>Feature sequence001 1229 1723 gene locus_tag LOCUS_00010 1229 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1729 1908 gene locus_tag LOCUS_00020 1729 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1992 2333 gene locus_tag LOCUS_00030 1992 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2433 2891 gene locus_tag LOCUS_00040 2433 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2897 3400 gene locus_tag LOCUS_00050 2897 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3579 3815 gene locus_tag LOCUS_00060 3579 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 3856 4368 gene locus_tag LOCUS_00070 3856 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 4527 4709 gene locus_tag LOCUS_00080 4527 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 4768 5223 gene locus_tag LOCUS_00090 4768 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 5229 5729 gene locus_tag LOCUS_00100 5229 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 5761 6090 gene locus_tag LOCUS_00110 5761 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 6109 6558 gene locus_tag LOCUS_00120 6109 6558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 7110 7796 gene locus_tag LOCUS_00130 7110 7796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 7872 8249 gene locus_tag LOCUS_00140 7872 8249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 8268 8555 gene locus_tag LOCUS_00150 8268 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 8585 9310 gene locus_tag LOCUS_00160 8585 9310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 9393 9602 gene locus_tag LOCUS_00170 9393 9602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 9768 10019 gene locus_tag LOCUS_00180 9768 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 10035 10427 gene locus_tag LOCUS_00190 10035 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 10557 10691 gene locus_tag LOCUS_00200 10557 10691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 10719 11156 gene locus_tag LOCUS_00210 10719 11156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 11224 11382 gene locus_tag LOCUS_00220 11224 11382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 11416 11706 gene locus_tag LOCUS_00230 11416 11706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 11723 12106 gene locus_tag LOCUS_00240 11723 12106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 12110 12355 gene locus_tag LOCUS_00250 12110 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 12319 12840 gene locus_tag LOCUS_00260 12319 12840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 12847 13290 gene locus_tag LOCUS_00270 12847 13290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 13637 13813 gene locus_tag LOCUS_00280 13637 13813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 15102 13810 gene locus_tag LOCUS_00290 15102 13810 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_00290 15312 15686 gene locus_tag LOCUS_00300 15312 15686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 15692 15868 gene locus_tag LOCUS_00310 15692 15868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 15868 16257 gene locus_tag LOCUS_00320 15868 16257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 16279 16485 gene locus_tag LOCUS_00330 16279 16485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 16490 16855 gene locus_tag LOCUS_00340 16490 16855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 16979 17500 gene locus_tag LOCUS_00350 16979 17500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 17548 17841 gene locus_tag LOCUS_00360 17548 17841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 17845 18369 gene locus_tag LOCUS_00370 17845 18369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 18366 18584 gene locus_tag LOCUS_00380 18366 18584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 18587 18745 gene locus_tag LOCUS_00390 18587 18745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 18748 19335 gene locus_tag LOCUS_00400 18748 19335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 19639 19767 gene locus_tag LOCUS_00410 19639 19767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 19843 20598 gene locus_tag LOCUS_00420 19843 20598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 20580 21008 gene locus_tag LOCUS_00430 20580 21008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 21079 21396 gene locus_tag LOCUS_00440 21079 21396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 21421 22548 gene locus_tag LOCUS_00450 21421 22548 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071540979.1 protein_id gnl|my_center|LOCUS_00450 22661 23305 gene locus_tag LOCUS_00460 22661 23305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 24130 23381 gene locus_tag LOCUS_00470 24130 23381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 25151 24276 gene locus_tag LOCUS_00480 25151 24276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 26101 26274 gene locus_tag LOCUS_00490 26101 26274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 26707 26474 gene locus_tag LOCUS_00500 26707 26474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 27168 26806 gene locus_tag LOCUS_00510 27168 26806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 27742 27458 gene locus_tag LOCUS_00520 27742 27458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 28842 28420 gene locus_tag LOCUS_00530 28842 28420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 29651 29127 gene locus_tag LOCUS_00540 29651 29127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 30438 29716 gene locus_tag LOCUS_00550 30438 29716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 31596 30691 gene locus_tag LOCUS_00560 31596 30691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 32405 31743 gene locus_tag LOCUS_00570 32405 31743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 33476 32739 gene locus_tag LOCUS_00580 33476 32739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 33910 33545 gene locus_tag LOCUS_00590 33910 33545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 35028 34153 gene locus_tag LOCUS_00600 35028 34153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 35342 35091 gene locus_tag LOCUS_00610 35342 35091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 35579 35355 gene locus_tag LOCUS_00620 35579 35355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 36298 35861 gene locus_tag LOCUS_00630 36298 35861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 36689 36384 gene locus_tag LOCUS_00640 36689 36384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 37794 37081 gene locus_tag LOCUS_00650 37794 37081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 38119 37952 gene locus_tag LOCUS_00660 38119 37952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 38991 38188 gene locus_tag LOCUS_00670 38991 38188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 39373 39098 gene locus_tag LOCUS_00680 39373 39098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 40128 39616 gene locus_tag LOCUS_00690 40128 39616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 41573 40689 gene locus_tag LOCUS_00700 41573 40689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 41996 41724 gene locus_tag LOCUS_00710 41996 41724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 42292 41996 gene locus_tag LOCUS_00720 42292 41996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 43395 42655 gene locus_tag LOCUS_00730 43395 42655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 43971 43756 gene locus_tag LOCUS_00740 43971 43756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 44079 43993 gene locus_tag LOCUS_t00010 44079 43993 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 44311 44090 gene locus_tag LOCUS_00750 44311 44090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 45169 44894 gene locus_tag LOCUS_00760 45169 44894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 45703 45236 gene locus_tag LOCUS_00770 45703 45236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 46204 45791 gene locus_tag LOCUS_00780 46204 45791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 46458 46219 gene locus_tag LOCUS_00790 46458 46219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 47455 46586 gene locus_tag LOCUS_00800 47455 46586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 48043 47507 gene locus_tag LOCUS_00810 48043 47507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 48496 48218 gene locus_tag LOCUS_00820 48496 48218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 48766 48518 gene locus_tag LOCUS_00830 48766 48518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 50132 49026 gene locus_tag LOCUS_00840 50132 49026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 51453 50587 gene locus_tag LOCUS_00850 51453 50587 CDS product adenine-specific methyltransferase EcoRI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874555.1 protein_id gnl|my_center|LOCUS_00850 51908 51711 gene locus_tag LOCUS_00860 51908 51711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 52154 51930 gene locus_tag LOCUS_00870 52154 51930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 52803 52399 gene locus_tag LOCUS_00880 52803 52399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 53450 53040 gene locus_tag LOCUS_00890 53450 53040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 54452 53952 gene locus_tag LOCUS_00900 54452 53952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 54975 54793 gene locus_tag LOCUS_00910 54975 54793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 55468 55067 gene locus_tag LOCUS_00920 55468 55067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 56409 56002 gene locus_tag LOCUS_00930 56409 56002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 57091 56897 gene locus_tag LOCUS_00940 57091 56897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 58306 57449 gene locus_tag LOCUS_00950 58306 57449 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_00950 60275 59187 gene locus_tag LOCUS_00960 60275 59187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 60710 60399 gene locus_tag LOCUS_00970 60710 60399 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764277.1 protein_id gnl|my_center|LOCUS_00970 61118 60744 gene locus_tag LOCUS_00980 61118 60744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 61251 62174 gene locus_tag LOCUS_00990 61251 62174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 63115 62261 gene locus_tag LOCUS_01000 63115 62261 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861779.1 protein_id gnl|my_center|LOCUS_01000 64168 63251 gene locus_tag LOCUS_01010 64168 63251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 64790 64230 gene locus_tag LOCUS_01020 64790 64230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 65258 64944 gene locus_tag LOCUS_01030 65258 64944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 67779 65260 gene locus_tag LOCUS_01040 67779 65260 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_01040 67882 68235 gene locus_tag LOCUS_01050 67882 68235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 68385 68645 gene locus_tag LOCUS_01060 68385 68645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 68954 68628 gene locus_tag LOCUS_01070 68954 68628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 69910 68954 gene locus_tag LOCUS_01080 69910 68954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 70146 69910 gene locus_tag LOCUS_01090 70146 69910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 71104 70226 gene locus_tag LOCUS_01100 71104 70226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 71592 71200 gene locus_tag LOCUS_01110 71592 71200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 72291 71599 gene locus_tag LOCUS_01120 72291 71599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 72550 72272 gene locus_tag LOCUS_01130 72550 72272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 72750 72541 gene locus_tag LOCUS_01140 72750 72541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 73135 72734 gene locus_tag LOCUS_01150 73135 72734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 73659 73132 gene locus_tag LOCUS_01160 73659 73132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 73857 73666 gene locus_tag LOCUS_01170 73857 73666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 74972 73887 gene locus_tag LOCUS_01180 gene clpX 74972 73887 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880858.1 protein_id gnl|my_center|LOCUS_01180 75331 75008 gene locus_tag LOCUS_01190 75331 75008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 77299 75545 gene locus_tag LOCUS_01200 77299 75545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 77445 77936 gene locus_tag LOCUS_01210 gene rfbC 77445 77936 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 protein_id gnl|my_center|LOCUS_01210 77992 79044 gene locus_tag LOCUS_01220 gene rfbB 77992 79044 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202143.1 protein_id gnl|my_center|LOCUS_01220 79031 79462 gene locus_tag LOCUS_01230 79031 79462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 79466 79654 gene locus_tag LOCUS_01240 79466 79654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 80761 79781 gene locus_tag LOCUS_01250 80761 79781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 82386 80776 gene locus_tag LOCUS_01260 82386 80776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 82456 82779 gene locus_tag LOCUS_01270 gene trxA 82456 82779 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 protein_id gnl|my_center|LOCUS_01270 82847 84421 gene locus_tag LOCUS_01280 82847 84421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 84408 85550 gene locus_tag LOCUS_01290 84408 85550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 85562 86620 gene locus_tag LOCUS_01300 85562 86620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 87032 86655 gene locus_tag LOCUS_01310 87032 86655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 87133 87516 gene locus_tag LOCUS_01320 87133 87516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 87518 88387 gene locus_tag LOCUS_01330 87518 88387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 88497 90044 gene locus_tag LOCUS_01340 88497 90044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 90107 90688 gene locus_tag LOCUS_01350 90107 90688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 90759 91106 gene locus_tag LOCUS_01360 90759 91106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 91096 92217 gene locus_tag LOCUS_01370 91096 92217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 92207 94606 gene locus_tag LOCUS_01380 92207 94606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 94818 94603 gene locus_tag LOCUS_01390 gene infA 94818 94603 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_01390 94902 96080 gene locus_tag LOCUS_01400 94902 96080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 96180 97613 gene locus_tag LOCUS_01410 96180 97613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 97657 99486 gene locus_tag LOCUS_01420 97657 99486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 99640 101328 gene locus_tag LOCUS_01430 99640 101328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 101321 102049 gene locus_tag LOCUS_01440 101321 102049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 102425 101973 gene locus_tag LOCUS_01450 102425 101973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 102411 102848 gene locus_tag LOCUS_01460 102411 102848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 103501 102845 gene locus_tag LOCUS_01470 103501 102845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 103469 103858 gene locus_tag LOCUS_01480 103469 103858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 103800 104144 gene locus_tag LOCUS_01490 103800 104144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 105052 104213 gene locus_tag LOCUS_01500 105052 104213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 106905 105316 gene locus_tag LOCUS_01510 106905 105316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 108600 106942 gene locus_tag LOCUS_01520 108600 106942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 111310 108692 gene locus_tag LOCUS_01530 111310 108692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 112552 111374 gene locus_tag LOCUS_01540 112552 111374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 112572 112820 gene locus_tag LOCUS_01550 112572 112820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 113254 112955 gene locus_tag LOCUS_01560 113254 112955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 113312 113659 gene locus_tag LOCUS_01570 113312 113659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 114029 113643 gene locus_tag LOCUS_01580 114029 113643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 114486 114010 gene locus_tag LOCUS_01590 114486 114010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 115240 114596 gene locus_tag LOCUS_01600 115240 114596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 116150 115233 gene locus_tag LOCUS_01610 116150 115233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 118246 116174 gene locus_tag LOCUS_01620 118246 116174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 120412 118529 gene locus_tag LOCUS_01630 120412 118529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 120477 121610 gene locus_tag LOCUS_01640 120477 121610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 121902 123035 gene locus_tag LOCUS_01650 121902 123035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 123150 124019 gene locus_tag LOCUS_01660 123150 124019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 124023 125363 gene locus_tag LOCUS_01670 124023 125363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 126326 125460 gene locus_tag LOCUS_01680 126326 125460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 126726 126334 gene locus_tag LOCUS_01690 126726 126334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 128440 126740 gene locus_tag LOCUS_01700 128440 126740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 128860 128444 gene locus_tag LOCUS_01710 128860 128444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 129576 128863 gene locus_tag LOCUS_01720 129576 128863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 130618 129806 gene locus_tag LOCUS_01730 130618 129806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 131733 130618 gene locus_tag LOCUS_01740 131733 130618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 132337 131741 gene locus_tag LOCUS_01750 132337 131741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 133657 132404 gene locus_tag LOCUS_01760 133657 132404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 136075 133715 gene locus_tag LOCUS_01770 136075 133715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 137592 136132 gene locus_tag LOCUS_01780 137592 136132 CDS product DnaB-like helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011011095.1 protein_id gnl|my_center|LOCUS_01780 138277 137690 gene locus_tag LOCUS_01790 138277 137690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 139155 138277 gene locus_tag LOCUS_01800 139155 138277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 139532 139155 gene locus_tag LOCUS_01810 139532 139155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 140178 139582 gene locus_tag LOCUS_01820 140178 139582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 140235 141998 gene locus_tag LOCUS_01830 140235 141998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 142021 143682 gene locus_tag LOCUS_01840 142021 143682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 143701 144870 gene locus_tag LOCUS_01850 143701 144870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 145074 145496 gene locus_tag LOCUS_01860 145074 145496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 145535 146119 gene locus_tag LOCUS_01870 145535 146119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 147402 146164 gene locus_tag LOCUS_01880 147402 146164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 148459 147446 gene locus_tag LOCUS_01890 148459 147446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 149447 148608 gene locus_tag LOCUS_01900 149447 148608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 149625 149452 gene locus_tag LOCUS_01910 149625 149452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 149801 149640 gene locus_tag LOCUS_01920 149801 149640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 150441 149839 gene locus_tag LOCUS_01930 150441 149839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 151152 152309 gene locus_tag LOCUS_01940 151152 152309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 152759 152328 gene locus_tag LOCUS_01950 152759 152328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 154779 152773 gene locus_tag LOCUS_01960 154779 152773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 154875 155417 gene locus_tag LOCUS_01970 154875 155417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 155424 156608 gene locus_tag LOCUS_01980 155424 156608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 156692 159610 gene locus_tag LOCUS_01990 156692 159610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 161303 159882 gene locus_tag LOCUS_02000 161303 159882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 161957 161313 gene locus_tag LOCUS_02010 161957 161313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 162503 161961 gene locus_tag LOCUS_02020 162503 161961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 162794 162510 gene locus_tag LOCUS_02030 162794 162510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 163153 162824 gene locus_tag LOCUS_02040 163153 162824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 163253 163687 gene locus_tag LOCUS_02050 163253 163687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 163733 164221 gene locus_tag LOCUS_02060 163733 164221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 164342 167236 gene locus_tag LOCUS_02070 164342 167236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 167362 171039 gene locus_tag LOCUS_02080 167362 171039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 171085 171399 gene locus_tag LOCUS_02090 171085 171399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 171404 177079 gene locus_tag LOCUS_02100 171404 177079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 177888 177118 gene locus_tag LOCUS_02110 177888 177118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 177964 179184 gene locus_tag LOCUS_02120 177964 179184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 179256 180104 gene locus_tag LOCUS_02130 179256 180104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 180962 180144 gene locus_tag LOCUS_02140 180962 180144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 181049 181414 gene locus_tag LOCUS_02150 181049 181414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 181414 183801 gene locus_tag LOCUS_02160 181414 183801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 183835 184554 gene locus_tag LOCUS_02170 183835 184554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 184568 185044 gene locus_tag LOCUS_02180 184568 185044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 185058 185558 gene locus_tag LOCUS_02190 185058 185558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 >Feature sequence002 1766 342 gene locus_tag LOCUS_02200 1766 342 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254410.1 protein_id gnl|my_center|LOCUS_02200 2327 1806 gene locus_tag LOCUS_02210 2327 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 3088 2708 gene locus_tag LOCUS_02220 3088 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 6651 3091 gene locus_tag LOCUS_02230 gene smc 6651 3091 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254411.1 protein_id gnl|my_center|LOCUS_02230 7346 6666 gene locus_tag LOCUS_02240 gene rnc 7346 6666 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547887.1 protein_id gnl|my_center|LOCUS_02240 9214 7454 gene locus_tag LOCUS_02250 9214 7454 CDS product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254413.1 protein_id gnl|my_center|LOCUS_02250 11097 9343 gene locus_tag LOCUS_02260 11097 9343 CDS product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254413.1 protein_id gnl|my_center|LOCUS_02260 12304 11390 gene locus_tag LOCUS_02270 12304 11390 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547893.1 protein_id gnl|my_center|LOCUS_02270 13283 12321 gene locus_tag LOCUS_02280 13283 12321 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547894.1 protein_id gnl|my_center|LOCUS_02280 14254 13286 gene locus_tag LOCUS_02290 14254 13286 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547895.1 protein_id gnl|my_center|LOCUS_02290 15271 14261 gene locus_tag LOCUS_02300 15271 14261 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547898.1 protein_id gnl|my_center|LOCUS_02300 15671 15429 gene locus_tag LOCUS_02310 gene acpP 15671 15429 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547899.1 protein_id gnl|my_center|LOCUS_02310 16728 15727 gene locus_tag LOCUS_02320 gene plsX 16728 15727 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547901.1 protein_id gnl|my_center|LOCUS_02320 18785 16746 gene locus_tag LOCUS_02330 gene recG 18785 16746 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254414.1 protein_id gnl|my_center|LOCUS_02330 20453 18789 gene locus_tag LOCUS_02340 20453 18789 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547907.1 protein_id gnl|my_center|LOCUS_02340 20837 20475 gene locus_tag LOCUS_02350 20837 20475 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547910.1 protein_id gnl|my_center|LOCUS_02350 21008 21193 gene locus_tag LOCUS_02360 gene rpmB 21008 21193 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547911.1 protein_id gnl|my_center|LOCUS_02360 21909 21241 gene locus_tag LOCUS_02370 21909 21241 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254415.1 protein_id gnl|my_center|LOCUS_02370 22556 21906 gene locus_tag LOCUS_02380 gene rpe 22556 21906 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547914.1 protein_id gnl|my_center|LOCUS_02380 23458 22565 gene locus_tag LOCUS_02390 gene rsgA 23458 22565 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547915.1 protein_id gnl|my_center|LOCUS_02390 25431 23458 gene locus_tag LOCUS_02400 gene pknB 25431 23458 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_056938256.1 protein_id gnl|my_center|LOCUS_02400 26201 25449 gene locus_tag LOCUS_02410 26201 25449 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254417.1 protein_id gnl|my_center|LOCUS_02410 27524 26208 gene locus_tag LOCUS_02420 gene rsmB 27524 26208 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254418.1 protein_id gnl|my_center|LOCUS_02420 28461 27517 gene locus_tag LOCUS_02430 gene fmt 28461 27517 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547919.1 protein_id gnl|my_center|LOCUS_02430 30879 28483 gene locus_tag LOCUS_02440 gene priA 30879 28483 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547921.1 protein_id gnl|my_center|LOCUS_02440 31152 30934 gene locus_tag LOCUS_02450 gene rpoZ 31152 30934 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547927.1 protein_id gnl|my_center|LOCUS_02450 31770 31156 gene locus_tag LOCUS_02460 gene gmk 31770 31156 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547929.1 protein_id gnl|my_center|LOCUS_02460 31931 32224 gene locus_tag LOCUS_02470 31931 32224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 33963 32284 gene locus_tag LOCUS_02480 gene recN 33963 32284 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547931.1 protein_id gnl|my_center|LOCUS_02480 34786 33974 gene locus_tag LOCUS_02490 34786 33974 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547933.1 protein_id gnl|my_center|LOCUS_02490 35656 34790 gene locus_tag LOCUS_02500 35656 34790 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547935.1 protein_id gnl|my_center|LOCUS_02500 35902 35657 gene locus_tag LOCUS_02510 35902 35657 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547938.1 protein_id gnl|my_center|LOCUS_02510 37253 35883 gene locus_tag LOCUS_02520 gene xseA 37253 35883 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547941.1 protein_id gnl|my_center|LOCUS_02520 38091 37243 gene locus_tag LOCUS_02530 38091 37243 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547942.1 protein_id gnl|my_center|LOCUS_02530 38539 38138 gene locus_tag LOCUS_02540 gene nusB 38539 38138 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547945.1 protein_id gnl|my_center|LOCUS_02540 38980 38540 gene locus_tag LOCUS_02550 38980 38540 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547946.1 protein_id gnl|my_center|LOCUS_02550 39567 38998 gene locus_tag LOCUS_02560 gene efp 39567 38998 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547948.1 protein_id gnl|my_center|LOCUS_02560 40761 39652 gene locus_tag LOCUS_02570 40761 39652 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547949.1 protein_id gnl|my_center|LOCUS_02570 41133 40834 gene locus_tag LOCUS_02580 gene rpmA 41133 40834 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254420.1 protein_id gnl|my_center|LOCUS_02580 41464 41153 gene locus_tag LOCUS_02590 gene rplU 41464 41153 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_02590 41678 42034 gene locus_tag LOCUS_02600 41678 42034 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254429.1 protein_id gnl|my_center|LOCUS_02600 42868 42029 gene locus_tag LOCUS_02610 42868 42029 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547954.1 protein_id gnl|my_center|LOCUS_02610 44265 42946 gene locus_tag LOCUS_02620 44265 42946 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254421.1 protein_id gnl|my_center|LOCUS_02620 44958 44557 gene locus_tag LOCUS_02630 44958 44557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 45141 44962 gene locus_tag LOCUS_02640 45141 44962 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547962.1 protein_id gnl|my_center|LOCUS_02640 45751 45194 gene locus_tag LOCUS_02650 45751 45194 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547188.1 protein_id gnl|my_center|LOCUS_02650 46585 45755 gene locus_tag LOCUS_02660 46585 45755 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254313.1 protein_id gnl|my_center|LOCUS_02660 47043 46582 gene locus_tag LOCUS_02670 47043 46582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 47717 47064 gene locus_tag LOCUS_02680 47717 47064 CDS product glucose-6-phosphate 1-dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289292.1 protein_id gnl|my_center|LOCUS_02680 49536 47740 gene locus_tag LOCUS_02690 49536 47740 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254424.1 protein_id gnl|my_center|LOCUS_02690 50736 49735 gene locus_tag LOCUS_02700 50736 49735 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547989.1 protein_id gnl|my_center|LOCUS_02700 51950 51030 gene locus_tag LOCUS_02710 51950 51030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 52372 52587 gene locus_tag LOCUS_02720 52372 52587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 54208 52892 gene locus_tag LOCUS_02730 54208 52892 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547002.1 protein_id gnl|my_center|LOCUS_02730 54733 54368 gene locus_tag LOCUS_02740 54733 54368 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254569.1 protein_id gnl|my_center|LOCUS_02740 55416 57170 gene locus_tag LOCUS_02750 55416 57170 CDS product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547891.1 protein_id gnl|my_center|LOCUS_02750 57715 57257 gene locus_tag LOCUS_02760 57715 57257 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548149.1 protein_id gnl|my_center|LOCUS_02760 57871 59343 gene locus_tag LOCUS_02770 57871 59343 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254465.1 protein_id gnl|my_center|LOCUS_02770 59343 59903 gene locus_tag LOCUS_02780 59343 59903 CDS product DUF4811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548152.1 protein_id gnl|my_center|LOCUS_02780 60741 59953 gene locus_tag LOCUS_02790 60741 59953 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795870.1 protein_id gnl|my_center|LOCUS_02790 61643 61026 gene locus_tag LOCUS_02800 61643 61026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 62025 61606 gene locus_tag LOCUS_02810 62025 61606 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475487.1 protein_id gnl|my_center|LOCUS_02810 63982 62171 gene locus_tag LOCUS_02820 gene glmS 63982 62171 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546133.1 protein_id gnl|my_center|LOCUS_02820 64235 64161 gene locus_tag LOCUS_t00020 64235 64161 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 65158 64394 gene locus_tag LOCUS_02830 65158 64394 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722653.1 protein_id gnl|my_center|LOCUS_02830 67779 65245 gene locus_tag LOCUS_02840 67779 65245 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101213.1 protein_id gnl|my_center|LOCUS_02840 67977 69008 gene locus_tag LOCUS_02850 67977 69008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02850 69005 70315 gene locus_tag LOCUS_02860 69005 70315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02860 70828 70394 gene locus_tag LOCUS_02870 70828 70394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 71223 70891 gene locus_tag LOCUS_02880 71223 70891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 72508 71327 gene locus_tag LOCUS_02890 72508 71327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 74190 72511 gene locus_tag LOCUS_02900 74190 72511 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254405.1 protein_id gnl|my_center|LOCUS_02900 75910 74210 gene locus_tag LOCUS_02910 75910 74210 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254405.1 protein_id gnl|my_center|LOCUS_02910 76672 76019 gene locus_tag LOCUS_02920 76672 76019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 78001 76685 gene locus_tag LOCUS_02930 78001 76685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 79033 78053 gene locus_tag LOCUS_02940 79033 78053 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642217.1 protein_id gnl|my_center|LOCUS_02940 79807 79076 gene locus_tag LOCUS_02950 79807 79076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 80617 79895 gene locus_tag LOCUS_02960 80617 79895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 82440 80986 gene locus_tag LOCUS_02970 82440 80986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549986.1 protein_id gnl|my_center|LOCUS_02970 83246 82455 gene locus_tag LOCUS_02980 83246 82455 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476433.1 protein_id gnl|my_center|LOCUS_02980 86927 83526 gene locus_tag LOCUS_02990 86927 83526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 >Feature sequence003 123 398 gene locus_tag LOCUS_03000 123 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 1971 676 gene locus_tag LOCUS_03010 1971 676 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546755.1 protein_id gnl|my_center|LOCUS_03010 2438 1974 gene locus_tag LOCUS_03020 2438 1974 CDS product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254248.1 protein_id gnl|my_center|LOCUS_03020 3166 2555 gene locus_tag LOCUS_03030 gene rpsD 3166 2555 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254249.1 protein_id gnl|my_center|LOCUS_03030 3209 3394 gene locus_tag LOCUS_03040 3209 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 3446 5170 gene locus_tag LOCUS_03050 gene ezrA 3446 5170 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546759.1 protein_id gnl|my_center|LOCUS_03050 5261 6415 gene locus_tag LOCUS_03060 5261 6415 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546760.1 protein_id gnl|my_center|LOCUS_03060 6425 7642 gene locus_tag LOCUS_03070 gene thiI 6425 7642 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546762.1 protein_id gnl|my_center|LOCUS_03070 7693 8394 gene locus_tag LOCUS_03080 7693 8394 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546764.1 protein_id gnl|my_center|LOCUS_03080 8633 11260 gene locus_tag LOCUS_03090 8633 11260 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254445.1 protein_id gnl|my_center|LOCUS_03090 11441 14158 gene locus_tag LOCUS_03100 11441 14158 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244282.1 protein_id gnl|my_center|LOCUS_03100 14142 14894 gene locus_tag LOCUS_03110 14142 14894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 14909 16858 gene locus_tag LOCUS_03120 14909 16858 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233883.1 protein_id gnl|my_center|LOCUS_03120 16845 18068 gene locus_tag LOCUS_03130 16845 18068 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966754.1 protein_id gnl|my_center|LOCUS_03130 18073 18627 gene locus_tag LOCUS_03140 18073 18627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 18922 21561 gene locus_tag LOCUS_03150 18922 21561 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254252.1 protein_id gnl|my_center|LOCUS_03150 21564 22829 gene locus_tag LOCUS_03160 21564 22829 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254253.1 protein_id gnl|my_center|LOCUS_03160 22819 23499 gene locus_tag LOCUS_03170 22819 23499 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546772.1 protein_id gnl|my_center|LOCUS_03170 23538 24149 gene locus_tag LOCUS_03180 gene radC 23538 24149 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546774.1 protein_id gnl|my_center|LOCUS_03180 24287 25288 gene locus_tag LOCUS_03190 24287 25288 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546776.1 protein_id gnl|my_center|LOCUS_03190 25353 26204 gene locus_tag LOCUS_03200 gene mreC 25353 26204 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546779.1 protein_id gnl|my_center|LOCUS_03200 26204 26737 gene locus_tag LOCUS_03210 gene mreD 26204 26737 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546782.1 protein_id gnl|my_center|LOCUS_03210 26915 26787 gene locus_tag LOCUS_03220 26915 26787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 27013 27348 gene locus_tag LOCUS_03230 27013 27348 CDS product DUF3397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254254.1 protein_id gnl|my_center|LOCUS_03230 27529 27960 gene locus_tag LOCUS_03240 gene mraZ 27529 27960 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355890.1 protein_id gnl|my_center|LOCUS_03240 27944 28912 gene locus_tag LOCUS_03250 gene rsmH 27944 28912 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546789.1 protein_id gnl|my_center|LOCUS_03250 28941 29303 gene locus_tag LOCUS_03260 gene ftsL 28941 29303 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254255.1 protein_id gnl|my_center|LOCUS_03260 29303 31453 gene locus_tag LOCUS_03270 29303 31453 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546793.1 protein_id gnl|my_center|LOCUS_03270 31477 32436 gene locus_tag LOCUS_03280 gene mraY 31477 32436 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546795.1 protein_id gnl|my_center|LOCUS_03280 32444 33826 gene locus_tag LOCUS_03290 gene murD 32444 33826 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546797.1 protein_id gnl|my_center|LOCUS_03290 33829 34941 gene locus_tag LOCUS_03300 gene murG 33829 34941 