>Feature sequence001 638 84 gene locus_tag LOCUS_00010 638 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1751 795 gene locus_tag LOCUS_00020 1751 795 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_00020 3102 1972 gene locus_tag LOCUS_00030 gene ytvI 3102 1972 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392554.1 protein_id gnl|my_center|LOCUS_00030 3749 3135 gene locus_tag LOCUS_00040 gene yihA 3749 3135 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_00040 6116 3801 gene locus_tag LOCUS_00050 gene lon 6116 3801 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435613.1 protein_id gnl|my_center|LOCUS_00050 7620 6349 gene locus_tag LOCUS_00060 gene clpX 7620 6349 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816893.1 protein_id gnl|my_center|LOCUS_00060 8227 7646 gene locus_tag LOCUS_00070 gene clpP 8227 7646 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_00070 9643 8357 gene locus_tag LOCUS_00080 gene tig 9643 8357 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_00080 10466 9906 gene locus_tag LOCUS_00090 10466 9906 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_00090 10670 11119 gene locus_tag LOCUS_00100 10670 11119 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_00100 11259 11636 gene locus_tag LOCUS_00110 11259 11636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13039 11822 gene locus_tag LOCUS_00120 13039 11822 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_00120 14019 13081 gene locus_tag LOCUS_00130 gene prfB 14019 13081 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181244843.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00130 16826 14250 gene locus_tag LOCUS_00140 gene secA 16826 14250 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966131.1 protein_id gnl|my_center|LOCUS_00140 17782 17003 gene locus_tag LOCUS_00150 gene hisA 17782 17003 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261650.1 protein_id gnl|my_center|LOCUS_00150 18350 17961 gene locus_tag LOCUS_00160 18350 17961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19289 18459 gene locus_tag LOCUS_00170 gene dapB 19289 18459 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_00170 20142 19504 gene locus_tag LOCUS_00180 20142 19504 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422086.1 protein_id gnl|my_center|LOCUS_00180 20387 22222 gene locus_tag LOCUS_00190 gene typA 20387 22222 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_00190 22371 22928 gene locus_tag LOCUS_00200 gene raiA 22371 22928 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_00200 23725 23072 gene locus_tag LOCUS_00210 23725 23072 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 protein_id gnl|my_center|LOCUS_00210 23928 26495 gene locus_tag LOCUS_00220 23928 26495 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860956.1 protein_id gnl|my_center|LOCUS_00220 27583 26654 gene locus_tag LOCUS_00230 27583 26654 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_00230 28524 27595 gene locus_tag LOCUS_00240 gene hprK 28524 27595 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_00240 30600 28669 gene locus_tag LOCUS_00250 gene uvrC 30600 28669 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_00250 32998 30917 gene locus_tag LOCUS_00260 gene ftsH 32998 30917 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048280.1 protein_id gnl|my_center|LOCUS_00260 33166 34659 gene locus_tag LOCUS_00270 33166 34659 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_00270 35006 36616 gene locus_tag LOCUS_00280 35006 36616 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_00280 37290 36706 gene locus_tag LOCUS_00290 37290 36706 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_00290 38304 37309 gene locus_tag LOCUS_00300 38304 37309 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363756.1 protein_id gnl|my_center|LOCUS_00300 38961 38332 gene locus_tag LOCUS_00310 38961 38332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 42586 39062 gene locus_tag LOCUS_00320 42586 39062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 43524 42643 gene locus_tag LOCUS_00330 43524 42643 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953624.1 protein_id gnl|my_center|LOCUS_00330 46700 43536 gene locus_tag LOCUS_00340 gene lacZ 46700 43536 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_00340 47217 46744 gene locus_tag LOCUS_00350 47217 46744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 47393 48250 gene locus_tag LOCUS_00360 47393 48250 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355307.1 protein_id gnl|my_center|LOCUS_00360 51475 48377 gene locus_tag LOCUS_00370 51475 48377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 52642 51719 gene locus_tag LOCUS_00380 52642 51719 CDS product 4Fe-4S-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430299.1 protein_id gnl|my_center|LOCUS_00380 53073 54035 gene locus_tag LOCUS_00390 53073 54035 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439497.1 protein_id gnl|my_center|LOCUS_00390 55615 54248 gene locus_tag LOCUS_00400 55615 54248 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966858.1 protein_id gnl|my_center|LOCUS_00400 56560 55643 gene locus_tag LOCUS_00410 56560 55643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 58290 56527 gene locus_tag LOCUS_00420 58290 56527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 59282 58287 gene locus_tag LOCUS_00430 59282 58287 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_00430 60430 59282 gene locus_tag LOCUS_00440 60430 59282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 62712 60427 gene locus_tag LOCUS_00450 62712 60427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 66628 62786 gene locus_tag LOCUS_00460 66628 62786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 67994 67071 gene locus_tag LOCUS_00470 67994 67071 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920869.1 protein_id gnl|my_center|LOCUS_00470 68565 68107 gene locus_tag LOCUS_00480 68565 68107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 72210 68617 gene locus_tag LOCUS_00490 72210 68617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 73227 72271 gene locus_tag LOCUS_00500 73227 72271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 73473 74855 gene locus_tag LOCUS_00510 73473 74855 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 protein_id gnl|my_center|LOCUS_00510 75698 74931 gene locus_tag LOCUS_00520 75698 74931 CDS product LamB/YcsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851457.1 protein_id gnl|my_center|LOCUS_00520 77058 75685 gene locus_tag LOCUS_00530 77058 75685 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_00530 77541 77092 gene locus_tag LOCUS_00540 gene accB 77541 77092 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966835.1 protein_id gnl|my_center|LOCUS_00540 78631 77630 gene locus_tag LOCUS_00550 78631 77630 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 protein_id gnl|my_center|LOCUS_00550 79367 78633 gene locus_tag LOCUS_00560 gene pxpB 79367 78633 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494307.1 protein_id gnl|my_center|LOCUS_00560 80716 79502 gene locus_tag LOCUS_00570 80716 79502 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419704.1 protein_id gnl|my_center|LOCUS_00570 81964 80816 gene locus_tag LOCUS_00580 81964 80816 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_00580 82101 81961 gene locus_tag LOCUS_00590 82101 81961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00590 83028 82120 gene locus_tag LOCUS_00600 83028 82120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 83907 83125 gene locus_tag LOCUS_00610 83907 83125 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_00610 84178 84600 gene locus_tag LOCUS_00620 84178 84600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 86462 84846 gene locus_tag LOCUS_00630 86462 84846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807777.1 protein_id gnl|my_center|LOCUS_00630 87908 86463 gene locus_tag LOCUS_00640 87908 86463 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_00640 89302 87917 gene locus_tag LOCUS_00650 gene trkA 89302 87917 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_00650 89529 89299 gene locus_tag LOCUS_00660 89529 89299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 91686 89611 gene locus_tag LOCUS_00670 gene fusA 91686 89611 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_00670 91975 93072 gene locus_tag LOCUS_00680 91975 93072 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230615.1 protein_id gnl|my_center|LOCUS_00680 93168 94463 gene locus_tag LOCUS_00690 gene aroA 93168 94463 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246068.1 protein_id gnl|my_center|LOCUS_00690 95384 94572 gene locus_tag LOCUS_00700 gene folK 95384 94572 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016121.1 protein_id gnl|my_center|LOCUS_00700 96222 95404 gene locus_tag LOCUS_00710 gene folP 96222 95404 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966209.1 protein_id gnl|my_center|LOCUS_00710 96713 96219 gene locus_tag LOCUS_00720 96713 96219 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966208.1 