gnl|my_center|LOCUS_13850 7485 8792 gene locus_tag LOCUS_13860 gene serS 7485 8792 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254519.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence063 1231 101 gene locus_tag LOCUS_13870 gene alr 1231 101 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548996.1 protein_id gnl|my_center|LOCUS_13870 1590 1234 gene locus_tag LOCUS_13880 gene acpS 1590 1234 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254099.1 protein_id gnl|my_center|LOCUS_13880 3164 1671 gene locus_tag LOCUS_13890 3164 1671 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548992.1 protein_id gnl|my_center|LOCUS_13890 4545 3178 gene locus_tag LOCUS_13900 4545 3178 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548990.1 protein_id gnl|my_center|LOCUS_13900 4915 4670 gene locus_tag LOCUS_13910 4915 4670 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548978.1 protein_id gnl|my_center|LOCUS_13910 6648 5026 gene locus_tag LOCUS_13920 6648 5026 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254098.1 protein_id gnl|my_center|LOCUS_13920 6767 7597 gene locus_tag LOCUS_13930 6767 7597 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548975.1 protein_id gnl|my_center|LOCUS_13930 <8796 7630 gene locus_tag LOCUS_13940 <8796 7630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254096.1:APC family permease >Feature sequence064 727 368 gene locus_tag LOCUS_13950 727 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 965 3586 gene locus_tag LOCUS_13960 965 3586 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254445.1 protein_id gnl|my_center|LOCUS_13960 3863 5017 gene locus_tag LOCUS_13970 3863 5017 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254446.1 protein_id gnl|my_center|LOCUS_13970 5058 5336 gene locus_tag LOCUS_13980 5058 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13980 5986 5468 gene locus_tag LOCUS_13990 5986 5468 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254447.1 protein_id gnl|my_center|LOCUS_13990 6348 6052 gene locus_tag LOCUS_14000 6348 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548053.1 protein_id gnl|my_center|LOCUS_14000 6743 6450 gene locus_tag LOCUS_14010 6743 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548058.1 protein_id gnl|my_center|LOCUS_14010 6970 7632 gene locus_tag LOCUS_14020 6970 7632 CDS product serine dehydratase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254449.1 protein_id gnl|my_center|LOCUS_14020 7646 8527 gene locus_tag LOCUS_14030 gene sdaAA 7646 8527 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548060.1 protein_id gnl|my_center|LOCUS_14030 >Feature sequence065 229 672 gene locus_tag LOCUS_14040 gene infC 229 672 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075917325.1 protein_id gnl|my_center|LOCUS_14040 701 901 gene locus_tag LOCUS_14050 gene rpmI 701 901 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548328.1 protein_id gnl|my_center|LOCUS_14050 942 1298 gene locus_tag LOCUS_14060 gene rplT 942 1298 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548326.1 protein_id gnl|my_center|LOCUS_14060 2351 1350 gene locus_tag LOCUS_14070 gene add 2351 1350 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548323.1 protein_id gnl|my_center|LOCUS_14070 2491 3015 gene locus_tag LOCUS_14080 2491 3015 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254490.1 protein_id gnl|my_center|LOCUS_14080 3008 4117 gene locus_tag LOCUS_14090 gene yqeH 3008 4117 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548317.1 protein_id gnl|my_center|LOCUS_14090 4128 4781 gene locus_tag LOCUS_14100 4128 4781 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548315.1 protein_id gnl|my_center|LOCUS_14100 4762 5355 gene locus_tag LOCUS_14110 gene yqeK 4762 5355 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548313.1 protein_id gnl|my_center|LOCUS_14110 5377 5724 gene locus_tag LOCUS_14120 gene rsfS 5377 5724 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548311.1 protein_id gnl|my_center|LOCUS_14120 5730 6881 gene locus_tag LOCUS_14130 5730 6881 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548309.1 protein_id gnl|my_center|LOCUS_14130 6883 7440 gene locus_tag LOCUS_14140 6883 7440 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548307.1 protein_id gnl|my_center|LOCUS_14140 7598 8314 gene locus_tag LOCUS_14150 7598 8314 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548305.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence066 87 1019 gene locus_tag LOCUS_14160 87 1019 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296177.1 protein_id gnl|my_center|LOCUS_14160 1317 1084 gene locus_tag LOCUS_14170 1317 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1947 1609 gene locus_tag LOCUS_14180 1947 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 2132 1998 gene locus_tag LOCUS_14190 2132 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3217 2357 gene locus_tag LOCUS_14200 3217 2357 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548564.1 protein_id gnl|my_center|LOCUS_14200 3285 4397 gene locus_tag LOCUS_14210 3285 4397 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201247873.1 protein_id gnl|my_center|LOCUS_14210 4889 4446 gene locus_tag LOCUS_14220 4889 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 5368 4940 gene locus_tag LOCUS_14230 5368 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 5654 5463 gene locus_tag LOCUS_14240 5654 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 7092 5647 gene locus_tag LOCUS_14250 7092 5647 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476248.1 protein_id gnl|my_center|LOCUS_14250 7450 7280 gene locus_tag LOCUS_14260 7450 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 7880 7479 gene locus_tag LOCUS_14270 7880 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence067 4667 3672 gene locus_tag LOCUS_14280 4667 3672 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254469.1 protein_id gnl|my_center|LOCUS_14280 6255 4795 gene locus_tag LOCUS_14290 6255 4795 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548166.1 protein_id gnl|my_center|LOCUS_14290 7439 6276 gene locus_tag LOCUS_14300 7439 6276 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548167.1 protein_id gnl|my_center|LOCUS_14300 7886 7614 gene locus_tag LOCUS_14310 7886 7614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence068 434 805 gene locus_tag LOCUS_14320 434 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1432 1665 gene locus_tag LOCUS_14330 1432 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 1667 2419 gene locus_tag LOCUS_14340 1667 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 2406 3242 gene locus_tag LOCUS_14350 2406 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3232 4419 gene locus_tag LOCUS_14360 3232 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 4588 5412 gene locus_tag LOCUS_14370 4588 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 5417 6034 gene locus_tag LOCUS_14380 5417 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 6054 7271 gene locus_tag LOCUS_14390 6054 7271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 7278 7661 gene locus_tag LOCUS_14400 7278 7661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence069 <1 2235 gene locus_tag LOCUS_14410 <1 2235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254252.1:valine--tRNA ligase 2236 3507 gene locus_tag LOCUS_14420 2236 3507 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254253.1 protein_id gnl|my_center|LOCUS_14420 3494 4174 gene locus_tag LOCUS_14430 3494 4174 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546772.1 protein_id gnl|my_center|LOCUS_14430 4212 4835 gene locus_tag LOCUS_14440 gene radC 4212 4835 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546774.1 protein_id gnl|my_center|LOCUS_14440 4931 5935 gene locus_tag LOCUS_14450 4931 5935 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546776.1 protein_id gnl|my_center|LOCUS_14450 5981 6832 gene locus_tag LOCUS_14460 gene mreC 5981 6832 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546779.1 protein_id gnl|my_center|LOCUS_14460 6832 7371 gene locus_tag LOCUS_14470 gene mreD 6832 7371 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546782.1 protein_id gnl|my_center|LOCUS_14470 7542 7408 gene locus_tag LOCUS_14480 7542 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 7635 7964 gene locus_tag LOCUS_14490 7635 7964 CDS product DUF3397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254254.