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254256.1 protein_id gnl|my_center|LOCUS_03300 34960 35808 gene locus_tag LOCUS_03310 34960 35808 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546801.1 protein_id gnl|my_center|LOCUS_03310 35873 37243 gene locus_tag LOCUS_03320 gene ftsA 35873 37243 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254257.1 protein_id gnl|my_center|LOCUS_03320 37261 38637 gene locus_tag LOCUS_03330 gene ftsZ 37261 38637 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546805.1 protein_id gnl|my_center|LOCUS_03330 38656 39090 gene locus_tag LOCUS_03340 gene sepF 38656 39090 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254258.1 protein_id gnl|my_center|LOCUS_03340 39090 39386 gene locus_tag LOCUS_03350 39090 39386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 39551 40126 gene locus_tag LOCUS_03360 39551 40126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03360 40131 40919 gene locus_tag LOCUS_03370 40131 40919 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254259.1 protein_id gnl|my_center|LOCUS_03370 41147 43015 gene locus_tag LOCUS_03380 41147 43015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03380 42987 43913 gene locus_tag LOCUS_03390 42987 43913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03390 43913 44122 gene locus_tag LOCUS_03400 43913 44122 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546816.1 protein_id gnl|my_center|LOCUS_03400 44136 44699 gene locus_tag LOCUS_03410 44136 44699 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254261.1 protein_id gnl|my_center|LOCUS_03410 44692 44982 gene locus_tag LOCUS_03420 44692 44982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 44998 45699 gene locus_tag LOCUS_03430 44998 45699 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254262.1 protein_id gnl|my_center|LOCUS_03430 45801 46955 gene locus_tag LOCUS_03440 45801 46955 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101678.1 protein_id gnl|my_center|LOCUS_03440 47058 47393 gene locus_tag LOCUS_03450 47058 47393 CDS product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546822.1 protein_id gnl|my_center|LOCUS_03450 47411 48538 gene locus_tag LOCUS_03460 gene mnmA 47411 48538 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546824.1 protein_id gnl|my_center|LOCUS_03460 48642 49301 gene locus_tag LOCUS_03470 48642 49301 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546826.1 protein_id gnl|my_center|LOCUS_03470 49303 49947 gene locus_tag LOCUS_03480 49303 49947 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546828.1 protein_id gnl|my_center|LOCUS_03480 49934 52309 gene locus_tag LOCUS_03490 49934 52309 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546830.1 protein_id gnl|my_center|LOCUS_03490 53283 52348 gene locus_tag LOCUS_03500 53283 52348 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546833.1 protein_id gnl|my_center|LOCUS_03500 55012 53333 gene locus_tag LOCUS_03510 55012 53333 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546834.1 protein_id gnl|my_center|LOCUS_03510 55245 55018 gene locus_tag LOCUS_03520 55245 55018 CDS product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546835.1 protein_id gnl|my_center|LOCUS_03520 55985 55431 gene locus_tag LOCUS_03530 gene def 55985 55431 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546838.1 protein_id gnl|my_center|LOCUS_03530 56256 58088 gene locus_tag LOCUS_03540 gene typA 56256 58088 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254264.1 protein_id gnl|my_center|LOCUS_03540 58203 59387 gene locus_tag LOCUS_03550 58203 59387 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254265.1 protein_id gnl|my_center|LOCUS_03550 59384 59719 gene locus_tag LOCUS_03560 59384 59719 CDS product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546844.1 protein_id gnl|my_center|LOCUS_03560 59716 60264 gene locus_tag LOCUS_03570 gene rsmD 59716 60264 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546846.1 protein_id gnl|my_center|LOCUS_03570 60266 60766 gene locus_tag LOCUS_03580 gene coaD 60266 60766 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546847.1 protein_id gnl|my_center|LOCUS_03580 60753 61763 gene locus_tag LOCUS_03590 60753 61763 CDS product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546849.1 protein_id gnl|my_center|LOCUS_03590 61820 62503 gene locus_tag LOCUS_03600 61820 62503 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546852.1 protein_id gnl|my_center|LOCUS_03600 62919 64742 gene locus_tag LOCUS_03610 62919 64742 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546854.1 protein_id gnl|my_center|LOCUS_03610 64739 65728 gene locus_tag LOCUS_03620 gene holA 64739 65728 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546856.1 protein_id gnl|my_center|LOCUS_03620 66054 65797 gene locus_tag LOCUS_03630 gene rpsT 66054 65797 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546858.1 protein_id gnl|my_center|LOCUS_03630 66249 66518 gene locus_tag LOCUS_03640 gene rpsO 66249 66518 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546859.1 protein_id gnl|my_center|LOCUS_03640 66679 68454 gene locus_tag LOCUS_03650 66679 68454 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546860.1 protein_id gnl|my_center|LOCUS_03650 68454 69311 gene locus_tag LOCUS_03660 68454 69311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254267.1 protein_id gnl|my_center|LOCUS_03660 69489 70679 gene locus_tag LOCUS_03670 gene tuf 69489 70679 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546862.1 protein_id gnl|my_center|LOCUS_03670 70838 72187 gene locus_tag LOCUS_03680 gene tig 70838 72187 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546863.1 protein_id gnl|my_center|LOCUS_03680 72333 73598 gene locus_tag LOCUS_03690 gene clpX 72333 73598 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546864.1 protein_id gnl|my_center|LOCUS_03690 73598 74182 gene locus_tag LOCUS_03700 gene yihA 73598 74182 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546867.1 protein_id gnl|my_center|LOCUS_03700 74395 74871 gene locus_tag LOCUS_03710 74395 74871 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_03710 74871 75386 gene locus_tag LOCUS_03720 74871 75386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546897.1 protein_id gnl|my_center|LOCUS_03720 >Feature sequence004 846 316 gene locus_tag LOCUS_03730 846 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 1400 843 gene locus_tag LOCUS_03740 1400 843 CDS product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269108.1 protein_id gnl|my_center|LOCUS_03740 1660 1397 gene locus_tag LOCUS_03750 1660 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 2151 1657 gene locus_tag LOCUS_03760 2151 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 2649 2194 gene locus_tag LOCUS_03770 2649 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 3379 2591 gene locus_tag LOCUS_03780 3379 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 4289 3381 gene locus_tag LOCUS_03790 4289 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 6294 4282 gene locus_tag LOCUS_03800 6294 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 8164 6428 gene locus_tag LOCUS_03810 8164 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 9186 8164 gene locus_tag LOCUS_03820 9186 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 10639 9287 gene locus_tag LOCUS_03830 10639 9287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 11252 10644 gene locus_tag LOCUS_03840 11252 10644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 11787 11179 gene locus_tag LOCUS_03850 11787 11179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 12143 11784 gene locus_tag LOCUS_03860 12143 11784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 12659 12150 gene locus_tag LOCUS_03870 12659 12150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 15039 12664 gene locus_tag LOCUS_03880 15039 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 16049 15042 gene locus_tag LOCUS_03890 16049 15042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 17647 16163 gene locus_tag LOCUS_03900 17647 16163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 18156 17665 gene locus_tag LOCUS_03910 18156 17665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 18743 19744 gene locus_tag LOCUS_03920 18743 19744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 20516 20265 gene locus_tag LOCUS_03930 20516 20265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 20769 20551 gene locus_tag LOCUS_03940 20769 20551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 22673 20772 gene locus_tag LOCUS_03950 22673 20772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 23995 22673 gene locus_tag LOCUS_03960 23995 22673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 25188 24007 gene locus_tag LOCUS_03970 25188 24007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 25759 25193 gene locus_tag LOCUS_03980 25759 25193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 26667 25756 gene locus_tag LOCUS_03990 26667 25756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 27535 26660 gene locus_tag LOCUS_04000 27535 26660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 28147 27602 gene locus_tag LOCUS_04010 28147 27602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 28613 28164 gene locus_tag LOCUS_04020 28613 28164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 29327 28707 gene locus_tag LOCUS_04030 29327 28707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 29740 29330 gene locus_tag LOCUS_04040 29740 29330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 30042 29743 gene locus_tag LOCUS_04050 30042 29743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 31027 29969 gene locus_tag LOCUS_04060 31027 29969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 33024 31699 gene locus_tag LOCUS_04070 33024 31699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 33851 33051 gene locus_tag LOCUS_04080 33851 33051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 35253 33844 gene locus_tag LOCUS_04090 35253 33844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 36229 35309 gene locus_tag LOCUS_04100 36229 35309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 37808 36234 gene locus_tag LOCUS_04110 37808 36234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 38901 37819 gene locus_tag LOCUS_04120 38901 37819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 45177 38920 gene locus_tag LOCUS_04130 45177 38920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 46561 45230 gene locus_tag LOCUS_04140 46561 45230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 47268 46819 gene locus_tag LOCUS_04150 47268 46819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 47917 47423 gene locus_tag LOCUS_04160 47917 47423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 49294 47945 gene locus_tag LOCUS_04170 49294 47945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 49657 49343 gene locus_tag LOCUS_04180 49657 49343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 50757 49714 gene locus_tag LOCUS_04190 50757 49714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 52041 50794 gene locus_tag LOCUS_04200 52041 50794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 52906 52106 gene locus_tag LOCUS_04210 52906 52106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 53549 52923 gene locus_tag LOCUS_04220 53549 52923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 54348 53542 gene locus_tag LOCUS_04230 54348 53542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 55748 54465 gene locus_tag LOCUS_04240 55748 54465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 56014 56562 gene locus_tag LOCUS_04250 56014 56562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 56565 57035 gene locus_tag LOCUS_04260 56565 57035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 57019 57456 gene locus_tag LOCUS_04270 57019 57456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 57446 58000 gene locus_tag LOCUS_04280 57446 58000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 58198 58788 gene locus_tag LOCUS_04290 58198 58788 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203304.1 protein_id gnl|my_center|LOCUS_04290 58793 59401 gene locus_tag LOCUS_04300 58793 59401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 59415 59690 gene locus_tag LOCUS_04310 59415 59690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 59653 60027 gene locus_tag LOCUS_04320 59653 60027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 60024 60293 gene locus_tag LOCUS_04330 60024 60293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 60296 61096 gene locus_tag LOCUS_04340 60296 61096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 61970 61113 gene locus_tag LOCUS_04350 61970 61113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 62143 62673 gene locus_tag LOCUS_04360 62143 62673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 62679 62969 gene locus_tag LOCUS_04370 62679 62969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 62999 63232 gene locus_tag LOCUS_04380 62999 63232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 63375 64442 gene locus_tag LOCUS_04390 63375 64442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 64557 64709 gene locus_tag LOCUS_04400 64557 64709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 >Feature sequence005 <1 3018 gene locus_tag LOCUS_04410 <1 3018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254101.1:transcription-repair coupling factor 3035 3277 gene locus_tag LOCUS_04420 3035 3277 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_04420 3366 3743 gene locus_tag LOCUS_04430 3366 3743 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254103.1 protein_id gnl|my_center|LOCUS_04430 3743 4099 gene locus_tag LOCUS_04440 3743 4099 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549009.1 protein_id gnl|my_center|LOCUS_04440 4122 5417 gene locus_tag LOCUS_04450 gene tilS 4122 5417 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549010.1 protein_id gnl|my_center|LOCUS_04450 5501 7627 gene locus_tag LOCUS_04460 gene ftsH 5501 7627 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254105.1 protein_id gnl|my_center|LOCUS_04460 7698 10385 gene locus_tag LOCUS_04470 7698 10385 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101465.1 protein_id gnl|my_center|LOCUS_04470 10448 13090 gene locus_tag LOCUS_04480 10448 13090 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101465.1 protein_id gnl|my_center|LOCUS_04480 13145 14020 gene locus_tag LOCUS_04490 gene hslO 13145 14020 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549012.1 protein_id gnl|my_center|LOCUS_04490 14080 15087 gene locus_tag LOCUS_04500 gene dusB 14080 15087 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254106.1 protein_id gnl|my_center|LOCUS_04500 15102 16646 gene locus_tag LOCUS_04510 gene lysS 15102 16646 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254107.1 protein_id gnl|my_center|LOCUS_04510 16748 16822 gene locus_tag LOCUS_t00030 16748 16822 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 16862 16937 gene locus_tag LOCUS_t00040 16862 16937 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 17102 19570 gene locus_tag LOCUS_04520 17102 19570 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549016.1 protein_id gnl|my_center|LOCUS_04520 19847 23407 gene locus_tag LOCUS_04530 19847 23407 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254108.1 protein_id gnl|my_center|LOCUS_04530 23425 27096 gene locus_tag LOCUS_04540 gene rpoC 23425 27096 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254109.1 protein_id gnl|my_center|LOCUS_04540 28009 28416 gene locus_tag LOCUS_04550 gene rpsL 28009 28416 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549020.1 protein_id gnl|my_center|LOCUS_04550 28440 28910 gene locus_tag LOCUS_04560 gene rpsG 28440 28910 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549021.1 protein_id gnl|my_center|LOCUS_04560 28940 31036 gene locus_tag LOCUS_04570 gene fusA 28940 31036 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549022.1 protein_id gnl|my_center|LOCUS_04570 31307 31615 gene locus_tag LOCUS_04580 gene rpsJ 31307 31615 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549023.1 protein_id gnl|my_center|LOCUS_04580 31642 32271 gene locus_tag LOCUS_04590 gene rplC 31642 32271 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549024.1 protein_id gnl|my_center|LOCUS_04590 32286 32903 gene locus_tag LOCUS_04600 gene rplD 32286 32903 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549025.1 protein_id gnl|my_center|LOCUS_04600 32903 33199 gene locus_tag LOCUS_04610 gene rplW 32903 33199 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549026.1 protein_id gnl|my_center|LOCUS_04610 33219 34055 gene locus_tag LOCUS_04620 gene rplB 33219 34055 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254111.1 protein_id gnl|my_center|LOCUS_04620 34077 34364 gene locus_tag LOCUS_04630 gene rpsS 34077 34364 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124353.1 protein_id gnl|my_center|LOCUS_04630 34385 34738 gene locus_tag LOCUS_04640 gene rplV 34385 34738 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549029.1 protein_id gnl|my_center|LOCUS_04640 34753 35421 gene locus_tag LOCUS_04650 gene rpsC 34753 35421 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254113.1 protein_id gnl|my_center|LOCUS_04650 35424 35861 gene locus_tag LOCUS_04660 gene rplP 35424 35861 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549031.1 protein_id gnl|my_center|LOCUS_04660 35851 36048 gene locus_tag LOCUS_04670 gene rpmC 35851 36048 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549032.1 protein_id gnl|my_center|LOCUS_04670 36071 36337 gene locus_tag LOCUS_04680 gene rpsQ 36071 36337 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254114.1 protein_id gnl|my_center|LOCUS_04680 36371 36739 gene locus_tag LOCUS_04690 gene rplN 36371 36739 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549034.1 protein_id gnl|my_center|LOCUS_04690 36760 36999 gene locus_tag LOCUS_04700 36760 36999 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549035.1 protein_id gnl|my_center|LOCUS_04700 37014 37556 gene locus_tag LOCUS_04710 gene rplE 37014 37556 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549036.1 protein_id gnl|my_center|LOCUS_04710 37571 37756 gene locus_tag LOCUS_04720 37571 37756 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549037.1 protein_id gnl|my_center|LOCUS_04720 37781 38179 gene locus_tag LOCUS_04730 gene rpsH 37781 38179 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 protein_id gnl|my_center|LOCUS_04730 38204 38734 gene locus_tag LOCUS_04740 gene rplF 38204 38734 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549039.1 protein_id gnl|my_center|LOCUS_04740 38762 39121 gene locus_tag LOCUS_04750 gene rplR 38762 39121 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549040.1 protein_id gnl|my_center|LOCUS_04750 39139 39663 gene locus_tag LOCUS_04760 gene rpsE 39139 39663 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549041.1 protein_id gnl|my_center|LOCUS_04760 39676 39858 gene locus_tag LOCUS_04770 gene rpmD 39676 39858 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549042.1 protein_id gnl|my_center|LOCUS_04770 39884 40324 gene locus_tag LOCUS_04780 gene rplO 39884 40324 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549043.1 protein_id gnl|my_center|LOCUS_04780 40324 41619 gene locus_tag LOCUS_04790 gene secY 40324 41619 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549044.1 protein_id gnl|my_center|LOCUS_04790 41631 42284 gene locus_tag LOCUS_04800 41631 42284 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549045.1 protein_id gnl|my_center|LOCUS_04800 42358 42579 gene locus_tag LOCUS_04810 gene infA 42358 42579 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878178.1 protein_id gnl|my_center|LOCUS_04810 42744 43091 gene locus_tag LOCUS_04820 gene rpsM 42744 43091 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549046.1 protein_id gnl|my_center|LOCUS_04820 43116 43505 gene locus_tag LOCUS_04830 gene rpsK 43116 43505 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613292.1 protein_id gnl|my_center|LOCUS_04830 43551 44489 gene locus_tag LOCUS_04840 43551 44489 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549048.1 protein_id gnl|my_center|LOCUS_04840 44516 44899 gene locus_tag LOCUS_04850 gene rplQ 44516 44899 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549049.1 protein_id gnl|my_center|LOCUS_04850 45085 45933 gene locus_tag LOCUS_04860 45085 45933 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549050.1 protein_id gnl|my_center|LOCUS_04860 45909 46778 gene locus_tag LOCUS_04870 45909 46778 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549051.1 protein_id gnl|my_center|LOCUS_04870 46802 47545 gene locus_tag LOCUS_04880 46802 47545 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549052.1 protein_id gnl|my_center|LOCUS_04880 47549 48340 gene locus_tag LOCUS_04890 gene truA 47549 48340 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549053.1 protein_id gnl|my_center|LOCUS_04890 48443 48886 gene locus_tag LOCUS_04900 gene rplM 48443 48886 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549054.1 protein_id gnl|my_center|LOCUS_04900 48900 49295 gene locus_tag LOCUS_04910 gene rpsI 48900 49295 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549055.1 protein_id gnl|my_center|LOCUS_04910 50417 49365 gene locus_tag LOCUS_04920 50417 49365 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254116.1 protein_id gnl|my_center|LOCUS_04920 50682 50494 gene locus_tag LOCUS_04930 50682 50494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549057.1 protein_id gnl|my_center|LOCUS_04930 51837 50743 gene locus_tag LOCUS_04940 51837 50743 CDS product Rep family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549058.1 protein_id gnl|my_center|LOCUS_04940 52556 52008 gene locus_tag LOCUS_04950 52556 52008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 53655 52558 gene locus_tag LOCUS_04960 53655 52558 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549060.1 protein_id gnl|my_center|LOCUS_04960 53963 53655 gene locus_tag LOCUS_04970 53963 53655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549061.1 protein_id gnl|my_center|LOCUS_04970 54105 55025 gene locus_tag LOCUS_04980 54105 55025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 55395 58895 gene locus_tag LOCUS_04990 55395 58895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 >Feature sequence006 151 816 gene locus_tag LOCUS_05000 151 816 CDS product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547977.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05000 926 1075 gene locus_tag LOCUS_05010 926 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 1653 1737 gene locus_tag LOCUS_t00050 1653 1737 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2618 1770 gene locus_tag LOCUS_05020 2618 1770 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548442.1 protein_id gnl|my_center|LOCUS_05020 2724 4781 gene locus_tag LOCUS_05030 2724 4781 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548440.1 protein_id gnl|my_center|LOCUS_05030 4802 5155 gene locus_tag LOCUS_05040 4802 5155 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548438.1 protein_id gnl|my_center|LOCUS_05040 5161 5856 gene locus_tag LOCUS_05050 5161 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05050 5789 6349 gene locus_tag LOCUS_05060 5789 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05060 6327 8768 gene locus_tag LOCUS_05070 6327 8768 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254507.1 protein_id gnl|my_center|LOCUS_05070 8768 9745 gene locus_tag LOCUS_05080 8768 9745 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254506.1 protein_id gnl|my_center|LOCUS_05080 10699 9803 gene locus_tag LOCUS_05090 10699 9803 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254505.1 protein_id gnl|my_center|LOCUS_05090 11171 10821 gene locus_tag LOCUS_05100 11171 10821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 11662 11171 gene locus_tag LOCUS_05110 11662 11171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 12179 11745 gene locus_tag LOCUS_05120 12179 11745 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548425.1 protein_id gnl|my_center|LOCUS_05120 12275 13021 gene locus_tag LOCUS_05130 12275 13021 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548423.1 protein_id gnl|my_center|LOCUS_05130 13014 14225 gene locus_tag LOCUS_05140 13014 14225 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613400.1 protein_id gnl|my_center|LOCUS_05140 14237 14893 gene locus_tag LOCUS_05150 gene trmB 14237 14893 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548419.1 protein_id gnl|my_center|LOCUS_05150 15349 14966 gene locus_tag LOCUS_05160 15349 14966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 15479 15799 gene locus_tag LOCUS_05170 15479 15799 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254504.1 protein_id gnl|my_center|LOCUS_05170 15824 16471 gene locus_tag LOCUS_05180 15824 16471 CDS product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548415.1 protein_id gnl|my_center|LOCUS_05180 16583 17221 gene locus_tag LOCUS_05190 16583 17221 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644620.1 protein_id gnl|my_center|LOCUS_05190 17805 19118 gene locus_tag LOCUS_05200 gene murC 17805 19118 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548413.1 protein_id gnl|my_center|LOCUS_05200 19602 21035 gene locus_tag LOCUS_05210 19602 21035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05210 21073 22242 gene locus_tag LOCUS_05220 21073 22242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05220 22262 23092 gene locus_tag LOCUS_05230 gene mutM 22262 23092 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548349.1 protein_id gnl|my_center|LOCUS_05230 23089 23685 gene locus_tag LOCUS_05240 gene coaE 23089 23685 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548347.1 protein_id gnl|my_center|LOCUS_05240 23690 24154 gene locus_tag LOCUS_05250 gene nrdR 23690 24154 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548345.1 protein_id gnl|my_center|LOCUS_05250 24162 25502 gene locus_tag LOCUS_05260 24162 25502 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548343.1 protein_id gnl|my_center|LOCUS_05260 25517 26416 gene locus_tag LOCUS_05270 gene dnaI 25517 26416 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254494.1 protein_id gnl|my_center|LOCUS_05270 26698 28629 gene locus_tag LOCUS_05280 gene thrS 26698 28629 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548338.1 protein_id gnl|my_center|LOCUS_05280 28800 29234 gene locus_tag LOCUS_05290 28800 29234 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548336.1 protein_id gnl|my_center|LOCUS_05290 29231 29662 gene locus_tag LOCUS_05300 29231 29662 CDS product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548334.1 protein_id gnl|my_center|LOCUS_05300 29870 31111 gene locus_tag LOCUS_05310 29870 31111 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546414.1 protein_id gnl|my_center|LOCUS_05310 31326 31844 gene locus_tag LOCUS_05320 gene infC 31326 31844 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075917325.1 protein_id gnl|my_center|LOCUS_05320 31863 32063 gene locus_tag LOCUS_05330 gene rpmI 31863 32063 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548328.1 protein_id gnl|my_center|LOCUS_05330 32096 32452 gene locus_tag LOCUS_05340 gene rplT 32096 32452 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548326.1 protein_id gnl|my_center|LOCUS_05340 33500 32499 gene locus_tag LOCUS_05350 gene add 33500 32499 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548323.1 protein_id gnl|my_center|LOCUS_05350 33662 34180 gene locus_tag LOCUS_05360 33662 34180 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254490.1 protein_id gnl|my_center|LOCUS_05360 34177 35286 gene locus_tag LOCUS_05370 gene yqeH 34177 35286 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548317.1 protein_id gnl|my_center|LOCUS_05370 35286 35912 gene locus_tag LOCUS_05380 35286 35912 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548315.1 protein_id gnl|my_center|LOCUS_05380 35905 36501 gene locus_tag LOCUS_05390 gene yqeK 35905 36501 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548313.1 protein_id gnl|my_center|LOCUS_05390 36524 36871 gene locus_tag LOCUS_05400 gene rsfS 36524 36871 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548311.1 protein_id gnl|my_center|LOCUS_05400 36882 38039 gene locus_tag LOCUS_05410 36882 38039 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548309.1 protein_id gnl|my_center|LOCUS_05410 38039 38584 gene locus_tag LOCUS_05420 38039 38584 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548307.1 protein_id gnl|my_center|LOCUS_05420 38671 39399 gene locus_tag LOCUS_05430 38671 39399 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548305.1 protein_id gnl|my_center|LOCUS_05430 39383 40903 gene locus_tag LOCUS_05440 39383 40903 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254489.1 protein_id gnl|my_center|LOCUS_05440 41926 40943 gene locus_tag LOCUS_05450 gene yidC 41926 40943 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254488.1 protein_id gnl|my_center|LOCUS_05450 42265 41990 gene locus_tag LOCUS_05460 42265 41990 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548299.1 protein_id gnl|my_center|LOCUS_05460 42363 43124 gene locus_tag LOCUS_05470 42363 43124 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548298.1 protein_id gnl|my_center|LOCUS_05470 43212 43568 gene locus_tag LOCUS_05480 43212 43568 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254487.1 protein_id gnl|my_center|LOCUS_05480 43857 44906 gene locus_tag LOCUS_05490 gene pheS 43857 44906 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548296.1 protein_id gnl|my_center|LOCUS_05490 44906 47320 gene locus_tag LOCUS_05500 gene pheT 44906 47320 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548294.1 protein_id gnl|my_center|LOCUS_05500 47384 48478 gene locus_tag LOCUS_05510 gene mltG 47384 48478 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564593.1 protein_id gnl|my_center|LOCUS_05510 48559 49041 gene locus_tag LOCUS_05520 gene greA 48559 49041 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548292.1 protein_id gnl|my_center|LOCUS_05520 49577 49092 gene locus_tag LOCUS_05530 49577 49092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05530 49974 49567 gene locus_tag LOCUS_05540 49974 49567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05540 51556 49904 gene locus_tag LOCUS_05550 51556 49904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 51732 53771 gene locus_tag LOCUS_05560 51732 53771 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254485.1 protein_id gnl|my_center|LOCUS_05560 53844 53993 gene locus_tag LOCUS_05570 gene rpmG 53844 53993 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548272.1 protein_id gnl|my_center|LOCUS_05570 54048 54605 gene locus_tag LOCUS_05580 54048 54605 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548253.1 protein_id gnl|my_center|LOCUS_05580 54621 55307 gene locus_tag LOCUS_05590 54621 55307 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254484.1 protein_id gnl|my_center|LOCUS_05590 55310 55540 gene locus_tag LOCUS_05600 55310 55540 CDS product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548250.1 protein_id gnl|my_center|LOCUS_05600 55576 55842 gene locus_tag LOCUS_05610 55576 55842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05610 >Feature sequence007 <1 1507 gene locus_tag LOCUS_05620 <1 1507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964376.1:WG repeat-containing protein 1925 1575 gene locus_tag LOCUS_05630 1925 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 2239 1961 gene locus_tag LOCUS_05640 2239 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 3972 2323 gene locus_tag LOCUS_05650 3972 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 4477 4404 gene locus_tag LOCUS_t00060 4477 4404 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4617 4546 gene locus_tag LOCUS_t00070 4617 4546 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5117 4773 gene locus_tag LOCUS_05660 5117 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 5245 5157 gene locus_tag LOCUS_t00080 5245 5157 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5406 5332 gene locus_tag LOCUS_t00090 5406 5332 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5771 5698 gene locus_tag LOCUS_t00100 5771 5698 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5850 5778 gene locus_tag LOCUS_t00110 5850 5778 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5927 5854 gene locus_tag LOCUS_t00120 5927 5854 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6644 6183 gene locus_tag LOCUS_05670 6644 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 8108 8038 gene locus_tag LOCUS_t00130 8108 8038 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9060 8152 gene locus_tag LOCUS_05680 9060 8152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 10267 9044 gene locus_tag LOCUS_05690 gene dcm 10267 9044 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203404.1 protein_id gnl|my_center|LOCUS_05690 11334 10264 gene locus_tag LOCUS_05700 11334 10264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 11661 11398 gene locus_tag LOCUS_05710 11661 11398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 12286 11615 gene locus_tag LOCUS_05720 12286 11615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 12518 12447 gene locus_tag LOCUS_t00140 12518 12447 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 13215 12772 gene locus_tag LOCUS_05730 13215 12772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 13649 13218 gene locus_tag LOCUS_05740 13649 13218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 14009 14971 gene locus_tag LOCUS_05750 14009 14971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 15005 15874 gene locus_tag LOCUS_05760 15005 15874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 15874 16677 gene locus_tag LOCUS_05770 15874 16677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 16739 17491 gene locus_tag LOCUS_05780 gene dam 16739 17491 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369388.1 protein_id gnl|my_center|LOCUS_05780 17503 18402 gene locus_tag LOCUS_05790 17503 18402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 18439 19002 gene locus_tag LOCUS_05800 18439 19002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 19013 19834 gene locus_tag LOCUS_05810 19013 19834 CDS product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549870.1 protein_id gnl|my_center|LOCUS_05810 19831 20316 gene locus_tag LOCUS_05820 19831 20316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 20300 20512 gene locus_tag LOCUS_05830 20300 20512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 20629 20991 gene locus_tag LOCUS_05840 gene dut 20629 20991 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016845.1 protein_id gnl|my_center|LOCUS_05840 21017 21970 gene locus_tag LOCUS_05850 21017 21970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 22041 22391 gene locus_tag LOCUS_05860 22041 22391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 22394 22915 gene locus_tag LOCUS_05870 22394 22915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 22969 23418 gene locus_tag LOCUS_05880 22969 23418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 23446 24051 gene locus_tag LOCUS_05890 23446 24051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 24337 25386 gene locus_tag LOCUS_05900 24337 25386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 25444 26724 gene locus_tag LOCUS_05910 25444 26724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 26811 27455 gene locus_tag LOCUS_05920 26811 27455 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525087.1 protein_id gnl|my_center|LOCUS_05920 27476 27700 gene locus_tag LOCUS_05930 27476 27700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 27794 28330 gene locus_tag LOCUS_05940 27794 28330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 28314 28586 gene locus_tag LOCUS_05950 28314 28586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 28608 29024 gene locus_tag LOCUS_05960 28608 29024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 29355 29065 gene locus_tag LOCUS_05970 29355 29065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 29394 29603 gene locus_tag LOCUS_05980 29394 29603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 29688 31175 gene locus_tag LOCUS_05990 29688 31175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 32622 31396 gene locus_tag LOCUS_06000 gene tnpB 32622 31396 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054297574.1 protein_id gnl|my_center|LOCUS_06000 32822 33268 gene locus_tag LOCUS_06010 32822 33268 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358004.1 protein_id gnl|my_center|LOCUS_06010 33336 33866 gene locus_tag LOCUS_06020 33336 33866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 35035 35107 gene locus_tag LOCUS_t00150 35035 35107 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 35290 35365 gene locus_tag LOCUS_t00160 35290 35365 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 35730 35473 gene locus_tag LOCUS_06030 35730 35473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 35938 36447 gene locus_tag LOCUS_06040 35938 36447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 37586 37780 gene locus_tag LOCUS_06050 37586 37780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 37780 38091 gene locus_tag LOCUS_06060 37780 38091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 38781 38960 gene locus_tag LOCUS_06070 38781 38960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 38974 40833 gene locus_tag LOCUS_06080 gene ligA 38974 40833 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965961.1 protein_id gnl|my_center|LOCUS_06080 40820 41305 gene locus_tag LOCUS_06090 40820 41305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 41283 41987 gene locus_tag LOCUS_06100 41283 41987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 42116 42430 gene locus_tag LOCUS_06110 42116 42430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 42417 43139 gene locus_tag LOCUS_06120 42417 43139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06120 43330 43833 gene locus_tag LOCUS_06130 43330 43833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 43961 44443 gene locus_tag LOCUS_06140 43961 44443 CDS product NADAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_06140 44451 44828 gene locus_tag LOCUS_06150 44451 44828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 44825 45145 gene locus_tag LOCUS_06160 44825 45145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 45159 45608 gene locus_tag LOCUS_06170 45159 45608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 45626 46996 gene locus_tag LOCUS_06180 45626 46996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 >Feature sequence008 293 1549 gene locus_tag LOCUS_06190 293 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 1539 2495 gene locus_tag LOCUS_06200 1539 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 2495 3433 gene locus_tag LOCUS_06210 2495 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 3442 3693 gene locus_tag