protein_id gnl|my_center|LOCUS_00720 97345 96710 gene locus_tag LOCUS_00730 gene folE 97345 96710 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380915.1 protein_id gnl|my_center|LOCUS_00730 98703 97408 gene locus_tag LOCUS_00740 98703 97408 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_00740 99061 99477 gene locus_tag LOCUS_00750 99061 99477 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548044.1 protein_id gnl|my_center|LOCUS_00750 99470 100372 gene locus_tag LOCUS_00760 99470 100372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_00760 100347 102431 gene locus_tag LOCUS_00770 100347 102431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 103864 102686 gene locus_tag LOCUS_00780 103864 102686 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_00780 105578 103866 gene locus_tag LOCUS_00790 105578 103866 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396717.1 protein_id gnl|my_center|LOCUS_00790 105991 105575 gene locus_tag LOCUS_00800 gene mscL 105991 105575 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932912.1 protein_id gnl|my_center|LOCUS_00800 107763 106021 gene locus_tag LOCUS_00810 107763 106021 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_00810 109617 107779 gene locus_tag LOCUS_00820 gene nuoF 109617 107779 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_00820 110133 109639 gene locus_tag LOCUS_00830 gene nuoE 110133 109639 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_00830 110851 110360 gene locus_tag LOCUS_00840 110851 110360 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009659744.1 protein_id gnl|my_center|LOCUS_00840 112550 110931 gene locus_tag LOCUS_00850 112550 110931 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966897.1 protein_id gnl|my_center|LOCUS_00850 114407 112572 gene locus_tag LOCUS_00860 114407 112572 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017020124.1 protein_id gnl|my_center|LOCUS_00860 115239 114409 gene locus_tag LOCUS_00870 gene oppC 115239 114409 CDS product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232954.1 protein_id gnl|my_center|LOCUS_00870 116159 115236 gene locus_tag LOCUS_00880 116159 115236 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_00880 117703 116153 gene locus_tag LOCUS_00890 gene cobA 117703 116153 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_00890 118686 117808 gene locus_tag LOCUS_00900 gene hemC 118686 117808 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842596.1 protein_id gnl|my_center|LOCUS_00900 119567 118794 gene locus_tag LOCUS_00910 119567 118794 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168485.1 protein_id gnl|my_center|LOCUS_00910 120156 119629 gene locus_tag LOCUS_00920 gene cobO 120156 119629 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392864.1 protein_id gnl|my_center|LOCUS_00920 120797 120381 gene locus_tag LOCUS_00930 120797 120381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 121986 120859 gene locus_tag LOCUS_00940 121986 120859 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247133.1 protein_id gnl|my_center|LOCUS_00940 122364 123740 gene locus_tag LOCUS_00950 122364 123740 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956936.1 protein_id gnl|my_center|LOCUS_00950 124936 123911 gene locus_tag LOCUS_00960 gene queA 124936 123911 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_00960 125853 124957 gene locus_tag LOCUS_00970 125853 124957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 126823 125834 gene locus_tag LOCUS_00980 gene sppA 126823 125834 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296309.1 protein_id gnl|my_center|LOCUS_00980 129328 126914 gene locus_tag LOCUS_00990 gene pheT 129328 126914 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_00990 130398 129379 gene locus_tag LOCUS_01000 gene pheS 130398 129379 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_01000 131692 130817 gene locus_tag LOCUS_01010 131692 130817 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242564.1 protein_id gnl|my_center|LOCUS_01010 132644 132258 gene locus_tag LOCUS_01020 132644 132258 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964852.1 protein_id gnl|my_center|LOCUS_01020 134156 132669 gene locus_tag LOCUS_01030 gene thrC 134156 132669 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_01030 139877 134454 gene locus_tag LOCUS_01040 139877 134454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 140399 139986 gene locus_tag LOCUS_01050 140399 139986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 140979 140482 gene locus_tag LOCUS_01060 gene leuD 140979 140482 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_01060 142253 140976 gene locus_tag LOCUS_01070 gene leuC 142253 140976 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_01070 143397 142312 gene locus_tag LOCUS_01080 gene asd 143397 142312 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051614.1 protein_id gnl|my_center|LOCUS_01080 144819 143437 gene locus_tag LOCUS_01090 gene argH 144819 143437 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_01090 145637 144987 gene locus_tag LOCUS_01100 145637 144987 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_01100 147076 145700 gene locus_tag LOCUS_01110 147076 145700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 149606 147189 gene locus_tag LOCUS_01120 149606 147189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01120 151132 149681 gene locus_tag LOCUS_01130 151132 149681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 151365 151129 gene locus_tag LOCUS_01140 151365 151129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 151418 152194 gene locus_tag LOCUS_01150 151418 152194 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963938.1 protein_id gnl|my_center|LOCUS_01150 152178 153059 gene locus_tag LOCUS_01160 152178 153059 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963937.1 protein_id gnl|my_center|LOCUS_01160 154804 153272 gene locus_tag LOCUS_01170 154804 153272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 155645 154905 gene locus_tag LOCUS_01180 155645 154905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 156765 155647 gene locus_tag LOCUS_01190 156765 155647 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978090.1 protein_id gnl|my_center|LOCUS_01190 >Feature sequence002 115 768 gene locus_tag LOCUS_01200 115 768 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_01200 1102 833 gene locus_tag LOCUS_01210 1102 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 1238 1561 gene locus_tag LOCUS_01220 1238 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 1581 2087 gene locus_tag LOCUS_01230 1581 2087 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674090.1 protein_id gnl|my_center|LOCUS_01230 3538 2213 gene locus_tag LOCUS_01240 3538 2213 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048319.1 protein_id gnl|my_center|LOCUS_01240 4082 3663 gene locus_tag LOCUS_01250 4082 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 4324 4638 gene locus_tag LOCUS_01260 4324 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 4775 8356 gene locus_tag LOCUS_01270 4775 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 8489 8956 gene locus_tag LOCUS_01280 8489 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 8976 9446 gene locus_tag LOCUS_01290 8976 9446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 11148 9718 gene locus_tag LOCUS_01300 11148 9718 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272578.1 protein_id gnl|my_center|LOCUS_01300 12219 11164 gene locus_tag LOCUS_01310 12219 11164 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562759.1 protein_id gnl|my_center|LOCUS_01310 13715 12273 gene locus_tag LOCUS_01320 13715 12273 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_01320 15495 14200 gene locus_tag LOCUS_01330 15495 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 15696 16892 gene locus_tag LOCUS_01340 15696 16892 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811028.1 protein_id gnl|my_center|LOCUS_01340 17761 17027 gene locus_tag LOCUS_01350 17761 17027 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948182.1 protein_id gnl|my_center|LOCUS_01350 18179 19081 gene locus_tag LOCUS_01360 18179 19081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 19204 19638 gene locus_tag LOCUS_01370 19204 19638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 19660 21210 gene locus_tag LOCUS_01380 19660 21210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 21411 22286 gene locus_tag LOCUS_01390 gene ispE 21411 22286 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894070.1 protein_id gnl|my_center|LOCUS_01390 22289 22963 gene locus_tag LOCUS_01400 22289 22963 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_01400 23043 23720 gene locus_tag LOCUS_01410 gene spoIIR 23043 23720 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947973.1 protein_id gnl|my_center|LOCUS_01410 23812 24525 gene locus_tag LOCUS_01420 23812 24525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 24558 25445 gene locus_tag LOCUS_01430 24558 25445 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986367.1 