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence070 894 223 gene locus_tag LOCUS_14500 894 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1049 2290 gene locus_tag LOCUS_14510 1049 2290 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476549.1 protein_id gnl|my_center|LOCUS_14510 2446 3204 gene locus_tag LOCUS_14520 2446 3204 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254023.1 protein_id gnl|my_center|LOCUS_14520 3655 3260 gene locus_tag LOCUS_14530 3655 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 3801 3652 gene locus_tag LOCUS_14540 3801 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 3888 4724 gene locus_tag LOCUS_14550 3888 4724 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254021.1 protein_id gnl|my_center|LOCUS_14550 4742 5698 gene locus_tag LOCUS_14560 4742 5698 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548569.1 protein_id gnl|my_center|LOCUS_14560 5712 6659 gene locus_tag LOCUS_14570 5712 6659 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254020.1 protein_id gnl|my_center|LOCUS_14570 6656 7525 gene locus_tag LOCUS_14580 6656 7525 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548564.1 protein_id gnl|my_center|LOCUS_14580 7621 7851 gene locus_tag LOCUS_14590 7621 7851 CDS product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548562.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence071 <1 891 gene locus_tag LOCUS_14600 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548719.1:ABC transporter substrate-binding protein/permease 884 1030 gene locus_tag LOCUS_14610 884 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14610 982 1563 gene locus_tag LOCUS_14620 982 1563 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254050.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14620 2837 1596 gene locus_tag LOCUS_14630 2837 1596 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254051.1 protein_id gnl|my_center|LOCUS_14630 2988 4070 gene locus_tag LOCUS_14640 2988 4070 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548727.1 protein_id gnl|my_center|LOCUS_14640 4098 4847 gene locus_tag LOCUS_14650 4098 4847 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254052.1 protein_id gnl|my_center|LOCUS_14650 4957 6090 gene locus_tag LOCUS_14660 4957 6090 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548730.1 protein_id gnl|my_center|LOCUS_14660 6087 6872 gene locus_tag LOCUS_14670 6087 6872 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548732.1 protein_id gnl|my_center|LOCUS_14670 6844 7665 gene locus_tag LOCUS_14680 6844 7665 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254053.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence072 1166 840 gene locus_tag LOCUS_14690 1166 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1900 1406 gene locus_tag LOCUS_14700 1900 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 2339 2121 gene locus_tag LOCUS_14710 2339 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 2816 2448 gene locus_tag LOCUS_14720 2816 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 3585 2797 gene locus_tag LOCUS_14730 3585 2797 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038924.1 protein_id gnl|my_center|LOCUS_14730 4656 3604 gene locus_tag LOCUS_14740 4656 3604 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857565.1 protein_id gnl|my_center|LOCUS_14740 5787 5095 gene locus_tag LOCUS_14750 5787 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 5989 5804 gene locus_tag LOCUS_14760 5989 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 <7410 6003 gene locus_tag LOCUS_14770 <7410 6003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082256.1:replicative DNA helicase >Feature sequence073 509 1051 gene locus_tag LOCUS_14780 509 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14780 949 1254 gene locus_tag LOCUS_14790 949 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14790 1278 3617 gene locus_tag LOCUS_14800 1278 3617 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254626.1 protein_id gnl|my_center|LOCUS_14800 4267 3662 gene locus_tag LOCUS_14810 4267 3662 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254627.1 protein_id gnl|my_center|LOCUS_14810 4387 5427 gene locus_tag LOCUS_14820 4387 5427 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254628.1 protein_id gnl|my_center|LOCUS_14820 6364 5537 gene locus_tag LOCUS_14830 6364 5537 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549471.1 protein_id gnl|my_center|LOCUS_14830 6485 7204 gene locus_tag LOCUS_14840 gene nagB 6485 7204 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549469.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence074 124 492 gene locus_tag LOCUS_14850 124 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 513 1301 gene locus_tag LOCUS_14860 513 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14860 1866 1501 gene locus_tag LOCUS_14870 1866 1501 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548789.1 protein_id gnl|my_center|LOCUS_14870 3193 1832 gene locus_tag LOCUS_14880 3193 1832 CDS product putative glycosyltransferase, exosortase G system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548791.1 protein_id gnl|my_center|LOCUS_14880 4314 3193 gene locus_tag LOCUS_14890 gene xrtG 4314 3193 CDS product exosortase family protein XrtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548793.1 protein_id gnl|my_center|LOCUS_14890 5817 4405 gene locus_tag LOCUS_14900 gene slpA 5817 4405 CDS product pore-forming S-layer protein SlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254065.1 protein_id gnl|my_center|LOCUS_14900 6532 6332 gene locus_tag LOCUS_14910 6532 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 6867 6652 gene locus_tag LOCUS_14920 6867 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence075 1 186 gene locus_tag LOCUS_14930 1 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 783 226 gene locus_tag LOCUS_14940 783 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254564.1 protein_id gnl|my_center|LOCUS_14940 878 1591 gene locus_tag LOCUS_14950 878 1591 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721394.1 protein_id gnl|my_center|LOCUS_14950 2272 1787 gene locus_tag LOCUS_14960 2272 1787 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549820.1 protein_id gnl|my_center|LOCUS_14960 3046 2276 gene locus_tag LOCUS_14970 3046 2276 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549818.1 protein_id gnl|my_center|LOCUS_14970 4598 3057 gene locus_tag LOCUS_14980 4598 3057 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549817.1 protein_id gnl|my_center|LOCUS_14980 4981 4607 gene locus_tag LOCUS_14990 4981 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549816.1 protein_id gnl|my_center|LOCUS_14990 5107 5685 gene locus_tag LOCUS_15000 5107 5685 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547351.1 protein_id gnl|my_center|LOCUS_15000 6169 5660 gene locus_tag LOCUS_15010 6169 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15010 <7294 6351 gene locus_tag LOCUS_15020 <7294 6351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549814.1:LCP family protein >Feature sequence076 663 253 gene locus_tag LOCUS_15030 663 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 1595 675 gene locus_tag LOCUS_15040 1595 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1946 1873 gene locus_tag LOCUS_t00280 1946 1873 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2810 2127 gene locus_tag LOCUS_15050 2810 2127 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013854628.1 protein_id gnl|my_center|LOCUS_15050 3522 2863 gene locus_tag LOCUS_15060 3522 2863 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254170.1 protein_id gnl|my_center|LOCUS_15060 4183 3590 gene locus_tag LOCUS_15070 4183 3590 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546210.1 protein_id gnl|my_center|LOCUS_15070 4765 4190 gene locus_tag LOCUS_15080 4765 4190 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546208.1 protein_id gnl|my_center|LOCUS_15080 5917 4847 gene locus_tag LOCUS_15090 5917 4847 CDS product SEC10/PgrA surface exclusion domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546206.1 protein_id gnl|my_center|LOCUS_15090 6777 6058 gene locus_tag LOCUS_15100 6777 6058 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546204.