LOCUS_06220 3442 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 3695 3916 gene locus_tag LOCUS_06230 3695 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 3909 4103 gene locus_tag LOCUS_06240 3909 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 4078 4605 gene locus_tag LOCUS_06250 4078 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 4595 5230 gene locus_tag LOCUS_06260 4595 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 5234 5692 gene locus_tag LOCUS_06270 5234 5692 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926422.1 protein_id gnl|my_center|LOCUS_06270 5685 6071 gene locus_tag LOCUS_06280 5685 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 6090 7448 gene locus_tag LOCUS_06290 gene dnaB 6090 7448 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368755.1 protein_id gnl|my_center|LOCUS_06290 7476 7880 gene locus_tag LOCUS_06300 7476 7880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 7892 8869 gene locus_tag LOCUS_06310 7892 8869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 8866 9108 gene locus_tag LOCUS_06320 8866 9108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 9156 9416 gene locus_tag LOCUS_06330 9156 9416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 9443 9655 gene locus_tag LOCUS_06340 9443 9655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 9668 9829 gene locus_tag LOCUS_06350 9668 9829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 9831 12881 gene locus_tag LOCUS_06360 9831 12881 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_06360 12881 13057 gene locus_tag LOCUS_06370 12881 13057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 13059 13448 gene locus_tag LOCUS_06380 13059 13448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 13441 14406 gene locus_tag LOCUS_06390 13441 14406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 14396 14623 gene locus_tag LOCUS_06400 14396 14623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 14626 15147 gene locus_tag LOCUS_06410 14626 15147 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048418.1 protein_id gnl|my_center|LOCUS_06410 15212 15376 gene locus_tag LOCUS_06420 15212 15376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 15393 15815 gene locus_tag LOCUS_06430 15393 15815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 16638 16712 gene locus_tag LOCUS_t00170 16638 16712 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 17819 17007 gene locus_tag LOCUS_06440 17819 17007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 18039 17830 gene locus_tag LOCUS_06450 18039 17830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 22974 18052 gene locus_tag LOCUS_06460 22974 18052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 25073 22992 gene locus_tag LOCUS_06470 25073 22992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 25856 25179 gene locus_tag LOCUS_06480 25856 25179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 26588 25869 gene locus_tag LOCUS_06490 26588 25869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 28598 26616 gene locus_tag LOCUS_06500 28598 26616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 29727 28777 gene locus_tag LOCUS_06510 29727 28777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 31415 29727 gene locus_tag LOCUS_06520 31415 29727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 33279 31429 gene locus_tag LOCUS_06530 33279 31429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 33688 33272 gene locus_tag LOCUS_06540 33688 33272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 33827 33681 gene locus_tag LOCUS_06550 33827 33681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 34973 33987 gene locus_tag LOCUS_06560 34973 33987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 35810 35016 gene locus_tag LOCUS_06570 35810 35016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 37926 35803 gene locus_tag LOCUS_06580 37926 35803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 38125 37919 gene locus_tag LOCUS_06590 38125 37919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 38394 38128 gene locus_tag LOCUS_06600 38394 38128 CDS product DUF6275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386748.1 protein_id gnl|my_center|LOCUS_06600 40082 38394 gene locus_tag LOCUS_06610 40082 38394 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143988.1 protein_id gnl|my_center|LOCUS_06610 40567 40151 gene locus_tag LOCUS_06620 40567 40151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 40929 40570 gene locus_tag LOCUS_06630 40929 40570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 42428 43024 gene locus_tag LOCUS_06640 42428 43024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 43075 43518 gene locus_tag LOCUS_06650 43075 43518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 43603 44082 gene locus_tag LOCUS_06660 43603 44082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 44208 44651 gene locus_tag LOCUS_06670 gene ssb 44208 44651 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420524.1 protein_id gnl|my_center|LOCUS_06670 44872 46248 gene locus_tag LOCUS_06680 44872 46248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 46721 46906 gene locus_tag LOCUS_06690 46721 46906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 >Feature sequence009 297 224 gene locus_tag LOCUS_t00180 297 224 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 503 2521 gene locus_tag LOCUS_06700 503 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 2639 3781 gene locus_tag LOCUS_06710 2639 3781 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254005.1 protein_id gnl|my_center|LOCUS_06710 4730 3846 gene locus_tag LOCUS_06720 4730 3846 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254003.1 protein_id gnl|my_center|LOCUS_06720 6200 4827 gene locus_tag LOCUS_06730 gene dnaB 6200 4827 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549341.1 protein_id gnl|my_center|LOCUS_06730 6658 6203 gene locus_tag LOCUS_06740 gene rplI 6658 6203 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549343.1 protein_id gnl|my_center|LOCUS_06740 8688 6670 gene locus_tag LOCUS_06750 8688 6670 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549345.1 protein_id gnl|my_center|LOCUS_06750 9713 8796 gene locus_tag LOCUS_06760 9713 8796 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475999.1 protein_id gnl|my_center|LOCUS_06760 10043 9807 gene locus_tag LOCUS_06770 gene rpsR 10043 9807 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701427.1 protein_id gnl|my_center|LOCUS_06770 10586 10068 gene locus_tag LOCUS_06780 gene ssb 10586 10068 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254001.1 protein_id gnl|my_center|LOCUS_06780 10916 10620 gene locus_tag LOCUS_06790 gene rpsF 10916 10620 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549370.1 protein_id gnl|my_center|LOCUS_06790 13592 11103 gene locus_tag LOCUS_06800 gene gyrA 13592 11103 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549372.1 protein_id gnl|my_center|LOCUS_06800 15570 13603 gene locus_tag LOCUS_06810 gene gyrB 15570 13603 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549374.1 protein_id gnl|my_center|LOCUS_06810 16695 15571 gene locus_tag LOCUS_06820 gene recF 16695 15571 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549377.1 protein_id gnl|my_center|LOCUS_06820 16848 16699 gene locus_tag LOCUS_06830 16848 16699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 18256 17126 gene locus_tag LOCUS_06840 gene dnaN 18256 17126 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549381.1 protein_id gnl|my_center|LOCUS_06840 19801 18437 gene locus_tag LOCUS_06850 gene dnaA 19801 18437 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011253999.1 protein_id gnl|my_center|LOCUS_06850 20287 20427 gene locus_tag LOCUS_06860 gene rpmH 20287 20427 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549412.1 protein_id gnl|my_center|LOCUS_06860 20476 20844 gene locus_tag LOCUS_06870 gene rnpA 20476 20844 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549413.1 protein_id gnl|my_center|LOCUS_06870 20858 21721 gene locus_tag LOCUS_06880 20858 21721 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254638.1 protein_id gnl|my_center|LOCUS_06880 21832 23217 gene locus_tag LOCUS_06890 gene mnmE 21832 23217 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549418.1 protein_id gnl|my_center|LOCUS_06890 23225 25123 gene locus_tag LOCUS_06900 gene mnmG 23225 25123 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549419.1 protein_id gnl|my_center|LOCUS_06900 25369 27177 gene locus_tag LOCUS_06910 gene spxB 25369 27177 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254637.1 protein_id gnl|my_center|LOCUS_06910 27323 28711 gene locus_tag LOCUS_06920 gene gndA 27323 28711 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254636.1 protein_id gnl|my_center|LOCUS_06920 28811 30364 gene locus_tag LOCUS_06930 28811 30364 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549425.1 protein_id gnl|my_center|LOCUS_06930 32261 30450 gene locus_tag LOCUS_06940 32261 30450 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399157.1 protein_id gnl|my_center|LOCUS_06940 32697 32903 gene locus_tag LOCUS_06950 32697 32903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 33527 33120 gene locus_tag LOCUS_06960 33527 33120 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546185.1 protein_id gnl|my_center|LOCUS_06960 34847 33573 gene locus_tag LOCUS_06970 34847 33573 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211863.1 protein_id gnl|my_center|LOCUS_06970 35003 35134 gene locus_tag LOCUS_06980 35003 35134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 35154 35594 gene locus_tag LOCUS_06990 35154 35594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 36090 35665 gene locus_tag LOCUS_07000 36090 35665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07000 36845 36096 gene locus_tag LOCUS_07010 36845 36096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07010 38948 36849 gene locus_tag LOCUS_07020 38948 36849 CDS product putative ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547166.1 protein_id gnl|my_center|LOCUS_07020 39192 40583 gene locus_tag LOCUS_07030 39192 40583 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254310.1 protein_id gnl|my_center|LOCUS_07030 40984 41403 gene locus_tag LOCUS_07040 40984 41403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 41593 42693 gene locus_tag LOCUS_07050 41593 42693 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356675.1 protein_id gnl|my_center|LOCUS_07050 43182 42676 gene locus_tag LOCUS_07060 43182 42676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 43289 43152 gene locus_tag LOCUS_07070 43289 43152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 >Feature sequence010 2280 112 gene locus_tag LOCUS_07080 2280 112 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254211.1 protein_id gnl|my_center|LOCUS_07080 2486 2668 gene locus_tag LOCUS_07090 2486 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 2788 3054 gene locus_tag LOCUS_07100 2788 3054 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546482.1 protein_id gnl|my_center|LOCUS_07100 3054 4793 gene locus_tag LOCUS_07110 gene ptsP 3054 4793 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254212.1 protein_id gnl|my_center|LOCUS_07110 4987 5247 gene locus_tag LOCUS_07120 4987 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 5350 6003 gene locus_tag LOCUS_07130 5350 6003 CDS product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546487.1 protein_id gnl|my_center|LOCUS_07130 6060 6941 gene locus_tag LOCUS_07140 6060 6941 CDS product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254214.1 protein_id gnl|my_center|LOCUS_07140 7552 6947 gene locus_tag LOCUS_07150 7552 6947 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546492.1 protein_id gnl|my_center|LOCUS_07150 8246 7623 gene locus_tag LOCUS_07160 8246 7623 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546493.1 protein_id gnl|my_center|LOCUS_07160 8324 8950 gene locus_tag LOCUS_07170 8324 8950 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546495.1 protein_id gnl|my_center|LOCUS_07170 8950 9762 gene locus_tag LOCUS_07180 8950 9762 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254215.1 protein_id gnl|my_center|LOCUS_07180 9762 10661 gene locus_tag LOCUS_07190 9762 10661 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546500.1 protein_id gnl|my_center|LOCUS_07190 10761 12536 gene locus_tag LOCUS_07200 10761 12536 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254216.1 protein_id gnl|my_center|LOCUS_07200 13842 12604 gene locus_tag LOCUS_07210 13842 12604 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100975.1 protein_id gnl|my_center|LOCUS_07210 14970 13912 gene locus_tag LOCUS_07220 14970 13912 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546505.1 protein_id gnl|my_center|LOCUS_07220 15074 15454 gene locus_tag LOCUS_07230 15074 15454 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546509.1 protein_id gnl|my_center|LOCUS_07230 15466 16647 gene locus_tag LOCUS_07240 15466 16647 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546511.1 protein_id gnl|my_center|LOCUS_07240 16720 17277 gene locus_tag LOCUS_07250 16720 17277 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546513.1 protein_id gnl|my_center|LOCUS_07250 17279 17713 gene locus_tag LOCUS_07260 17279 17713 CDS product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546515.1 protein_id gnl|my_center|LOCUS_07260 17735 20158 gene locus_tag LOCUS_07270 17735 20158 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546517.1 protein_id gnl|my_center|LOCUS_07270 20161 21375 gene locus_tag LOCUS_07280 20161 21375 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254218.1 protein_id gnl|my_center|LOCUS_07280 21372 22607 gene locus_tag LOCUS_07290 21372 22607 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546521.1 protein_id gnl|my_center|LOCUS_07290 22608 23336 gene locus_tag LOCUS_07300 22608 23336 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546523.1 protein_id gnl|my_center|LOCUS_07300 23395 24435 gene locus_tag LOCUS_07310 23395 24435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 24435 24998 gene locus_tag LOCUS_07320 gene pgsA 24435 24998 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546529.1 protein_id gnl|my_center|LOCUS_07320 25161 26243 gene locus_tag LOCUS_07330 gene recA 25161 26243 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546531.1 protein_id gnl|my_center|LOCUS_07330 26370 27992 gene locus_tag LOCUS_07340 gene rny 26370 27992 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254219.1 protein_id gnl|my_center|LOCUS_07340 28094 29236 gene locus_tag LOCUS_07350 28094 29236 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546535.1 protein_id gnl|my_center|LOCUS_07350 29919 29254 gene locus_tag LOCUS_07360 29919 29254 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546537.1 protein_id gnl|my_center|LOCUS_07360 30042 31229 gene locus_tag LOCUS_07370 30042 31229 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546538.1 protein_id gnl|my_center|LOCUS_07370 31226 31897 gene locus_tag LOCUS_07380 31226 31897 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254220.1 protein_id gnl|my_center|LOCUS_07380 31979 32524 gene locus_tag LOCUS_07390 gene raiA 31979 32524 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254221.1 protein_id gnl|my_center|LOCUS_07390 32682 35081 gene locus_tag LOCUS_07400 gene secA 32682 35081 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254222.1 protein_id gnl|my_center|LOCUS_07400 35281 36279 gene locus_tag LOCUS_07410 gene prfB 35281 36279 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095522727.1 protein_id gnl|my_center|LOCUS_07410 36298 36576 gene locus_tag LOCUS_07420 36298 36576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 36569 37528 gene locus_tag LOCUS_07430 gene hprK 36569 37528 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546560.1 protein_id gnl|my_center|LOCUS_07430 37525 38361 gene locus_tag LOCUS_07440 gene lgt 37525 38361 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613330.1 protein_id gnl|my_center|LOCUS_07440 38398 39417 gene locus_tag LOCUS_07450 38398 39417 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546563.1 protein_id gnl|my_center|LOCUS_07450 39489 40424 gene locus_tag LOCUS_07460 gene trxB 39489 40424 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254223.1 protein_id gnl|my_center|LOCUS_07460 40593 41591 gene locus_tag LOCUS_07470 40593 41591 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548182.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence011 253 125 gene locus_tag LOCUS_07480 253 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 1533 349 gene locus_tag LOCUS_07490 1533 349 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547458.1 protein_id gnl|my_center|LOCUS_07490 1660 2301 gene locus_tag LOCUS_07500 1660 2301 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254444.1 protein_id gnl|my_center|LOCUS_07500 3127 2330 gene locus_tag LOCUS_07510 3127 2330 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547157.1 protein_id gnl|my_center|LOCUS_07510 3845 3234 gene locus_tag LOCUS_07520 3845 3234 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254296.1 protein_id gnl|my_center|LOCUS_07520 4780 3854 gene locus_tag LOCUS_07530 4780 3854 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254272.1 protein_id gnl|my_center|LOCUS_07530 4922 6724 gene locus_tag LOCUS_07540 gene uvrC 4922 6724 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547051.1 protein_id gnl|my_center|LOCUS_07540 6832 8118 gene locus_tag LOCUS_07550 gene obgE 6832 8118 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254297.1 protein_id gnl|my_center|LOCUS_07550 8148 10073 gene locus_tag LOCUS_07560 8148 10073 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025015105.1 protein_id gnl|my_center|LOCUS_07560 10087 11016 gene locus_tag LOCUS_07570 gene rnz 10087 11016 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547055.1 protein_id gnl|my_center|LOCUS_07570 11021 11815 gene locus_tag LOCUS_07580 11021 11815 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547056.1 protein_id gnl|my_center|LOCUS_07580 11822 12151 gene locus_tag LOCUS_07590 11822 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 12268 12459 gene locus_tag LOCUS_07600 gene rpmF 12268 12459 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547064.1 protein_id gnl|my_center|LOCUS_07600 12519 14084 gene locus_tag LOCUS_07610 12519 14084 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547066.1 protein_id gnl|my_center|LOCUS_07610 14342 14142 gene locus_tag LOCUS_07620 14342 14142 CDS product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254299.1 protein_id gnl|my_center|LOCUS_07620 14445 17561 gene locus_tag LOCUS_07630 14445 17561 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547069.1 protein_id gnl|my_center|LOCUS_07630 17491 17703 gene locus_tag LOCUS_07640 17491 17703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 17735 18694 gene locus_tag LOCUS_07650 gene pfkA 17735 18694 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547070.1 protein_id gnl|my_center|LOCUS_07650 18729 20498 gene locus_tag LOCUS_07660 gene pyk 18729 20498 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547072.1 protein_id gnl|my_center|LOCUS_07660 20611 21504 gene locus_tag LOCUS_07670 20611 21504 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254300.1 protein_id gnl|my_center|LOCUS_07670 21476 22384 gene locus_tag LOCUS_07680 gene xerD 21476 22384 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547075.1 protein_id gnl|my_center|LOCUS_07680 22390 22752 gene locus_tag LOCUS_07690 22390 22752 CDS product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254301.1 protein_id gnl|my_center|LOCUS_07690 22745 23488 gene locus_tag LOCUS_07700 22745 23488 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547078.1 protein_id gnl|my_center|LOCUS_07700 23478 24068 gene locus_tag LOCUS_07710 gene scpB 23478 24068 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547080.1 protein_id gnl|my_center|LOCUS_07710 24070 24789 gene locus_tag LOCUS_07720 24070 24789 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547082.1 protein_id gnl|my_center|LOCUS_07720 24850 25611 gene locus_tag LOCUS_07730 24850 25611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 25876 26469 gene locus_tag LOCUS_07740 25876 26469 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674489.1 protein_id gnl|my_center|LOCUS_07740 26577 27242 gene locus_tag LOCUS_07750 gene cmk 26577 27242 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 protein_id gnl|my_center|LOCUS_07750 27305 28507 gene locus_tag LOCUS_07760 gene rpsA 27305 28507 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547091.1 protein_id gnl|my_center|LOCUS_07760 28582 29889 gene locus_tag LOCUS_07770 gene der 28582 29889 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254303.1 protein_id gnl|my_center|LOCUS_07770 30053 30328 gene locus_tag LOCUS_07780 30053 30328 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547110.1 protein_id gnl|my_center|LOCUS_07780 30429 31688 gene locus_tag LOCUS_07790 30429 31688 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547113.1 protein_id gnl|my_center|LOCUS_07790 31791 34535 gene locus_tag LOCUS_07800 31791 34535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 34528 35445 gene locus_tag LOCUS_07810 34528 35445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 35616 38714 gene locus_tag LOCUS_07820 35616 38714 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775680.1 protein_id gnl|my_center|LOCUS_07820 >Feature sequence012 917 105 gene locus_tag LOCUS_07830 gene yidA 917 105 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824472.1 protein_id gnl|my_center|LOCUS_07830 1267 914 gene locus_tag LOCUS_07840 1267 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07840 1952 1290 gene locus_tag LOCUS_07850 1952 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07850 2084 2410 gene locus_tag LOCUS_07860 2084 2410 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563651.1 protein_id gnl|my_center|LOCUS_07860 3832 2441 gene locus_tag LOCUS_07870 3832 2441 CDS product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254371.1 protein_id gnl|my_center|LOCUS_07870 4809 3832 gene locus_tag LOCUS_07880 4809 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547594.1 protein_id gnl|my_center|LOCUS_07880 5537 4809 gene locus_tag LOCUS_07890 5537 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254372.1 protein_id gnl|my_center|LOCUS_07890 5627 6196 gene locus_tag LOCUS_07900 gene lepB 5627 6196 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547598.1 protein_id gnl|my_center|LOCUS_07900 6224 6409 gene locus_tag LOCUS_07910 6224 6409 CDS product LBP_cg2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547599.1 protein_id gnl|my_center|LOCUS_07910 7324 6488 gene locus_tag LOCUS_07920 7324 6488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254375.1 protein_id gnl|my_center|LOCUS_07920 8146 7331 gene locus_tag LOCUS_07930 8146 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254375.1 protein_id gnl|my_center|LOCUS_07930 8856 8149 gene locus_tag LOCUS_07940 8856 8149 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547603.1 protein_id gnl|my_center|LOCUS_07940 9226 8858 gene locus_tag LOCUS_07950 9226 8858 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547604.1 protein_id gnl|my_center|LOCUS_07950 10798 9551 gene locus_tag LOCUS_07960 gene pepT 10798 9551 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547606.1 protein_id gnl|my_center|LOCUS_07960 11606 10809 gene locus_tag LOCUS_07970 11606 10809 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547612.1 protein_id gnl|my_center|LOCUS_07970 12286 11603 gene locus_tag LOCUS_07980 12286 11603 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547613.1 protein_id gnl|my_center|LOCUS_07980 13263 12409 gene locus_tag LOCUS_07990 13263 12409 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011669024.1 protein_id gnl|my_center|LOCUS_07990 14015 13275 gene locus_tag LOCUS_08000 14015 13275 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011669023.1 protein_id gnl|my_center|LOCUS_08000 14696 14019 gene locus_tag LOCUS_08010 14696 14019 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547325.1 protein_id gnl|my_center|LOCUS_08010 15336 14677 gene locus_tag LOCUS_08020 15336 14677 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547323.1 protein_id gnl|my_center|LOCUS_08020 16408 15551 gene locus_tag LOCUS_08030 16408 15551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 17803 16517 gene locus_tag LOCUS_08040 17803 16517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 18057 17884 gene locus_tag LOCUS_08050 18057 17884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 18489 18136 gene locus_tag LOCUS_08060 18489 18136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 19020 18508 gene locus_tag LOCUS_08070 19020 18508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 19920 19033 gene locus_tag LOCUS_08080 19920 19033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 21396 20278 gene locus_tag LOCUS_08090 gene rpoD 21396 20278 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254377.1 protein_id gnl|my_center|LOCUS_08090 23223 21412 gene locus_tag LOCUS_08100 gene dnaG 23223 21412 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547619.1 protein_id gnl|my_center|LOCUS_08100 25319 23247 gene locus_tag LOCUS_08110 gene glyS 25319 23247 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547620.1 protein_id gnl|my_center|LOCUS_08110 26229 25312 gene locus_tag LOCUS_08120 gene glyQ 26229 25312 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547621.1 protein_id gnl|my_center|LOCUS_08120 27276 26524 gene locus_tag LOCUS_08130 gene recO 27276 26524 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547622.1 protein_id gnl|my_center|LOCUS_08130 28188 27277 gene locus_tag LOCUS_08140 gene era 28188 27277 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254378.1 protein_id gnl|my_center|LOCUS_08140 28740 28213 gene locus_tag LOCUS_08150 gene ybeY 28740 28213 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547628.1 protein_id gnl|my_center|LOCUS_08150 29706 28744 gene locus_tag LOCUS_08160 29706 28744 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254379.1 protein_id gnl|my_center|LOCUS_08160 30177 29734 gene locus_tag LOCUS_08170 30177 29734 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547630.1 protein_id gnl|my_center|LOCUS_08170 30460 30284 gene locus_tag LOCUS_08180 gene rpsU 30460 30284 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002880182.1 protein_id gnl|my_center|LOCUS_08180 30611 31453 gene locus_tag LOCUS_08190 30611 31453 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547712.1 protein_id gnl|my_center|LOCUS_08190 31838 31518 gene locus_tag LOCUS_08200 31838 31518 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548061.1 protein_id gnl|my_center|LOCUS_08200 32721 31840 gene locus_tag LOCUS_08210 gene sdaAA 32721 31840 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548060.1 protein_id gnl|my_center|LOCUS_08210 33483 32734 gene locus_tag LOCUS_08220 33483 32734 CDS product serine dehydratase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254449.1 protein_id gnl|my_center|LOCUS_08220 34362 33484 gene locus_tag LOCUS_08230 34362 33484 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547719.1 protein_id gnl|my_center|LOCUS_08230 34985 34428 gene locus_tag LOCUS_08240 gene msrA 34985 34428 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547717.1 protein_id gnl|my_center|LOCUS_08240 35340 35149 gene locus_tag LOCUS_08250 35340 35149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023376657.1 protein_id gnl|my_center|LOCUS_08250 36382 35621 gene locus_tag LOCUS_08260 36382 35621 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547854.1 protein_id gnl|my_center|LOCUS_08260 36815 36387 gene locus_tag LOCUS_08270 gene msrB 36815 36387 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548013.1 protein_id gnl|my_center|LOCUS_08270 36921 38105 gene locus_tag LOCUS_08280 36921 38105 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547041.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence013 295 68 gene locus_tag LOCUS_08290 295 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 438 286 gene locus_tag LOCUS_08300 438 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 767 1402 gene locus_tag LOCUS_08310 gene udk 767 1402 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546365.1 protein_id gnl|my_center|LOCUS_08310 1677 1429 gene locus_tag LOCUS_08320 1677 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 2458 1664 gene locus_tag LOCUS_08330 2458 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 3091 2558 gene locus_tag LOCUS_08340 3091 2558 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775286.1 protein_id gnl|my_center|LOCUS_08340 3734 3156 gene locus_tag LOCUS_08350 3734 3156 CDS product phenolic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641609.1 protein_id gnl|my_center|LOCUS_08350 5779 3851 gene locus_tag LOCUS_08360 5779 3851 CDS product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547194.1 protein_id gnl|my_center|LOCUS_08360 5972 6697 gene locus_tag LOCUS_08370 gene treR 5972 6697 CDS product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547196.1 protein_id gnl|my_center|LOCUS_08370 6713 8371 gene locus_tag LOCUS_08380 gene treC 6713 8371 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254315.1 protein_id gnl|my_center|LOCUS_08380 8820 8431 gene locus_tag LOCUS_08390 8820 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 9656 9006 gene locus_tag LOCUS_08400 9656 9006 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546369.1 protein_id gnl|my_center|LOCUS_08400 10308 9670 gene locus_tag LOCUS_08410 10308 9670 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546368.1 protein_id gnl|my_center|LOCUS_08410 11129 10305 gene locus_tag LOCUS_08420 11129 10305 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546367.1 protein_id gnl|my_center|LOCUS_08420 11880 11131 gene locus_tag LOCUS_08430 11880 11131 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546366.1 protein_id gnl|my_center|LOCUS_08430 13145 12324 gene locus_tag LOCUS_08440 13145 12324 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563836.1 protein_id gnl|my_center|LOCUS_08440 14968 13199 gene locus_tag LOCUS_08450 14968 13199 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254194.1 protein_id gnl|my_center|LOCUS_08450 16694 14961 gene locus_tag LOCUS_08460 16694 14961 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254193.1 protein_id gnl|my_center|LOCUS_08460 17135 16698 gene locus_tag LOCUS_08470 17135 16698 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254192.1 protein_id gnl|my_center|LOCUS_08470 18075 17221 gene locus_tag LOCUS_08480 18075 17221 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082599082.1 protein_id gnl|my_center|LOCUS_08480 19413 18175 gene locus_tag LOCUS_08490 19413 18175 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288985.1 protein_id gnl|my_center|LOCUS_08490 20910 19504 gene locus_tag LOCUS_08500 20910 19504 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549685.1 protein_id gnl|my_center|LOCUS_08500 22585 21092 gene locus_tag LOCUS_08510 22585 21092 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254595.1 protein_id gnl|my_center|LOCUS_08510 24765 22726 gene locus_tag LOCUS_08520 24765 22726 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254434.1 protein_id gnl|my_center|LOCUS_08520 25060 26346 gene locus_tag LOCUS_08530 25060 26346 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548475.1 protein_id gnl|my_center|LOCUS_08530 26382 27815 gene locus_tag LOCUS_08540 gene aaxC 26382 27815 CDS product arginine/agmatine antiporter AaxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892188.1 protein_id gnl|my_center|LOCUS_08540 27843 29129 gene locus_tag LOCUS_08550 27843 29129 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548475.1 protein_id gnl|my_center|LOCUS_08550 29960 29199 gene locus_tag LOCUS_08560 gene fetB 29960 29199 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254483.1 protein_id gnl|my_center|LOCUS_08560 30591 29938 gene locus_tag LOCUS_08570 30591 29938 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700976.1 protein_id gnl|my_center|LOCUS_08570 30888 30688 gene locus_tag LOCUS_08580 30888 30688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 32063 30888 gene locus_tag LOCUS_08590 32063 30888 CDS product M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546357.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence014 2092 1097 gene locus_tag LOCUS_08600 2092 1097 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567744.1 protein_id gnl|my_center|LOCUS_08600 3437 2211 gene locus_tag LOCUS_08610 3437 2211 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548780.1 protein_id gnl|my_center|LOCUS_08610 4728 3532 gene locus_tag LOCUS_08620 4728 3532 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548779.1 protein_id gnl|my_center|LOCUS_08620 5318 4728 gene locus_tag LOCUS_08630 5318 4728 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254062.1 protein_id gnl|my_center|LOCUS_08630 6086 5373 gene locus_tag LOCUS_08640 gene nrdG 6086 5373 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548777.1 protein_id gnl|my_center|LOCUS_08640 8296 6086 gene locus_tag LOCUS_08650 gene nrdD 8296 6086 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254061.1 protein_id gnl|my_center|LOCUS_08650 9837 8506 gene locus_tag LOCUS_08660 9837 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548775.1 protein_id gnl|my_center|LOCUS_08660 11816 9867 gene locus_tag LOCUS_08670 gene asnB 11816 9867 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548773.1 protein_id gnl|my_center|LOCUS_08670 13271 11877 gene locus_tag LOCUS_08680 13271 11877 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254060.1 protein_id gnl|my_center|LOCUS_08680 13806 13324 gene locus_tag LOCUS_08690 13806 13324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548767.1 protein_id gnl|my_center|LOCUS_08690 14770 13958 gene locus_tag LOCUS_08700 gene phnE 14770 13958 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548762.1 protein_id gnl|my_center|LOCUS_08700 15573 14770 gene locus_tag LOCUS_08710 gene phnE 15573 14770 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254058.1 protein_id gnl|my_center|LOCUS_08710 16351 15566 gene locus_tag LOCUS_08720 gene phnC 16351 15566 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548759.1 protein_id gnl|my_center|LOCUS_08720 17389 16460 gene locus_tag LOCUS_08730 17389 16460 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254057.1 protein_id gnl|my_center|LOCUS_08730 18284 17790 gene locus_tag LOCUS_08740 18284 17790 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548753.1 protein_id gnl|my_center|LOCUS_08740 18458 19261 gene locus_tag LOCUS_08750 18458 19261 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548752.1 protein_id gnl|my_center|LOCUS_08750 19270 19995 gene locus_tag LOCUS_08760 19270 19995 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194099.1 protein_id gnl|my_center|LOCUS_08760 20600 20040 gene locus_tag LOCUS_08770 20600 20040 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548750.1 protein_id gnl|my_center|LOCUS_08770 20686 21162 gene locus_tag LOCUS_08780 20686 21162 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613286.1 protein_id gnl|my_center|LOCUS_08780 22405 21230 gene locus_tag LOCUS_08790 22405 21230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 22912 22568 gene locus_tag LOCUS_08800 22912 22568 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167449.1 protein_id gnl|my_center|LOCUS_08800 23754 22936 gene locus_tag LOCUS_08810 23754 22936 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357254.1 protein_id gnl|my_center|LOCUS_08810 24658 23741 gene locus_tag LOCUS_08820 24658 23741 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357253.1 protein_id gnl|my_center|LOCUS_08820 25158 24670 gene locus_tag LOCUS_08830 25158 24670 CDS product PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156967.1 protein_id gnl|my_center|LOCUS_08830 26453 25296 gene locus_tag LOCUS_08840 gene nagA 26453 25296 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254054.1 protein_id gnl|my_center|LOCUS_08840 27681 26515 gene locus_tag LOCUS_08850 27681 26515 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898687.1 protein_id gnl|my_center|LOCUS_08850 28418 27702 gene locus_tag LOCUS_08860 28418 27702 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437811.1 protein_id gnl|my_center|LOCUS_08860 28578 31637 gene locus_tag LOCUS_08870 28578 31637 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548741.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence015 510 1043 gene locus_tag LOCUS_08880 510 1043 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546623.1 protein_id gnl|my_center|LOCUS_08880 1536 1060 gene locus_tag LOCUS_08890 gene tsaE 1536 1060 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546616.1 protein_id gnl|my_center|LOCUS_08890 2515 1538 gene locus_tag LOCUS_08900 gene pta 2515 1538 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641060.1 protein_id gnl|my_center|LOCUS_08900 3283 2588 gene locus_tag LOCUS_08910 3283 2588 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546612.1 protein_id gnl|my_center|LOCUS_08910 3360 4226 gene locus_tag LOCUS_08920 3360 4226 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546611.1 protein_id gnl|my_center|LOCUS_08920 4250 4765 gene locus_tag LOCUS_08930 4250 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254226.1 protein_id gnl|my_center|LOCUS_08930 5331 4762 gene locus_tag LOCUS_08940 5331 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 6087 5518 gene locus_tag LOCUS_08950 6087 5518 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254542.1 protein_id gnl|my_center|LOCUS_08950 6555 6100 gene locus_tag LOCUS_08960 gene smpB 6555 6100 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550138.1 protein_id gnl|my_center|LOCUS_08960 8912 6570 gene locus_tag LOCUS_08970 gene rnr 8912 6570 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550136.1 protein_id gnl|my_center|LOCUS_08970 9229 8996 gene locus_tag LOCUS_08980 9229 8996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 10651 9353 gene locus_tag LOCUS_08990 gene eno 10651 9353 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564271.1 protein_id gnl|my_center|LOCUS_08990 11453 10698 gene locus_tag LOCUS_09000 gene tpiA 11453 10698 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546605.1 protein_id gnl|my_center|LOCUS_09000 12683 11472 gene locus_tag LOCUS_09010 12683 11472 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546602.1 protein_id gnl|my_center|LOCUS_09010 13806 12790 gene locus_tag LOCUS_09020 gene gap 13806 12790 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546601.1 protein_id gnl|my_center|LOCUS_09020 14892 13861 gene locus_tag LOCUS_09030 14892 13861 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546600.1 protein_id gnl|my_center|LOCUS_09030 15116 15187 gene locus_tag LOCUS_t00190 15116 15187 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15329 15712 gene locus_tag LOCUS_09040 15329 15712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09040 15831 16778 gene locus_tag LOCUS_09050 15831 16778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09050 16920 17507 gene locus_tag LOCUS_09060 gene clpP 16920 17507 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546597.1 protein_id gnl|my_center|LOCUS_09060 18500 17559 gene locus_tag LOCUS_09070 gene whiA 18500 17559 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546596.1 protein_id gnl|my_center|LOCUS_09070 19541 18504 gene locus_tag LOCUS_09080 19541 18504 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546595.1 protein_id gnl|my_center|LOCUS_09080 20427 19552 gene locus_tag LOCUS_09090 gene rapZ 20427 19552 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546593.1 protein_id gnl|my_center|LOCUS_09090 21074 20535 gene locus_tag LOCUS_09100 21074 20535 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546590.1 protein_id gnl|my_center|LOCUS_09100 23991 21124 gene locus_tag LOCUS_09110 gene uvrA 23991 21124 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546588.1 protein_id gnl|my_center|LOCUS_09110 26021 24006 gene locus_tag LOCUS_09120 gene uvrB 26021 24006 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546586.1 protein_id gnl|my_center|LOCUS_09120 27844 26120 gene locus_tag LOCUS_09130 27844 26120 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546584.1 protein_id gnl|my_center|LOCUS_09130 28957 27971 gene locus_tag LOCUS_09140 28957 27971 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254469.1 protein_id gnl|my_center|LOCUS_09140 30427 28958 gene locus_tag LOCUS_09150 30427 28958 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548166.