protein_id gnl|my_center|LOCUS_01430 25471 28944 gene locus_tag LOCUS_01440 25471 28944 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_01440 29014 30021 gene locus_tag LOCUS_01450 gene pfkA 29014 30021 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_01450 30029 30862 gene locus_tag LOCUS_01460 gene murI 30029 30862 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_01460 30865 31347 gene locus_tag LOCUS_01470 30865 31347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 32174 31731 gene locus_tag LOCUS_01480 32174 31731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 32342 33817 gene locus_tag LOCUS_01490 gene cls 32342 33817 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243311.1 protein_id gnl|my_center|LOCUS_01490 33988 35079 gene locus_tag LOCUS_01500 33988 35079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 35262 36131 gene locus_tag LOCUS_01510 35262 36131 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382347.1 protein_id gnl|my_center|LOCUS_01510 36315 36533 gene locus_tag LOCUS_01520 36315 36533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01520 36621 38492 gene locus_tag LOCUS_01530 36621 38492 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01530 38693 39055 gene locus_tag LOCUS_01540 38693 39055 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_01540 39229 40449 gene locus_tag LOCUS_01550 39229 40449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 40460 41359 gene locus_tag LOCUS_01560 40460 41359 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860957.1 protein_id gnl|my_center|LOCUS_01560 41381 42313 gene locus_tag LOCUS_01570 41381 42313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01570 42195 42479 gene locus_tag LOCUS_01580 42195 42479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01580 43773 42655 gene locus_tag LOCUS_01590 gene glgD 43773 42655 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418641.1 protein_id gnl|my_center|LOCUS_01590 44914 43775 gene locus_tag LOCUS_01600 44914 43775 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922500.1 protein_id gnl|my_center|LOCUS_01600 45158 46339 gene locus_tag LOCUS_01610 45158 46339 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964048.1 protein_id gnl|my_center|LOCUS_01610 46511 46660 gene locus_tag LOCUS_01620 gene rpmG 46511 46660 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810204.1 protein_id gnl|my_center|LOCUS_01620 46683 46904 gene locus_tag LOCUS_01630 46683 46904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 46930 47445 gene locus_tag LOCUS_01640 gene nusG 46930 47445 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_01640 47497 47922 gene locus_tag LOCUS_01650 gene rplK 47497 47922 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_01650 48007 48699 gene locus_tag LOCUS_01660 gene rplA 48007 48699 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_01660 49214 49744 gene locus_tag LOCUS_01670 gene rplJ 49214 49744 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832306.1 protein_id gnl|my_center|LOCUS_01670 49853 50227 gene locus_tag LOCUS_01680 gene rplL 49853 50227 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832283.1 protein_id gnl|my_center|LOCUS_01680 50843 54718 gene locus_tag LOCUS_01690 gene rpoB 50843 54718 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_01690 54733 58488 gene locus_tag LOCUS_01700 gene rpoC 54733 58488 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966420.1 protein_id gnl|my_center|LOCUS_01700 59823 58636 gene locus_tag LOCUS_01710 59823 58636 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_01710 60821 59823 gene locus_tag LOCUS_01720 60821 59823 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_01720 61950 60835 gene locus_tag LOCUS_01730 61950 60835 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132280311.1 protein_id gnl|my_center|LOCUS_01730 63541 62228 gene locus_tag LOCUS_01740 gene murC 63541 62228 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_01740 63824 65098 gene locus_tag LOCUS_01750 63824 65098 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082942.1 protein_id gnl|my_center|LOCUS_01750 65140 66207 gene locus_tag LOCUS_01760 gene glgD 65140 66207 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_01760 66253 66540 gene locus_tag LOCUS_01770 gene spoVG 66253 66540 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_01770 67334 66660 gene locus_tag LOCUS_01780 67334 66660 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_01780 67491 68909 gene locus_tag LOCUS_01790 67491 68909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 68990 70135 gene locus_tag LOCUS_01800 68990 70135 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_01800 70381 71823 gene locus_tag LOCUS_01810 gene proS 70381 71823 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 protein_id gnl|my_center|LOCUS_01810 71940 72851 gene locus_tag LOCUS_01820 71940 72851 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644751.1 protein_id gnl|my_center|LOCUS_01820 73026 73448 gene locus_tag LOCUS_01830 gene rpsL 73026 73448 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_01830 73660 74130 gene locus_tag LOCUS_01840 gene rpsG 73660 74130 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357613.1 protein_id gnl|my_center|LOCUS_01840 74143 76260 gene locus_tag LOCUS_01850 gene fusA 74143 76260 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436178.1 protein_id gnl|my_center|LOCUS_01850 76381 77574 gene locus_tag LOCUS_01860 gene tuf 76381 77574 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887863.1 protein_id gnl|my_center|LOCUS_01860 77842 81099 gene locus_tag LOCUS_01870 77842 81099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 81146 81313 gene locus_tag LOCUS_01880 81146 81313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 81359 82354 gene locus_tag LOCUS_01890 81359 82354 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_01890 82502 83452 gene locus_tag LOCUS_01900 82502 83452 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002940642.1 protein_id gnl|my_center|LOCUS_01900 83453 84256 gene locus_tag LOCUS_01910 83453 84256 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_01910 84462 85160 gene locus_tag LOCUS_01920 84462 85160 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_01920 85205 85786 gene locus_tag LOCUS_01930 85205 85786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 85790 86044 gene locus_tag LOCUS_01940 85790 86044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 87941 86151 gene locus_tag LOCUS_01950 87941 86151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 88206 89417 gene locus_tag LOCUS_01960 88206 89417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 89742 90374 gene locus_tag LOCUS_01970 gene nth 89742 90374 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895383.1 protein_id gnl|my_center|LOCUS_01970 90395 91765 gene locus_tag LOCUS_01980 90395 91765 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682090.1 protein_id gnl|my_center|LOCUS_01980 91904 92965 gene locus_tag LOCUS_01990 91904 92965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 93004 94413 gene locus_tag LOCUS_02000 93004 94413 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_02000 94546 94887 gene locus_tag LOCUS_tm00010 94546 94887 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 95140 95958 gene locus_tag LOCUS_02010 95140 95958 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678767.1 protein_id gnl|my_center|LOCUS_02010 95982 97223 gene locus_tag LOCUS_02020 95982 97223 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272444.1 protein_id gnl|my_center|LOCUS_02020 97503 98207 gene locus_tag LOCUS_02030 97503 98207 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721621.1 protein_id gnl|my_center|LOCUS_02030 98223 101297 gene locus_tag LOCUS_02040 98223 101297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 101512 102192 gene locus_tag LOCUS_02050 101512 102192 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965730.1 protein_id gnl|my_center|LOCUS_02050 102365 103747 gene locus_tag LOCUS_02060 102365 103747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 103911 104531 gene locus_tag LOCUS_02070 gene hisH 103911 104531 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_02070 104531 105292 gene locus_tag LOCUS_02080 gene hisF 104531 105292 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949116.1 protein_id gnl|my_center|LOCUS_02080 105305 105973 gene locus_tag LOCUS_02090 105305 105973 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814489.1 protein_id gnl|my_center|LOCUS_02090 106291 106028 gene locus_tag LOCUS_02100 106291 106028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 106719 108215 gene locus_tag LOCUS_02110 106719 108215 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892595.1 protein_id gnl|my_center|LOCUS_02110 108461 109519 gene locus_tag LOCUS_02120 108461 109519 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681843.1 protein_id gnl|my_center|LOCUS_02120 109627 110340 gene locus_tag LOCUS_02130 109627 110340 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723980.1 protein_id gnl|my_center|LOCUS_02130 