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence077 <1 1379 gene locus_tag LOCUS_15110 <1 1379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005794862.1:fructose-1,6-bisphosphatase 2144 1440 gene locus_tag LOCUS_15120 gene wecG 2144 1440 CDS product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064043.1 protein_id gnl|my_center|LOCUS_15120 3285 2122 gene locus_tag LOCUS_15130 gene vpsj 3285 2122 CDS product exopolysaccharide biosynthesis protein VpsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843487.1 protein_id gnl|my_center|LOCUS_15130 3397 3708 gene locus_tag LOCUS_15140 3397 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 5671 4784 gene locus_tag LOCUS_15150 5671 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence078 185 922 gene locus_tag LOCUS_15160 gene pnuC 185 922 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550046.1 protein_id gnl|my_center|LOCUS_15160 1064 1288 gene locus_tag LOCUS_15170 1064 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1263 2321 gene locus_tag LOCUS_15180 1263 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 2431 3231 gene locus_tag LOCUS_15190 2431 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550052.1 protein_id gnl|my_center|LOCUS_15190 3239 4195 gene locus_tag LOCUS_15200 3239 4195 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550053.1 protein_id gnl|my_center|LOCUS_15200 4205 5065 gene locus_tag LOCUS_15210 4205 5065 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550055.1 protein_id gnl|my_center|LOCUS_15210 5103 6530 gene locus_tag LOCUS_15220 5103 6530 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550057.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence079 <1 973 gene locus_tag LOCUS_15230 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549080.1:DNA repair protein RadA 1050 2549 gene locus_tag LOCUS_15240 gene gltX 1050 2549 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254122.1 protein_id gnl|my_center|LOCUS_15240 2646 4079 gene locus_tag LOCUS_15250 gene cysS 2646 4079 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549082.1 protein_id gnl|my_center|LOCUS_15250 4072 4515 gene locus_tag LOCUS_15260 4072 4515 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549083.1 protein_id gnl|my_center|LOCUS_15260 4502 5254 gene locus_tag LOCUS_15270 gene rlmB 4502 5254 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254123.1 protein_id gnl|my_center|LOCUS_15270 5393 5938 gene locus_tag LOCUS_15280 5393 5938 CDS product DNA-directed RNA polymerase subunit sigma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254124.1 protein_id gnl|my_center|LOCUS_15280 6002 6220 gene locus_tag LOCUS_15290 6002 6220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549087.1 protein_id gnl|my_center|LOCUS_15290 6361 6780 gene locus_tag LOCUS_15300 6361 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence080 1625 585 gene locus_tag LOCUS_15310 1625 585 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549893.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15310 2042 1845 gene locus_tag LOCUS_15320 2042 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 2592 2071 gene locus_tag LOCUS_15330 2592 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254226.1 protein_id gnl|my_center|LOCUS_15330 3479 2604 gene locus_tag LOCUS_15340 3479 2604 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546611.1 protein_id gnl|my_center|LOCUS_15340 3547 4245 gene locus_tag LOCUS_15350 3547 4245 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546612.1 protein_id gnl|my_center|LOCUS_15350 4259 5248 gene locus_tag LOCUS_15360 gene pta 4259 5248 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254227.1 protein_id gnl|my_center|LOCUS_15360 5248 5727 gene locus_tag LOCUS_15370 gene tsaE 5248 5727 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546616.1 protein_id gnl|my_center|LOCUS_15370 6338 5796 gene locus_tag LOCUS_15380 6338 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15380 >Feature sequence081 2443 497 gene locus_tag LOCUS_15390 gene parE 2443 497 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547476.1 protein_id gnl|my_center|LOCUS_15390 2766 2521 gene locus_tag LOCUS_15400 2766 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 3039 2824 gene locus_tag LOCUS_15410 3039 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 6597 3307 gene locus_tag LOCUS_15420 6597 3307 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288952.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence082 2209 293 gene locus_tag LOCUS_15430 2209 293 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549141.1 protein_id gnl|my_center|LOCUS_15430 2394 3029 gene locus_tag LOCUS_15440 2394 3029 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549143.1 protein_id gnl|my_center|LOCUS_15440 4057 3071 gene locus_tag LOCUS_15450 4057 3071 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549144.1 protein_id gnl|my_center|LOCUS_15450 5521 4073 gene locus_tag LOCUS_15460 5521 4073 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549147.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence083 2347 701 gene locus_tag LOCUS_15470 2347 701 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548498.1 protein_id gnl|my_center|LOCUS_15470 4855 2441 gene locus_tag LOCUS_15480 gene leuS 4855 2441 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548508.1 protein_id gnl|my_center|LOCUS_15480 5148 5810 gene locus_tag LOCUS_15490 5148 5810 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254516.1 protein_id gnl|my_center|LOCUS_15490 <6474 5853 gene locus_tag LOCUS_15500 <6474 5853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548513.1:MDR family MFS transporter >Feature sequence084 1543 515 gene locus_tag LOCUS_15510 1543 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549513.1 protein_id gnl|my_center|LOCUS_15510 2241 2711 gene locus_tag LOCUS_15520 2241 2711 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549510.1 protein_id gnl|my_center|LOCUS_15520 2853 4709 gene locus_tag LOCUS_15530 2853 4709 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549508.1 protein_id gnl|my_center|LOCUS_15530 4864 6033 gene locus_tag LOCUS_15540 4864 6033 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549506.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence085 305 733 gene locus_tag LOCUS_15550 305 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 738 1118 gene locus_tag LOCUS_15560 738 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1295 1765 gene locus_tag LOCUS_15570 1295 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1837 2250 gene locus_tag LOCUS_15580 1837 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 5318 2712 gene locus_tag LOCUS_15590 5318 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 5528 6079 gene locus_tag LOCUS_15600 5528 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 6067 6420 gene locus_tag LOCUS_15610 6067 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence086 260 1642 gene locus_tag LOCUS_15620 260 1642 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546946.1 protein_id gnl|my_center|LOCUS_15620 1642 3057 gene locus_tag LOCUS_15630 1642 3057 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254281.1 protein_id gnl|my_center|LOCUS_15630 3076 3318 gene locus_tag LOCUS_15640 3076 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546942.1 protein_id gnl|my_center|LOCUS_15640 3440 4162 gene locus_tag LOCUS_15650 3440 4162 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254280.1 protein_id gnl|my_center|LOCUS_15650 4173 5654 gene locus_tag LOCUS_15660 4173 5654 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546937.1 protein_id gnl|my_center|LOCUS_15660 5759 6169 gene locus_tag LOCUS_15670 5759 6169 CDS product DUF3284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254279.