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence016 396 1601 gene locus_tag LOCUS_09160 396 1601 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813994.1 protein_id gnl|my_center|LOCUS_09160 2933 1659 gene locus_tag LOCUS_09170 2933 1659 CDS product ISL3-like element ISP1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101247.1 protein_id gnl|my_center|LOCUS_09170 3304 3645 gene locus_tag LOCUS_09180 3304 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09180 5268 3826 gene locus_tag LOCUS_09190 gene gtfA 5268 3826 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254462.1 protein_id gnl|my_center|LOCUS_09190 7480 5279 gene locus_tag LOCUS_09200 7480 5279 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548136.1 protein_id gnl|my_center|LOCUS_09200 8605 7493 gene locus_tag LOCUS_09210 gene ugpC 8605 7493 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548138.1 protein_id gnl|my_center|LOCUS_09210 9465 8632 gene locus_tag LOCUS_09220 9465 8632 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254463.1 protein_id gnl|my_center|LOCUS_09220 10355 9480 gene locus_tag LOCUS_09230 10355 9480 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548142.1 protein_id gnl|my_center|LOCUS_09230 11621 10368 gene locus_tag LOCUS_09240 11621 10368 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254464.1 protein_id gnl|my_center|LOCUS_09240 11871 12704 gene locus_tag LOCUS_09250 11871 12704 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548147.1 protein_id gnl|my_center|LOCUS_09250 13733 12747 gene locus_tag LOCUS_09260 13733 12747 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254469.1 protein_id gnl|my_center|LOCUS_09260 15199 13736 gene locus_tag LOCUS_09270 15199 13736 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548166.1 protein_id gnl|my_center|LOCUS_09270 16383 15220 gene locus_tag LOCUS_09280 16383 15220 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548167.1 protein_id gnl|my_center|LOCUS_09280 16685 16413 gene locus_tag LOCUS_09290 16685 16413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 17168 16782 gene locus_tag LOCUS_09300 17168 16782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 18009 17293 gene locus_tag LOCUS_09310 gene mngR 18009 17293 CDS product mannosyl-D-glycerate transport/metabolism system transcriptional repressor MngR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509902.1 protein_id gnl|my_center|LOCUS_09310 18805 18161 gene locus_tag LOCUS_09320 18805 18161 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702509.1 protein_id gnl|my_center|LOCUS_09320 21337 19331 gene locus_tag LOCUS_09330 21337 19331 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254470.1 protein_id gnl|my_center|LOCUS_09330 23267 21348 gene locus_tag LOCUS_09340 23267 21348 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254471.1 protein_id gnl|my_center|LOCUS_09340 24467 23460 gene locus_tag LOCUS_09350 24467 23460 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548182.1 protein_id gnl|my_center|LOCUS_09350 24692 26572 gene locus_tag LOCUS_09360 24692 26572 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548184.1 protein_id gnl|my_center|LOCUS_09360 26556 27506 gene locus_tag LOCUS_09370 26556 27506 CDS product beta-galactosidase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254473.1 protein_id gnl|my_center|LOCUS_09370 27609 28568 gene locus_tag LOCUS_09380 gene galE 27609 28568 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548187.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence017 1 198 gene locus_tag LOCUS_09390 1 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 419 760 gene locus_tag LOCUS_09400 419 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1122 1895 gene locus_tag LOCUS_09410 1122 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 2197 2358 gene locus_tag LOCUS_09420 2197 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 2512 2652 gene locus_tag LOCUS_09430 2512 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 2657 3154 gene locus_tag LOCUS_09440 2657 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 3263 3454 gene locus_tag LOCUS_09450 3263 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 3659 3859 gene locus_tag LOCUS_09460 3659 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 4032 4268 gene locus_tag LOCUS_09470 4032 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 4255 4530 gene locus_tag LOCUS_09480 4255 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 5226 5357 gene locus_tag LOCUS_09490 5226 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 5338 5616 gene locus_tag LOCUS_09500 5338 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 5579 5950 gene locus_tag LOCUS_09510 5579 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 6344 7075 gene locus_tag LOCUS_09520 6344 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 7077 7637 gene locus_tag LOCUS_09530 7077 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 7791 8255 gene locus_tag LOCUS_09540 7791 8255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 8255 8680 gene locus_tag LOCUS_09550 8255 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 8705 8995 gene locus_tag LOCUS_09560 8705 8995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 10061 11146 gene locus_tag LOCUS_09570 10061 11146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 11447 11773 gene locus_tag LOCUS_09580 11447 11773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 12005 12169 gene locus_tag LOCUS_09590 12005 12169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 12219 13382 gene locus_tag LOCUS_09600 12219 13382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 13467 13676 gene locus_tag LOCUS_09610 13467 13676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 13887 14525 gene locus_tag LOCUS_09620 13887 14525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 14826 14981 gene locus_tag LOCUS_09630 14826 14981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 15061 15501 gene locus_tag LOCUS_09640 15061 15501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 15612 15860 gene locus_tag LOCUS_09650 15612 15860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 16003 16242 gene locus_tag LOCUS_09660 16003 16242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 16333 16866 gene locus_tag LOCUS_09670 16333 16866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 16866 17069 gene locus_tag LOCUS_09680 16866 17069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 17311 17841 gene locus_tag LOCUS_09690 17311 17841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 17961 18170 gene locus_tag LOCUS_09700 17961 18170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 18232 18900 gene locus_tag LOCUS_09710 18232 18900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 18949 19089 gene locus_tag LOCUS_09720 18949 19089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 19234 20121 gene locus_tag LOCUS_09730 19234 20121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 20251 20637 gene locus_tag LOCUS_09740 20251 20637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 20689 21192 gene locus_tag LOCUS_09750 20689 21192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 21241 21672 gene locus_tag LOCUS_09760 21241 21672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 21796 22344 gene locus_tag LOCUS_09770 21796 22344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 22366 23268 gene locus_tag LOCUS_09780 22366 23268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 23333 23812 gene locus_tag LOCUS_09790 23333 23812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 23935 24102 gene locus_tag LOCUS_09800 23935 24102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 24136 24459 gene locus_tag LOCUS_09810 24136 24459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 24514 25509 gene locus_tag LOCUS_09820 24514 25509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 25753 26148 gene locus_tag LOCUS_09830 25753 26148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 26174 26392 gene locus_tag LOCUS_09840 26174 26392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 26554 26718 gene locus_tag LOCUS_09850 26554 26718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 27155 27346 gene locus_tag LOCUS_09860 27155 27346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence018 1216 272 gene locus_tag LOCUS_09870 1216 272 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564289.1 protein_id gnl|my_center|LOCUS_09870 2340 1369 gene locus_tag LOCUS_09880 2340 1369 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254080.1 protein_id gnl|my_center|LOCUS_09880 3836 2451 gene locus_tag LOCUS_09890 gene glmU 3836 2451 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548882.1 protein_id gnl|my_center|LOCUS_09890 4720 3884 gene locus_tag LOCUS_09900 gene purR 4720 3884 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548880.1 protein_id gnl|my_center|LOCUS_09900 5077 4838 gene locus_tag LOCUS_09910 5077 4838 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548879.1 protein_id gnl|my_center|LOCUS_09910 6043 5153 gene locus_tag LOCUS_09920 gene rsmA 6043 5153 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548878.1 protein_id gnl|my_center|LOCUS_09920 6596 6033 gene locus_tag LOCUS_09930 gene rnmV 6596 6033 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548877.1 protein_id gnl|my_center|LOCUS_09930 7353 6580 gene locus_tag LOCUS_09940 7353 6580 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548876.1 protein_id gnl|my_center|LOCUS_09940 9329 7353 gene locus_tag LOCUS_09950 gene metG 9329 7353 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254078.1 protein_id gnl|my_center|LOCUS_09950 10449 9427 gene locus_tag LOCUS_09960 10449 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 11344 10757 gene locus_tag LOCUS_09970 11344 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 11822 11334 gene locus_tag LOCUS_09980 11822 11334 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548871.1 protein_id gnl|my_center|LOCUS_09980 12870 11842 gene locus_tag LOCUS_09990 gene trpS 12870 11842 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548870.1 protein_id gnl|my_center|LOCUS_09990 13005 13616 gene locus_tag LOCUS_10000 13005 13616 CDS product SOS response-associated peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548869.1 protein_id gnl|my_center|LOCUS_10000 13643 13713 gene locus_tag LOCUS_t00200 13643 13713 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 14419 13757 gene locus_tag LOCUS_10010 14419 13757 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254077.1 protein_id gnl|my_center|LOCUS_10010 14562 15398 gene locus_tag LOCUS_10020 14562 15398 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613346.1 protein_id gnl|my_center|LOCUS_10020 15601 16980 gene locus_tag LOCUS_10030 15601 16980 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546946.1 protein_id gnl|my_center|LOCUS_10030 16980 18410 gene locus_tag LOCUS_10040 16980 18410 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254281.1 protein_id gnl|my_center|LOCUS_10040 18557 18880 gene locus_tag LOCUS_10050 18557 18880 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642267.1 protein_id gnl|my_center|LOCUS_10050 18885 19133 gene locus_tag LOCUS_10060 18885 19133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546942.1 protein_id gnl|my_center|LOCUS_10060 19227 19553 gene locus_tag LOCUS_10070 19227 19553 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577029.1 protein_id gnl|my_center|LOCUS_10070 19553 20278 gene locus_tag LOCUS_10080 19553 20278 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254280.1 protein_id gnl|my_center|LOCUS_10080 20345 21838 gene locus_tag LOCUS_10090 20345 21838 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546937.1 protein_id gnl|my_center|LOCUS_10090 21910 22317 gene locus_tag LOCUS_10100 21910 22317 CDS product DUF3284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254279.1 protein_id gnl|my_center|LOCUS_10100 23066 22368 gene locus_tag LOCUS_10110 23066 22368 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226988.1 protein_id gnl|my_center|LOCUS_10110 24494 23142 gene locus_tag LOCUS_10120 gene celB 24494 23142 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014565762.1 protein_id gnl|my_center|LOCUS_10120 25014 24517 gene locus_tag LOCUS_10130 25014 24517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254277.1 protein_id gnl|my_center|LOCUS_10130 25213 26661 gene locus_tag LOCUS_10140 25213 26661 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546921.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence019 347 1246 gene locus_tag LOCUS_10150 347 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546199.1 protein_id gnl|my_center|LOCUS_10150 2003 1314 gene locus_tag LOCUS_10160 2003 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549674.1 protein_id gnl|my_center|LOCUS_10160 2119 2478 gene locus_tag LOCUS_10170 2119 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 2468 3226 gene locus_tag LOCUS_10180 gene yaaA 2468 3226 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254594.1 protein_id gnl|my_center|LOCUS_10180 4016 3303 gene locus_tag LOCUS_10190 4016 3303 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254593.1 protein_id gnl|my_center|LOCUS_10190 4137 4763 gene locus_tag LOCUS_10200 4137 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 4770 5369 gene locus_tag LOCUS_10210 4770 5369 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549678.1 protein_id gnl|my_center|LOCUS_10210 5501 6022 gene locus_tag LOCUS_10220 5501 6022 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254592.1 protein_id gnl|my_center|LOCUS_10220 6029 7081 gene locus_tag LOCUS_10230 6029 7081 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254591.1 protein_id gnl|my_center|LOCUS_10230 7096 7782 gene locus_tag LOCUS_10240 7096 7782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254590.1 protein_id gnl|my_center|LOCUS_10240 7915 8763 gene locus_tag LOCUS_10250 7915 8763 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254546.1 protein_id gnl|my_center|LOCUS_10250 8760 10622 gene locus_tag LOCUS_10260 8760 10622 CDS product PTS beta-glucoside transporter subunit IIBCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549922.1 protein_id gnl|my_center|LOCUS_10260 10632 12110 gene locus_tag LOCUS_10270 10632 12110 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549927.1 protein_id gnl|my_center|LOCUS_10270 13584 12172 gene locus_tag LOCUS_10280 13584 12172 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549685.1 protein_id gnl|my_center|LOCUS_10280 13662 13904 gene locus_tag LOCUS_10290 13662 13904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007126009.1 protein_id gnl|my_center|LOCUS_10290 14049 14654 gene locus_tag LOCUS_10300 14049 14654 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549687.1 protein_id gnl|my_center|LOCUS_10300 14791 15327 gene locus_tag LOCUS_10310 14791 15327 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549688.1 protein_id gnl|my_center|LOCUS_10310 15340 15894 gene locus_tag LOCUS_10320 15340 15894 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549689.1 protein_id gnl|my_center|LOCUS_10320 16025 17062 gene locus_tag LOCUS_10330 16025 17062 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549580.1 protein_id gnl|my_center|LOCUS_10330 17073 17876 gene locus_tag LOCUS_10340 17073 17876 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549690.1 protein_id gnl|my_center|LOCUS_10340 17873 18799 gene locus_tag LOCUS_10350 17873 18799 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549691.1 protein_id gnl|my_center|LOCUS_10350 19380 18844 gene locus_tag LOCUS_10360 19380 18844 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549693.1 protein_id gnl|my_center|LOCUS_10360 19579 20298 gene locus_tag LOCUS_10370 gene rsmG 19579 20298 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 protein_id gnl|my_center|LOCUS_10370 20320 21201 gene locus_tag LOCUS_10380 gene noc 20320 21201 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254588.1 protein_id gnl|my_center|LOCUS_10380 21217 21990 gene locus_tag LOCUS_10390 21217 21990 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254587.1 protein_id gnl|my_center|LOCUS_10390 21974 22855 gene locus_tag LOCUS_10400 21974 22855 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549701.1 protein_id gnl|my_center|LOCUS_10400 22875 23123 gene locus_tag LOCUS_10410 22875 23123 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549703.1 protein_id gnl|my_center|LOCUS_10410 23146 24246 gene locus_tag LOCUS_10420 gene ychF 23146 24246 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549709.1 protein_id gnl|my_center|LOCUS_10420 24258 25091 gene locus_tag LOCUS_10430 24258 25091 CDS product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549711.1 protein_id gnl|my_center|LOCUS_10430 >Feature sequence020 2479 86 gene locus_tag LOCUS_10440 2479 86 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254361.1 protein_id gnl|my_center|LOCUS_10440 3101 2490 gene locus_tag LOCUS_10450 gene recU 3101 2490 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254360.1 protein_id gnl|my_center|LOCUS_10450 3169 3732 gene locus_tag LOCUS_10460 3169 3732 CDS product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547535.1 protein_id gnl|my_center|LOCUS_10460 3938 4375 gene locus_tag LOCUS_10470 3938 4375 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547534.1 protein_id gnl|my_center|LOCUS_10470 4841 5965 gene locus_tag LOCUS_10480 4841 5965 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547533.1 protein_id gnl|my_center|LOCUS_10480 5971 7203 gene locus_tag LOCUS_10490 5971 7203 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254359.1 protein_id gnl|my_center|LOCUS_10490 8379 7252 gene locus_tag LOCUS_10500 8379 7252 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254598.1 protein_id gnl|my_center|LOCUS_10500 9082 8465 gene locus_tag LOCUS_10510 9082 8465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10510 9389 9168 gene locus_tag LOCUS_10520 9389 9168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10520 9522 9866 gene locus_tag LOCUS_10530 9522 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 9863 11542 gene locus_tag LOCUS_10540 9863 11542 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254358.1 protein_id gnl|my_center|LOCUS_10540 11542 12006 gene locus_tag LOCUS_10550 gene lspA 11542 12006 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613370.1 protein_id gnl|my_center|LOCUS_10550 12021 12935 gene locus_tag LOCUS_10560 12021 12935 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254356.1 protein_id gnl|my_center|LOCUS_10560 12939 13994 gene locus_tag LOCUS_10570 12939 13994 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547524.1 protein_id gnl|my_center|LOCUS_10570 13998 17162 gene locus_tag LOCUS_10580 13998 17162 CDS product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254355.1 protein_id gnl|my_center|LOCUS_10580 18926 17235 gene locus_tag LOCUS_10590 18926 17235 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547519.1 protein_id gnl|my_center|LOCUS_10590 19115 19525 gene locus_tag LOCUS_10600 19115 19525 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254354.1 protein_id gnl|my_center|LOCUS_10600 19641 20528 gene locus_tag LOCUS_10610 19641 20528 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254353.1 protein_id gnl|my_center|LOCUS_10610 20613 21725 gene locus_tag LOCUS_10620 20613 21725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 22664 21783 gene locus_tag LOCUS_10630 22664 21783 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287470.1 protein_id gnl|my_center|LOCUS_10630 23805 22735 gene locus_tag LOCUS_10640 gene xerS 23805 22735 CDS product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547513.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence021 102 554 gene locus_tag LOCUS_10650 102 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 594 1493 gene locus_tag LOCUS_10660 594 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1493 2602 gene locus_tag LOCUS_10670 1493 2602 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546967.1 protein_id gnl|my_center|LOCUS_10670 3038 2675 gene locus_tag LOCUS_tm00010 3038 2675 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 4174 3095 gene locus_tag LOCUS_10680 4174 3095 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546683.1 protein_id gnl|my_center|LOCUS_10680 5302 4301 gene locus_tag LOCUS_10690 5302 4301 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546680.1 protein_id gnl|my_center|LOCUS_10690 6016 5372 gene locus_tag LOCUS_10700 6016 5372 CDS product ComGF family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546679.1 protein_id gnl|my_center|LOCUS_10700 6240 6022 gene locus_tag LOCUS_10710 6240 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 6646 6230 gene locus_tag LOCUS_10720 6646 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 6840 6643 gene locus_tag LOCUS_10730 6840 6643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 7931 6930 gene locus_tag LOCUS_10740 7931 6930 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721297.1 protein_id gnl|my_center|LOCUS_10740 8874 7897 gene locus_tag LOCUS_10750 gene comGA 8874 7897 CDS product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546670.1 protein_id gnl|my_center|LOCUS_10750 9764 9033 gene locus_tag LOCUS_10760 9764 9033 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546668.1 protein_id gnl|my_center|LOCUS_10760 10353 9838 gene locus_tag LOCUS_10770 10353 9838 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254234.1 protein_id gnl|my_center|LOCUS_10770 11558 10350 gene locus_tag LOCUS_10780 gene coaBC 11558 10350 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254293.1 protein_id gnl|my_center|LOCUS_10780 11722 12612 gene locus_tag LOCUS_10790 11722 12612 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254571.1 protein_id gnl|my_center|LOCUS_10790 13433 12657 gene locus_tag LOCUS_10800 13433 12657 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100893.1 protein_id gnl|my_center|LOCUS_10800 14086 13436 gene locus_tag LOCUS_10810 14086 13436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546642.1 protein_id gnl|my_center|LOCUS_10810 14170 15387 gene locus_tag LOCUS_10820 14170 15387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 15804 15445 gene locus_tag LOCUS_10830 gene crcB 15804 15445 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547161.1 protein_id gnl|my_center|LOCUS_10830 16190 15801 gene locus_tag LOCUS_10840 16190 15801 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254309.1 protein_id gnl|my_center|LOCUS_10840 16998 16183 gene locus_tag LOCUS_10850 16998 16183 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546639.1 protein_id gnl|my_center|LOCUS_10850 18533 17178 gene locus_tag LOCUS_10860 gene glmM 18533 17178 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546635.1 protein_id gnl|my_center|LOCUS_10860 19526 18558 gene locus_tag LOCUS_10870 19526 18558 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546633.1 protein_id gnl|my_center|LOCUS_10870 20371 19523 gene locus_tag LOCUS_10880 gene cdaA 20371 19523 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254229.1 protein_id gnl|my_center|LOCUS_10880 21485 20412 gene locus_tag LOCUS_10890 21485 20412 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546630.1 protein_id gnl|my_center|LOCUS_10890 22279 21482 gene locus_tag LOCUS_10900 22279 21482 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254228.1 protein_id gnl|my_center|LOCUS_10900 23088 22276 gene locus_tag LOCUS_10910 23088 22276 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546626.1 protein_id gnl|my_center|LOCUS_10910 24180 23092 gene locus_tag LOCUS_10920 24180 23092 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546625.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence022 2286 94 gene locus_tag LOCUS_10930 2286 94 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546703.1 protein_id gnl|my_center|LOCUS_10930 2446 3048 gene locus_tag LOCUS_10940 2446 3048 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254238.1 protein_id gnl|my_center|LOCUS_10940 3132 4475 gene locus_tag LOCUS_10950 3132 4475 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546706.1 protein_id gnl|my_center|LOCUS_10950 4580 5992 gene locus_tag LOCUS_10960 4580 5992 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254239.1 protein_id gnl|my_center|LOCUS_10960 5985 6425 gene locus_tag LOCUS_10970 5985 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 6576 6649 gene locus_tag LOCUS_t00210 6576 6649 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6654 6726 gene locus_tag LOCUS_t00220 6654 6726 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6784 7803 gene locus_tag LOCUS_10980 6784 7803 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546711.1 protein_id gnl|my_center|LOCUS_10980 9192 7840 gene locus_tag LOCUS_10990 9192 7840 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546733.1 protein_id gnl|my_center|LOCUS_10990 9351 9950 gene locus_tag LOCUS_11000 9351 9950 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613340.1 protein_id gnl|my_center|LOCUS_11000 9982 11070 gene locus_tag LOCUS_11010 gene prfA 9982 11070 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546735.1 protein_id gnl|my_center|LOCUS_11010 11063 11905 gene locus_tag LOCUS_11020 gene prmC 11063 11905 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546736.1 protein_id gnl|my_center|LOCUS_11020 11905 12897 gene locus_tag LOCUS_11030 11905 12897 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546737.1 protein_id gnl|my_center|LOCUS_11030 13011 13640 gene locus_tag LOCUS_11040 gene upp 13011 13640 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546738.1 protein_id gnl|my_center|LOCUS_11040 13732 14448 gene locus_tag LOCUS_11050 gene atpB 13732 14448 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546739.1 protein_id gnl|my_center|LOCUS_11050 14467 14679 gene locus_tag LOCUS_11060 gene atpE 14467 14679 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029779745.1 protein_id gnl|my_center|LOCUS_11060 14729 15229 gene locus_tag LOCUS_11070 gene atpF 14729 15229 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546741.1 protein_id gnl|my_center|LOCUS_11070 15229 15777 gene locus_tag LOCUS_11080 15229 15777 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546742.1 protein_id gnl|my_center|LOCUS_11080 15792 17303 gene locus_tag LOCUS_11090 gene atpA 15792 17303 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254246.1 protein_id gnl|my_center|LOCUS_11090 17321 18277 gene locus_tag LOCUS_11100 17321 18277 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546744.1 protein_id gnl|my_center|LOCUS_11100 18300 19742 gene locus_tag LOCUS_11110 gene atpD 18300 19742 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254247.1 protein_id gnl|my_center|LOCUS_11110 19754 20194 gene locus_tag LOCUS_11120 19754 20194 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546746.1 protein_id gnl|my_center|LOCUS_11120 20245 20478 gene locus_tag LOCUS_11130 20245 20478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 20586 21575 gene locus_tag LOCUS_11140 20586 21575 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546749.1 protein_id gnl|my_center|LOCUS_11140 21578 21763 gene locus_tag LOCUS_11150 21578 21763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 21765 22058 gene locus_tag LOCUS_11160 gene yidD 21765 22058 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564982.1 protein_id gnl|my_center|LOCUS_11160 22069 22296 gene locus_tag LOCUS_11170 22069 22296 CDS product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546751.1 protein_id gnl|my_center|LOCUS_11170 22315 23511 gene locus_tag LOCUS_11180 22315 23511 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546752.1 protein_id gnl|my_center|LOCUS_11180 24039 23560 gene locus_tag LOCUS_11190 24039 23560 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546753.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence023 394 1188 gene locus_tag LOCUS_11200 gene sufC 394 1188 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004894681.1 protein_id gnl|my_center|LOCUS_11200 1197 2402 gene locus_tag LOCUS_11210 gene sufD 1197 2402 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101418.1 protein_id gnl|my_center|LOCUS_11210 2383 3621 gene locus_tag LOCUS_11220 2383 3621 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101419.1 protein_id gnl|my_center|LOCUS_11220 3608 4066 gene locus_tag LOCUS_11230 3608 4066 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640266.1 protein_id gnl|my_center|LOCUS_11230 4059 5462 gene locus_tag LOCUS_11240 gene sufB 4059 5462 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014567504.1 protein_id gnl|my_center|LOCUS_11240 5462 5785 gene locus_tag LOCUS_11250 5462 5785 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549827.1 protein_id gnl|my_center|LOCUS_11250 5794 7293 gene locus_tag LOCUS_11260 5794 7293 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476029.1 protein_id gnl|my_center|LOCUS_11260 7375 8115 gene locus_tag LOCUS_11270 7375 8115 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645186.1 protein_id gnl|my_center|LOCUS_11270 8737 8498 gene locus_tag LOCUS_11280 8737 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 9012 9989 gene locus_tag LOCUS_11290 gene bsh 9012 9989 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547395.1 protein_id gnl|my_center|LOCUS_11290 11237 10158 gene locus_tag LOCUS_11300 11237 10158 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056552.1 protein_id gnl|my_center|LOCUS_11300 12644 11544 gene locus_tag LOCUS_11310 12644 11544 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056552.1 protein_id gnl|my_center|LOCUS_11310 12887 15409 gene locus_tag LOCUS_11320 12887 15409 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254312.1 protein_id gnl|my_center|LOCUS_11320 15619 16071 gene locus_tag LOCUS_11330 15619 16071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 16471 16139 gene locus_tag LOCUS_11340 16471 16139 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355924.1 protein_id gnl|my_center|LOCUS_11340 17098 16604 gene locus_tag LOCUS_11350 gene tpx 17098 16604 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547331.1 protein_id gnl|my_center|LOCUS_11350 17295 17708 gene locus_tag LOCUS_11360 17295 17708 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548490.1 protein_id gnl|my_center|LOCUS_11360 18161 20839 gene locus_tag LOCUS_11370 gene mgtA 18161 20839 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548873.1 protein_id gnl|my_center|LOCUS_11370 20971 21408 gene locus_tag LOCUS_11380 20971 21408 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546394.1 protein_id gnl|my_center|LOCUS_11380 21493 23244 gene locus_tag LOCUS_11390 21493 23244 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546396.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence024 6601 188 gene locus_tag LOCUS_11400 6601 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11400 8214 6577 gene locus_tag LOCUS_11410 8214 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11410 9056 8484 gene locus_tag LOCUS_11420 gene efp 9056 8484 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550017.1 protein_id gnl|my_center|LOCUS_11420 9920 9069 gene locus_tag LOCUS_11430 gene coaA 9920 9069 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550009.1 protein_id gnl|my_center|LOCUS_11430 10010 10582 gene locus_tag LOCUS_11440 10010 10582 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550008.1 protein_id gnl|my_center|LOCUS_11440 11341 10619 gene locus_tag LOCUS_11450 11341 10619 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721394.1 protein_id gnl|my_center|LOCUS_11450 13758 11440 gene locus_tag LOCUS_11460 gene helD 13758 11440 CDS product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_056990024.1 protein_id gnl|my_center|LOCUS_11460 13903 14547 gene locus_tag LOCUS_11470 13903 14547 CDS product matrixin family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549990.1 protein_id gnl|my_center|LOCUS_11470 14756 14574 gene locus_tag LOCUS_11480 14756 14574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 14905 17589 gene locus_tag LOCUS_11490 14905 17589 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254541.1 protein_id gnl|my_center|LOCUS_11490 18628 17810 gene locus_tag LOCUS_11500 18628 17810 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358531.1 protein_id gnl|my_center|LOCUS_11500 18757 19449 gene locus_tag LOCUS_11510 18757 19449 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130140.1 protein_id gnl|my_center|LOCUS_11510 19477 21360 gene locus_tag LOCUS_11520 19477 21360 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289252.1 protein_id gnl|my_center|LOCUS_11520 21388 21543 gene locus_tag LOCUS_11530 21388 21543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 22382 21618 gene locus_tag LOCUS_11540 22382 21618 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549947.1 protein_id gnl|my_center|LOCUS_11540 22853 22509 gene locus_tag LOCUS_11550 22853 22509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 22957 23172 gene locus_tag LOCUS_11560 22957 23172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 23215 23865 gene locus_tag LOCUS_11570 23215 23865 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549989.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence025 <1 758 gene locus_tag LOCUS_11580 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010714105.1:DUF4393 domain-containing protein 879 721 gene locus_tag LOCUS_11590 879 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1014 1637 gene locus_tag LOCUS_11600 1014 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1722 2840 gene locus_tag LOCUS_11610 1722 2840 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475894.1 protein_id gnl|my_center|LOCUS_11610 3022 2948 gene locus_tag LOCUS_t00230 3022 2948 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4403 3072 gene locus_tag LOCUS_11620 4403 3072 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546442.1 protein_id gnl|my_center|LOCUS_11620 5632 4403 gene locus_tag LOCUS_11630 5632 4403 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546440.1 protein_id gnl|my_center|LOCUS_11630 6353 5643 gene locus_tag LOCUS_11640 6353 5643 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546437.1 protein_id gnl|my_center|LOCUS_11640 6474 7784 gene locus_tag LOCUS_11650 6474 7784 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254206.1 protein_id gnl|my_center|LOCUS_11650 8444 7875 gene locus_tag LOCUS_11660 gene hpt 8444 7875 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254205.1 protein_id gnl|my_center|LOCUS_11660 9924 8542 gene locus_tag LOCUS_11670 9924 8542 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546431.1 protein_id gnl|my_center|LOCUS_11670 10670 9975 gene locus_tag LOCUS_11680 10670 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 11453 10797 gene locus_tag LOCUS_11690 11453 10797 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546429.1 protein_id gnl|my_center|LOCUS_11690 14019 11614 gene locus_tag LOCUS_11700 14019 11614 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254199.1 protein_id gnl|my_center|LOCUS_11700 14912 14127 gene locus_tag LOCUS_11710 14912 14127 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475503.1 protein_id gnl|my_center|LOCUS_11710 15177 15503 gene locus_tag LOCUS_11720 15177 15503 CDS product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475528.1 protein_id gnl|my_center|LOCUS_11720 16296 15568 gene locus_tag LOCUS_11730 16296 15568 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546381.1 protein_id gnl|my_center|LOCUS_11730 17219 16296 gene locus_tag LOCUS_11740 17219 16296 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546379.1 protein_id gnl|my_center|LOCUS_11740 18886 17312 gene locus_tag LOCUS_11750 18886 17312 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254603.1 protein_id gnl|my_center|LOCUS_11750 19083 18955 gene locus_tag LOCUS_11760 19083 18955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 20220 19108 gene locus_tag LOCUS_11770 20220 19108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 21703 20213 gene locus_tag LOCUS_11780 21703 20213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 22681 21869 gene locus_tag LOCUS_11790 22681 21869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 >Feature sequence026 4269 1699 gene locus_tag LOCUS_11800 4269 1699 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476508.1 protein_id gnl|my_center|LOCUS_11800 4980 4279 gene locus_tag LOCUS_11810 4980 4279 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549550.1 protein_id gnl|my_center|LOCUS_11810 5765 5097 gene locus_tag LOCUS_11820 5765 5097 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475996.1 protein_id gnl|my_center|LOCUS_11820 5821 6945 gene locus_tag LOCUS_11830 5821 6945 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201247873.1 protein_id gnl|my_center|LOCUS_11830 7013 9751 gene locus_tag LOCUS_11840 gene ppc 7013 9751 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254335.1 protein_id gnl|my_center|LOCUS_11840 9774 10322 gene locus_tag LOCUS_11850 9774 10322 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476384.1 protein_id gnl|my_center|LOCUS_11850 10910 10374 gene locus_tag LOCUS_11860 gene pyrR 10910 10374 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548034.1 protein_id gnl|my_center|LOCUS_11860 14131 10943 gene locus_tag LOCUS_11870 gene carB 14131 10943 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254441.1 protein_id gnl|my_center|LOCUS_11870 15212 14124 gene locus_tag LOCUS_11880 gene carA 15212 14124 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548026.1 protein_id gnl|my_center|LOCUS_11880 16486 15209 gene locus_tag LOCUS_11890 16486 15209 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254442.1 protein_id gnl|my_center|LOCUS_11890 17442 16486 gene locus_tag LOCUS_11900 17442 16486 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548032.1 protein_id gnl|my_center|LOCUS_11900 18132 17590 gene locus_tag LOCUS_11910 gene pyrR 18132 17590 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548034.1 protein_id gnl|my_center|LOCUS_11910 19222 18299 gene locus_tag LOCUS_11920 19222 18299 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254443.1 protein_id gnl|my_center|LOCUS_11920 19473 20180 gene locus_tag LOCUS_11930 gene pyrF 19473 20180 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548039.1 protein_id gnl|my_center|LOCUS_11930 20182 20820 gene locus_tag LOCUS_11940 gene pyrE 20182 20820 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548040.1 protein_id gnl|my_center|LOCUS_11940 21102 22697 gene locus_tag LOCUS_11950 21102 22697 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546894.