110355 112256 gene locus_tag LOCUS_02140 110355 112256 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379416.1 protein_id gnl|my_center|LOCUS_02140 112279 112860 gene locus_tag LOCUS_02150 112279 112860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 112980 114227 gene locus_tag LOCUS_02160 112980 114227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 114959 114228 gene locus_tag LOCUS_02170 114959 114228 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_02170 115464 115045 gene locus_tag LOCUS_02180 115464 115045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 115633 115448 gene locus_tag LOCUS_02190 115633 115448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 116185 115682 gene locus_tag LOCUS_02200 116185 115682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 116346 116182 gene locus_tag LOCUS_02210 116346 116182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 116653 117210 gene locus_tag LOCUS_02220 116653 117210 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730082.1 protein_id gnl|my_center|LOCUS_02220 117381 119063 gene locus_tag LOCUS_02230 117381 119063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 119493 119200 gene locus_tag LOCUS_02240 119493 119200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 120013 120813 gene locus_tag LOCUS_02250 120013 120813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 121631 124279 gene locus_tag LOCUS_02260 121631 124279 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_02260 124354 126573 gene locus_tag LOCUS_02270 124354 126573 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873616.1 protein_id gnl|my_center|LOCUS_02270 126748 126882 gene locus_tag LOCUS_02280 126748 126882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 126905 128248 gene locus_tag LOCUS_02290 126905 128248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 128401 128715 gene locus_tag LOCUS_02300 gene spoIIAA 128401 128715 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418414.1 protein_id gnl|my_center|LOCUS_02300 128712 129167 gene locus_tag LOCUS_02310 gene spoIIAB 128712 129167 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357714.1 protein_id gnl|my_center|LOCUS_02310 129146 129862 gene locus_tag LOCUS_02320 gene sigF 129146 129862 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860953.1 protein_id gnl|my_center|LOCUS_02320 129974 130135 gene locus_tag LOCUS_02330 129974 130135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 130180 130845 gene locus_tag LOCUS_02340 gene spoVAA 130180 130845 CDS product stage V sporulation protein SpoVAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246053.1 protein_id gnl|my_center|LOCUS_02340 130805 131221 gene locus_tag LOCUS_02350 gene spoVAB 130805 131221 CDS product stage V sporulation protein SpoVAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572936.1 protein_id gnl|my_center|LOCUS_02350 131374 131658 gene locus_tag LOCUS_02360 131374 131658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 131720 132223 gene locus_tag LOCUS_02370 gene spoVAC 131720 132223 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_02370 132351 133385 gene locus_tag LOCUS_02380 gene spoVAD 132351 133385 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_02380 133399 133755 gene locus_tag LOCUS_02390 gene spoVAE 133399 133755 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418423.1 protein_id gnl|my_center|LOCUS_02390 133989 135626 gene locus_tag LOCUS_02400 133989 135626 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_02400 135982 136914 gene locus_tag LOCUS_02410 135982 136914 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_02410 136916 137809 gene locus_tag LOCUS_02420 gene pstC 136916 137809 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814831.1 protein_id gnl|my_center|LOCUS_02420 137802 138662 gene locus_tag LOCUS_02430 gene pstA 137802 138662 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049767.1 protein_id gnl|my_center|LOCUS_02430 138718 139467 gene locus_tag LOCUS_02440 gene pstB 138718 139467 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_02440 139471 140139 gene locus_tag LOCUS_02450 gene phoU 139471 140139 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_02450 140144 140320 gene locus_tag LOCUS_02460 140144 140320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 140341 141015 gene locus_tag LOCUS_02470 140341 141015 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_02470 141012 142352 gene locus_tag LOCUS_02480 141012 142352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 142591 142965 gene locus_tag LOCUS_02490 142591 142965 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963919.1 protein_id gnl|my_center|LOCUS_02490 143028 145472 gene locus_tag LOCUS_02500 143028 145472 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897132.1 protein_id gnl|my_center|LOCUS_02500 145576 145989 gene locus_tag LOCUS_02510 145576 145989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 146173 147525 gene locus_tag LOCUS_02520 gene radA 146173 147525 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_02520 147633 151643 gene locus_tag LOCUS_02530 147633 151643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 151834 152019 gene locus_tag LOCUS_02540 151834 152019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 152071 154596 gene locus_tag LOCUS_02550 152071 154596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 >Feature sequence003 722 93 gene locus_tag LOCUS_02560 722 93 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048244.1 protein_id gnl|my_center|LOCUS_02560 834 1709 gene locus_tag LOCUS_02570 834 1709 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948372.1 protein_id gnl|my_center|LOCUS_02570 3278 1842 gene locus_tag LOCUS_02580 gene pyk 3278 1842 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_02580 4183 3353 gene locus_tag LOCUS_02590 4183 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 4712 8962 gene locus_tag LOCUS_02600 4712 8962 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484061.1 protein_id gnl|my_center|LOCUS_02600 9719 9216 gene locus_tag LOCUS_02610 gene greA 9719 9216 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965725.1 protein_id gnl|my_center|LOCUS_02610 12150 9745 gene locus_tag LOCUS_02620 12150 9745 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459887.1 protein_id gnl|my_center|LOCUS_02620 12436 12233 gene locus_tag LOCUS_02630 12436 12233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 13161 12625 gene locus_tag LOCUS_02640 13161 12625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 13427 13161 gene locus_tag LOCUS_02650 13427 13161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 14388 13450 gene locus_tag LOCUS_02660 14388 13450 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_02660 14928 14392 gene locus_tag LOCUS_02670 14928 14392 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 protein_id gnl|my_center|LOCUS_02670 15843 15070 gene locus_tag LOCUS_02680 15843 15070 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943941.1 protein_id gnl|my_center|LOCUS_02680 17204 15855 gene locus_tag LOCUS_02690 17204 15855 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460409.1 protein_id gnl|my_center|LOCUS_02690 17482 17679 gene locus_tag LOCUS_02700 17482 17679 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966272.1 protein_id gnl|my_center|LOCUS_02700 19174 17939 gene locus_tag LOCUS_02710 gene glyA 19174 17939 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001981400.1 protein_id gnl|my_center|LOCUS_02710 23861 19302 gene locus_tag LOCUS_02720 23861 19302 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_02720 24904 23849 gene locus_tag LOCUS_02730 gene ispG 24904 23849 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965103.1 protein_id gnl|my_center|LOCUS_02730 25683 25225 gene locus_tag LOCUS_02740 25683 25225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 25859 25680 gene locus_tag LOCUS_02750 25859 25680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 26390 25881 gene locus_tag LOCUS_02760 26390 25881 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_02760 27463 26387 gene locus_tag LOCUS_02770 gene hisC 27463 26387 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949115.1 protein_id gnl|my_center|LOCUS_02770 28667 27480 gene locus_tag LOCUS_02780 28667 27480 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459580.1 protein_id gnl|my_center|LOCUS_02780 29615 28707 gene locus_tag LOCUS_02790 29615 28707 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054703570.1 protein_id gnl|my_center|LOCUS_02790 30731 29655 gene locus_tag LOCUS_02800 gene prfA 30731 29655 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_02800 31646 30753 gene locus_tag LOCUS_02810 gene prmC 31646 30753 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_02810 32605 31643 gene locus_tag LOCUS_02820 32605 31643 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421392.1 protein_id gnl|my_center|LOCUS_02820 32879 32679 gene locus_tag LOCUS_02830 gene rpmE 32879 32679 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_02830 34345 32996 gene locus_tag