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence087 1520 2449 gene locus_tag LOCUS_15680 1520 2449 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964246.1 protein_id gnl|my_center|LOCUS_15680 2668 3435 gene locus_tag LOCUS_15690 2668 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 4635 4180 gene locus_tag LOCUS_15700 4635 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 5618 4857 gene locus_tag LOCUS_15710 5618 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence088 990 112 gene locus_tag LOCUS_15720 990 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1250 966 gene locus_tag LOCUS_15730 1250 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 1407 2405 gene locus_tag LOCUS_15740 1407 2405 CDS product cytochrome C5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549662.1 protein_id gnl|my_center|LOCUS_15740 2592 3053 gene locus_tag LOCUS_15750 2592 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15750 3098 3298 gene locus_tag LOCUS_15760 3098 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15760 3828 3457 gene locus_tag LOCUS_15770 3828 3457 CDS product aggregation promoting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549663.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence089 1868 81 gene locus_tag LOCUS_15780 1868 81 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254014.1 protein_id gnl|my_center|LOCUS_15780 2633 1926 gene locus_tag LOCUS_15790 2633 1926 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025079808.1 protein_id gnl|my_center|LOCUS_15790 2991 3983 gene locus_tag LOCUS_15800 gene trpX 2991 3983 CDS product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254013.1 protein_id gnl|my_center|LOCUS_15800 3980 4801 gene locus_tag LOCUS_15810 3980 4801 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 protein_id gnl|my_center|LOCUS_15810 4869 5519 gene locus_tag LOCUS_15820 4869 5519 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549277.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence090 <1 1915 gene locus_tag LOCUS_15830 <1 1915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775498.1:ATP-binding protein 1918 2073 gene locus_tag LOCUS_15840 1918 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 2083 2571 gene locus_tag LOCUS_15850 2083 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 2574 2861 gene locus_tag LOCUS_15860 2574 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2944 3684 gene locus_tag LOCUS_15870 2944 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 3681 3971 gene locus_tag LOCUS_15880 3681 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 5398 4004 gene locus_tag LOCUS_15890 5398 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence091 532 242 gene locus_tag LOCUS_15900 532 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1238 570 gene locus_tag LOCUS_15910 1238 570 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499537.1 protein_id gnl|my_center|LOCUS_15910 2632 1241 gene locus_tag LOCUS_15920 2632 1241 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_15920 3727 2744 gene locus_tag LOCUS_15930 3727 2744 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_15930 5123 3867 gene locus_tag LOCUS_15940 gene fabF 5123 3867 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201893.1 protein_id gnl|my_center|LOCUS_15940 5457 5224 gene locus_tag LOCUS_15950 5457 5224 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence092 1621 3033 gene locus_tag LOCUS_15960 1621 3033 CDS product CotH kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202473.1 protein_id gnl|my_center|LOCUS_15960 3742 3407 gene locus_tag LOCUS_15970 3742 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 5249 3912 gene locus_tag LOCUS_15980 5249 3912 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108623.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence093 397 44 gene locus_tag LOCUS_15990 397 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 1844 639 gene locus_tag LOCUS_16000 1844 639 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547189.1 protein_id gnl|my_center|LOCUS_16000 2477 1920 gene locus_tag LOCUS_16010 2477 1920 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547188.1 protein_id gnl|my_center|LOCUS_16010 3308 2487 gene locus_tag LOCUS_16020 3308 2487 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254313.1 protein_id gnl|my_center|LOCUS_16020 4502 3378 gene locus_tag LOCUS_16030 4502 3378 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547186.1 protein_id gnl|my_center|LOCUS_16030 4715 5347 gene locus_tag LOCUS_16040 4715 5347 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547184.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence094 1466 762 gene locus_tag LOCUS_16050 1466 762 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254276.1 protein_id gnl|my_center|LOCUS_16050 1867 2202 gene locus_tag LOCUS_16060 1867 2202 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546926.1 protein_id gnl|my_center|LOCUS_16060 2235 2606 gene locus_tag LOCUS_16070 2235 2606 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546929.1 protein_id gnl|my_center|LOCUS_16070 2711 3223 gene locus_tag LOCUS_16080 2711 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254277.1 protein_id gnl|my_center|LOCUS_16080 3430 3696 gene locus_tag LOCUS_16090 3430 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16090 3753 4781 gene locus_tag LOCUS_16100 gene celB 3753 4781 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014565762.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16100 >Feature sequence095 110 466 gene locus_tag LOCUS_16110 110 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 649 2148 gene locus_tag LOCUS_16120 gene yjeM 649 2148 CDS product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548106.1 protein_id gnl|my_center|LOCUS_16120 2180 2581 gene locus_tag LOCUS_16130 2180 2581 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254569.1 protein_id gnl|my_center|LOCUS_16130 3605 2649 gene locus_tag LOCUS_16140 3605 2649 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549473.1 protein_id gnl|my_center|LOCUS_16140 4744 3602 gene locus_tag LOCUS_16150 4744 3602 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549477.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence096 908 207 gene locus_tag LOCUS_16160 908 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549985.1 protein_id gnl|my_center|LOCUS_16160 1004 2278 gene locus_tag LOCUS_16170 1004 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549986.1 protein_id gnl|my_center|LOCUS_16170 2425 3174 gene locus_tag LOCUS_16180 2425 3174 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549987.1 protein_id gnl|my_center|LOCUS_16180 3187 4989 gene locus_tag LOCUS_16190 3187 4989 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549988.