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence027 1849 500 gene locus_tag LOCUS_11960 gene rlmD 1849 500 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546298.1 protein_id gnl|my_center|LOCUS_11960 2582 1899 gene locus_tag LOCUS_11970 2582 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 3279 2575 gene locus_tag LOCUS_11980 3279 2575 CDS product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896245.1 protein_id gnl|my_center|LOCUS_11980 3639 5015 gene locus_tag LOCUS_11990 gene nhaC 3639 5015 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546295.1 protein_id gnl|my_center|LOCUS_11990 5131 5388 gene locus_tag LOCUS_12000 5131 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 5381 6211 gene locus_tag LOCUS_12010 5381 6211 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547023.1 protein_id gnl|my_center|LOCUS_12010 6274 6987 gene locus_tag LOCUS_12020 6274 6987 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640270.1 protein_id gnl|my_center|LOCUS_12020 9086 7062 gene locus_tag LOCUS_12030 9086 7062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 11104 9086 gene locus_tag LOCUS_12040 11104 9086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 12021 11707 gene locus_tag LOCUS_12050 12021 11707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 12328 11975 gene locus_tag LOCUS_12060 12328 11975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 13064 12414 gene locus_tag LOCUS_12070 13064 12414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 13548 13036 gene locus_tag LOCUS_12080 13548 13036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 13854 13561 gene locus_tag LOCUS_12090 13854 13561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 15473 14658 gene locus_tag LOCUS_12100 15473 14658 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546636.1 protein_id gnl|my_center|LOCUS_12100 15692 15483 gene locus_tag LOCUS_12110 15692 15483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 16652 15744 gene locus_tag LOCUS_12120 16652 15744 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546288.1 protein_id gnl|my_center|LOCUS_12120 18106 16676 gene locus_tag LOCUS_12130 gene gatB 18106 16676 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254176.1 protein_id gnl|my_center|LOCUS_12130 19549 18110 gene locus_tag LOCUS_12140 gene gatA 19549 18110 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546285.1 protein_id gnl|my_center|LOCUS_12140 19851 19549 gene locus_tag LOCUS_12150 gene gatC 19851 19549 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546283.1 protein_id gnl|my_center|LOCUS_12150 21001 19862 gene locus_tag LOCUS_12160 21001 19862 CDS product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546280.1 protein_id gnl|my_center|LOCUS_12160 <22259 21023 gene locus_tag LOCUS_12170 <22259 21023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546277.1:NAD-dependent DNA ligase LigA >Feature sequence028 1220 549 gene locus_tag LOCUS_12180 1220 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 2200 1376 gene locus_tag LOCUS_12190 2200 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 3366 2416 gene locus_tag LOCUS_12200 3366 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12200 3962 3360 gene locus_tag LOCUS_12210 3962 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12210 4277 3993 gene locus_tag LOCUS_12220 gene groES 4277 3993 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549156.1 protein_id gnl|my_center|LOCUS_12220 5963 5205 gene locus_tag LOCUS_12230 5963 5205 CDS product LiaF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549154.1 protein_id gnl|my_center|LOCUS_12230 6313 5960 gene locus_tag LOCUS_12240 6313 5960 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721270.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12240 6852 6547 gene locus_tag LOCUS_12250 6852 6547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 7360 6794 gene locus_tag LOCUS_12260 7360 6794 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705809.1 protein_id gnl|my_center|LOCUS_12260 8145 7501 gene locus_tag LOCUS_12270 8145 7501 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549143.1 protein_id gnl|my_center|LOCUS_12270 8761 8297 gene locus_tag LOCUS_12280 gene tnpA 8761 8297 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475896.1 protein_id gnl|my_center|LOCUS_12280 8861 10195 gene locus_tag LOCUS_12290 8861 10195 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476585.1 protein_id gnl|my_center|LOCUS_12290 10413 11795 gene locus_tag LOCUS_12300 10413 11795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12300 11764 12306 gene locus_tag LOCUS_12310 11764 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12310 13898 12372 gene locus_tag LOCUS_12320 13898 12372 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830011.1 protein_id gnl|my_center|LOCUS_12320 15965 13998 gene locus_tag LOCUS_12330 15965 13998 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836524.1 protein_id gnl|my_center|LOCUS_12330 18290 16062 gene locus_tag LOCUS_12340 gene bglX 18290 16062 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113557.1 protein_id gnl|my_center|LOCUS_12340 18446 19273 gene locus_tag LOCUS_12350 18446 19273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 20485 19343 gene locus_tag LOCUS_12360 20485 19343 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549134.1 protein_id gnl|my_center|LOCUS_12360 21187 20582 gene locus_tag LOCUS_12370 21187 20582 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964800.1 protein_id gnl|my_center|LOCUS_12370 21363 21184 gene locus_tag LOCUS_12380 21363 21184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 >Feature sequence029 529 455 gene locus_tag LOCUS_t00240 529 455 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 739 664 gene locus_tag LOCUS_t00250 739 664 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 820 1527 gene locus_tag LOCUS_12390 gene yycF 820 1527 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548578.1 protein_id gnl|my_center|LOCUS_12390 1574 3424 gene locus_tag LOCUS_12400 gene walK 1574 3424 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254027.1 protein_id gnl|my_center|LOCUS_12400 3414 4742 gene locus_tag LOCUS_12410 3414 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548582.1 protein_id gnl|my_center|LOCUS_12410 4732 5553 gene locus_tag LOCUS_12420 4732 5553 CDS product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548584.1 protein_id gnl|my_center|LOCUS_12420 5559 6356 gene locus_tag LOCUS_12430 5559 6356 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254029.1 protein_id gnl|my_center|LOCUS_12430 6440 7660 gene locus_tag LOCUS_12440 6440 7660 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613276.1 protein_id gnl|my_center|LOCUS_12440 8171 8650 gene locus_tag LOCUS_12450 gene rlmH 8171 8650 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548590.1 protein_id gnl|my_center|LOCUS_12450 9304 8651 gene locus_tag LOCUS_12460 9304 8651 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548607.1 protein_id gnl|my_center|LOCUS_12460 10662 9316 gene locus_tag LOCUS_12470 10662 9316 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548609.1 protein_id gnl|my_center|LOCUS_12470 11200 10637 gene locus_tag LOCUS_12480 11200 10637 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643692.1 protein_id gnl|my_center|LOCUS_12480 11437 12363 gene locus_tag LOCUS_12490 11437 12363 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548611.1 protein_id gnl|my_center|LOCUS_12490 13288 12398 gene locus_tag LOCUS_12500 gene htpX 13288 12398 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254032.1 protein_id gnl|my_center|LOCUS_12500 13854 13297 gene locus_tag LOCUS_12510 13854 13297 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254033.1 protein_id gnl|my_center|LOCUS_12510 15076 13970 gene locus_tag LOCUS_12520 15076 13970 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254034.1 protein_id gnl|my_center|LOCUS_12520 15251 15661 gene locus_tag LOCUS_12530 15251 15661 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548621.1 protein_id gnl|my_center|LOCUS_12530 15740 15880 gene locus_tag LOCUS_12540 15740 15880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548644.1 protein_id gnl|my_center|LOCUS_12540 16056 16916 gene locus_tag LOCUS_12550 16056 16916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254037.1 protein_id gnl|my_center|LOCUS_12550 16913 17059 gene locus_tag LOCUS_12560 16913 17059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 17049 18356 gene locus_tag LOCUS_12570 17049 18356 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896777.1 protein_id gnl|my_center|LOCUS_12570 18366 19490 gene locus_tag LOCUS_12580 18366 19490 CDS product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548666.1 protein_id gnl|my_center|LOCUS_12580 19633 20151 gene locus_tag LOCUS_12590 19633 20151 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254040.1 protein_id gnl|my_center|LOCUS_12590 20219 21082 gene locus_tag LOCUS_12600 20219 21082 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254041.1 protein_id gnl|my_center|LOCUS_12600 21429 21163 gene locus_tag LOCUS_12610 21429 21163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence030 1793 264 gene locus_tag LOCUS_12620 1793 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 2840 2010 gene locus_tag LOCUS_12630 2840 2010 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199652.1 protein_id gnl|my_center|LOCUS_12630 4366 2861 gene locus_tag LOCUS_12640 4366 2861 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476089.1 protein_id gnl|my_center|LOCUS_12640 6385 4367 gene locus_tag LOCUS_12650 6385 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 7673 6378 gene locus_tag LOCUS_12660 7673 6378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 8663 7674 gene locus_tag LOCUS_12670 8663 7674 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014568758.1 protein_id gnl|my_center|LOCUS_12670 9402 8653 gene locus_tag LOCUS_12680 9402 8653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 9622 9395 gene locus_tag LOCUS_12690 9622 9395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 10689 9625 gene locus_tag LOCUS_12700 10689 9625 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434606.1 protein_id gnl|my_center|LOCUS_12700 11189 10692 gene locus_tag LOCUS_12710 11189 10692 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578443.1 protein_id gnl|my_center|LOCUS_12710 11648 11199 gene locus_tag LOCUS_12720 11648 11199 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_12720 12323 11664 gene locus_tag LOCUS_12730 12323 11664 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721391.1 protein_id gnl|my_center|LOCUS_12730 13121 12351 gene locus_tag LOCUS_12740 13121 12351 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549867.1 protein_id gnl|my_center|LOCUS_12740 13889 13128 gene locus_tag LOCUS_12750 13889 13128 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549866.1 protein_id gnl|my_center|LOCUS_12750 14763 13900 gene locus_tag LOCUS_12760 14763 13900 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549864.1 protein_id gnl|my_center|LOCUS_12760 15774 14770 gene locus_tag LOCUS_12770 15774 14770 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549863.1 protein_id gnl|my_center|LOCUS_12770 16073 15909 gene locus_tag LOCUS_12780 16073 15909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 16483 16001 gene locus_tag LOCUS_12790 16483 16001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 17539 16688 gene locus_tag LOCUS_12800 17539 16688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 18325 17660 gene locus_tag LOCUS_12810 18325 17660 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549576.1 protein_id gnl|my_center|LOCUS_12810 19661 18393 gene locus_tag LOCUS_12820 19661 18393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 20129 19758 gene locus_tag LOCUS_12830 20129 19758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 21012 20362 gene locus_tag LOCUS_12840 21012 20362 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549576.1 protein_id gnl|my_center|LOCUS_12840 21201 21031 gene locus_tag LOCUS_12850 21201 21031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence031 25 99 gene locus_tag LOCUS_t00260 25 99 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 120 211 gene locus_tag LOCUS_t00270 120 211 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 328 401 gene locus_tag LOCUS_t00280 328 401 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 423 498 gene locus_tag LOCUS_t00290 423 498 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 647 1855 gene locus_tag LOCUS_12860 gene metK 647 1855 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548514.1 protein_id gnl|my_center|LOCUS_12860 1845 2807 gene locus_tag LOCUS_12870 1845 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12870 2832 3302 gene locus_tag LOCUS_12880 2832 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12880 3996 3346 gene locus_tag LOCUS_12890 3996 3346 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254516.1 protein_id gnl|my_center|LOCUS_12890 4296 6710 gene locus_tag LOCUS_12900 gene leuS 4296 6710 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548508.1 protein_id gnl|my_center|LOCUS_12900 6812 8470 gene locus_tag LOCUS_12910 6812 8470 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548498.1 protein_id gnl|my_center|LOCUS_12910 8575 9711 gene locus_tag LOCUS_12920 8575 9711 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_12920 9799 10545 gene locus_tag LOCUS_12930 9799 10545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 10589 11434 gene locus_tag LOCUS_12940 10589 11434 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254511.1 protein_id gnl|my_center|LOCUS_12940 11475 12413 gene locus_tag LOCUS_12950 11475 12413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 12693 14369 gene locus_tag LOCUS_12960 gene argS 12693 14369 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548463.1 protein_id gnl|my_center|LOCUS_12960 14481 15398 gene locus_tag LOCUS_12970 gene fba 14481 15398 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254510.1 protein_id gnl|my_center|LOCUS_12970 15465 15776 gene locus_tag LOCUS_12980 15465 15776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548967.1 protein_id gnl|my_center|LOCUS_12980 16281 16817 gene locus_tag LOCUS_12990 gene hpt 16281 16817 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567626.1 protein_id gnl|my_center|LOCUS_12990 16829 17449 gene locus_tag LOCUS_13000 16829 17449 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254328.1 protein_id gnl|my_center|LOCUS_13000 17521 18153 gene locus_tag LOCUS_13010 17521 18153 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547287.1 protein_id gnl|my_center|LOCUS_13010 18669 18211 gene locus_tag LOCUS_13020 18669 18211 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549015.1 protein_id gnl|my_center|LOCUS_13020 19013 18717 gene locus_tag LOCUS_13030 19013 18717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13030 19929 18979 gene locus_tag LOCUS_13040 19929 18979 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182456.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13040 20056 21051 gene locus_tag LOCUS_13050 20056 21051 CDS product class III bacteriocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548389.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence032 124 1617 gene locus_tag LOCUS_13060 124 1617 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547498.1 protein_id gnl|my_center|LOCUS_13060 1617 3200 gene locus_tag LOCUS_13070 1617 3200 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547496.1 protein_id gnl|my_center|LOCUS_13070 4418 3393 gene locus_tag LOCUS_13080 gene fni 4418 3393 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254369.1 protein_id gnl|my_center|LOCUS_13080 5503 4430 gene locus_tag LOCUS_13090 5503 4430 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254368.1 protein_id gnl|my_center|LOCUS_13090 6503 5538 gene locus_tag LOCUS_13100 gene mvaD 6503 5538 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547574.1 protein_id gnl|my_center|LOCUS_13100 7420 6503 gene locus_tag LOCUS_13110 gene mvk 7420 6503 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547572.1 protein_id gnl|my_center|LOCUS_13110 7507 10983 gene locus_tag LOCUS_13120 7507 10983 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254367.1 protein_id gnl|my_center|LOCUS_13120 10984 14574 gene locus_tag LOCUS_13130 gene addA 10984 14574 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254366.1 protein_id gnl|my_center|LOCUS_13130 14599 17415 gene locus_tag LOCUS_13140 14599 17415 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254365.1 protein_id gnl|my_center|LOCUS_13140 17408 17902 gene locus_tag LOCUS_13150 17408 17902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254364.1 protein_id gnl|my_center|LOCUS_13150 17971 19269 gene locus_tag LOCUS_13160 gene asnS 17971 19269 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547544.1 protein_id gnl|my_center|LOCUS_13160 19341 19985 gene locus_tag LOCUS_13170 19341 19985 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547543.1 protein_id gnl|my_center|LOCUS_13170 19995 20624 gene locus_tag LOCUS_13180 gene nth 19995 20624 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254362.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence033 471 1814 gene locus_tag LOCUS_13190 471 1814 CDS product maltose-6'-phosphate glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549970.1 protein_id gnl|my_center|LOCUS_13190 1900 3786 gene locus_tag LOCUS_13200 1900 3786 CDS product alpha-glucoside-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546418.1 protein_id gnl|my_center|LOCUS_13200 3875 4681 gene locus_tag LOCUS_13210 3875 4681 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254203.1 protein_id gnl|my_center|LOCUS_13210 4659 5168 gene locus_tag LOCUS_13220 4659 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254204.1 protein_id gnl|my_center|LOCUS_13220 5173 5664 gene locus_tag LOCUS_13230 5173 5664 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546424.1 protein_id gnl|my_center|LOCUS_13230 6135 5812 gene locus_tag LOCUS_13240 gene mscL 6135 5812 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254148.1 protein_id gnl|my_center|LOCUS_13240 6029 6280 gene locus_tag LOCUS_13250 6029 6280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 10862 6258 gene locus_tag LOCUS_13260 10862 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 11289 12059 gene locus_tag LOCUS_13270 gene pnuC 11289 12059 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550046.1 protein_id gnl|my_center|LOCUS_13270 12129 12665 gene locus_tag LOCUS_13280 12129 12665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 12729 14003 gene locus_tag LOCUS_13290 gene pepT 12729 14003 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548288.1 protein_id gnl|my_center|LOCUS_13290 14010 14459 gene locus_tag LOCUS_13300 14010 14459 CDS product DUF3290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550049.1 protein_id gnl|my_center|LOCUS_13300 14467 15102 gene locus_tag LOCUS_13310 14467 15102 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550051.1 protein_id gnl|my_center|LOCUS_13310 15118 15918 gene locus_tag LOCUS_13320 15118 15918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550052.1 protein_id gnl|my_center|LOCUS_13320 15932 16894 gene locus_tag LOCUS_13330 15932 16894 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550053.1 protein_id gnl|my_center|LOCUS_13330 18046 16922 gene locus_tag LOCUS_13340 18046 16922 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836412.1 protein_id gnl|my_center|LOCUS_13340 18887 18063 gene locus_tag LOCUS_13350 18887 18063 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709302.1 protein_id gnl|my_center|LOCUS_13350 19025 19867 gene locus_tag LOCUS_13360 19025 19867 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550055.1 protein_id gnl|my_center|LOCUS_13360 20052 20246 gene locus_tag LOCUS_13370 20052 20246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13370 >Feature sequence034 727 410 gene locus_tag LOCUS_13380 727 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13380 790 1293 gene locus_tag LOCUS_13390 gene ybaK 790 1293 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254291.1 protein_id gnl|my_center|LOCUS_13390 3037 1358 gene locus_tag LOCUS_13400 3037 1358 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254405.1 protein_id gnl|my_center|LOCUS_13400 4894 3203 gene locus_tag LOCUS_13410 4894 3203 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254405.1 protein_id gnl|my_center|LOCUS_13410 7403 4974 gene locus_tag LOCUS_13420 7403 4974 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546985.1 protein_id gnl|my_center|LOCUS_13420 8445 7420 gene locus_tag LOCUS_13430 8445 7420 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549977.1 protein_id gnl|my_center|LOCUS_13430 9915 8539 gene locus_tag LOCUS_13440 9915 8539 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547031.1 protein_id gnl|my_center|LOCUS_13440 10956 10030 gene locus_tag LOCUS_13450 10956 10030 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547001.1 protein_id gnl|my_center|LOCUS_13450 12409 11036 gene locus_tag LOCUS_13460 12409 11036 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546997.1 protein_id gnl|my_center|LOCUS_13460 13830 12424 gene locus_tag LOCUS_13470 13830 12424 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546995.1 protein_id gnl|my_center|LOCUS_13470 14669 13968 gene locus_tag LOCUS_13480 14669 13968 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254285.1 protein_id gnl|my_center|LOCUS_13480 15711 14662 gene locus_tag LOCUS_13490 15711 14662 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546989.1 protein_id gnl|my_center|LOCUS_13490 16582 15728 gene locus_tag LOCUS_13500 16582 15728 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254284.1 protein_id gnl|my_center|LOCUS_13500 17001 17693 gene locus_tag LOCUS_13510 17001 17693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547406.1 protein_id gnl|my_center|LOCUS_13510 17693 18544 gene locus_tag LOCUS_13520 17693 18544 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547408.1 protein_id gnl|my_center|LOCUS_13520 18847 19164 gene locus_tag LOCUS_13530 18847 19164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 20194 19214 gene locus_tag LOCUS_13540 gene bsh 20194 19214 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547395.1 protein_id gnl|my_center|LOCUS_13540 >Feature sequence035 71 1934 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtattctccacgtatgtggaggtgatcct 2677 5427 gene locus_tag LOCUS_13550 2677 5427 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674070.1 protein_id gnl|my_center|LOCUS_13550 5420 7105 gene locus_tag LOCUS_13560 5420 7105 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674071.1 protein_id gnl|my_center|LOCUS_13560 7122 7730 gene locus_tag LOCUS_13570 7122 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 7733 8893 gene locus_tag LOCUS_13580 gene cas7e 7733 8893 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674072.1 protein_id gnl|my_center|LOCUS_13580 8874 9584 gene locus_tag LOCUS_13590 gene cas5e 8874 9584 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674073.1 protein_id gnl|my_center|LOCUS_13590 9596 10243 gene locus_tag LOCUS_13600 gene cas6e 9596 10243 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674074.1 protein_id gnl|my_center|LOCUS_13600 10246 11184 gene locus_tag LOCUS_13610 gene cas1e 10246 11184 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674075.1 protein_id gnl|my_center|LOCUS_13610 11190 12068 gene locus_tag LOCUS_13620 gene cas2e 11190 12068 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674076.1 protein_id gnl|my_center|LOCUS_13620 12140 14427 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttctccacgtatgtggagatgatcct 15152 15880 gene locus_tag LOCUS_13630 15152 15880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 16788 15946 gene locus_tag LOCUS_13640 16788 15946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 16940 17380 gene locus_tag LOCUS_13650 16940 17380 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547614.1 protein_id gnl|my_center|LOCUS_13650 18070 17411 gene locus_tag LOCUS_13660 18070 17411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 18275 18676 gene locus_tag LOCUS_13670 18275 18676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 18765 19145 gene locus_tag LOCUS_13680 18765 19145 CDS product DUF1828 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547028.1 protein_id gnl|my_center|LOCUS_13680 19368 20219 gene locus_tag LOCUS_13690 19368 20219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence036 2495 552 gene locus_tag LOCUS_13700 2495 552 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254141.1 protein_id gnl|my_center|LOCUS_13700 2732 4201 gene locus_tag LOCUS_13710 2732 4201 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475493.1 protein_id gnl|my_center|LOCUS_13710 4212 5198 gene locus_tag LOCUS_13720 4212 5198 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700709.1 protein_id gnl|my_center|LOCUS_13720 6012 5236 gene locus_tag LOCUS_13730 6012 5236 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549621.1 protein_id gnl|my_center|LOCUS_13730 6215 7030 gene locus_tag LOCUS_13740 gene thiD 6215 7030 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549612.1 protein_id gnl|my_center|LOCUS_13740 7106 7789 gene locus_tag LOCUS_13750 7106 7789 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549605.1 protein_id gnl|my_center|LOCUS_13750 7770 9158 gene locus_tag LOCUS_13760 7770 9158 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613351.1 protein_id gnl|my_center|LOCUS_13760 10071 9196 gene locus_tag LOCUS_13770 10071 9196 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549600.1 protein_id gnl|my_center|LOCUS_13770 10519 11529 gene locus_tag LOCUS_13780 gene asnA 10519 11529 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549578.1 protein_id gnl|my_center|LOCUS_13780 12975 11575 gene locus_tag LOCUS_13790 12975 11575 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549571.1 protein_id gnl|my_center|LOCUS_13790 13466 12993 gene locus_tag LOCUS_13800 13466 12993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13800 13708 13502 gene locus_tag LOCUS_13810 13708 13502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13810 15253 13871 gene locus_tag LOCUS_13820 15253 13871 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546978.1 protein_id gnl|my_center|LOCUS_13820 16637 15243 gene locus_tag LOCUS_13830 16637 15243 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546978.1 protein_id gnl|my_center|LOCUS_13830 17157 16795 gene locus_tag LOCUS_13840 17157 16795 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546115.1 protein_id gnl|my_center|LOCUS_13840 18152 17223 gene locus_tag LOCUS_13850 18152 17223 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700025.1 protein_id gnl|my_center|LOCUS_13850 18985 18182 gene locus_tag LOCUS_13860 18985 18182 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254158.1 protein_id gnl|my_center|LOCUS_13860 20002 19007 gene locus_tag LOCUS_13870 20002 19007 CDS product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702191.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence037 1581 73 gene locus_tag LOCUS_13880 gene asp1 1581 73 CDS product accessory Sec system protein Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873202.1 protein_id gnl|my_center|LOCUS_13880 2771 1584 gene locus_tag LOCUS_13890 gene secY2 2771 1584 CDS product accessory Sec system protein translocase subunit SecY2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161877.1 protein_id gnl|my_center|LOCUS_13890 3251 4912 gene locus_tag LOCUS_13900 3251 4912 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 protein_id gnl|my_center|LOCUS_13900 6382 5057 gene locus_tag LOCUS_13910 6382 5057 CDS product IS66-like element short variant transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068990772.1 protein_id gnl|my_center|LOCUS_13910 6566 6339 gene locus_tag LOCUS_13920 6566 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691850.1 protein_id gnl|my_center|LOCUS_13920 6979 6632 gene locus_tag LOCUS_13930 gene tnpB 6979 6632 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152348.1 protein_id gnl|my_center|LOCUS_13930 18026 7380 gene locus_tag LOCUS_13940 18026 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 19600 17969 gene locus_tag LOCUS_13950 19600 17969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 >Feature sequence038 1567 170 gene locus_tag LOCUS_13960 1567 170 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701275.1 protein_id gnl|my_center|LOCUS_13960 3808 1694 gene locus_tag LOCUS_13970 3808 1694 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254615.1 protein_id gnl|my_center|LOCUS_13970 4980 4063 gene locus_tag LOCUS_13980 4980 4063 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549553.1 protein_id gnl|my_center|LOCUS_13980 6283 4964 gene locus_tag LOCUS_13990 6283 4964 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549552.1 protein_id gnl|my_center|LOCUS_13990 6449 6685 gene locus_tag LOCUS_14000 6449 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 6803 8002 gene locus_tag LOCUS_14010 6803 8002 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674376.1 protein_id gnl|my_center|LOCUS_14010 9033 8242 gene locus_tag LOCUS_14020 9033 8242 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549527.1 protein_id gnl|my_center|LOCUS_14020 10496 9195 gene locus_tag LOCUS_14030 gene dltD 10496 9195 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549525.1 protein_id gnl|my_center|LOCUS_14030 10728 10489 gene locus_tag LOCUS_14040 gene dltC 10728 10489 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549523.1 protein_id gnl|my_center|LOCUS_14040 11981 10758 gene locus_tag LOCUS_14050 gene dltB 11981 10758 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254621.1 protein_id gnl|my_center|LOCUS_14050 13486 11978 gene locus_tag LOCUS_14060 gene dltA 13486 11978 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549519.1 protein_id gnl|my_center|LOCUS_14060 13665 13507 gene locus_tag LOCUS_14070 13665 13507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 14090 13800 gene locus_tag LOCUS_14080 14090 13800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 15244 14093 gene locus_tag LOCUS_14090 15244 14093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549513.1 protein_id gnl|my_center|LOCUS_14090 15973 16467 gene locus_tag LOCUS_14100 15973 16467 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549510.1 protein_id gnl|my_center|LOCUS_14100 16538 18415 gene locus_tag LOCUS_14110 16538 18415 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549508.1 protein_id gnl|my_center|LOCUS_14110 18579 19739 gene locus_tag LOCUS_14120 18579 19739 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549506.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence039 188 9 gene locus_tag LOCUS_14130 188 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 329 1249 gene locus_tag LOCUS_14140 gene miaA 329 1249 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548247.1 protein_id gnl|my_center|LOCUS_14140 1454 2791 gene locus_tag LOCUS_14150 gene glnA 1454 2791 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003627067.1 protein_id gnl|my_center|LOCUS_14150 2899 4068 gene locus_tag LOCUS_14160 2899 4068 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548117.1 protein_id gnl|my_center|LOCUS_14160 4082 4894 gene locus_tag LOCUS_14170 4082 4894 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254431.1 protein_id gnl|my_center|LOCUS_14170 5240 4944 gene locus_tag LOCUS_14180 5240 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 5315 6259 gene locus_tag LOCUS_14190 5315 6259 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254232.1 protein_id gnl|my_center|LOCUS_14190 6382 7548 gene locus_tag LOCUS_14200 6382 7548 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546457.1 protein_id gnl|my_center|LOCUS_14200 7526 8761 gene locus_tag LOCUS_14210 7526 8761 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546459.1 protein_id gnl|my_center|LOCUS_14210 8763 9926 gene locus_tag LOCUS_14220 8763 9926 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546460.1 protein_id gnl|my_center|LOCUS_14220 11616 10237 gene locus_tag LOCUS_14230 gene rlmD 11616 10237 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546467.1 protein_id gnl|my_center|LOCUS_14230 11745 12560 gene locus_tag LOCUS_14240 gene recX 11745 12560 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546469.1 protein_id gnl|my_center|LOCUS_14240 12597 13187 gene locus_tag LOCUS_14250 12597 13187 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130958.1 protein_id gnl|my_center|LOCUS_14250 13159 13656 gene locus_tag LOCUS_14260 13159 13656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254210.1 protein_id gnl|my_center|LOCUS_14260 14118 13657 gene locus_tag LOCUS_14270 14118 13657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 14233 15099 gene locus_tag LOCUS_14280 14233 15099 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546472.1 protein_id gnl|my_center|LOCUS_14280 15099 16667 gene locus_tag LOCUS_14290 15099 16667 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546473.1 protein_id gnl|my_center|LOCUS_14290 16993 16712 gene locus_tag LOCUS_14300 16993 16712 CDS product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546474.1 protein_id gnl|my_center|LOCUS_14300 <17654 16977 gene locus_tag LOCUS_14310 <17654 16977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000054202.1:ABC transporter ATP-binding protein >Feature sequence040 800 102 gene locus_tag LOCUS_14320 gene rpiA 800 102 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254196.1 protein_id gnl|my_center|LOCUS_14320 1726 800 gene locus_tag LOCUS_14330 gene rbsK 1726 800 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563212.1 protein_id gnl|my_center|LOCUS_14330 2283 1816 gene locus_tag LOCUS_14340 2283 1816 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297290.1 protein_id gnl|my_center|LOCUS_14340 3905 2367 gene locus_tag LOCUS_14350 3905 2367 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949006.1 protein_id gnl|my_center|LOCUS_14350 4495 4049 gene locus_tag LOCUS_14360 4495 4049 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797437.1 protein_id gnl|my_center|LOCUS_14360 5197 4514 gene locus_tag LOCUS_14370 gene phoU 5197 4514 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549102.1 protein_id gnl|my_center|LOCUS_14370 5969 5214 gene locus_tag LOCUS_14380 gene pstB 5969 5214 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549101.1 protein_id gnl|my_center|LOCUS_14380 6780 5980 gene locus_tag LOCUS_14390 gene pstB 6780 5980 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613297.1 protein_id gnl|my_center|LOCUS_14390 7681 6791 gene locus_tag LOCUS_14400 gene pstA 7681 6791 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549099.1 protein_id gnl|my_center|LOCUS_14400 8673 7681 gene locus_tag LOCUS_14410 gene pstC 8673 7681 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549098.1 protein_id gnl|my_center|LOCUS_14410 9559 8690 gene locus_tag LOCUS_14420 9559 8690 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254125.1 protein_id gnl|my_center|LOCUS_14420 10198 9677 gene locus_tag LOCUS_14430 10198 9677 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643199.1 protein_id gnl|my_center|LOCUS_14430 11025 10294 gene locus_tag LOCUS_14440 11025 10294 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254050.1 protein_id gnl|my_center|LOCUS_14440 12505 11012 gene locus_tag LOCUS_14450 12505 11012 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548719.1 protein_id gnl|my_center|LOCUS_14450 13454 12606 gene locus_tag LOCUS_14460 13454 12606 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 protein_id gnl|my_center|LOCUS_14460 16324 13526 gene locus_tag LOCUS_14470 16324 13526 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262972.1 protein_id gnl|my_center|LOCUS_14470 16705 16421 gene locus_tag LOCUS_14480 16705 16421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 17022 16708 gene locus_tag LOCUS_14490 17022 16708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 17375 17145 gene locus_tag LOCUS_14500 17375 17145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 >Feature sequence041 349 1998 gene locus_tag LOCUS_14510 349 1998 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 protein_id gnl|my_center|LOCUS_14510 2033 3358 gene locus_tag LOCUS_14520 2033 3358 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476236.1 protein_id gnl|my_center|LOCUS_14520 3392 4816 gene locus_tag LOCUS_14530 3392 4816 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475567.1 protein_id gnl|my_center|LOCUS_14530 4885 6555 gene locus_tag LOCUS_14540 4885 6555 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 protein_id gnl|my_center|LOCUS_14540 6582 7907 gene locus_tag LOCUS_14550 6582 7907 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714165.1 protein_id gnl|my_center|LOCUS_14550 7941 9296 gene locus_tag LOCUS_14560 7941 9296 CDS product C45 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022064.1 protein_id gnl|my_center|LOCUS_14560 9997 9377 gene locus_tag LOCUS_14570 9997 9377 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547184.1 protein_id gnl|my_center|LOCUS_14570 11058 10138 gene locus_tag LOCUS_14580 gene glsA 11058 10138 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295938.1 protein_id gnl|my_center|LOCUS_14580 11597 11193 gene locus_tag LOCUS_14590 11597 11193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 11881 13212 gene locus_tag LOCUS_14600 11881 13212 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546343.1 protein_id gnl|my_center|LOCUS_14600 14006 14794 gene locus_tag LOCUS_14610 14006 14794 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025015513.1 protein_id gnl|my_center|LOCUS_14610 15620 15192 gene locus_tag LOCUS_14620 15620 15192 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546335.1 protein_id gnl|my_center|LOCUS_14620 17300 15849 gene locus_tag LOCUS_14630 17300 15849 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254182.