LOCUS_02840 34345 32996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 34617 35543 gene locus_tag LOCUS_02850 34617 35543 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_02850 35536 36048 gene locus_tag LOCUS_02860 35536 36048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 37378 36062 gene locus_tag LOCUS_02870 37378 36062 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_02870 38163 37408 gene locus_tag LOCUS_02880 38163 37408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 38337 39725 gene locus_tag LOCUS_02890 38337 39725 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930806.1 protein_id gnl|my_center|LOCUS_02890 39839 41008 gene locus_tag LOCUS_02900 39839 41008 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966242.1 protein_id gnl|my_center|LOCUS_02900 41008 42501 gene locus_tag LOCUS_02910 gene galT 41008 42501 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_02910 43581 42658 gene locus_tag LOCUS_02920 43581 42658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 43952 43596 gene locus_tag LOCUS_02930 43952 43596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964626.1 protein_id gnl|my_center|LOCUS_02930 45253 44141 gene locus_tag LOCUS_02940 45253 44141 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989529.1 protein_id gnl|my_center|LOCUS_02940 45327 45758 gene locus_tag LOCUS_02950 45327 45758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 46416 45832 gene locus_tag LOCUS_02960 46416 45832 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_02960 48258 46612 gene locus_tag LOCUS_02970 48258 46612 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_02970 48650 49348 gene locus_tag LOCUS_02980 48650 49348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 50027 49407 gene locus_tag LOCUS_02990 50027 49407 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_02990 51949 50045 gene locus_tag LOCUS_03000 51949 50045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 52267 52112 gene locus_tag LOCUS_03010 52267 52112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 53427 52279 gene locus_tag LOCUS_03020 gene fucO 53427 52279 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766959.1 protein_id gnl|my_center|LOCUS_03020 53819 53520 gene locus_tag LOCUS_03030 53819 53520 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461875.1 protein_id gnl|my_center|LOCUS_03030 54812 53982 gene locus_tag LOCUS_03040 54812 53982 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_03040 56027 54846 gene locus_tag LOCUS_03050 gene dnaJ 56027 54846 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816474.1 protein_id gnl|my_center|LOCUS_03050 58005 56137 gene locus_tag LOCUS_03060 gene dnaK 58005 56137 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_03060 58768 58076 gene locus_tag LOCUS_03070 gene grpE 58768 58076 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_03070 59860 58772 gene locus_tag LOCUS_03080 gene hrcA 59860 58772 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_03080 60121 60681 gene locus_tag LOCUS_03090 60121 60681 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_03090 60678 61232 gene locus_tag LOCUS_03100 60678 61232 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679462.1 protein_id gnl|my_center|LOCUS_03100 62432 61248 gene locus_tag LOCUS_03110 gene hemW 62432 61248 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454756.1 protein_id gnl|my_center|LOCUS_03110 64304 62490 gene locus_tag LOCUS_03120 gene lepA 64304 62490 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416556.1 protein_id gnl|my_center|LOCUS_03120 65418 64432 gene locus_tag LOCUS_03130 gene holA 65418 64432 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279916.1 protein_id gnl|my_center|LOCUS_03130 67739 65406 gene locus_tag LOCUS_03140 67739 65406 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157831.1 protein_id gnl|my_center|LOCUS_03140 68677 67736 gene locus_tag LOCUS_03150 68677 67736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 70200 68674 gene locus_tag LOCUS_03160 70200 68674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 70819 70130 gene locus_tag LOCUS_03170 70819 70130 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_03170 71617 70832 gene locus_tag LOCUS_03180 71617 70832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 72165 71734 gene locus_tag LOCUS_03190 72165 71734 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395139.1 protein_id gnl|my_center|LOCUS_03190 73494 72310 gene locus_tag LOCUS_03200 73494 72310 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864195.1 protein_id gnl|my_center|LOCUS_03200 74380 73481 gene locus_tag LOCUS_03210 gene argB 74380 73481 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864194.1 protein_id gnl|my_center|LOCUS_03210 75616 74393 gene locus_tag LOCUS_03220 gene argJ 75616 74393 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082329.1 protein_id gnl|my_center|LOCUS_03220 76081 75635 gene locus_tag LOCUS_03230 76081 75635 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851934.1 protein_id gnl|my_center|LOCUS_03230 77165 76125 gene locus_tag LOCUS_03240 gene argC 77165 76125 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851634.1 protein_id gnl|my_center|LOCUS_03240 78865 77615 gene locus_tag LOCUS_03250 78865 77615 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_03250 79833 78931 gene locus_tag LOCUS_03260 gene proB 79833 78931 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287451.1 protein_id gnl|my_center|LOCUS_03260 82736 79965 gene locus_tag LOCUS_03270 82736 79965 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_03270 84206 82842 gene locus_tag LOCUS_03280 84206 82842 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891654.1 protein_id gnl|my_center|LOCUS_03280 84656 84309 gene locus_tag LOCUS_03290 84656 84309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03290 87616 85001 gene locus_tag LOCUS_03300 87616 85001 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355749.1 protein_id gnl|my_center|LOCUS_03300 88440 87883 gene locus_tag LOCUS_03310 88440 87883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 89540 88440 gene locus_tag LOCUS_03320 89540 88440 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_03320 89683 89537 gene locus_tag LOCUS_03330 89683 89537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 90274 91497 gene locus_tag LOCUS_03340 90274 91497 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_03340 92703 91690 gene locus_tag LOCUS_03350 92703 91690 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_03350 92838 93539 gene locus_tag LOCUS_03360 92838 93539 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438111.1 protein_id gnl|my_center|LOCUS_03360 93619 93801 gene locus_tag LOCUS_03370 93619 93801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815107.1 protein_id gnl|my_center|LOCUS_03370 93814 94071 gene locus_tag LOCUS_03380 93814 94071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 94508 94149 gene locus_tag LOCUS_03390 94508 94149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 97431 94549 gene locus_tag LOCUS_03400 97431 94549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 97991 97446 gene locus_tag LOCUS_03410 97991 97446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 99209 98061 gene locus_tag LOCUS_03420 99209 98061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 99955 99272 gene locus_tag LOCUS_03430 99955 99272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 101290 100562 gene locus_tag LOCUS_03440 101290 100562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 101552 104272 gene locus_tag LOCUS_03450 101552 104272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 104257 108225 gene locus_tag LOCUS_03460 104257 108225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 109773 108463 gene locus_tag LOCUS_03470 109773 108463 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_03470 110314 110099 gene locus_tag LOCUS_03480 110314 110099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 111109 110495 gene locus_tag LOCUS_03490 111109 110495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 112269 111214 gene locus_tag LOCUS_03500 112269 111214 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790944.1 protein_id gnl|my_center|LOCUS_03500 112963 112400 gene locus_tag LOCUS_03510 112963 112400 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016072.1 protein_id gnl|my_center|LOCUS_03510 113932 113075 gene locus_tag LOCUS_03520 gene nadC 113932 113075 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454666.1 protein_id gnl|my_center|LOCUS_03520 115238 113922 gene locus_tag LOCUS_03530 115238 113922 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016070.1 protein_id gnl|my_center|LOCUS_03530 115662 116582 gene locus_tag LOCUS_03540 gene nadA 115662 116582 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870480.1 protein_id gnl|my_center|LOCUS_03540 118256 116973 gene locus_tag LOCUS_03550 118256 116973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 118701 118315 gene locus_tag LOCUS_03560 118701 118315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386950.1 