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence097 1341 655 gene locus_tag LOCUS_16200 gene cobI 1341 655 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 protein_id gnl|my_center|LOCUS_16200 4898 1929 gene locus_tag LOCUS_r00010 4898 1929 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence098 827 192 gene locus_tag LOCUS_16210 827 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1420 824 gene locus_tag LOCUS_16220 1420 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1853 1443 gene locus_tag LOCUS_16230 gene tnpA 1853 1443 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979110.1 protein_id gnl|my_center|LOCUS_16230 2074 2787 gene locus_tag LOCUS_16240 2074 2787 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547771.1 protein_id gnl|my_center|LOCUS_16240 2798 3709 gene locus_tag LOCUS_16250 gene cysK 2798 3709 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547772.1 protein_id gnl|my_center|LOCUS_16250 3850 4017 gene locus_tag LOCUS_16260 3850 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16260 4176 4706 gene locus_tag LOCUS_16270 4176 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16270 >Feature sequence099 156 1043 gene locus_tag LOCUS_16280 156 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1067 1714 gene locus_tag LOCUS_16290 1067 1714 CDS product temperature-sensitive replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547721.1 protein_id gnl|my_center|LOCUS_16290 1947 2708 gene locus_tag LOCUS_16300 1947 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16300 3776 2913 gene locus_tag LOCUS_16310 gene thrB 3776 2913 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547723.1 protein_id gnl|my_center|LOCUS_16310 4877 3798 gene locus_tag LOCUS_16320 4877 3798 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547725.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence100 367 1470 gene locus_tag LOCUS_16330 367 1470 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288985.1 protein_id gnl|my_center|LOCUS_16330 2716 1535 gene locus_tag LOCUS_16340 2716 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 3546 2731 gene locus_tag LOCUS_16350 3546 2731 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476364.1 protein_id gnl|my_center|LOCUS_16350 4128 3655 gene locus_tag LOCUS_16360 4128 3655 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547404.1 protein_id gnl|my_center|LOCUS_16360 4800 4309 gene locus_tag LOCUS_16370 4800 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence101 216 145 gene locus_tag LOCUS_t00290 216 145 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 456 1487 gene locus_tag LOCUS_16380 456 1487 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546600.1 protein_id gnl|my_center|LOCUS_16380 1541 2557 gene locus_tag LOCUS_16390 gene gap 1541 2557 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546601.1 protein_id gnl|my_center|LOCUS_16390 2671 3882 gene locus_tag LOCUS_16400 2671 3882 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546602.1 protein_id gnl|my_center|LOCUS_16400 3908 4666 gene locus_tag LOCUS_16410 gene tpiA 3908 4666 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546605.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence102 3 479 gene locus_tag LOCUS_16420 3 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 572 1042 gene locus_tag LOCUS_16430 572 1042 CDS product NUMOD4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006993.1 protein_id gnl|my_center|LOCUS_16430 1039 1818 gene locus_tag LOCUS_16440 1039 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 1904 2461 gene locus_tag LOCUS_16450 1904 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2475 3263 gene locus_tag LOCUS_16460 2475 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 3319 3612 gene locus_tag LOCUS_16470 3319 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 3624 3917 gene locus_tag LOCUS_16480 3624 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 3910 4332 gene locus_tag LOCUS_16490 3910 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 4329 4673 gene locus_tag LOCUS_16500 4329 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence103 >Feature sequence104 292 98 gene locus_tag LOCUS_16510 292 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 561 310 gene locus_tag LOCUS_16520 561 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1351 1154 gene locus_tag LOCUS_16530 1351 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549761.1 protein_id gnl|my_center|LOCUS_16530 1711 1352 gene locus_tag LOCUS_16540 1711 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 2301 1738 gene locus_tag LOCUS_16550 2301 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254575.1 protein_id gnl|my_center|LOCUS_16550 4474 2312 gene locus_tag LOCUS_16560 4474 2312 CDS product peptide cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254576.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence105 458 282 gene locus_tag LOCUS_16570 458 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1714 539 gene locus_tag LOCUS_16580 1714 539 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254401.1 protein_id gnl|my_center|LOCUS_16580 2452 1838 gene locus_tag LOCUS_16590 2452 1838 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547840.1 protein_id gnl|my_center|LOCUS_16590 2516 3547 gene locus_tag LOCUS_16600 2516 3547 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547839.1 protein_id gnl|my_center|LOCUS_16600 3708 4481 gene locus_tag LOCUS_16610 gene rpsB 3708 4481 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547837.1 protein_id gnl|my_center|LOCUS_16610 >Feature sequence106 781 173 gene locus_tag LOCUS_16620 781 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16620 1566 733 gene locus_tag LOCUS_16630 1566 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16630 2788 1589 gene locus_tag LOCUS_16640 gene metK 2788 1589 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548514.1 protein_id gnl|my_center|LOCUS_16640 3020 2945 gene locus_tag LOCUS_t00300 3020 2945 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3096 3024 gene locus_tag LOCUS_t00310 3096 3024 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4125 3238 gene locus_tag LOCUS_16650 4125 3238 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007126647.1 protein_id gnl|my_center|LOCUS_16650 4324 4232 gene locus_tag LOCUS_t00320 4324 4232 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4407 4333 gene locus_tag LOCUS_t00330 4407 4333 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence107 463 191 gene locus_tag LOCUS_16660 463 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 584 429 gene locus_tag LOCUS_16670 584 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 1705 593 gene locus_tag LOCUS_16680 1705 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16680 2042 1743 gene locus_tag LOCUS_16690 2042 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16690 2180 3028 gene locus_tag LOCUS_16700 2180 3028 CDS product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254624.1 protein_id gnl|my_center|LOCUS_16700 3183 3356 gene locus_tag LOCUS_16710 3183 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16710 3360 3689 gene locus_tag LOCUS_16720 3360 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16720 <4398 3732 gene locus_tag LOCUS_16730 <4398 3732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549496.1:type II CAAX endopeptidase family protein >Feature sequence108 147 1358 gene locus_tag LOCUS_16740 gene istA 147 1358 CDS product IS21-like element ISMac9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023062.1 protein_id gnl|my_center|LOCUS_16740 1363 2121 gene locus_tag LOCUS_16750 gene istB 1363 2121 CDS product IS21-like element ISMac3 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021079.1 protein_id gnl|my_center|LOCUS_16750 2372 3754 gene locus_tag LOCUS_16760 2372 3754 CDS product ISLre2-like element ISLca4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674077.1 protein_id gnl|my_center|LOCUS_16760 3869 4342 gene locus_tag LOCUS_16770 3869 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence109 1227 2021 gene locus_tag LOCUS_16780 1227 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 2387 2716 gene locus_tag LOCUS_16790 2387 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 2829 3209 gene locus_tag LOCUS_16800 2829 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 3470 3745 gene locus_tag LOCUS_16810 3470 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 3770 4144 gene locus_tag LOCUS_16820 3770 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence110 931 656 gene locus_tag LOCUS_16830 931 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876866.1 protein_id gnl|my_center|LOCUS_16830 1440 928 gene locus_tag LOCUS_16840 1440 928 CDS product MnhB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876867.1 protein_id gnl|my_center|LOCUS_16840 1754 1437 gene locus_tag LOCUS_16850 1754 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061006.1 protein_id gnl|my_center|LOCUS_16850 2082 1747 gene locus_tag LOCUS_16860 2082 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 3563 2082 gene locus_tag LOCUS_16870 gene ehbF 3563 2082 CDS product energy conserving hydrogenase EhbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876870.1 protein_id gnl|my_center|LOCUS_16870 3925 3560 gene locus_tag LOCUS_16880 3925 3560 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330371.1 protein_id gnl|my_center|LOCUS_16880 4162 3929 gene locus_tag LOCUS_16890 4162 3929 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869936.