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence042 821 339 gene locus_tag LOCUS_14640 821 339 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254394.1 protein_id gnl|my_center|LOCUS_14640 887 1354 gene locus_tag LOCUS_14650 887 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547345.1 protein_id gnl|my_center|LOCUS_14650 1407 1865 gene locus_tag LOCUS_14660 1407 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547345.1 protein_id gnl|my_center|LOCUS_14660 1849 2394 gene locus_tag LOCUS_14670 1849 2394 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639830.1 protein_id gnl|my_center|LOCUS_14670 2533 2853 gene locus_tag LOCUS_14680 2533 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 2853 3158 gene locus_tag LOCUS_14690 2853 3158 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916506.1 protein_id gnl|my_center|LOCUS_14690 3704 3369 gene locus_tag LOCUS_14700 3704 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 3878 5455 gene locus_tag LOCUS_14710 3878 5455 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254534.1 protein_id gnl|my_center|LOCUS_14710 6001 5519 gene locus_tag LOCUS_14720 6001 5519 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546951.1 protein_id gnl|my_center|LOCUS_14720 6180 7361 gene locus_tag LOCUS_14730 6180 7361 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002351560.1 protein_id gnl|my_center|LOCUS_14730 8737 7451 gene locus_tag LOCUS_14740 gene eno 8737 7451 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546959.1 protein_id gnl|my_center|LOCUS_14740 10525 8942 gene locus_tag LOCUS_14750 10525 8942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254025.1 protein_id gnl|my_center|LOCUS_14750 12117 10528 gene locus_tag LOCUS_14760 12117 10528 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548575.1 protein_id gnl|my_center|LOCUS_14760 12421 13287 gene locus_tag LOCUS_14770 12421 13287 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548384.1 protein_id gnl|my_center|LOCUS_14770 13486 13337 gene locus_tag LOCUS_14780 13486 13337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 14679 13549 gene locus_tag LOCUS_14790 14679 13549 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546645.1 protein_id gnl|my_center|LOCUS_14790 15010 15282 gene locus_tag LOCUS_14800 15010 15282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14800 15834 15436 gene locus_tag LOCUS_14810 15834 15436 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861104.1 protein_id gnl|my_center|LOCUS_14810 16552 15908 gene locus_tag LOCUS_14820 16552 15908 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702509.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence043 1776 154 gene locus_tag LOCUS_14830 1776 154 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546358.1 protein_id gnl|my_center|LOCUS_14830 2124 1843 gene locus_tag LOCUS_14840 2124 1843 CDS product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262921.1 protein_id gnl|my_center|LOCUS_14840 3524 2238 gene locus_tag LOCUS_14850 gene eno 3524 2238 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546959.1 protein_id gnl|my_center|LOCUS_14850 4285 3701 gene locus_tag LOCUS_14860 4285 3701 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546962.1 protein_id gnl|my_center|LOCUS_14860 4560 4473 gene locus_tag LOCUS_t00300 4560 4473 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5690 4842 gene locus_tag LOCUS_14870 5690 4842 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254391.1 protein_id gnl|my_center|LOCUS_14870 5814 8081 gene locus_tag LOCUS_14880 5814 8081 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254392.1 protein_id gnl|my_center|LOCUS_14880 9498 8155 gene locus_tag LOCUS_14890 9498 8155 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613273.1 protein_id gnl|my_center|LOCUS_14890 10178 9675 gene locus_tag LOCUS_14900 10178 9675 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546982.1 protein_id gnl|my_center|LOCUS_14900 11152 10196 gene locus_tag LOCUS_14910 11152 10196 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546979.1 protein_id gnl|my_center|LOCUS_14910 11288 12775 gene locus_tag LOCUS_14920 gene cls 11288 12775 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547770.1 protein_id gnl|my_center|LOCUS_14920 14284 12824 gene locus_tag LOCUS_14930 gene yjeM 14284 12824 CDS product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548106.1 protein_id gnl|my_center|LOCUS_14930 14984 14457 gene locus_tag LOCUS_14940 14984 14457 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547784.1 protein_id gnl|my_center|LOCUS_14940 <16387 15119 gene locus_tag LOCUS_14950 <16387 15119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547786.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence044 635 120 gene locus_tag LOCUS_14960 635 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613291.1 protein_id gnl|my_center|LOCUS_14960 2188 830 gene locus_tag LOCUS_14970 gene frc 2188 830 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549137.1 protein_id gnl|my_center|LOCUS_14970 3930 2194 gene locus_tag LOCUS_14980 gene oxc 3930 2194 CDS product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044304031.1 protein_id gnl|my_center|LOCUS_14980 4282 5463 gene locus_tag LOCUS_14990 4282 5463 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549103.1 protein_id gnl|my_center|LOCUS_14990 5533 5748 gene locus_tag LOCUS_15000 5533 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 6553 5840 gene locus_tag LOCUS_15010 6553 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 6640 7092 gene locus_tag LOCUS_15020 6640 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240220.1 protein_id gnl|my_center|LOCUS_15020 7413 7093 gene locus_tag LOCUS_15030 7413 7093 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644291.1 protein_id gnl|my_center|LOCUS_15030 7563 8165 gene locus_tag LOCUS_15040 7563 8165 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575135.1 protein_id gnl|my_center|LOCUS_15040 9070 8312 gene locus_tag LOCUS_15050 9070 8312 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546159.1 protein_id gnl|my_center|LOCUS_15050 9573 9211 gene locus_tag LOCUS_15060 9573 9211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 10556 9600 gene locus_tag LOCUS_15070 10556 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15070 11461 10634 gene locus_tag LOCUS_15080 11461 10634 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548147.1 protein_id gnl|my_center|LOCUS_15080 11682 13631 gene locus_tag LOCUS_15090 11682 13631 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643065.1 protein_id gnl|my_center|LOCUS_15090 13615 13968 gene locus_tag LOCUS_15100 13615 13968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15100 13923 15758 gene locus_tag LOCUS_15110 13923 15758 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548136.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15110 >Feature sequence045 1930 104 gene locus_tag LOCUS_15120 1930 104 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254067.1 protein_id gnl|my_center|LOCUS_15120 2829 2017 gene locus_tag LOCUS_15130 gene pfkB 2829 2017 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355534.1 protein_id gnl|my_center|LOCUS_15130 5108 2940 gene locus_tag LOCUS_15140 5108 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 7250 5163 gene locus_tag LOCUS_15150 7250 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 7693 7454 gene locus_tag LOCUS_15160 7693 7454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 7943 7734 gene locus_tag LOCUS_15170 7943 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 8122 9186 gene locus_tag LOCUS_15180 8122 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 9273 9692 gene locus_tag LOCUS_15190 9273 9692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548785.1 protein_id gnl|my_center|LOCUS_15190 9832 11829 gene locus_tag LOCUS_15200 9832 11829 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254197.1 protein_id gnl|my_center|LOCUS_15200 11978 14029 gene locus_tag LOCUS_15210 11978 14029 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087236515.1 protein_id gnl|my_center|LOCUS_15210 15783 14125 gene locus_tag LOCUS_15220 15783 14125 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546143.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence046 3154 908 gene locus_tag LOCUS_15230 gene pcrA 3154 908 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546275.1 protein_id gnl|my_center|LOCUS_15230 3878 3252 gene locus_tag LOCUS_15240 3878 3252 CDS product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546273.1 protein_id gnl|my_center|LOCUS_15240 4455 3880 gene locus_tag LOCUS_15250 4455 3880 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254627.1 protein_id gnl|my_center|LOCUS_15250 4616 4528 gene locus_tag LOCUS_t00310 4616 4528 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5132 4674 gene locus_tag LOCUS_15260 5132 4674 CDS product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344247.1 protein_id gnl|my_center|LOCUS_15260 5712 5215 gene locus_tag LOCUS_15270 5712 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 7151 5709 gene locus_tag LOCUS_15280 7151 5709 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254175.1 protein_id gnl|my_center|LOCUS_15280 8269 7163 gene locus_tag LOCUS_15290 8269 7163 CDS product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546266.1 protein_id gnl|my_center|LOCUS_15290 8456 8244 gene locus_tag LOCUS_15300 8456 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 8712 8431 gene locus_tag LOCUS_15310 8712 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15310 11089 8672 gene locus_tag LOCUS_15320 11089 8672 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546265.1 protein_id gnl|my_center|LOCUS_15320 13307 11313 gene locus_tag LOCUS_15330 13307 11313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 14165 13332 gene locus_tag LOCUS_15340 gene nadE 14165 13332 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546262.1 protein_id gnl|my_center|LOCUS_15340 15639 14167 gene locus_tag LOCUS_15350 15639 14167 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254174.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence047 475 3315 gene locus_tag LOCUS_15360 475 3315 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254017.1 protein_id gnl|my_center|LOCUS_15360 3405 3980 gene locus_tag LOCUS_15370 3405 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15370 3977 4243 gene locus_tag LOCUS_15380 3977 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 4396 4163 gene locus_tag LOCUS_15390 4396 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 4528 5577 gene locus_tag LOCUS_15400 4528 5577 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549287.1 protein_id gnl|my_center|LOCUS_15400 5834 6031 gene locus_tag LOCUS_15410 5834 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 6189 6332 gene locus_tag LOCUS_15420 6189 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 6332 8041 gene locus_tag LOCUS_15430 6332 8041 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990058.1 protein_id gnl|my_center|LOCUS_15430 8044 10581 gene locus_tag LOCUS_15440 gene lanKC 8044 10581 CDS product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127742798.1 protein_id gnl|my_center|LOCUS_15440 10584 10730 gene locus_tag LOCUS_15450 10584 10730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 10956 12287 gene locus_tag LOCUS_15460 10956 12287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 12579 13064 gene locus_tag LOCUS_15470 12579 13064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 13246 14580 gene locus_tag LOCUS_15480 13246 14580 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547445.1 protein_id gnl|my_center|LOCUS_15480 <15764 14623 gene locus_tag LOCUS_15490 <15764 14623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254072.1:IMP dehydrogenase >Feature sequence048 3733 800 gene locus_tag LOCUS_15500 3733 800 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548819.1 protein_id gnl|my_center|LOCUS_15500 4350 3730 gene locus_tag LOCUS_15510 4350 3730 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548818.1 protein_id gnl|my_center|LOCUS_15510 5459 4350 gene locus_tag LOCUS_15520 5459 4350 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548816.1 protein_id gnl|my_center|LOCUS_15520 6469 5588 gene locus_tag LOCUS_15530 6469 5588 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129425.1 protein_id gnl|my_center|LOCUS_15530 7585 6722 gene locus_tag LOCUS_15540 7585 6722 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548017.1 protein_id gnl|my_center|LOCUS_15540 8370 7657 gene locus_tag LOCUS_15550 8370 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 9540 8608 gene locus_tag LOCUS_15560 9540 8608 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547856.1 protein_id gnl|my_center|LOCUS_15560 9997 9560 gene locus_tag LOCUS_15570 9997 9560 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254406.1 protein_id gnl|my_center|LOCUS_15570 10181 10438 gene locus_tag LOCUS_15580 gene rpsN 10181 10438 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354822.1 protein_id gnl|my_center|LOCUS_15580 11315 11034 gene locus_tag LOCUS_15590 11315 11034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 12073 11381 gene locus_tag LOCUS_15600 12073 11381 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548802.1 protein_id gnl|my_center|LOCUS_15600 12235 12657 gene locus_tag LOCUS_15610 12235 12657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 12743 13570 gene locus_tag LOCUS_15620 12743 13570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 13591 14373 gene locus_tag LOCUS_15630 13591 14373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 14387 15349 gene locus_tag LOCUS_15640 14387 15349 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548798.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence049 875 312 gene locus_tag LOCUS_15650 875 312 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254344.1 protein_id gnl|my_center|LOCUS_15650 1668 1027 gene locus_tag LOCUS_15660 1668 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2577 1690 gene locus_tag LOCUS_15670 2577 1690 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547149.1 protein_id gnl|my_center|LOCUS_15670 3999 2605 gene locus_tag LOCUS_15680 gene hslU 3999 2605 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254308.1 protein_id gnl|my_center|LOCUS_15680 4534 4010 gene locus_tag LOCUS_15690 gene hslV 4534 4010 CDS product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254307.1 protein_id gnl|my_center|LOCUS_15690 5462 4539 gene locus_tag LOCUS_15700 5462 4539 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547143.1 protein_id gnl|my_center|LOCUS_15700 6781 5465 gene locus_tag LOCUS_15710 gene trmFO 6781 5465 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547141.1 protein_id gnl|my_center|LOCUS_15710 8960 6879 gene locus_tag LOCUS_15720 gene topA 8960 6879 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547140.1 protein_id gnl|my_center|LOCUS_15720 9871 9026 gene locus_tag LOCUS_15730 gene dprA 9871 9026 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547135.1 protein_id gnl|my_center|LOCUS_15730 10676 9924 gene locus_tag LOCUS_15740 10676 9924 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254306.1 protein_id gnl|my_center|LOCUS_15740 11512 10673 gene locus_tag LOCUS_15750 gene ylqF 11512 10673 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547131.1 protein_id gnl|my_center|LOCUS_15750 12966 11515 gene locus_tag LOCUS_15760 12966 11515 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101574.1 protein_id gnl|my_center|LOCUS_15760 13201 12974 gene locus_tag LOCUS_15770 13201 12974 CDS product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547128.1 protein_id gnl|my_center|LOCUS_15770 14058 13201 gene locus_tag LOCUS_15780 14058 13201 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254305.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence050 <1 504 gene locus_tag LOCUS_15790 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254482.1:RNA-guided endonuclease TnpB family protein 701 2134 gene locus_tag LOCUS_15800 701 2134 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550057.1 protein_id gnl|my_center|LOCUS_15800 2442 3527 gene locus_tag LOCUS_15810 2442 3527 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254531.1 protein_id gnl|my_center|LOCUS_15810 3527 4390 gene locus_tag LOCUS_15820 3527 4390 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550063.1 protein_id gnl|my_center|LOCUS_15820 4392 5222 gene locus_tag LOCUS_15830 4392 5222 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254529.1 protein_id gnl|my_center|LOCUS_15830 5206 6507 gene locus_tag LOCUS_15840 5206 6507 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550067.1 protein_id gnl|my_center|LOCUS_15840 6552 7856 gene locus_tag LOCUS_15850 6552 7856 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550069.1 protein_id gnl|my_center|LOCUS_15850 8290 7922 gene locus_tag LOCUS_15860 8290 7922 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550019.1 protein_id gnl|my_center|LOCUS_15860 8443 8901 gene locus_tag LOCUS_15870 8443 8901 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254537.1 protein_id gnl|my_center|LOCUS_15870 8903 9427 gene locus_tag LOCUS_15880 8903 9427 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550021.1 protein_id gnl|my_center|LOCUS_15880 9427 9867 gene locus_tag LOCUS_15890 9427 9867 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550006.1 protein_id gnl|my_center|LOCUS_15890 10839 9916 gene locus_tag LOCUS_15900 10839 9916 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548278.1 protein_id gnl|my_center|LOCUS_15900 11031 11975 gene locus_tag LOCUS_15910 11031 11975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 12102 12665 gene locus_tag LOCUS_15920 12102 12665 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254526.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence051 1239 97 gene locus_tag LOCUS_15930 gene wecB 1239 97 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254207.1 protein_id gnl|my_center|LOCUS_15930 1832 1692 gene locus_tag LOCUS_15940 1832 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 2297 1899 gene locus_tag LOCUS_15950 2297 1899 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961810.1 protein_id gnl|my_center|LOCUS_15950 2703 2497 gene locus_tag LOCUS_15960 2703 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 3091 2900 gene locus_tag LOCUS_15970 3091 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023376657.1 protein_id gnl|my_center|LOCUS_15970 4119 3217 gene locus_tag LOCUS_15980 4119 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 4528 4121 gene locus_tag LOCUS_15990 4528 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 4685 4515 gene locus_tag LOCUS_16000 4685 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 5062 4685 gene locus_tag LOCUS_16010 5062 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 5298 5074 gene locus_tag LOCUS_16020 5298 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 5729 5298 gene locus_tag LOCUS_16030 5729 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 6094 5801 gene locus_tag LOCUS_16040 6094 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 6774 6094 gene locus_tag LOCUS_16050 6774 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 7194 6775 gene locus_tag LOCUS_16060 7194 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 7646 7194 gene locus_tag LOCUS_16070 7646 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 8298 7660 gene locus_tag LOCUS_16080 8298 7660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 9217 8309 gene locus_tag LOCUS_16090 9217 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 10362 9214 gene locus_tag LOCUS_16100 10362 9214 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390596.1 protein_id gnl|my_center|LOCUS_16100 10690 10355 gene locus_tag LOCUS_16110 10690 10355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 11042 10677 gene locus_tag LOCUS_16120 11042 10677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377515.1 protein_id gnl|my_center|LOCUS_16120 11905 11042 gene locus_tag LOCUS_16130 11905 11042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390593.1 protein_id gnl|my_center|LOCUS_16130 12233 11898 gene locus_tag LOCUS_16140 12233 11898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377517.1 protein_id gnl|my_center|LOCUS_16140 12796 12233 gene locus_tag LOCUS_16150 12796 12233 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386767.1 protein_id gnl|my_center|LOCUS_16150 13459 12800 gene locus_tag LOCUS_16160 13459 12800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence052 299 1249 gene locus_tag LOCUS_16170 299 1249 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548569.1 protein_id gnl|my_center|LOCUS_16170 1262 2212 gene locus_tag LOCUS_16180 1262 2212 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254020.1 protein_id gnl|my_center|LOCUS_16180 2209 3069 gene locus_tag LOCUS_16190 2209 3069 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548564.1 protein_id gnl|my_center|LOCUS_16190 3371 4729 gene locus_tag LOCUS_16200 3371 4729 CDS product conjugated bile salt MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861900.1 protein_id gnl|my_center|LOCUS_16200 4753 6108 gene locus_tag LOCUS_16210 4753 6108 CDS product conjugated bile salt MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861900.1 protein_id gnl|my_center|LOCUS_16210 6123 7073 gene locus_tag LOCUS_16220 gene bsh 6123 7073 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389832.1 protein_id gnl|my_center|LOCUS_16220 7831 7223 gene locus_tag LOCUS_16230 7831 7223 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254536.1 protein_id gnl|my_center|LOCUS_16230 8867 7953 gene locus_tag LOCUS_16240 8867 7953 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550037.1 protein_id gnl|my_center|LOCUS_16240 9622 8900 gene locus_tag LOCUS_16250 9622 8900 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102162.1 protein_id gnl|my_center|LOCUS_16250 11049 9685 gene locus_tag LOCUS_16260 gene brnQ 11049 9685 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476479.1 protein_id gnl|my_center|LOCUS_16260 12990 11140 gene locus_tag LOCUS_16270 12990 11140 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187364788.1 protein_id gnl|my_center|LOCUS_16270 <13938 13080 gene locus_tag LOCUS_16280 <13938 13080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003643099.1:LysR family transcriptional regulator >Feature sequence053 545 99 gene locus_tag LOCUS_16290 545 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16290 697 542 gene locus_tag LOCUS_16300 697 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16300 2226 715 gene locus_tag LOCUS_16310 2226 715 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547799.1 protein_id gnl|my_center|LOCUS_16310 3423 2485 gene locus_tag LOCUS_16320 gene ribF 3423 2485 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547803.1 protein_id gnl|my_center|LOCUS_16320 4329 3436 gene locus_tag LOCUS_16330 gene truB 4329 3436 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547805.1 protein_id gnl|my_center|LOCUS_16330 4593 4375 gene locus_tag LOCUS_16340 4593 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16340 4714 4553 gene locus_tag LOCUS_16350 4714 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16350 7387 4745 gene locus_tag LOCUS_16360 gene infB 7387 4745 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254396.1 protein_id gnl|my_center|LOCUS_16360 7703 7392 gene locus_tag LOCUS_16370 7703 7392 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027746.1 protein_id gnl|my_center|LOCUS_16370 7981 7706 gene locus_tag LOCUS_16380 7981 7706 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547812.1 protein_id gnl|my_center|LOCUS_16380 9233 8013 gene locus_tag LOCUS_16390 gene nusA 9233 8013 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254397.1 protein_id gnl|my_center|LOCUS_16390 9729 9253 gene locus_tag LOCUS_16400 gene rimP 9729 9253 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254398.1 protein_id gnl|my_center|LOCUS_16400 <13647 9837 gene locus_tag LOCUS_16410 <13647 9837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547817.1:PolC-type DNA polymerase III >Feature sequence054 1335 472 gene locus_tag LOCUS_16420 1335 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1489 1644 gene locus_tag LOCUS_16430 1489 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 2136 1663 gene locus_tag LOCUS_16440 2136 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 5283 3166 gene locus_tag LOCUS_16450 5283 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 5958 5560 gene locus_tag LOCUS_16460 5958 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 6263 5985 gene locus_tag LOCUS_16470 6263 5985 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391907.1 protein_id gnl|my_center|LOCUS_16470 6655 6263 gene locus_tag LOCUS_16480 6655 6263 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766756.1 protein_id gnl|my_center|LOCUS_16480 7650 6847 gene locus_tag LOCUS_16490 7650 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 7821 8336 gene locus_tag LOCUS_16500 7821 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 8944 8357 gene locus_tag LOCUS_16510 8944 8357 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050340461.1 protein_id gnl|my_center|LOCUS_16510 9024 9314 gene locus_tag LOCUS_16520 9024 9314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 9813 9412 gene locus_tag LOCUS_16530 gene arsC 9813 9412 CDS product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675012.1 protein_id gnl|my_center|LOCUS_16530 9886 10221 gene locus_tag LOCUS_16540 9886 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 11888 10386 gene locus_tag LOCUS_16550 11888 10386 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642121.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence055 1852 338 gene locus_tag LOCUS_16560 1852 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 2745 1873 gene locus_tag LOCUS_16570 2745 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 3343 3269 gene locus_tag LOCUS_t00320 3343 3269 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4300 3443 gene locus_tag LOCUS_16580 4300 3443 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254321.1 protein_id gnl|my_center|LOCUS_16580 5713 4382 gene locus_tag LOCUS_16590 5713 4382 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254382.1 protein_id gnl|my_center|LOCUS_16590 5847 6332 gene locus_tag LOCUS_16600 5847 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 6373 6609 gene locus_tag LOCUS_16610 6373 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 6669 7661 gene locus_tag LOCUS_16620 gene galE 6669 7661 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548187.1 protein_id gnl|my_center|LOCUS_16620 8105 7704 gene locus_tag LOCUS_16630 8105 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16630 9907 8072 gene locus_tag LOCUS_16640 9907 8072 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546149.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16640 11249 9915 gene locus_tag LOCUS_16650 11249 9915 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546148.1 protein_id gnl|my_center|LOCUS_16650 13130 11253 gene locus_tag LOCUS_16660 13130 11253 CDS product TerB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546145.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence056 1362 2330 gene locus_tag LOCUS_16670 1362 2330 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548693.1 protein_id gnl|my_center|LOCUS_16670 2708 2499 gene locus_tag LOCUS_16680 2708 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 3523 2792 gene locus_tag LOCUS_16690 3523 2792 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548691.1 protein_id gnl|my_center|LOCUS_16690 3612 4538 gene locus_tag LOCUS_16700 3612 4538 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548688.1 protein_id gnl|my_center|LOCUS_16700 4562 5269 gene locus_tag LOCUS_16710 4562 5269 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383773.1 protein_id gnl|my_center|LOCUS_16710 5274 6743 gene locus_tag LOCUS_16720 gene cls 5274 6743 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548687.1 protein_id gnl|my_center|LOCUS_16720 7287 6811 gene locus_tag LOCUS_16730 7287 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254045.1 protein_id gnl|my_center|LOCUS_16730 7414 8127 gene locus_tag LOCUS_16740 7414 8127 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613281.1 protein_id gnl|my_center|LOCUS_16740 8244 8774 gene locus_tag LOCUS_16750 8244 8774 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004039686.1 protein_id gnl|my_center|LOCUS_16750 8761 9543 gene locus_tag LOCUS_16760 8761 9543 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548681.1 protein_id gnl|my_center|LOCUS_16760 9902 9540 gene locus_tag LOCUS_16770 9902 9540 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548679.1 protein_id gnl|my_center|LOCUS_16770 9978 10604 gene locus_tag LOCUS_16780 9978 10604 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254043.1 protein_id gnl|my_center|LOCUS_16780 10940 12553 gene locus_tag LOCUS_16790 10940 12553 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254042.1 protein_id gnl|my_center|LOCUS_16790 12543 13301 gene locus_tag LOCUS_16800 12543 13301 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548674.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence057 1366 2358 gene locus_tag LOCUS_16810 1366 2358 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254608.1 protein_id gnl|my_center|LOCUS_16810 2448 3803 gene locus_tag LOCUS_16820 2448 3803 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254446.1 protein_id gnl|my_center|LOCUS_16820 4521 3898 gene locus_tag LOCUS_16830 4521 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 5605 4769 gene locus_tag LOCUS_16840 5605 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 8624 5613 gene locus_tag LOCUS_16850 8624 5613 CDS product SEC10/PgrA surface exclusion domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836594.1 protein_id gnl|my_center|LOCUS_16850 9889 8843 gene locus_tag LOCUS_16860 gene tsaD 9889 8843 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549127.1 protein_id gnl|my_center|LOCUS_16860 10443 9907 gene locus_tag LOCUS_16870 gene rimI 10443 9907 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549125.1 protein_id gnl|my_center|LOCUS_16870 11152 10427 gene locus_tag LOCUS_16880 gene tsaB 11152 10427 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549123.1 protein_id gnl|my_center|LOCUS_16880 11558 11181 gene locus_tag LOCUS_16890 11558 11181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 12390 11656 gene locus_tag LOCUS_16900 12390 11656 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254136.1 protein_id gnl|my_center|LOCUS_16900 <13239 12405 gene locus_tag LOCUS_16910 <13239 12405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549119.1:16S rRNA (cytidine(1402)-2'-O)-methyltransferase >Feature sequence058 257 1675 gene locus_tag LOCUS_16920 257 1675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613381.1 protein_id gnl|my_center|LOCUS_16920 2898 1717 gene locus_tag LOCUS_16930 2898 1717 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254401.1 protein_id gnl|my_center|LOCUS_16930 3580 2966 gene locus_tag LOCUS_16940 3580 2966 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547840.1 protein_id gnl|my_center|LOCUS_16940 3649 4671 gene locus_tag LOCUS_16950 3649 4671 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547839.1 protein_id gnl|my_center|LOCUS_16950 4825 5610 gene locus_tag LOCUS_16960 gene rpsB 4825 5610 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547837.1 protein_id gnl|my_center|LOCUS_16960 5648 6673 gene locus_tag LOCUS_16970 gene tsf 5648 6673 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547835.1 protein_id gnl|my_center|LOCUS_16970 6783 7508 gene locus_tag LOCUS_16980 gene pyrH 6783 7508 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254400.1 protein_id gnl|my_center|LOCUS_16980 7508 8065 gene locus_tag LOCUS_16990 gene frr 7508 8065 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095341972.1 protein_id gnl|my_center|LOCUS_16990 8084 8803 gene locus_tag LOCUS_17000 8084 8803 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547825.1 protein_id gnl|my_center|LOCUS_17000 8830 9621 gene locus_tag LOCUS_17010 8830 9621 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547823.1 protein_id gnl|my_center|LOCUS_17010 9634 10890 gene locus_tag LOCUS_17020 gene rseP 9634 10890 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547820.1 protein_id gnl|my_center|LOCUS_17020 10907 12604 gene locus_tag LOCUS_17030 10907 12604 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547819.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence059 709 482 gene locus_tag LOCUS_17040 709 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 1458 820 gene locus_tag LOCUS_17050 1458 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 2711 1566 gene locus_tag LOCUS_17060 2711 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 3807 2704 gene locus_tag LOCUS_17070 3807 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 4733 3819 gene locus_tag LOCUS_17080 4733 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 4923 4849 gene locus_tag LOCUS_t00330 4923 4849 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5618 4938 gene locus_tag LOCUS_17090 gene clpP 5618 4938 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964184.1 protein_id gnl|my_center|LOCUS_17090 6728 5658 gene locus_tag LOCUS_17100 gene dnaJ 6728 5658 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016154.1 protein_id gnl|my_center|LOCUS_17100 7684 6932 gene locus_tag LOCUS_17110 7684 6932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 8832 7693 gene locus_tag LOCUS_17120 8832 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 9601 8837 gene locus_tag LOCUS_17130 9601 8837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 9939 9598 gene locus_tag LOCUS_17140 9939 9598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 10484 10104 gene locus_tag LOCUS_17150 10484 10104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 11400 10549 gene locus_tag LOCUS_17160 11400 10549 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259191.1 protein_id gnl|my_center|LOCUS_17160 11678 11484 gene locus_tag LOCUS_17170 11678 11484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 11842 11681 gene locus_tag LOCUS_17180 11842 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 11945 12643 gene locus_tag LOCUS_17190 11945 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence060 <1 1134 gene locus_tag LOCUS_17200 <1 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254625.1:YdcF family protein 1147 3210 gene locus_tag LOCUS_17210 1147 3210 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254626.1 protein_id gnl|my_center|LOCUS_17210 3188 3481 gene locus_tag LOCUS_17220 3188 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17220 3646 5037 gene locus_tag LOCUS_17230 3646 5037 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641324.1 protein_id gnl|my_center|LOCUS_17230 5037 6059 gene locus_tag LOCUS_17240 gene cydB 5037 6059 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571229.1 protein_id gnl|my_center|LOCUS_17240 6078 7895 gene locus_tag LOCUS_17250 gene cydD 6078 7895 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476126.1 protein_id gnl|my_center|LOCUS_17250 7892 9265 gene locus_tag LOCUS_17260 gene cydC 7892 9265 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641327.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17260 9387 9614 gene locus_tag LOCUS_17270 9387 9614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17270 9634 10560 gene locus_tag LOCUS_17280 9634 10560 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174552.1 protein_id gnl|my_center|LOCUS_17280 10775 11707 gene locus_tag LOCUS_17290 gene phnD 10775 11707 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254002.1 protein_id gnl|my_center|LOCUS_17290 11801 12871 gene locus_tag LOCUS_17300 11801 12871 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549489.1 protein_id gnl|my_center|LOCUS_17300 >Feature sequence061 276 944 gene locus_tag LOCUS_17310 276 944 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546647.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17310 972 1118 gene locus_tag LOCUS_17320 972 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17320 1348 1611 gene locus_tag LOCUS_17330 1348 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17330 1905 2819 gene locus_tag LOCUS_17340 1905 2819 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549601.1 protein_id gnl|my_center|LOCUS_17340 3075 4829 gene locus_tag LOCUS_17350 3075 4829 CDS product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547891.1 protein_id gnl|my_center|LOCUS_17350 5109 6029 gene locus_tag LOCUS_17360 5109 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 6045 6824 gene locus_tag LOCUS_17370 6045 6824 CDS product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721639.1 protein_id gnl|my_center|LOCUS_17370 6814 7617 gene locus_tag LOCUS_17380 6814 7617 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728733.1 protein_id gnl|my_center|LOCUS_17380 7702 8097 gene locus_tag LOCUS_17390 7702 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 8634 8158 gene locus_tag LOCUS_17400 8634 8158 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547404.1 protein_id gnl|my_center|LOCUS_17400 9758 8649 gene locus_tag LOCUS_17410 9758 8649 CDS product vitamin B12 independent methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102105.1 protein_id gnl|my_center|LOCUS_17410 11670 10282 gene locus_tag LOCUS_17420 11670 10282 CDS product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355598.1 protein_id gnl|my_center|LOCUS_17420 12081 12815 gene locus_tag LOCUS_17430 12081 12815 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254533.1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence062 809 111 gene locus_tag LOCUS_17440 809 111 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549297.1 protein_id gnl|my_center|LOCUS_17440 953 1357 gene locus_tag LOCUS_17450 gene psiE 953 1357 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905975.1 protein_id gnl|my_center|LOCUS_17450 1885 1352 gene locus_tag LOCUS_17460 1885 1352 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254447.1 protein_id gnl|my_center|LOCUS_17460 3319 2111 gene locus_tag LOCUS_17470 3319 2111 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546183.1 protein_id gnl|my_center|LOCUS_17470 3692 3393 gene locus_tag LOCUS_17480 3692 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 4650 3622 gene locus_tag LOCUS_17490 4650 3622 CDS product Rep family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546178.1 protein_id gnl|my_center|LOCUS_17490 5032 4628 gene locus_tag LOCUS_17500 5032 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 5819 5196 gene locus_tag LOCUS_17510 5819 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 6910 5834 gene locus_tag LOCUS_17520 6910 5834 CDS product type IV secretion system DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837675.1 protein_id gnl|my_center|LOCUS_17520 7221 6910 gene locus_tag LOCUS_17530 7221 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549061.1 protein_id gnl|my_center|LOCUS_17530 8351 7479 gene locus_tag LOCUS_17540 8351 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 8847 8335 gene locus_tag LOCUS_17550 8847 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476598.1 protein_id gnl|my_center|LOCUS_17550 9259 10626 gene locus_tag LOCUS_17560 9259 10626 CDS product AbiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248015.1 protein_id gnl|my_center|LOCUS_17560 10748 11209 gene locus_tag LOCUS_17570 10748 11209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 <12917 11522 gene locus_tag LOCUS_17580 <12917 11522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109608.1:LPXTG cell wall anchor domain-containing protein >Feature sequence063 <1 562 gene locus_tag LOCUS_17590 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549457.1:MerR family transcriptional regulator 1977 754 gene locus_tag LOCUS_17600 1977 754 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549459.