protein_id gnl|my_center|LOCUS_03560 120492 118717 gene locus_tag LOCUS_03570 gene dnaK 120492 118717 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_03570 121397 120594 gene locus_tag LOCUS_03580 121397 120594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 122214 121390 gene locus_tag LOCUS_03590 122214 121390 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_03590 124278 122491 gene locus_tag LOCUS_03600 gene glgB 124278 122491 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367106.1 protein_id gnl|my_center|LOCUS_03600 124473 125009 gene locus_tag LOCUS_03610 124473 125009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 125565 125029 gene locus_tag LOCUS_03620 125565 125029 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_03620 125797 126162 gene locus_tag LOCUS_03630 125797 126162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 126155 126847 gene locus_tag LOCUS_03640 126155 126847 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294273.1 protein_id gnl|my_center|LOCUS_03640 128312 127065 gene locus_tag LOCUS_03650 128312 127065 CDS product YidE/YbjL duplication inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280515.1 protein_id gnl|my_center|LOCUS_03650 128993 128436 gene locus_tag LOCUS_03660 128993 128436 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_03660 129837 128995 gene locus_tag LOCUS_03670 129837 128995 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 protein_id gnl|my_center|LOCUS_03670 131529 129919 gene locus_tag LOCUS_03680 131529 129919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 132217 131543 gene locus_tag LOCUS_03690 132217 131543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 133150 132290 gene locus_tag LOCUS_03700 133150 132290 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392335.1 protein_id gnl|my_center|LOCUS_03700 134187 133150 gene locus_tag LOCUS_03710 134187 133150 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_03710 135165 134191 gene locus_tag LOCUS_03720 135165 134191 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392333.1 protein_id gnl|my_center|LOCUS_03720 135596 135153 gene locus_tag LOCUS_03730 135596 135153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 137575 135587 gene locus_tag LOCUS_03740 137575 135587 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927008.1 protein_id gnl|my_center|LOCUS_03740 137970 137581 gene locus_tag LOCUS_03750 137970 137581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 138773 137970 gene locus_tag LOCUS_03760 138773 137970 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_03760 >Feature sequence004 268 465 gene locus_tag LOCUS_03770 268 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03770 505 885 gene locus_tag LOCUS_03780 505 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03780 1308 1730 gene locus_tag LOCUS_03790 1308 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 2133 1927 gene locus_tag LOCUS_03800 2133 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 2763 2476 gene locus_tag LOCUS_03810 2763 2476 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210984.1 protein_id gnl|my_center|LOCUS_03810 2966 3997 gene locus_tag LOCUS_03820 2966 3997 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 protein_id gnl|my_center|LOCUS_03820 4166 6160 gene locus_tag LOCUS_03830 gene uvrB 4166 6160 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_03830 6273 9119 gene locus_tag LOCUS_03840 gene uvrA 6273 9119 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_03840 9178 10167 gene locus_tag LOCUS_03850 9178 10167 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_03850 10186 12405 gene locus_tag LOCUS_03860 10186 12405 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_03860 12588 13187 gene locus_tag LOCUS_03870 12588 13187 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_03870 13267 13659 gene locus_tag LOCUS_03880 13267 13659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 13714 14880 gene locus_tag LOCUS_03890 13714 14880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 14918 15787 gene locus_tag LOCUS_03900 gene cdaA 14918 15787 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966360.1 protein_id gnl|my_center|LOCUS_03900 15777 17090 gene locus_tag LOCUS_03910 15777 17090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 17248 17526 gene locus_tag LOCUS_03920 17248 17526 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_03920 17547 18476 gene locus_tag LOCUS_03930 17547 18476 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_03930 19590 18595 gene locus_tag LOCUS_03940 19590 18595 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921459.1 protein_id gnl|my_center|LOCUS_03940 19845 21248 gene locus_tag LOCUS_03950 19845 21248 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_03950 21266 22180 gene locus_tag LOCUS_03960 gene rfbN 21266 22180 CDS product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 protein_id gnl|my_center|LOCUS_03960 22398 23924 gene locus_tag LOCUS_03970 22398 23924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 23956 25548 gene locus_tag LOCUS_03980 23956 25548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 25679 27478 gene locus_tag LOCUS_03990 25679 27478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 27638 28735 gene locus_tag LOCUS_04000 gene glf 27638 28735 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_04000 29003 30922 gene locus_tag LOCUS_04010 29003 30922 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775020.1 protein_id gnl|my_center|LOCUS_04010 30961 32961 gene locus_tag LOCUS_04020 30961 32961 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_04020 32985 34187 gene locus_tag LOCUS_04030 32985 34187 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609547.1 protein_id gnl|my_center|LOCUS_04030 34177 34878 gene locus_tag LOCUS_04040 34177 34878 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922186.1 protein_id gnl|my_center|LOCUS_04040 34991 36244 gene locus_tag LOCUS_04050 34991 36244 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704930.1 protein_id gnl|my_center|LOCUS_04050 36331 37461 gene locus_tag LOCUS_04060 36331 37461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 37554 38636 gene locus_tag LOCUS_04070 37554 38636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 38647 40092 gene locus_tag LOCUS_04080 38647 40092 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094940979.1 protein_id gnl|my_center|LOCUS_04080 40121 41308 gene locus_tag LOCUS_04090 40121 41308 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434606.1 protein_id gnl|my_center|LOCUS_04090 41299 42312 gene locus_tag LOCUS_04100 41299 42312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 42316 43350 gene locus_tag LOCUS_04110 42316 43350 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549884.1 protein_id gnl|my_center|LOCUS_04110 43516 44961 gene locus_tag LOCUS_04120 43516 44961 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060458416.1 protein_id gnl|my_center|LOCUS_04120 45071 46330 gene locus_tag LOCUS_04130 45071 46330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 46249 47691 gene locus_tag LOCUS_04140 46249 47691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 47734 49203 gene locus_tag LOCUS_04150 47734 49203 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128519551.1 protein_id gnl|my_center|LOCUS_04150 49268 49729 gene locus_tag LOCUS_04160 49268 49729 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_04160 49761 50255 gene locus_tag LOCUS_04170 49761 50255 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578443.1 protein_id gnl|my_center|LOCUS_04170 50271 51401 gene locus_tag LOCUS_04180 50271 51401 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143696.1 protein_id gnl|my_center|LOCUS_04180 51422 52642 gene locus_tag LOCUS_04190 51422 52642 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107236.1 protein_id gnl|my_center|LOCUS_04190 52662 53774 gene locus_tag LOCUS_04200 52662 53774 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434606.1 protein_id gnl|my_center|LOCUS_04200 53771 54844 gene locus_tag LOCUS_04210 53771 54844 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039954.1 protein_id gnl|my_center|LOCUS_04210 54859 55974 gene locus_tag LOCUS_04220 54859 55974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 57463 58497 gene locus_tag LOCUS_04230 57463 58497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 60422 58605 gene locus_tag LOCUS_04240 60422 58605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 61967 60597 gene locus_tag LOCUS_04250 61967 60597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04250 64181 61977 gene locus_tag LOCUS_04260 64181 61977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04260 64877 67804 gene locus_tag LOCUS_04270 64877 67804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 67929 71264 gene locus_tag LOCUS_04280 67929 71264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 71388 73472 gene locus_tag LOCUS_04290 71388 73472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302719.1 protein_id gnl|my_center|LOCUS_04290 73420 73593 gene locus_tag