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence111 265 885 gene locus_tag LOCUS_16900 265 885 CDS product LVIS_2131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549837.1 protein_id gnl|my_center|LOCUS_16900 2436 931 gene locus_tag LOCUS_16910 2436 931 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549839.1 protein_id gnl|my_center|LOCUS_16910 2832 2530 gene locus_tag LOCUS_16920 2832 2530 CDS product DUF2187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549842.1 protein_id gnl|my_center|LOCUS_16920 2929 3477 gene locus_tag LOCUS_16930 2929 3477 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041814911.1 protein_id gnl|my_center|LOCUS_16930 3661 4215 gene locus_tag LOCUS_16940 3661 4215 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254561.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence112 436 855 gene locus_tag LOCUS_16950 436 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1045 2145 gene locus_tag LOCUS_16960 1045 2145 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356675.1 protein_id gnl|my_center|LOCUS_16960 2147 2911 gene locus_tag LOCUS_16970 2147 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 3041 4090 gene locus_tag LOCUS_16980 3041 4090 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004270929.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence113 89 862 gene locus_tag LOCUS_16990 89 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1029 1160 gene locus_tag LOCUS_17000 1029 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 1144 2103 gene locus_tag LOCUS_17010 1144 2103 CDS product beta-galactosidase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254473.1 protein_id gnl|my_center|LOCUS_17010 2526 2681 gene locus_tag LOCUS_17020 2526 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence114 285 2285 gene locus_tag LOCUS_17030 285 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2937 2338 gene locus_tag LOCUS_17040 2937 2338 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548007.1 protein_id gnl|my_center|LOCUS_17040 3807 3010 gene locus_tag LOCUS_17050 3807 3010 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122377.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence115 <3979 1758 gene locus_tag LOCUS_17060 <3979 1758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193330373.1:anaerobic ribonucleoside-triphosphate reductase >Feature sequence116 1518 61 gene locus_tag LOCUS_17070 1518 61 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254617.1 protein_id gnl|my_center|LOCUS_17070 1904 2878 gene locus_tag LOCUS_17080 1904 2878 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254618.1 protein_id gnl|my_center|LOCUS_17080 3632 2952 gene locus_tag LOCUS_17090 3632 2952 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254619.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence117 978 640 gene locus_tag LOCUS_17100 978 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 2098 938 gene locus_tag LOCUS_17110 2098 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 3352 2105 gene locus_tag LOCUS_17120 3352 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 >Feature sequence118 2229 346 gene locus_tag LOCUS_17130 2229 346 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187364788.1 protein_id gnl|my_center|LOCUS_17130 3546 2836 gene locus_tag LOCUS_17140 3546 2836 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546764.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence119 215 496 gene locus_tag LOCUS_17150 215 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613385.1 protein_id gnl|my_center|LOCUS_17150 546 983 gene locus_tag LOCUS_17160 gene msrB 546 983 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548013.1 protein_id gnl|my_center|LOCUS_17160 3424 1043 gene locus_tag LOCUS_17170 3424 1043 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548011.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence120 173 3601 gene locus_tag LOCUS_17180 gene ileS 173 3601 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876987.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence121 690 1568 gene locus_tag LOCUS_17190 690 1568 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_17190 1733 2410 gene locus_tag LOCUS_17200 1733 2410 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788527.1 protein_id gnl|my_center|LOCUS_17200 2407 3288 gene locus_tag LOCUS_17210 2407 3288 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233875.1 protein_id gnl|my_center|LOCUS_17210 >Feature sequence122 1410 217 gene locus_tag LOCUS_17220 1410 217 CDS product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014565478.1 protein_id gnl|my_center|LOCUS_17220 1545 2225 gene locus_tag LOCUS_17230 1545 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 3304 2276 gene locus_tag LOCUS_17240 3304 2276 CDS product class III bacteriocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548389.1 protein_id gnl|my_center|LOCUS_17240 3647 3324 gene locus_tag LOCUS_17250 3647 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence123 1002 172 gene locus_tag LOCUS_17260 1002 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1675 1214 gene locus_tag LOCUS_17270 1675 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence124 310 1686 gene locus_tag LOCUS_17280 310 1686 CDS product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254450.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17280 1735 2055 gene locus_tag LOCUS_17290 1735 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17290 2147 2980 gene locus_tag LOCUS_17300 2147 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 3271 3038 gene locus_tag LOCUS_17310 3271 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence125 1970 111 gene locus_tag LOCUS_17320 1970 111 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193363685.1 protein_id gnl|my_center|LOCUS_17320 2092 3015 gene locus_tag LOCUS_17330 2092 3015 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643099.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence126 2 529 gene locus_tag LOCUS_17340 2 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 522 1382 gene locus_tag LOCUS_17350 522 1382 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021909.1 protein_id gnl|my_center|LOCUS_17350 1391 2335 gene locus_tag LOCUS_17360 1391 2335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021908.1 protein_id gnl|my_center|LOCUS_17360 2341 2955 gene locus_tag LOCUS_17370 2341 2955 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021907.