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17600 2219 3457 gene locus_tag LOCUS_17610 2219 3457 CDS product lactate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642933.1 protein_id gnl|my_center|LOCUS_17610 4186 3512 gene locus_tag LOCUS_17620 4186 3512 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549464.1 protein_id gnl|my_center|LOCUS_17620 4855 4208 gene locus_tag LOCUS_17630 4855 4208 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549467.1 protein_id gnl|my_center|LOCUS_17630 5789 5070 gene locus_tag LOCUS_17640 gene nagB 5789 5070 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549469.1 protein_id gnl|my_center|LOCUS_17640 5916 6755 gene locus_tag LOCUS_17650 5916 6755 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549471.1 protein_id gnl|my_center|LOCUS_17650 7595 6840 gene locus_tag LOCUS_17660 7595 6840 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549071.1 protein_id gnl|my_center|LOCUS_17660 7914 9917 gene locus_tag LOCUS_17670 7914 9917 CDS product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549932.1 protein_id gnl|my_center|LOCUS_17670 9926 10822 gene locus_tag LOCUS_17680 gene murQ 9926 10822 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254545.1 protein_id gnl|my_center|LOCUS_17680 10879 11949 gene locus_tag LOCUS_17690 10879 11949 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549938.1 protein_id gnl|my_center|LOCUS_17690 11952 12824 gene locus_tag LOCUS_17700 11952 12824 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549941.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence064 58 1422 gene locus_tag LOCUS_17710 58 1422 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548899.1 protein_id gnl|my_center|LOCUS_17710 3076 1460 gene locus_tag LOCUS_17720 3076 1460 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254098.1 protein_id gnl|my_center|LOCUS_17720 4008 3151 gene locus_tag LOCUS_17730 4008 3151 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549634.1 protein_id gnl|my_center|LOCUS_17730 5348 4011 gene locus_tag LOCUS_17740 5348 4011 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549632.1 protein_id gnl|my_center|LOCUS_17740 6602 5385 gene locus_tag LOCUS_17750 6602 5385 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549630.1 protein_id gnl|my_center|LOCUS_17750 7817 6714 gene locus_tag LOCUS_17760 gene ugpC 7817 6714 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546234.1 protein_id gnl|my_center|LOCUS_17760 8500 7838 gene locus_tag LOCUS_17770 gene pgmB 8500 7838 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549628.1 protein_id gnl|my_center|LOCUS_17770 10755 8485 gene locus_tag LOCUS_17780 10755 8485 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549627.1 protein_id gnl|my_center|LOCUS_17780 12632 10908 gene locus_tag LOCUS_17790 12632 10908 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549626.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence065 687 361 gene locus_tag LOCUS_17800 687 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613308.1 protein_id gnl|my_center|LOCUS_17800 787 2169 gene locus_tag LOCUS_17810 787 2169 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549215.1 protein_id gnl|my_center|LOCUS_17810 2188 3585 gene locus_tag LOCUS_17820 gene pepV 2188 3585 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547162.1 protein_id gnl|my_center|LOCUS_17820 3685 6504 gene locus_tag LOCUS_17830 3685 6504 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674291.1 protein_id gnl|my_center|LOCUS_17830 7572 6577 gene locus_tag LOCUS_17840 7572 6577 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549214.1 protein_id gnl|my_center|LOCUS_17840 7716 8822 gene locus_tag LOCUS_17850 7716 8822 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549213.1 protein_id gnl|my_center|LOCUS_17850 9252 8920 gene locus_tag LOCUS_17860 9252 8920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549212.1 protein_id gnl|my_center|LOCUS_17860 9706 9275 gene locus_tag LOCUS_17870 9706 9275 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549209.1 protein_id gnl|my_center|LOCUS_17870 9829 10725 gene locus_tag LOCUS_17880 9829 10725 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674287.1 protein_id gnl|my_center|LOCUS_17880 11948 10770 gene locus_tag LOCUS_17890 11948 10770 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254602.1 protein_id gnl|my_center|LOCUS_17890 >Feature sequence066 13 88 gene locus_tag LOCUS_t00340 13 88 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 161 928 gene locus_tag LOCUS_17900 161 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 912 2201 gene locus_tag LOCUS_17910 912 2201 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_17910 2201 3658 gene locus_tag LOCUS_17920 2201 3658 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674652.1 protein_id gnl|my_center|LOCUS_17920 3606 5228 gene locus_tag LOCUS_17930 3606 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 5216 5515 gene locus_tag LOCUS_17940 5216 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 5648 6286 gene locus_tag LOCUS_17950 5648 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 6290 7321 gene locus_tag LOCUS_17960 6290 7321 CDS product N4-gp56 family major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922080.1 protein_id gnl|my_center|LOCUS_17960 7321 7527 gene locus_tag LOCUS_17970 7321 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 7502 7843 gene locus_tag LOCUS_17980 7502 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 7853 8287 gene locus_tag LOCUS_17990 7853 8287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 8289 8672 gene locus_tag LOCUS_18000 8289 8672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 8774 9049 gene locus_tag LOCUS_18010 8774 9049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 9042 10145 gene locus_tag LOCUS_18020 9042 10145 CDS product DUF3383 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010717321.1 protein_id gnl|my_center|LOCUS_18020 10157 10555 gene locus_tag LOCUS_18030 10157 10555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377526.1 protein_id gnl|my_center|LOCUS_18030 10622 10954 gene locus_tag LOCUS_18040 10622 10954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 10920 11141 gene locus_tag LOCUS_18050 10920 11141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 >Feature sequence067 2151 979 gene locus_tag LOCUS_18060 2151 979 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948530.1 protein_id gnl|my_center|LOCUS_18060 3724 2219 gene locus_tag LOCUS_18070 3724 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 4088 3888 gene locus_tag LOCUS_18080 4088 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 4391 4606 gene locus_tag LOCUS_18090 4391 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 6819 4681 gene locus_tag LOCUS_18100 6819 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 8441 6942 gene locus_tag LOCUS_18110 8441 6942 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678766.1 protein_id gnl|my_center|LOCUS_18110 9156 8443 gene locus_tag LOCUS_18120 9156 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 10885 9140 gene locus_tag LOCUS_18130 10885 9140 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678765.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence068 <1 1527 gene locus_tag LOCUS_18140 <1 1527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254317.1:LPXTG cell wall anchor domain-containing protein 1696 2037 gene locus_tag LOCUS_18150 1696 2037 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547875.1 protein_id gnl|my_center|LOCUS_18150 2039 3469 gene locus_tag LOCUS_18160 gene ffh 2039 3469 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547873.1 protein_id gnl|my_center|LOCUS_18160 3556 3828 gene locus_tag LOCUS_18170 gene rpsP 3556 3828 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547870.1 protein_id gnl|my_center|LOCUS_18170 3897 4418 gene locus_tag LOCUS_18180 gene rimM 3897 4418 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254408.1 protein_id gnl|my_center|LOCUS_18180 4408 5130 gene locus_tag LOCUS_18190 gene trmD 4408 5130 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254407.1 protein_id gnl|my_center|LOCUS_18190 5244 5594 gene locus_tag LOCUS_18200 gene rplS 5244 5594 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003629071.1 protein_id gnl|my_center|LOCUS_18200 6330 5689 gene locus_tag LOCUS_18210 gene lepB 6330 5689 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549558.1 protein_id gnl|my_center|LOCUS_18210 6532 6951 gene locus_tag LOCUS_18220 6532 6951 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546138.1 protein_id gnl|my_center|LOCUS_18220 6929 7573 gene locus_tag LOCUS_18230 6929 7573 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547855.1 protein_id gnl|my_center|LOCUS_18230 8232 7609 gene locus_tag LOCUS_18240 gene lexA 8232 7609 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254404.1 protein_id gnl|my_center|LOCUS_18240 8370 8618 gene locus_tag LOCUS_18250 8370 8618 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547851.1 protein_id gnl|my_center|LOCUS_18250 8691 8912 gene locus_tag LOCUS_18260 8691 8912 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547849.1 protein_id gnl|my_center|LOCUS_18260 8989 10755 gene locus_tag LOCUS_18270 8989 10755 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254403.1 protein_id gnl|my_center|LOCUS_18270 10745 10969 gene locus_tag LOCUS_18280 10745 10969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence069 62 937 gene locus_tag LOCUS_18290 62 937 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547292.1 protein_id gnl|my_center|LOCUS_18290 1072 1686 gene locus_tag LOCUS_18300 1072 1686 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254380.1 protein_id gnl|my_center|LOCUS_18300 2165 2356 gene locus_tag LOCUS_18310 2165 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 2545 4503 gene locus_tag LOCUS_18320 gene parE 2545 4503 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547476.1 protein_id gnl|my_center|LOCUS_18320 4520 7000 gene locus_tag LOCUS_18330 gene parC 4520 7000 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547478.1 protein_id gnl|my_center|LOCUS_18330 7243 8196 gene locus_tag LOCUS_18340 7243 8196 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547480.1 protein_id gnl|my_center|LOCUS_18340 8315 9250 gene locus_tag LOCUS_18350 8315 9250 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547481.1 protein_id gnl|my_center|LOCUS_18350 9321 10655 gene locus_tag LOCUS_18360 9321 10655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18360 >Feature sequence070 771 148 gene locus_tag LOCUS_18370 771 148 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549206.1 protein_id gnl|my_center|LOCUS_18370 1574 774 gene locus_tag LOCUS_18380 gene murI 1574 774 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549203.1 protein_id gnl|my_center|LOCUS_18380 1671 2066 gene locus_tag LOCUS_18390 1671 2066 CDS product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549202.1 protein_id gnl|my_center|LOCUS_18390 2460 2149 gene locus_tag LOCUS_18400 gene trxA 2460 2149 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254147.1 protein_id gnl|my_center|LOCUS_18400 4905 2539 gene locus_tag LOCUS_18410 4905 2539 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549197.1 protein_id gnl|my_center|LOCUS_18410 5490 4948 gene locus_tag LOCUS_18420 5490 4948 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564014.1 protein_id gnl|my_center|LOCUS_18420 5862 5548 gene locus_tag LOCUS_18430 5862 5548 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549194.1 protein_id gnl|my_center|LOCUS_18430 6295 5864 gene locus_tag LOCUS_18440 gene ruvX 6295 5864 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549192.1 protein_id gnl|my_center|LOCUS_18440 6552 6295 gene locus_tag LOCUS_18450 6552 6295 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549189.1 protein_id gnl|my_center|LOCUS_18450 9255 6607 gene locus_tag LOCUS_18460 gene alaS 9255 6607 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549179.1 protein_id gnl|my_center|LOCUS_18460 10872 9487 gene locus_tag LOCUS_18470 10872 9487 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549176.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence071 611 102 gene locus_tag LOCUS_18480 611 102 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546446.1 protein_id gnl|my_center|LOCUS_18480 1050 604 gene locus_tag LOCUS_18490 1050 604 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546448.1 protein_id gnl|my_center|LOCUS_18490 1236 2060 gene locus_tag LOCUS_18500 gene map 1236 2060 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254208.1 protein_id gnl|my_center|LOCUS_18500 2075 2983 gene locus_tag LOCUS_18510 2075 2983 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546451.1 protein_id gnl|my_center|LOCUS_18510 3057 3962 gene locus_tag LOCUS_18520 gene galU 3057 3962 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546456.1 protein_id gnl|my_center|LOCUS_18520 4096 5055 gene locus_tag LOCUS_18530 4096 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 5048 6595 gene locus_tag LOCUS_18540 5048 6595 CDS product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289765.1 protein_id gnl|my_center|LOCUS_18540 6608 7018 gene locus_tag LOCUS_18550 6608 7018 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548115.1 protein_id gnl|my_center|LOCUS_18550 7280 8212 gene locus_tag LOCUS_18560 7280 8212 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836378.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18560 8280 8891 gene locus_tag LOCUS_18570 8280 8891 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548123.1 protein_id gnl|my_center|LOCUS_18570 8896 9561 gene locus_tag LOCUS_18580 8896 9561 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548121.1 protein_id gnl|my_center|LOCUS_18580 9572 10846 gene locus_tag LOCUS_18590 9572 10846 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254461.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence072 463 23 gene locus_tag LOCUS_18600 463 23 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804879.1 protein_id gnl|my_center|LOCUS_18600 985 1332 gene locus_tag LOCUS_18610 985 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 1766 1431 gene locus_tag LOCUS_18620 1766 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 1939 2196 gene locus_tag LOCUS_18630 1939 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 2640 2218 gene locus_tag LOCUS_18640 2640 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 3853 2747 gene locus_tag LOCUS_18650 3853 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 4778 3864 gene locus_tag LOCUS_18660 gene hflC 4778 3864 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597160.1 protein_id gnl|my_center|LOCUS_18660 6331 4790 gene locus_tag LOCUS_18670 6331 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 8416 6332 gene locus_tag LOCUS_18680 8416 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 9486 8566 gene locus_tag LOCUS_18690 9486 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 10895 9483 gene locus_tag LOCUS_18700 10895 9483 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948715.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence073 891 625 gene locus_tag LOCUS_18710 891 625 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546917.1 protein_id gnl|my_center|LOCUS_18710 1095 931 gene locus_tag LOCUS_18720 1095 931 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549333.1 protein_id gnl|my_center|LOCUS_18720 1396 2322 gene locus_tag LOCUS_18730 1396 2322 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296674.1 protein_id gnl|my_center|LOCUS_18730 2430 3455 gene locus_tag LOCUS_18740 2430 3455 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673973.1 protein_id gnl|my_center|LOCUS_18740 4633 3593 gene locus_tag LOCUS_18750 4633 3593 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775182.1 protein_id gnl|my_center|LOCUS_18750 5274 6200 gene locus_tag LOCUS_18760 5274 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 8373 6454 gene locus_tag LOCUS_18770 8373 6454 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254014.1 protein_id gnl|my_center|LOCUS_18770 8583 8768 gene locus_tag LOCUS_18780 8583 8768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 8887 9726 gene locus_tag LOCUS_18790 8887 9726 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476577.1 protein_id gnl|my_center|LOCUS_18790 <10295 9761 gene locus_tag LOCUS_18800 <10295 9761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025079808.1:YjjG family noncanonical pyrimidine nucleotidase >Feature sequence074 1963 101 gene locus_tag LOCUS_18810 1963 101 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549988.1 protein_id gnl|my_center|LOCUS_18810 2729 1983 gene locus_tag LOCUS_18820 2729 1983 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549987.1 protein_id gnl|my_center|LOCUS_18820 2969 4417 gene locus_tag LOCUS_18830 2969 4417 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566325.1 protein_id gnl|my_center|LOCUS_18830 5158 6438 gene locus_tag LOCUS_18840 gene hflX 5158 6438 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549861.1 protein_id gnl|my_center|LOCUS_18840 7692 6484 gene locus_tag LOCUS_18850 7692 6484 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549671.1 protein_id gnl|my_center|LOCUS_18850 9052 7796 gene locus_tag LOCUS_18860 gene msp1 9052 7796 CDS product cell wall hydrolase P75 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592858.1 protein_id gnl|my_center|LOCUS_18860 9803 9246 gene locus_tag LOCUS_18870 9803 9246 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041814911.1 protein_id gnl|my_center|LOCUS_18870 >Feature sequence075 784 98 gene locus_tag LOCUS_18880 784 98 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701796.1 protein_id gnl|my_center|LOCUS_18880 958 1122 gene locus_tag LOCUS_18890 958 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18890 1242 1430 gene locus_tag LOCUS_18900 1242 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18900 1509 2108 gene locus_tag LOCUS_18910 1509 2108 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547369.1 protein_id gnl|my_center|LOCUS_18910 2131 2754 gene locus_tag LOCUS_18920 2131 2754 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547344.1 protein_id gnl|my_center|LOCUS_18920 2893 3588 gene locus_tag LOCUS_18930 2893 3588 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550031.1 protein_id gnl|my_center|LOCUS_18930 3581 4933 gene locus_tag LOCUS_18940 3581 4933 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254535.1 protein_id gnl|my_center|LOCUS_18940 5063 5692 gene locus_tag LOCUS_18950 5063 5692 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254536.1 protein_id gnl|my_center|LOCUS_18950 5730 5996 gene locus_tag LOCUS_18960 5730 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18960 6024 6347 gene locus_tag LOCUS_18970 6024 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18970 6510 7256 gene locus_tag LOCUS_18980 6510 7256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 7656 9035 gene locus_tag LOCUS_18990 gene brnQ 7656 9035 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254324.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence076 467 649 gene locus_tag LOCUS_19000 467 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 633 929 gene locus_tag LOCUS_19010 633 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 945 1163 gene locus_tag LOCUS_19020 945 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19020 1192 3060 gene locus_tag LOCUS_19030 1192 3060 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19030 3201 4091 gene locus_tag LOCUS_19040 3201 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 4152 4949 gene locus_tag LOCUS_19050 4152 4949 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404660.1 protein_id gnl|my_center|LOCUS_19050 5010 5624 gene locus_tag LOCUS_19060 5010 5624 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963888.1 protein_id gnl|my_center|LOCUS_19060 5742 6398 gene locus_tag LOCUS_19070 5742 6398 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072772897.1 protein_id gnl|my_center|LOCUS_19070 6463 6825 gene locus_tag LOCUS_19080 6463 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 7642 8901 gene locus_tag LOCUS_19090 7642 8901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 8928 9617 gene locus_tag LOCUS_19100 8928 9617 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404711.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence077 496 1806 gene locus_tag LOCUS_19110 496 1806 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025014283.1 protein_id gnl|my_center|LOCUS_19110 2070 3329 gene locus_tag LOCUS_19120 2070 3329 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025014283.1 protein_id gnl|my_center|LOCUS_19120 3437 3922 gene locus_tag LOCUS_19130 3437 3922 CDS product DUF3955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775247.1 protein_id gnl|my_center|LOCUS_19130 3987 4370 gene locus_tag LOCUS_19140 3987 4370 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254019.1 protein_id gnl|my_center|LOCUS_19140 4997 4452 gene locus_tag LOCUS_19150 4997 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 5581 5294 gene locus_tag LOCUS_19160 5581 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 5739 6173 gene locus_tag LOCUS_19170 5739 6173 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549441.1 protein_id gnl|my_center|LOCUS_19170 6186 6563 gene locus_tag LOCUS_19180 6186 6563 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549440.1 protein_id gnl|my_center|LOCUS_19180 6581 6868 gene locus_tag LOCUS_19190 6581 6868 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549438.1 protein_id gnl|my_center|LOCUS_19190 6868 7443 gene locus_tag LOCUS_19200 6868 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19200 7403 8725 gene locus_tag LOCUS_19210 7403 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19210 8958 9125 gene locus_tag LOCUS_19220 8958 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 >Feature sequence078 845 129 gene locus_tag LOCUS_19230 845 129 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254052.1 protein_id gnl|my_center|LOCUS_19230 1960 875 gene locus_tag LOCUS_19240 1960 875 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548727.1 protein_id gnl|my_center|LOCUS_19240 2120 3646 gene locus_tag LOCUS_19250 2120 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 4810 3971 gene locus_tag LOCUS_19260 4810 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 5491 4832 gene locus_tag LOCUS_19270 5491 4832 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254049.1 protein_id gnl|my_center|LOCUS_19270 7012 5657 gene locus_tag LOCUS_19280 7012 5657 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549562.1 protein_id gnl|my_center|LOCUS_19280 8298 7309 gene locus_tag LOCUS_19290 8298 7309 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548712.1 protein_id gnl|my_center|LOCUS_19290 8743 8381 gene locus_tag LOCUS_19300 8743 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence079 208 1266 gene locus_tag LOCUS_19310 gene hrcA 208 1266 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547794.1 protein_id gnl|my_center|LOCUS_19310 1278 1856 gene locus_tag LOCUS_19320 gene grpE 1278 1856 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547792.1 protein_id gnl|my_center|LOCUS_19320 1874 3748 gene locus_tag LOCUS_19330 gene dnaK 1874 3748 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547791.1 protein_id gnl|my_center|LOCUS_19330 3828 4994 gene locus_tag LOCUS_19340 gene dnaJ 3828 4994 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547790.1 protein_id gnl|my_center|LOCUS_19340 5140 6978 gene locus_tag LOCUS_19350 gene lepA 5140 6978 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254395.1 protein_id gnl|my_center|LOCUS_19350 7146 7835 gene locus_tag LOCUS_19360 7146 7835 CDS product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547788.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence080 167 814 gene locus_tag LOCUS_19370 167 814 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549496.1 protein_id gnl|my_center|LOCUS_19370 1340 831 gene locus_tag LOCUS_19380 1340 831 CDS product DUF1440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161023296.1 protein_id gnl|my_center|LOCUS_19380 2843 1389 gene locus_tag LOCUS_19390 2843 1389 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475887.1 protein_id gnl|my_center|LOCUS_19390 2983 3504 gene locus_tag LOCUS_19400 2983 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 3569 3823 gene locus_tag LOCUS_19410 3569 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 3968 4456 gene locus_tag LOCUS_19420 3968 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 4570 5244 gene locus_tag LOCUS_19430 4570 5244 CDS product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674016.1 protein_id gnl|my_center|LOCUS_19430 5246 6157 gene locus_tag LOCUS_19440 5246 6157 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577393.1 protein_id gnl|my_center|LOCUS_19440 6154 6801 gene locus_tag LOCUS_19450 gene pcp 6154 6801 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592791.1 protein_id gnl|my_center|LOCUS_19450 7936 7073 gene locus_tag LOCUS_19460 7936 7073 CDS product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254624.1 protein_id gnl|my_center|LOCUS_19460 >Feature sequence081 204 1802 gene locus_tag LOCUS_19470 204 1802 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254096.1 protein_id gnl|my_center|LOCUS_19470 1919 2170 gene locus_tag LOCUS_19480 1919 2170 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548978.1 protein_id gnl|my_center|LOCUS_19480 2333 3700 gene locus_tag LOCUS_19490 2333 3700 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548990.1 protein_id gnl|my_center|LOCUS_19490 3716 5170 gene locus_tag LOCUS_19500 3716 5170 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548992.1 protein_id gnl|my_center|LOCUS_19500 5246 5605 gene locus_tag LOCUS_19510 gene acpS 5246 5605 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254099.1 protein_id gnl|my_center|LOCUS_19510 5605 6669 gene locus_tag LOCUS_19520 gene alr 5605 6669 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548996.1 protein_id gnl|my_center|LOCUS_19520 7412 6732 gene locus_tag LOCUS_19530 gene cbpA 7412 6732 CDS product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254100.1 protein_id gnl|my_center|LOCUS_19530 8529 7558 gene locus_tag LOCUS_19540 8529 7558 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549000.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence082 144 605 gene locus_tag LOCUS_19550 144 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 802 1833 gene locus_tag LOCUS_19560 802 1833 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547468.1 protein_id gnl|my_center|LOCUS_19560 1970 2146 gene locus_tag LOCUS_19570 1970 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19570 2204 2974 gene locus_tag LOCUS_19580 2204 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19580 3511 3053 gene locus_tag LOCUS_19590 3511 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547433.1 protein_id gnl|my_center|LOCUS_19590 3700 5379 gene locus_tag LOCUS_19600 gene alsS 3700 5379 CDS product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700881.1 protein_id gnl|my_center|LOCUS_19600 5379 6113 gene locus_tag LOCUS_19610 gene budA 5379 6113 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475570.1 protein_id gnl|my_center|LOCUS_19610 6614 8569 gene locus_tag LOCUS_19620 6614 8569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence083 106 492 gene locus_tag LOCUS_19630 106 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 747 1976 gene locus_tag LOCUS_19640 747 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19640 1966 2217 gene locus_tag LOCUS_19650 1966 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19650 2388 3335 gene locus_tag LOCUS_19660 2388 3335 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804173.1 protein_id gnl|my_center|LOCUS_19660 3343 3507 gene locus_tag LOCUS_19670 3343 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 3547 4647 gene locus_tag LOCUS_19680 3547 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 4680 4886 gene locus_tag LOCUS_19690 4680 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 6117 4903 gene locus_tag LOCUS_19700 6117 4903 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106642.1 protein_id gnl|my_center|LOCUS_19700 7203 6313 gene locus_tag LOCUS_19710 7203 6313 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547115.1 protein_id gnl|my_center|LOCUS_19710 7260 8456 gene locus_tag LOCUS_19720 7260 8456 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547116.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence084 295 2661 gene locus_tag LOCUS_19730 295 2661 CDS product glycoside hydrolase family 68 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262343.1 protein_id gnl|my_center|LOCUS_19730 2900 3790 gene locus_tag LOCUS_19740 2900 3790 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546685.1 protein_id gnl|my_center|LOCUS_19740 3852 4937 gene locus_tag LOCUS_19750 3852 4937 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158181789.1 protein_id gnl|my_center|LOCUS_19750 4998 5765 gene locus_tag LOCUS_19760 gene manA 4998 5765 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546690.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19760 5933 6325 gene locus_tag LOCUS_19770 5933 6325 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288595.1 protein_id gnl|my_center|LOCUS_19770 6325 7035 gene locus_tag LOCUS_19780 6325 7035 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254236.1 protein_id gnl|my_center|LOCUS_19780 7039 8490 gene locus_tag LOCUS_19790 7039 8490 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546698.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence085 <1 640 gene locus_tag LOCUS_19800 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_156576251.1:Gly-Xaa-Xaa repeat protein 967 2121 gene locus_tag LOCUS_19810 967 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 2108 2929 gene locus_tag LOCUS_19820 2108 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 2910 3962 gene locus_tag LOCUS_19830 2910 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 3965 4825 gene locus_tag LOCUS_19840 3965 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 4839 5630 gene locus_tag LOCUS_19850 4839 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 5620 6741 gene locus_tag LOCUS_19860 gene glf 5620 6741 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_19860 6731 7963 gene locus_tag LOCUS_19870 6731 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 >Feature sequence086 1960 461 gene locus_tag LOCUS_19880 gene gltX 1960 461 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254122.1 protein_id gnl|my_center|LOCUS_19880 3421 2042 gene locus_tag LOCUS_19890 gene radA 3421 2042 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549080.1 protein_id gnl|my_center|LOCUS_19890 3972 3421 gene locus_tag LOCUS_19900 3972 3421 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254121.1 protein_id gnl|my_center|LOCUS_19900 4543 4091 gene locus_tag LOCUS_19910 4543 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19910 4942 4562 gene locus_tag LOCUS_19920 4942 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19920 5139 6488 gene locus_tag LOCUS_19930 gene pepC 5139 6488 CDS product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549077.1 protein_id gnl|my_center|LOCUS_19930 6772 7785 gene locus_tag LOCUS_19940 6772 7785 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263776.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence087 172 396 gene locus_tag LOCUS_19950 172 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 801 409 gene locus_tag LOCUS_19960 801 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19960 1219 734 gene locus_tag LOCUS_19970 1219 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19970 1659 1297 gene locus_tag LOCUS_19980 gene rplL 1659 1297 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254128.1 protein_id gnl|my_center|LOCUS_19980 2275 1703 gene locus_tag LOCUS_19990 gene rplJ 2275 1703 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549105.1 protein_id gnl|my_center|LOCUS_19990 3194 2403 gene locus_tag LOCUS_20000 3194 2403 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289242.1 protein_id gnl|my_center|LOCUS_20000 3838 3191 gene locus_tag LOCUS_20010 3838 3191 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641493.1 protein_id gnl|my_center|LOCUS_20010 4469 3825 gene locus_tag LOCUS_20020 4469 3825 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641492.1 protein_id gnl|my_center|LOCUS_20020 5292 4600 gene locus_tag LOCUS_20030 gene rplA 5292 4600 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549096.1 protein_id gnl|my_center|LOCUS_20030 5815 5390 gene locus_tag LOCUS_20040 gene rplK 5815 5390 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549095.1 protein_id gnl|my_center|LOCUS_20040 6498 5947 gene locus_tag LOCUS_20050 gene nusG 6498 5947 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549094.1 protein_id gnl|my_center|LOCUS_20050 6763 6593 gene locus_tag LOCUS_20060 gene secE 6763 6593 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549093.1 protein_id gnl|my_center|LOCUS_20060 6920 6771 gene locus_tag LOCUS_20070 gene rpmG 6920 6771 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549092.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence088 550 1326 gene locus_tag LOCUS_20080 550 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254091.1 protein_id gnl|my_center|LOCUS_20080 1539 2117 gene locus_tag LOCUS_20090 1539 2117 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254090.1 protein_id gnl|my_center|LOCUS_20090 2118 3446 gene locus_tag LOCUS_20100 2118 3446 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548915.1 protein_id gnl|my_center|LOCUS_20100 3774 3538 gene locus_tag LOCUS_20110 3774 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20110 4765 3746 gene locus_tag LOCUS_20120 4765 3746 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254086.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20120 6519 4897 gene locus_tag LOCUS_20130 6519 4897 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254085.1 protein_id gnl|my_center|LOCUS_20130 7192 6650 gene locus_tag LOCUS_20140 gene rpoE 7192 6650 CDS product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548904.1 protein_id gnl|my_center|LOCUS_20140 7660 7241 gene locus_tag LOCUS_20150 7660 7241 CDS product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548902.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence089 <1 2962 gene locus_tag LOCUS_20160 <1 2962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929138.1:WG repeat-containing protein 3253 3561 gene locus_tag LOCUS_20170 3253 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 3647 4006 gene locus_tag LOCUS_20180 3647 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 4142 4957 gene locus_tag LOCUS_20190 gene yhdJ 4142 4957 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258898.1 protein_id gnl|my_center|LOCUS_20190 4944 6023 gene locus_tag LOCUS_20200 4944 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 6041 6856 gene locus_tag LOCUS_20210 6041 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence090 235 534 gene locus_tag LOCUS_20220 235 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 547 1074 gene locus_tag LOCUS_20230 547 1074 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860885.1 protein_id gnl|my_center|LOCUS_20230 1124 3046 gene locus_tag LOCUS_20240 gene tet(O) 1124 3046 CDS product tetracycline resistance ribosomal protection protein Tet(O) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775603.1 protein_id gnl|my_center|LOCUS_20240 3361 4218 gene locus_tag LOCUS_20250 gene ant(6) 3361 4218 CDS product aminoglycoside nucleotidyltransferase ANT(6)-Ia inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255864.1 protein_id gnl|my_center|LOCUS_20250 4925 5674 gene locus_tag LOCUS_20260 gene aph(3')-IIIa 4925 5674 CDS product aminoglycoside O-phosphotransferase APH(3')-IIIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096887.1 protein_id gnl|my_center|LOCUS_20260 5697 6131 gene locus_tag LOCUS_20270 5697 6131 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837153.1 protein_id gnl|my_center|LOCUS_20270 6509 6207 gene locus_tag LOCUS_20280 6509 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 6986 7192 gene locus_tag LOCUS_20290 6986 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 7362 7114 gene locus_tag LOCUS_20300 7362 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 >Feature sequence091 319 125 gene locus_tag LOCUS_20310 319 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 477 1106 gene locus_tag LOCUS_20320 477 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 1845 3005 gene locus_tag LOCUS_20330 1845 3005 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087235334.1 protein_id gnl|my_center|LOCUS_20330 3145 4557 gene locus_tag LOCUS_20340 gene cysS 3145 4557 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549082.1 protein_id gnl|my_center|LOCUS_20340 4550 4993 gene locus_tag LOCUS_20350 4550 4993 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549083.1 protein_id gnl|my_center|LOCUS_20350 4980 5735 gene locus_tag LOCUS_20360 gene rlmB 4980 5735 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254123.1 protein_id gnl|my_center|LOCUS_20360 5949 6506 gene locus_tag LOCUS_20370 5949 6506 CDS product DNA-directed RNA polymerase subunit sigma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254124.1 protein_id gnl|my_center|LOCUS_20370 6574 6792 gene locus_tag LOCUS_20380 6574 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549087.1 protein_id gnl|my_center|LOCUS_20380 >Feature sequence092 1057 431 gene locus_tag LOCUS_20390 1057 431 CDS product LVIS_2131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549837.1 protein_id gnl|my_center|LOCUS_20390 1199 1660 gene locus_tag LOCUS_20400 gene nrdI 1199 1660 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549835.1 protein_id gnl|my_center|LOCUS_20400 1653 2594 gene locus_tag LOCUS_20410 1653 2594 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254563.1 protein_id gnl|my_center|LOCUS_20410 2906 2619 gene locus_tag LOCUS_20420 2906 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20420 3072 2920 gene locus_tag LOCUS_20430 3072 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 3499 3158 gene locus_tag LOCUS_20440 3499 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 3737 3486 gene locus_tag LOCUS_20450 3737 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 4439 3969 gene locus_tag LOCUS_20460 4439 3969 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549820.1 protein_id gnl|my_center|LOCUS_20460 5221 4439 gene locus_tag LOCUS_20470 5221 4439 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549818.1 protein_id gnl|my_center|LOCUS_20470 6785 5238 gene locus_tag LOCUS_20480 6785 5238 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549817.1 protein_id gnl|my_center|LOCUS_20480 >Feature sequence093 510 61 gene locus_tag LOCUS_20490 510 61 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254419.1 protein_id gnl|my_center|LOCUS_20490 670 503 gene locus_tag LOCUS_20500 670 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20500 1262 615 gene locus_tag LOCUS_20510 1262 615 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547367.