LOCUS_04300 73420 73593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 73586 74542 gene locus_tag LOCUS_04310 73586 74542 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965621.1 protein_id gnl|my_center|LOCUS_04310 74601 75644 gene locus_tag LOCUS_04320 74601 75644 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389356.1 protein_id gnl|my_center|LOCUS_04320 75852 77570 gene locus_tag LOCUS_04330 75852 77570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 77634 78716 gene locus_tag LOCUS_04340 gene rfbB 77634 78716 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965629.1 protein_id gnl|my_center|LOCUS_04340 78937 80343 gene locus_tag LOCUS_04350 78937 80343 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_04350 80362 81561 gene locus_tag LOCUS_04360 80362 81561 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454855.1 protein_id gnl|my_center|LOCUS_04360 81693 83642 gene locus_tag LOCUS_04370 81693 83642 CDS product rhamnan synthesis F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389355.1 protein_id gnl|my_center|LOCUS_04370 83881 85848 gene locus_tag LOCUS_04380 83881 85848 CDS product rhamnan synthesis F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389355.1 protein_id gnl|my_center|LOCUS_04380 85894 87006 gene locus_tag LOCUS_04390 85894 87006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 87070 88290 gene locus_tag LOCUS_04400 87070 88290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 88457 89326 gene locus_tag LOCUS_04410 gene rfbA 88457 89326 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965630.1 protein_id gnl|my_center|LOCUS_04410 89342 89887 gene locus_tag LOCUS_04420 gene rfbC 89342 89887 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_04420 89996 90772 gene locus_tag LOCUS_04430 89996 90772 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_04430 90793 91524 gene locus_tag LOCUS_04440 90793 91524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 91877 93976 gene locus_tag LOCUS_04450 91877 93976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 94057 95094 gene locus_tag LOCUS_04460 94057 95094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 95146 97161 gene locus_tag LOCUS_04470 95146 97161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 97416 98876 gene locus_tag LOCUS_04480 97416 98876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 99003 99398 gene locus_tag LOCUS_04490 99003 99398 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413285.1 protein_id gnl|my_center|LOCUS_04490 100152 99556 gene locus_tag LOCUS_04500 100152 99556 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_04500 100425 100156 gene locus_tag LOCUS_04510 100425 100156 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964646.1 protein_id gnl|my_center|LOCUS_04510 100996 101280 gene locus_tag LOCUS_04520 100996 101280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 101690 101615 gene locus_tag LOCUS_t00010 101690 101615 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 101821 103701 gene locus_tag LOCUS_04530 gene asnB 101821 103701 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288533.1 protein_id gnl|my_center|LOCUS_04530 103920 104759 gene locus_tag LOCUS_04540 103920 104759 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890830.1 protein_id gnl|my_center|LOCUS_04540 104849 105085 gene locus_tag LOCUS_04550 104849 105085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 105307 105492 gene locus_tag LOCUS_04560 105307 105492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 105546 105983 gene locus_tag LOCUS_04570 gene mraZ 105546 105983 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700457.1 protein_id gnl|my_center|LOCUS_04570 106032 106967 gene locus_tag LOCUS_04580 gene rsmH 106032 106967 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_04580 107015 107572 gene locus_tag LOCUS_04590 107015 107572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 107902 109962 gene locus_tag LOCUS_04600 107902 109962 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949034.1 protein_id gnl|my_center|LOCUS_04600 110189 111955 gene locus_tag LOCUS_04610 110189 111955 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_04610 111979 113016 gene locus_tag LOCUS_04620 gene mraY 111979 113016 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_04620 113023 114399 gene locus_tag LOCUS_04630 gene murD 113023 114399 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_04630 114413 115531 gene locus_tag LOCUS_04640 gene ftsW 114413 115531 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_04640 115559 116350 gene locus_tag LOCUS_04650 115559 116350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 116654 117835 gene locus_tag LOCUS_04660 gene ftsZ 116654 117835 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_04660 118095 118937 gene locus_tag LOCUS_04670 gene spoIIGA 118095 118937 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_04670 118995 119741 gene locus_tag LOCUS_04680 gene sigE 118995 119741 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811355.1 protein_id gnl|my_center|LOCUS_04680 120270 121796 gene locus_tag LOCUS_04690 120270 121796 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_04690 121910 122686 gene locus_tag LOCUS_04700 gene sigG 121910 122686 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_04700 122855 123523 gene locus_tag LOCUS_04710 122855 123523 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680765.1 protein_id gnl|my_center|LOCUS_04710 123590 123853 gene locus_tag LOCUS_04720 123590 123853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 124398 123964 gene locus_tag LOCUS_04730 124398 123964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 124522 125109 gene locus_tag LOCUS_04740 gene pth 124522 125109 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_04740 125106 128468 gene locus_tag LOCUS_04750 gene mfd 125106 128468 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425912.1 protein_id gnl|my_center|LOCUS_04750 128581 129729 gene locus_tag LOCUS_04760 128581 129729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 >Feature sequence005 259 459 gene locus_tag LOCUS_04770 259 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 479 898 gene locus_tag LOCUS_04780 479 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 1315 1467 gene locus_tag LOCUS_04790 1315 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 1487 2209 gene locus_tag LOCUS_04800 1487 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 2216 2587 gene locus_tag LOCUS_04810 2216 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 2584 2907 gene locus_tag LOCUS_04820 2584 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 2922 4655 gene locus_tag LOCUS_04830 2922 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 4642 4800 gene locus_tag LOCUS_04840 4642 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 4784 6133 gene locus_tag LOCUS_04850 4784 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 6133 6681 gene locus_tag LOCUS_04860 6133 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 6671 7234 gene locus_tag LOCUS_04870 6671 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 7256 7726 gene locus_tag LOCUS_04880 7256 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 7730 8212 gene locus_tag LOCUS_04890 7730 8212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 8216 8992 gene locus_tag LOCUS_04900 8216 8992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 9047 9682 gene locus_tag LOCUS_04910 9047 9682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 9684 12434 gene locus_tag LOCUS_04920 9684 12434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 12876 13478 gene locus_tag LOCUS_04930 12876 13478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 13471 14175 gene locus_tag LOCUS_04940 13471 14175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 14172 14414 gene locus_tag LOCUS_04950 14172 14414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 14356 14553 gene locus_tag LOCUS_04960 14356 14553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 14565 15050 gene locus_tag LOCUS_04970 14565 15050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 15068 15292 gene locus_tag LOCUS_04980 15068 15292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 15289 15453 gene locus_tag LOCUS_04990 15289 15453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 15450 15806 gene locus_tag LOCUS_05000 15450 15806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 15784 16200 gene locus_tag LOCUS_05010 15784 16200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 16200 16442 gene locus_tag LOCUS_05020 16200 16442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 16457 16963 gene locus_tag LOCUS_05030 16457 16963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 17059 17604 gene locus_tag LOCUS_05040 17059 17604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 18336 19700 gene locus_tag LOCUS_05050 18336 19700 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774201.1 protein_id gnl|my_center|LOCUS_05050 19702 20262 gene locus_tag LOCUS_05060 19702 20262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 