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence127 <1 2023 gene locus_tag LOCUS_17380 <1 2023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012099504.1:TaqI-like C-terminal specificity domain-containing protein 2007 3083 gene locus_tag LOCUS_17390 2007 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence128 <1 1393 gene locus_tag LOCUS_17400 <1 1393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547843.1:M13 family metallopeptidase >Feature sequence129 70 1080 gene locus_tag LOCUS_17410 70 1080 CDS product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546107.1 protein_id gnl|my_center|LOCUS_17410 1099 1911 gene locus_tag LOCUS_17420 1099 1911 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254158.1 protein_id gnl|my_center|LOCUS_17420 1940 2860 gene locus_tag LOCUS_17430 1940 2860 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254159.1 protein_id gnl|my_center|LOCUS_17430 2864 3232 gene locus_tag LOCUS_17440 2864 3232 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546115.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence130 214 645 gene locus_tag LOCUS_17450 gene mraZ 214 645 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700457.1 protein_id gnl|my_center|LOCUS_17450 649 1596 gene locus_tag LOCUS_17460 gene rsmH 649 1596 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546789.1 protein_id gnl|my_center|LOCUS_17460 1610 1972 gene locus_tag LOCUS_17470 gene ftsL 1610 1972 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254255.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence131 <1 501 gene locus_tag LOCUS_17480 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109529.1:BspA family leucine-rich repeat surface protein 576 2099 gene locus_tag LOCUS_17490 576 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 2166 2327 gene locus_tag LOCUS_17500 2166 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2385 2774 gene locus_tag LOCUS_17510 2385 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence132 335 216 gene locus_tag LOCUS_17520 335 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 2215 551 gene locus_tag LOCUS_17530 2215 551 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031832.1 protein_id gnl|my_center|LOCUS_17530 3256 2291 gene locus_tag LOCUS_17540 3256 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence133 260 45 gene locus_tag LOCUS_17550 260 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 985 503 gene locus_tag LOCUS_17560 985 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1036 1596 gene locus_tag LOCUS_17570 1036 1596 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088388.1 protein_id gnl|my_center|LOCUS_17570 1729 2088 gene locus_tag LOCUS_17580 1729 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 2100 2699 gene locus_tag LOCUS_17590 2100 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 2855 3016 gene locus_tag LOCUS_17600 2855 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence134 1427 1945 gene locus_tag LOCUS_17610 1427 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 2040 2657 gene locus_tag LOCUS_17620 2040 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence135 919 254 gene locus_tag LOCUS_17630 919 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17630 2001 949 gene locus_tag LOCUS_17640 2001 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17640 3009 2146 gene locus_tag LOCUS_17650 3009 2146 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102090.1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence136 158 310 gene locus_tag LOCUS_17660 158 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 326 1840 gene locus_tag LOCUS_17670 gene dltA 326 1840 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549519.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence137 170 1456 gene locus_tag LOCUS_17680 gene dltD 170 1456 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549525.1 protein_id gnl|my_center|LOCUS_17680 1456 2397 gene locus_tag LOCUS_17690 1456 2397 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549527.1 protein_id gnl|my_center|LOCUS_17690 2492 2890 gene locus_tag LOCUS_17700 2492 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014566242.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence138 741 1706 gene locus_tag LOCUS_17710 741 1706 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548798.1 protein_id gnl|my_center|LOCUS_17710 <2957 1778 gene locus_tag LOCUS_17720 <2957 1778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001106642.1:ATP-binding protein >Feature sequence139 250 576 gene locus_tag LOCUS_17730 250 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 1403 621 gene locus_tag LOCUS_17740 1403 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 1871 1404 gene locus_tag LOCUS_17750 1871 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 2226 1903 gene locus_tag LOCUS_17760 gene trxA 2226 1903 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948620.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence140 844 461 gene locus_tag LOCUS_17770 844 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 1010 834 gene locus_tag LOCUS_17780 1010 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 1110 1682 gene locus_tag LOCUS_17790 1110 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 2219 1698 gene locus_tag LOCUS_17800 2219 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence141 386 195 gene locus_tag LOCUS_17810 386 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549727.1 protein_id gnl|my_center|LOCUS_17810 703 479 gene locus_tag LOCUS_17820 703 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549726.1 protein_id gnl|my_center|LOCUS_17820 1102 779 gene locus_tag LOCUS_17830 1102 779 CDS product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549725.1 protein_id gnl|my_center|LOCUS_17830 2411 1182 gene locus_tag LOCUS_17840 2411 1182 CDS product lactate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642933.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence142 1791 316 gene locus_tag LOCUS_17850 1791 316 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818556.1 protein_id gnl|my_center|LOCUS_17850 1954 1811 gene locus_tag LOCUS_17860 1954 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 <2839 2323 gene locus_tag LOCUS_17870 <2839 2323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107343.1:nucleotide sugar dehydrogenase note possible pseudo, frameshifted >Feature sequence143 1375 176 gene locus_tag LOCUS_17880 1375 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2121 1372 gene locus_tag LOCUS_17890 2121 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 2636 2124 gene locus_tag LOCUS_17900 2636 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence144 133 1287 gene locus_tag LOCUS_17910 133 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17910 1747 1280 gene locus_tag LOCUS_17920 1747 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 1796 2296 gene locus_tag LOCUS_17930 1796 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence145 >Feature sequence146 1027 446 gene locus_tag LOCUS_17940 1027 446 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764900.1 protein_id gnl|my_center|LOCUS_17940 1387 1142 gene locus_tag LOCUS_17950 1387 1142 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_17950 2059 1391 gene locus_tag LOCUS_17960 2059 1391 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759971.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence147 941 726 gene locus_tag LOCUS_17970 941 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 2118 1027 gene locus_tag LOCUS_17980 2118 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 >Feature sequence148 555 1544 gene locus_tag LOCUS_17990 555 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1708 2229 gene locus_tag LOCUS_18000 1708 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence149 828 2120 gene locus_tag LOCUS_18010 828 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence150 419 586 gene locus_tag LOCUS_18020 419 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 648 1682 gene locus_tag LOCUS_18030 648 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence151 536 75 gene locus_tag LOCUS_18040 gene ribE 536 75 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099502.1 protein_id gnl|my_center|LOCUS_18040 1723 548 gene locus_tag LOCUS_18050 1723 548 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101406.1 protein_id gnl|my_center|LOCUS_18050 2322 1726 gene locus_tag LOCUS_18060 2322 1726 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261426.