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20510 2054 1275 gene locus_tag LOCUS_20520 2054 1275 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547366.1 protein_id gnl|my_center|LOCUS_20520 2827 2066 gene locus_tag LOCUS_20530 2827 2066 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547361.1 protein_id gnl|my_center|LOCUS_20530 3300 2836 gene locus_tag LOCUS_20540 3300 2836 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035009.1 protein_id gnl|my_center|LOCUS_20540 4485 3700 gene locus_tag LOCUS_20550 4485 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 4541 4741 gene locus_tag LOCUS_20560 4541 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 5557 4943 gene locus_tag LOCUS_20570 5557 4943 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476045.1 protein_id gnl|my_center|LOCUS_20570 6044 5547 gene locus_tag LOCUS_20580 6044 5547 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665857.1 protein_id gnl|my_center|LOCUS_20580 6394 6062 gene locus_tag LOCUS_20590 6394 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20590 >Feature sequence094 1008 157 gene locus_tag LOCUS_20600 1008 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20600 1772 1056 gene locus_tag LOCUS_20610 1772 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20610 3855 1906 gene locus_tag LOCUS_20620 3855 1906 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548782.1 protein_id gnl|my_center|LOCUS_20620 5907 3970 gene locus_tag LOCUS_20630 5907 3970 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576585.1 protein_id gnl|my_center|LOCUS_20630 <6725 5894 gene locus_tag LOCUS_20640 <6725 5894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003596342.1:1-phosphofructokinase >Feature sequence095 <1 817 gene locus_tag LOCUS_20650 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254599.1:ABC transporter ATP-binding protein 934 1083 gene locus_tag LOCUS_20660 934 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20660 1062 1394 gene locus_tag LOCUS_20670 1062 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20670 1391 3403 gene locus_tag LOCUS_20680 gene mutS 1391 3403 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254144.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20680 3409 5301 gene locus_tag LOCUS_20690 gene mutL 3409 5301 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549162.1 protein_id gnl|my_center|LOCUS_20690 5307 5885 gene locus_tag LOCUS_20700 gene ruvA 5307 5885 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549165.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence096 1742 1455 gene locus_tag LOCUS_20710 1742 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2466 1831 gene locus_tag LOCUS_20720 2466 1831 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254180.1 protein_id gnl|my_center|LOCUS_20720 3031 2486 gene locus_tag LOCUS_20730 3031 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546308.1 protein_id gnl|my_center|LOCUS_20730 3261 3031 gene locus_tag LOCUS_20740 3261 3031 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546307.1 protein_id gnl|my_center|LOCUS_20740 5190 3337 gene locus_tag LOCUS_20750 5190 3337 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546304.1 protein_id gnl|my_center|LOCUS_20750 6135 5779 gene locus_tag LOCUS_20760 gene tnpB 6135 5779 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748682.1 protein_id gnl|my_center|LOCUS_20760 6316 6125 gene locus_tag LOCUS_20770 6316 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 >Feature sequence097 339 1 gene locus_tag LOCUS_20780 339 1 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137628160.1 protein_id gnl|my_center|LOCUS_20780 493 657 gene locus_tag LOCUS_20790 493 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 680 1015 gene locus_tag LOCUS_20800 680 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 1020 1295 gene locus_tag LOCUS_20810 1020 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 1410 1562 gene locus_tag LOCUS_20820 1410 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 1601 1966 gene locus_tag LOCUS_20830 1601 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 1979 2845 gene locus_tag LOCUS_20840 1979 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 2851 3696 gene locus_tag LOCUS_20850 2851 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 3677 4648 gene locus_tag LOCUS_20860 3677 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 4638 4994 gene locus_tag LOCUS_20870 4638 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 4999 5574 gene locus_tag LOCUS_20880 4999 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 5567 6403 gene locus_tag LOCUS_20890 5567 6403 CDS product phage antirepressor Ant inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389859.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence098 413 138 gene locus_tag LOCUS_20900 413 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 986 696 gene locus_tag LOCUS_20910 986 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 1293 1099 gene locus_tag LOCUS_20920 1293 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 2036 1443 gene locus_tag LOCUS_20930 2036 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254575.1 protein_id gnl|my_center|LOCUS_20930 4206 2047 gene locus_tag LOCUS_20940 4206 2047 CDS product peptide cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254576.1 protein_id gnl|my_center|LOCUS_20940 5016 4219 gene locus_tag LOCUS_20950 5016 4219 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721605.1 protein_id gnl|my_center|LOCUS_20950 5648 5019 gene locus_tag LOCUS_20960 5648 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 5651 6214 gene locus_tag LOCUS_20970 5651 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence099 <1 1635 gene locus_tag LOCUS_20980 <1 1635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549813.1:oligoendopeptidase F 3216 1705 gene locus_tag LOCUS_20990 3216 1705 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549809.1 protein_id gnl|my_center|LOCUS_20990 4128 3337 gene locus_tag LOCUS_21000 4128 3337 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613417.1 protein_id gnl|my_center|LOCUS_21000 4787 4128 gene locus_tag LOCUS_21010 4787 4128 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254570.1 protein_id gnl|my_center|LOCUS_21010 5725 4826 gene locus_tag LOCUS_21020 5725 4826 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254571.1 protein_id gnl|my_center|LOCUS_21020 6202 6026 gene locus_tag LOCUS_21030 6202 6026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 >Feature sequence100 198 73 gene locus_tag LOCUS_21040 198 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 723 349 gene locus_tag LOCUS_21050 723 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 998 810 gene locus_tag LOCUS_21060 998 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 1236 1009 gene locus_tag LOCUS_21070 1236 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 1956 1363 gene locus_tag LOCUS_21080 1956 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254575.1 protein_id gnl|my_center|LOCUS_21080 4126 1967 gene locus_tag LOCUS_21090 4126 1967 CDS product peptide cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254576.1 protein_id gnl|my_center|LOCUS_21090 4936 4139 gene locus_tag LOCUS_21100 4936 4139 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721605.1 protein_id gnl|my_center|LOCUS_21100 5438 4944 gene locus_tag LOCUS_21110 5438 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21110 6021 5422 gene locus_tag LOCUS_21120 6021 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21120 >Feature sequence101 269 1411 gene locus_tag LOCUS_21130 269 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549513.1 protein_id gnl|my_center|LOCUS_21130 1594 2439 gene locus_tag LOCUS_21140 1594 2439 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548928.1 protein_id gnl|my_center|LOCUS_21140 2439 3305 gene locus_tag LOCUS_21150 2439 3305 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548929.1 protein_id gnl|my_center|LOCUS_21150 3295 3744 gene locus_tag LOCUS_21160 3295 3744 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548931.1 protein_id gnl|my_center|LOCUS_21160 3746 4135 gene locus_tag LOCUS_21170 3746 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 4160 4651 gene locus_tag LOCUS_21180 4160 4651 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548936.1 protein_id gnl|my_center|LOCUS_21180 5358 4918 gene locus_tag LOCUS_21190 5358 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21190 5754 5413 gene locus_tag LOCUS_21200 5754 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21200 >Feature sequence102 1599 289 gene locus_tag LOCUS_21210 gene serS 1599 289 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254519.1 protein_id gnl|my_center|LOCUS_21210 2370 1816 gene locus_tag LOCUS_21220 2370 1816 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550097.1 protein_id gnl|my_center|LOCUS_21220 2969 2370 gene locus_tag LOCUS_21230 2969 2370 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550094.1 protein_id gnl|my_center|LOCUS_21230 3135 3941 gene locus_tag LOCUS_21240 3135 3941 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254520.1 protein_id gnl|my_center|LOCUS_21240 3928 4770 gene locus_tag LOCUS_21250 3928 4770 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550089.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence103 302 1168 gene locus_tag LOCUS_21260 302 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 1189 1971 gene locus_tag LOCUS_21270 1189 1971 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288821.1 protein_id gnl|my_center|LOCUS_21270 2173 2364 gene locus_tag LOCUS_21280 2173 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2897 2484 gene locus_tag LOCUS_21290 2897 2484 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964881.1 protein_id gnl|my_center|LOCUS_21290 3108 3641 gene locus_tag LOCUS_21300 3108 3641 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594615.1 protein_id gnl|my_center|LOCUS_21300 3643 4239 gene locus_tag LOCUS_21310 3643 4239 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594613.1 protein_id gnl|my_center|LOCUS_21310 4326 5192 gene locus_tag LOCUS_21320 4326 5192 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548923.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence104 497 1435 gene locus_tag LOCUS_21330 497 1435 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546354.1 protein_id gnl|my_center|LOCUS_21330 1451 2236 gene locus_tag LOCUS_21340 1451 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 3028 2276 gene locus_tag LOCUS_21350 3028 2276 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254508.1 protein_id gnl|my_center|LOCUS_21350 3233 4711 gene locus_tag LOCUS_21360 3233 4711 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254182.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence105 103 561 gene locus_tag LOCUS_21370 103 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 805 1125 gene locus_tag LOCUS_21380 805 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 1337 1621 gene locus_tag LOCUS_21390 gene groES 1337 1621 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965991.1 protein_id gnl|my_center|LOCUS_21390 1668 3281 gene locus_tag LOCUS_21400 gene groL 1668 3281 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357641.1 protein_id gnl|my_center|LOCUS_21400 3355 3861 gene locus_tag LOCUS_21410 3355 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 3839 5176 gene locus_tag LOCUS_21420 3839 5176 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017864221.1 protein_id gnl|my_center|LOCUS_21420 >Feature sequence106 1494 208 gene locus_tag LOCUS_21430 gene hisS 1494 208 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547037.1 protein_id gnl|my_center|LOCUS_21430 2214 1777 gene locus_tag LOCUS_21440 gene dtd 2214 1777 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547036.1 protein_id gnl|my_center|LOCUS_21440 4463 2214 gene locus_tag LOCUS_21450 4463 2214 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254292.1 protein_id gnl|my_center|LOCUS_21450 4861 4481 gene locus_tag LOCUS_21460 4861 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence107 247 1320 gene locus_tag LOCUS_21470 247 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 2594 1899 gene locus_tag LOCUS_21480 2594 1899 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081476.1 protein_id gnl|my_center|LOCUS_21480 3241 2606 gene locus_tag LOCUS_21490 3241 2606 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861619.1 protein_id gnl|my_center|LOCUS_21490 4380 3241 gene locus_tag LOCUS_21500 4380 3241 CDS product DUF3533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475872.1 protein_id gnl|my_center|LOCUS_21500 4471 5061 gene locus_tag LOCUS_21510 4471 5061 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836800.1 protein_id gnl|my_center|LOCUS_21510 >Feature sequence108 1215 127 gene locus_tag LOCUS_21520 1215 127 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106909.1 protein_id gnl|my_center|LOCUS_21520 1238 2356 gene locus_tag LOCUS_21530 1238 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 2645 2328 gene locus_tag LOCUS_21540 2645 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 3137 2859 gene locus_tag LOCUS_21550 3137 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 4705 3353 gene locus_tag LOCUS_21560 4705 3353 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547412.1 protein_id gnl|my_center|LOCUS_21560 5040 5113 gene locus_tag LOCUS_t00350 5040 5113 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence109 <1 1158 gene locus_tag LOCUS_21570 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254583.1:glycoside hydrolase family 31 protein 1335 1748 gene locus_tag LOCUS_21580 1335 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21580 1702 2070 gene locus_tag LOCUS_21590 1702 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21590 2067 2981 gene locus_tag LOCUS_21600 gene pfkB 2067 2981 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549796.1 protein_id gnl|my_center|LOCUS_21600 3022 5007 gene locus_tag LOCUS_21610 3022 5007 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549797.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence110 1804 143 gene locus_tag LOCUS_21620 1804 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 2013 1810 gene locus_tag LOCUS_21630 2013 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 3314 2016 gene locus_tag LOCUS_21640 3314 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 4569 3463 gene locus_tag LOCUS_21650 4569 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence111 2771 108 gene locus_tag LOCUS_21660 2771 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 3028 4041 gene locus_tag LOCUS_21670 3028 4041 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613274.1 protein_id gnl|my_center|LOCUS_21670 4435 4656 gene locus_tag LOCUS_21680 4435 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21680 >Feature sequence112 >Feature sequence113 <1 519 gene locus_tag LOCUS_21690 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254152.1:bifunctional UDP-sugar hydrolase/5'-nucleotidase 519 1058 gene locus_tag LOCUS_21700 519 1058 CDS product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549221.1 protein_id gnl|my_center|LOCUS_21700 1061 1843 gene locus_tag LOCUS_21710 1061 1843 CDS product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549224.1 protein_id gnl|my_center|LOCUS_21710 1831 2448 gene locus_tag LOCUS_21720 1831 2448 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254154.1 protein_id gnl|my_center|LOCUS_21720 3139 2489 gene locus_tag LOCUS_21730 3139 2489 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549229.1 protein_id gnl|my_center|LOCUS_21730 4122 3166 gene locus_tag LOCUS_21740 4122 3166 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014565583.1 protein_id gnl|my_center|LOCUS_21740 4222 4593 gene locus_tag LOCUS_21750 4222 4593 CDS product CvfD/Ygs/GSP13 family RNA-binding post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566816.1 protein_id gnl|my_center|LOCUS_21750 >Feature sequence114 307 1026 gene locus_tag LOCUS_21760 307 1026 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546204.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21760 1449 2354 gene locus_tag LOCUS_21770 1449 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2556 2627 gene locus_tag LOCUS_t00360 2556 2627 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2689 3009 gene locus_tag LOCUS_21780 2689 3009 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722598.1 protein_id gnl|my_center|LOCUS_21780 3467 4375 gene locus_tag LOCUS_21790 3467 4375 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548290.1 protein_id gnl|my_center|LOCUS_21790 4463 4544 gene locus_tag LOCUS_t00370 4463 4544 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4600 4671 gene locus_tag LOCUS_t00380 4600 4671 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence115 835 641 gene locus_tag LOCUS_21800 835 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 1988 3037 gene locus_tag LOCUS_21810 gene rlmN 1988 3037 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082231.1 protein_id gnl|my_center|LOCUS_21810 3268 4098 gene locus_tag LOCUS_21820 3268 4098 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959497.1 protein_id gnl|my_center|LOCUS_21820 >Feature sequence116 775 191 gene locus_tag LOCUS_21830 775 191 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549069.1 protein_id gnl|my_center|LOCUS_21830 1038 1727 gene locus_tag LOCUS_21840 1038 1727 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549072.1 protein_id gnl|my_center|LOCUS_21840 2080 1754 gene locus_tag LOCUS_21850 2080 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2175 3059 gene locus_tag LOCUS_21860 2175 3059 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549073.1 protein_id gnl|my_center|LOCUS_21860 3123 3380 gene locus_tag LOCUS_21870 3123 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 3382 3624 gene locus_tag LOCUS_21880 3382 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 3634 4323 gene locus_tag LOCUS_21890 3634 4323 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721658.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence117 502 116 gene locus_tag LOCUS_21900 gene tagD 502 116 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254173.1 protein_id gnl|my_center|LOCUS_21900 646 1386 gene locus_tag LOCUS_21910 646 1386 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546254.1 protein_id gnl|my_center|LOCUS_21910 1391 2506 gene locus_tag LOCUS_21920 1391 2506 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546257.1 protein_id gnl|my_center|LOCUS_21920 2490 4484 gene locus_tag LOCUS_21930 2490 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence118 369 1745 gene locus_tag LOCUS_21940 369 1745 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547458.1 protein_id gnl|my_center|LOCUS_21940 3058 1847 gene locus_tag LOCUS_21950 3058 1847 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254190.1 protein_id gnl|my_center|LOCUS_21950 3269 3039 gene locus_tag LOCUS_21960 3269 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435950.1 protein_id gnl|my_center|LOCUS_21960 3694 3284 gene locus_tag LOCUS_21970 3694 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 4359 3775 gene locus_tag LOCUS_21980 4359 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613359.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence119 864 46 gene locus_tag LOCUS_21990 864 46 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254053.1 protein_id gnl|my_center|LOCUS_21990 1648 887 gene locus_tag LOCUS_22000 1648 887 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548732.1 protein_id gnl|my_center|LOCUS_22000 2751 1645 gene locus_tag LOCUS_22010 2751 1645 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548730.1 protein_id gnl|my_center|LOCUS_22010 2856 4427 gene locus_tag LOCUS_22020 2856 4427 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824470.1 protein_id gnl|my_center|LOCUS_22020 >Feature sequence120 391 762 gene locus_tag LOCUS_22030 391 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941644.1 protein_id gnl|my_center|LOCUS_22030 837 977 gene locus_tag LOCUS_22040 837 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 1498 3186 gene locus_tag LOCUS_22050 1498 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 3179 4396 gene locus_tag LOCUS_22060 3179 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 >Feature sequence121 225 866 gene locus_tag LOCUS_22070 225 866 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475928.1 protein_id gnl|my_center|LOCUS_22070 871 1035 gene locus_tag LOCUS_22080 871 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 1070 1336 gene locus_tag LOCUS_22090 1070 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 1374 1523 gene locus_tag LOCUS_22100 1374 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 1717 2130 gene locus_tag LOCUS_22110 1717 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 2127 2588 gene locus_tag LOCUS_22120 2127 2588 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047623.1 protein_id gnl|my_center|LOCUS_22120 2689 2988 gene locus_tag LOCUS_22130 2689 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 3046 3537 gene locus_tag LOCUS_22140 3046 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 4264 4338 gene locus_tag LOCUS_t00390 4264 4338 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence122 1082 60 gene locus_tag LOCUS_22150 1082 60 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399537.1 protein_id gnl|my_center|LOCUS_22150 2272 1217 gene locus_tag LOCUS_22160 2272 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 2636 2292 gene locus_tag LOCUS_22170 2636 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 2981 4339 gene locus_tag LOCUS_22180 2981 4339 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197065.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence123 494 1741 gene locus_tag LOCUS_22190 494 1741 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813994.1 protein_id gnl|my_center|LOCUS_22190 1841 2398 gene locus_tag LOCUS_22200 1841 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22200 2404 3585 gene locus_tag LOCUS_22210 2404 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22210 <4164 3652 gene locus_tag LOCUS_22220 <4164 3652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549089.1:gluconokinase >Feature sequence124 556 822 gene locus_tag LOCUS_22230 556 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 1745 840 gene locus_tag LOCUS_22240 1745 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 2572 3633 gene locus_tag LOCUS_22250 2572 3633 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_22250 >Feature sequence125 124 438 gene locus_tag LOCUS_22260 124 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 601 726 gene locus_tag LOCUS_22270 601 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 748 900 gene locus_tag LOCUS_22280 748 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 944 1309 gene locus_tag LOCUS_22290 944 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 1321 2220 gene locus_tag LOCUS_22300 1321 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 2223 3059 gene locus_tag LOCUS_22310 2223 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 3069 3818 gene locus_tag LOCUS_22320 3069 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence126 296 1180 gene locus_tag LOCUS_22330 gene rfbA 296 1180 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389370.1 protein_id gnl|my_center|LOCUS_22330 1211 1819 gene locus_tag LOCUS_22340 gene rfbC 1211 1819 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_22340 1836 2822 gene locus_tag LOCUS_22350 gene rfbD 1836 2822 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664667.1 protein_id gnl|my_center|LOCUS_22350 3110 3673 gene locus_tag LOCUS_22360 3110 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 >Feature sequence127 56 349 gene locus_tag LOCUS_22370 56 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 492 2699 gene locus_tag LOCUS_22380 492 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2751 3497 gene locus_tag LOCUS_22390 2751 3497 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101978.1 protein_id gnl|my_center|LOCUS_22390 >Feature sequence128 1448 453 gene locus_tag LOCUS_22400 1448 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2661 1453 gene locus_tag LOCUS_22410 gene dcm 2661 1453 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219492.1 protein_id gnl|my_center|LOCUS_22410 3337 2843 gene locus_tag LOCUS_22420 3337 2843 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004301986.1 protein_id gnl|my_center|LOCUS_22420 >Feature sequence129 2027 1839 gene locus_tag LOCUS_22430 2027 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 3348 2020 gene locus_tag LOCUS_22440 gene gtfB 3348 2020 CDS product accessory Sec system glycosylation chaperone GtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609042.1 protein_id gnl|my_center|LOCUS_22440 >Feature sequence130 1667 510 gene locus_tag LOCUS_22450 1667 510 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549721.1 protein_id gnl|my_center|LOCUS_22450 2035 1673 gene locus_tag LOCUS_22460 2035 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22460 2342 2049 gene locus_tag LOCUS_22470 2342 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22470 <3510 2493 gene locus_tag LOCUS_22480 <3510 2493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021721608.1:ABC transporter ATP-binding protein >Feature sequence131 <1 3426 gene locus_tag LOCUS_22490 <1 3426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004399367.1:P-loop NTPase fold protein >Feature sequence132 1181 951 gene locus_tag LOCUS_22500 1181 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 2093 1239 gene locus_tag LOCUS_22510 2093 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 2268 2083 gene locus_tag LOCUS_22520 2268 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 >Feature sequence133 1382 120 gene locus_tag LOCUS_22530 1382 120 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070090119.1 protein_id gnl|my_center|LOCUS_22530 3055 1781 gene locus_tag LOCUS_22540 3055 1781 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070090119.1 protein_id gnl|my_center|LOCUS_22540 >Feature sequence134 926 90 gene locus_tag LOCUS_22550 926 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22550 1430 1143 gene locus_tag LOCUS_22560 1430 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22560 >Feature sequence135 918 1406 gene locus_tag LOCUS_22570 918 1406 CDS product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 protein_id gnl|my_center|LOCUS_22570 2019 1576 gene locus_tag LOCUS_22580 2019 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 >Feature sequence136 1279 1034 gene locus_tag LOCUS_22590 1279 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 2743 2213 gene locus_tag LOCUS_22600 2743 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence137 769 1140 gene locus_tag LOCUS_22610 769 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 1168 1701 gene locus_tag LOCUS_22620 1168 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 1730 1957 gene locus_tag LOCUS_22630 1730 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 2271 2660 gene locus_tag LOCUS_22640 2271 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 2660 2884 gene locus_tag LOCUS_22650 2660 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 2866 3189 gene locus_tag LOCUS_22660 2866 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 >Feature sequence138 38 490 gene locus_tag LOCUS_22670 38 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 483 1106 gene locus_tag LOCUS_22680 483 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 1992 1237 gene locus_tag LOCUS_22690 gene aph(3')-IIIa 1992 1237 CDS product aminoglycoside O-phosphotransferase APH(3')-IIIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096887.1 protein_id gnl|my_center|LOCUS_22690 2627 2085 gene locus_tag LOCUS_22700 gene sat4 2627 2085 CDS product streptothricin N-acetyltransferase Sat4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627290.1 protein_id gnl|my_center|LOCUS_22700 <3211 2624 gene locus_tag LOCUS_22710 <3211 2624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001255866.1:aminoglycoside nucleotidyltransferase ANT(6)-Ia >Feature sequence139 56 253 gene locus_tag LOCUS_22720 56 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 388 786 gene locus_tag LOCUS_22730 388 786 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_22730 790 1329 gene locus_tag LOCUS_22740 790 1329 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_22740 1393 2817 gene locus_tag LOCUS_22750 1393 2817 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895854.1 protein_id gnl|my_center|LOCUS_22750 >Feature sequence140 771 547 gene locus_tag LOCUS_22760 771 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 1060 1692 gene locus_tag LOCUS_22770 1060 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 2063 1902 gene locus_tag LOCUS_22780 2063 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22780 <3074 2132 gene locus_tag LOCUS_22790 <3074 2132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254025.1:ABC transporter ATP-binding protein note possible pseudo, frameshifted >Feature sequence141 294 1139 gene locus_tag LOCUS_22800 294 1139 CDS product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116878224.1 protein_id gnl|my_center|LOCUS_22800 1326 2135 gene locus_tag LOCUS_22810 1326 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22810 2792 2199 gene locus_tag LOCUS_22820 2792 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613359.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence142 99 392 gene locus_tag LOCUS_22830 99 392 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020811.1 protein_id gnl|my_center|LOCUS_22830 358 726 gene locus_tag LOCUS_22840 358 726 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020812.1 protein_id gnl|my_center|LOCUS_22840 1022 2317 gene locus_tag LOCUS_22850 1022 2317 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_22850 >Feature sequence143 831 1973 gene locus_tag LOCUS_22860 831 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 2519 2310 gene locus_tag LOCUS_22870 2519 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22870 2751 2542 gene locus_tag LOCUS_22880 2751 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22880 >Feature sequence144 319 125 gene locus_tag LOCUS_22890 319 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 460 1077 gene locus_tag LOCUS_22900 460 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 1501 2661 gene locus_tag LOCUS_22910 1501 2661 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087235334.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence145 342 73 gene locus_tag LOCUS_22920 342 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 578 339 gene locus_tag LOCUS_22930 578 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 2314 578 gene locus_tag LOCUS_22940 2314 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 >Feature sequence146 148 2 gene locus_tag LOCUS_22950 148 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 498 1712 gene locus_tag LOCUS_22960 498 1712 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254348.1 protein_id gnl|my_center|LOCUS_22960 1840 2646 gene locus_tag LOCUS_22970 1840 2646 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549308.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence147 1833 601 gene locus_tag LOCUS_22980 1833 601 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298157.1 protein_id gnl|my_center|LOCUS_22980 2615 1845 gene locus_tag LOCUS_22990 2615 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 >Feature sequence148 3 269 gene locus_tag LOCUS_23000 3 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 418 816 gene locus_tag LOCUS_23010 418 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 1742 840 gene locus_tag LOCUS_23020 1742 840 CDS product IS30-like element IS6770 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389992.1 protein_id gnl|my_center|LOCUS_23020 <2570 1897 gene locus_tag LOCUS_23030 <2570 1897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476171.1:alanine--tRNA ligase >Feature sequence149 <1 1538 gene locus_tag LOCUS_23040 <1 1538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836745.1:accessory Sec system translocase SecA2 >Feature sequence150 527 192 gene locus_tag LOCUS_23050 527 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2490 1132 gene locus_tag LOCUS_23060 2490 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 >Feature sequence151 >Feature sequence152 638 120 gene locus_tag LOCUS_23070 638 120 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764107.1 protein_id gnl|my_center|LOCUS_23070 1949 783 gene locus_tag LOCUS_23080 1949 783 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_23080 2337 2230 gene locus_tag LOCUS_r00010 2337 2230 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence153 1 801 gene locus_tag LOCUS_23090 1 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23090 >Feature sequence154 575 1435 gene locus_tag LOCUS_23100 575 1435 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548564.1 protein_id gnl|my_center|LOCUS_23100 <2428 1472 gene locus_tag LOCUS_23110 <2428 1472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254389.1:GNAT family N-acetyltransferase >Feature sequence155 592 798 gene locus_tag LOCUS_23120 592 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 1536 799 gene locus_tag LOCUS_23130 1536 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 >Feature sequence156 163 1611 gene locus_tag LOCUS_23140 gene zwf 163 1611 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549170.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence157 775 323 gene locus_tag LOCUS_23150 775 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 1862 906 gene locus_tag LOCUS_23160 1862 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23160 2146 1883 gene locus_tag LOCUS_23170 2146 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23170 2362 2150 gene locus_tag LOCUS_23180 2362 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 >Feature sequence158 454 687 gene locus_tag LOCUS_23190 454 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 868 1263 gene locus_tag LOCUS_23200 gene rbsD 868 1263 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254480.1 protein_id gnl|my_center|LOCUS_23200 1339 2229 gene locus_tag LOCUS_23210 1339 2229 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641602.1 protein_id gnl|my_center|LOCUS_23210 >Feature sequence159 1584 17 gene locus_tag LOCUS_r00020 1584 17 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2307 1957 gene locus_tag LOCUS_23220 2307 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 >Feature sequence160 <1 879 gene locus_tag LOCUS_23230 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549111.1:DNA polymerase III subunit gamma/tau 892 1221 gene locus_tag LOCUS_23240 892 1221 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549112.1 protein_id gnl|my_center|LOCUS_23240 1223 1822 gene locus_tag LOCUS_23250 gene recR 1223 1822 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549113.1 protein_id gnl|my_center|LOCUS_23250 1819 2055 gene locus_tag LOCUS_23260 1819 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 >Feature sequence161 1996 1790 gene locus_tag LOCUS_23270 1996 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 >Feature sequence162 698 189 gene locus_tag LOCUS_23280 698 189 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263276.1 protein_id gnl|my_center|LOCUS_23280 1491 859 gene locus_tag LOCUS_23290 1491 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 1696 2088 gene locus_tag LOCUS_23300 1696 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 >Feature sequence163 656 270 gene locus_tag LOCUS_23310 656 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 839 1039 gene locus_tag LOCUS_23320 839 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 1036 1530 gene locus_tag LOCUS_23330 1036 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 >Feature sequence164 <1 948 gene locus_tag LOCUS_23340 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254462.1:sucrose phosphorylase >Feature sequence165 308 1129 gene locus_tag LOCUS_23350 308 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 1242 1568 gene locus_tag LOCUS_23360 1242 1568 CDS product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549609.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence166 1362 1904 gene locus_tag LOCUS_23370 1362 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence167 103 1335 gene locus_tag LOCUS_23380 103 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1328 1906 gene locus_tag LOCUS_23390 1328 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 >Feature sequence168 7 267 gene locus_tag LOCUS_23400 7 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 1985 399 gene locus_tag LOCUS_23410 1985 399 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198991.1 protein_id gnl|my_center|LOCUS_23410 >Feature sequence169 1433 558 gene locus_tag LOCUS_23420 gene tnpB 1433 558 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23420 1848 1411 gene locus_tag LOCUS_23430 gene tnpA 1848 1411 CDS product IS200/IS605-like element ISEfa4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287522.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence170 1865 603 gene locus_tag LOCUS_23440 1865 603 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101454.1 protein_id gnl|my_center|LOCUS_23440