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence152 315 2150 gene locus_tag LOCUS_18070 315 2150 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254067.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence153 587 991 gene locus_tag LOCUS_18080 gene tnpA 587 991 CDS product IS200/IS605-like element ISEfa4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287522.1 protein_id gnl|my_center|LOCUS_18080 991 2166 gene locus_tag LOCUS_18090 gene tnpB 991 2166 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 protein_id gnl|my_center|LOCUS_18090 >Feature sequence154 1199 456 gene locus_tag LOCUS_18100 1199 456 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549867.1 protein_id gnl|my_center|LOCUS_18100 1984 1202 gene locus_tag LOCUS_18110 1984 1202 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549866.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence155 1860 625 gene locus_tag LOCUS_18120 1860 625 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548972.1 protein_id gnl|my_center|LOCUS_18120 2198 1917 gene locus_tag LOCUS_18130 2198 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254095.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence156 93 314 gene locus_tag LOCUS_18140 93 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 346 510 gene locus_tag LOCUS_18150 346 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 1365 532 gene locus_tag LOCUS_18160 1365 532 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547023.1 protein_id gnl|my_center|LOCUS_18160 <2356 1367 gene locus_tag LOCUS_18170 <2356 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547024.1:ABC transporter ATP-binding protein >Feature sequence157 <1 919 gene locus_tag LOCUS_18180 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000090364.1:elongation factor G 1079 2272 gene locus_tag LOCUS_18190 gene tuf 1079 2272 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966415.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence158 <1 744 gene locus_tag LOCUS_18200 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_191216118.1:2-oxoacid:acceptor oxidoreductase subunit alpha 753 1613 gene locus_tag LOCUS_18210 gene korB 753 1613 CDS product 2-oxoglutarate synthase subunit KorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876665.1 protein_id gnl|my_center|LOCUS_18210 1615 2160 gene locus_tag LOCUS_18220 1615 2160 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060957.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence159 1615 320 gene locus_tag LOCUS_18230 gene ltrA 1615 320 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292559.1 protein_id gnl|my_center|LOCUS_18230 2176 2057 gene locus_tag LOCUS_18240 2176 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence160 <1 915 gene locus_tag LOCUS_18250 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921814.1:IS66-like element short variant transposase >Feature sequence161 1045 1680 gene locus_tag LOCUS_18260 1045 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1965 2222 gene locus_tag LOCUS_18270 1965 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence162 706 563 gene locus_tag LOCUS_18280 706 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 2108 873 gene locus_tag LOCUS_18290 2108 873 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988380.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence163 423 2096 gene locus_tag LOCUS_18300 423 2096 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254026.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence164 86 235 gene locus_tag LOCUS_18310 86 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 232 579 gene locus_tag LOCUS_18320 gene tnpB 232 579 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973424.1 protein_id gnl|my_center|LOCUS_18320 639 875 gene locus_tag LOCUS_18330 639 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691850.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence165 2015 1056 gene locus_tag LOCUS_18340 2015 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence166 1359 208 gene locus_tag LOCUS_18350 1359 208 CDS product Rep family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549058.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence167 87 317 gene locus_tag LOCUS_18360 87 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691850.1 protein_id gnl|my_center|LOCUS_18360 271 465 gene locus_tag LOCUS_18370 271 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18370 543 1040 gene locus_tag LOCUS_18380 543 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18380 1111 1236 gene locus_tag LOCUS_18390 1111 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1247 1597 gene locus_tag LOCUS_18400 1247 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1940 2116 gene locus_tag LOCUS_18410 1940 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence168 931 563 gene locus_tag LOCUS_18420 931 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 1840 1091 gene locus_tag LOCUS_18430 1840 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18430 >Feature sequence169 1172 618 gene locus_tag LOCUS_18440 1172 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768972.1 protein_id gnl|my_center|LOCUS_18440 1657 1190 gene locus_tag LOCUS_18450 1657 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence170 876 640 gene locus_tag LOCUS_18460 876 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 1478 1308 gene locus_tag LOCUS_18470 1478 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 <2097 1501 gene locus_tag LOCUS_18480 <2097 1501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000186339.1:Rep protein >Feature sequence171 986 1666 gene locus_tag LOCUS_18490 986 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence172 <1 1207 gene locus_tag LOCUS_18500 <1 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140384.1:hemolysin family protein 1207 2034 gene locus_tag LOCUS_18510 1207 2034 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence173 <1 1584 gene locus_tag LOCUS_18520 <1 1584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476043.1:HsdR family type I site-specific deoxyribonuclease 1854 1636 gene locus_tag LOCUS_18530 1854 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 >Feature sequence174 1889 306 gene locus_tag LOCUS_18540 1889 306 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254603.1 protein_id gnl|my_center|LOCUS_18540 >Feature sequence175 643 38 gene locus_tag LOCUS_18550 gene rpsD 643 38 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791575.1 protein_id gnl|my_center|LOCUS_18550 1131 745 gene locus_tag LOCUS_18560 gene rpsK 1131 745 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_18560 1602 1222 gene locus_tag LOCUS_18570 gene rpsM 1602 1222 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296328.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence176 279 76 gene locus_tag LOCUS_18580 279 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1117 821 gene locus_tag LOCUS_18590 1117 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence177 313 714 gene locus_tag LOCUS_18600 gene tnpA 313 714 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606465.1 protein_id gnl|my_center|LOCUS_18600 723 1814 gene locus_tag LOCUS_18610 gene tnpB 723 1814 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076629448.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence178 349 1914 gene locus_tag LOCUS_r00020 349 1914 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence179 1767 475 gene locus_tag LOCUS_18620 1767 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 >Feature sequence180 60 608 gene locus_tag LOCUS_18630 60 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 930 622 gene locus_tag LOCUS_18640 930 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18640 2002 1247 gene locus_tag LOCUS_18650 2002 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548110.1 protein_id gnl|my_center|LOCUS_18650