20240 22075 gene locus_tag LOCUS_05070 20240 22075 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272394.1 protein_id gnl|my_center|LOCUS_05070 22088 22321 gene locus_tag LOCUS_05080 22088 22321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 22325 23920 gene locus_tag LOCUS_05090 22325 23920 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460141.1 protein_id gnl|my_center|LOCUS_05090 23871 24494 gene locus_tag LOCUS_05100 23871 24494 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153406462.1 protein_id gnl|my_center|LOCUS_05100 24491 26056 gene locus_tag LOCUS_05110 24491 26056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272391.1 protein_id gnl|my_center|LOCUS_05110 26075 26401 gene locus_tag LOCUS_05120 26075 26401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 26415 26690 gene locus_tag LOCUS_05130 26415 26690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 26683 27018 gene locus_tag LOCUS_05140 26683 27018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 27018 27602 gene locus_tag LOCUS_05150 27018 27602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 27603 28079 gene locus_tag LOCUS_05160 27603 28079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 28076 28372 gene locus_tag LOCUS_05170 28076 28372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 28390 29841 gene locus_tag LOCUS_05180 28390 29841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460135.1 protein_id gnl|my_center|LOCUS_05180 29844 30368 gene locus_tag LOCUS_05190 29844 30368 CDS product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816083.1 protein_id gnl|my_center|LOCUS_05190 30387 30749 gene locus_tag LOCUS_05200 30387 30749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 30879 34472 gene locus_tag LOCUS_05210 30879 34472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 34485 34688 gene locus_tag LOCUS_05220 34485 34688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 34691 35995 gene locus_tag LOCUS_05230 34691 35995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 36009 36545 gene locus_tag LOCUS_05240 36009 36545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 36550 36948 gene locus_tag LOCUS_05250 36550 36948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 36962 37264 gene locus_tag LOCUS_05260 36962 37264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 37257 38411 gene locus_tag LOCUS_05270 37257 38411 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272381.1 protein_id gnl|my_center|LOCUS_05270 38404 39312 gene locus_tag LOCUS_05280 38404 39312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 39326 39877 gene locus_tag LOCUS_05290 39326 39877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 39877 41154 gene locus_tag LOCUS_05300 39877 41154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 41576 42799 gene locus_tag LOCUS_05310 41576 42799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 42738 43001 gene locus_tag LOCUS_05320 42738 43001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 43001 43156 gene locus_tag LOCUS_05330 43001 43156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 43365 43718 gene locus_tag LOCUS_05340 43365 43718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 43734 43958 gene locus_tag LOCUS_05350 43734 43958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 44027 45073 gene locus_tag LOCUS_05360 44027 45073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 45527 45318 gene locus_tag LOCUS_05370 45527 45318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 46203 46084 gene locus_tag LOCUS_05380 46203 46084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 46416 47456 gene locus_tag LOCUS_05390 46416 47456 CDS product IS30-like element ISTde2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956682.1 protein_id gnl|my_center|LOCUS_05390 47857 48351 gene locus_tag LOCUS_05400 gene infC 47857 48351 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048135.1 protein_id gnl|my_center|LOCUS_05400 48406 48603 gene locus_tag LOCUS_05410 gene rpmI 48406 48603 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942164.1 protein_id gnl|my_center|LOCUS_05410 48632 48988 gene locus_tag LOCUS_05420 gene rplT 48632 48988 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429730.1 protein_id gnl|my_center|LOCUS_05420 49334 49251 gene locus_tag LOCUS_t00020 49334 49251 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 49761 53780 gene locus_tag LOCUS_05430 49761 53780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 53852 55462 gene locus_tag LOCUS_05440 53852 55462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 55811 57976 gene locus_tag LOCUS_05450 gene gnpA 55811 57976 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389475.1 protein_id gnl|my_center|LOCUS_05450 58133 59476 gene locus_tag LOCUS_05460 gene ngcE 58133 59476 CDS product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030591.1 protein_id gnl|my_center|LOCUS_05460 59604 60497 gene locus_tag LOCUS_05470 59604 60497 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030592.1 protein_id gnl|my_center|LOCUS_05470 60510 61379 gene locus_tag LOCUS_05480 60510 61379 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_05480 61393 61560 gene locus_tag LOCUS_05490 61393 61560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 61586 62680 gene locus_tag LOCUS_05500 61586 62680 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_05500 62801 63802 gene locus_tag LOCUS_05510 62801 63802 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_05510 63874 65646 gene locus_tag LOCUS_05520 gene dnaG 63874 65646 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357766.1 protein_id gnl|my_center|LOCUS_05520 65706 66824 gene locus_tag LOCUS_05530 gene rpoD 65706 66824 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_05530 66837 67658 gene locus_tag LOCUS_05540 66837 67658 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889262.1 protein_id gnl|my_center|LOCUS_05540 67627 68409 gene locus_tag LOCUS_05550 67627 68409 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_05550 68508 70184 gene locus_tag LOCUS_05560 68508 70184 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_05560 71338 70238 gene locus_tag LOCUS_05570 gene aroC 71338 70238 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938193.1 protein_id gnl|my_center|LOCUS_05570 71497 73464 gene locus_tag LOCUS_05580 71497 73464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 73553 74683 gene locus_tag LOCUS_05590 gene tgt 73553 74683 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965580.1 protein_id gnl|my_center|LOCUS_05590 74755 75069 gene locus_tag LOCUS_05600 74755 75069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 75192 76277 gene locus_tag LOCUS_05610 gene leuB 75192 76277 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861060.1 protein_id gnl|my_center|LOCUS_05610 76345 78030 gene locus_tag LOCUS_05620 gene ilvD 76345 78030 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_05620 78032 79708 gene locus_tag LOCUS_05630 gene ilvB 78032 79708 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_05630 79736 80818 gene locus_tag LOCUS_05640 gene serC 79736 80818 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_05640 80820 81983 gene locus_tag LOCUS_05650 80820 81983 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_05650 82225 82890 gene locus_tag LOCUS_05660 82225 82890 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_05660 83008 84204 gene locus_tag LOCUS_05670 83008 84204 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_05670 86217 84292 gene locus_tag LOCUS_05680 86217 84292 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_05680 86465 87148 gene locus_tag LOCUS_05690 86465 87148 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_05690 87121 87309 gene locus_tag LOCUS_05700 87121 87309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 87293 88795 gene locus_tag LOCUS_05710 87293 88795 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_05710 88792 89958 gene locus_tag LOCUS_05720 gene alr 88792 89958 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_05720 90056 90403 gene locus_tag LOCUS_05730 gene ndoA 90056 90403 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 protein_id gnl|my_center|LOCUS_05730 90561 91295 gene locus_tag LOCUS_05740 90561 91295 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_05740 91333 92106 gene locus_tag LOCUS_05750 91333 92106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 92119 93393 gene locus_tag LOCUS_05760 92119 93393 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_05760 93562 94356 gene locus_tag LOCUS_05770 93562 94356 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388341.1 protein_id gnl|my_center|LOCUS_05770 94583 97138 gene locus_tag LOCUS_05780 94583 97138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 97159 98829 gene locus_tag LOCUS_05790 97159 98829 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_05790 99002 99856 gene locus_tag LOCUS_05800 gene folD 99002 99856 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722487.1 protein_id gnl|my_center|LOCUS_05800 99853 101295 gene locus_tag LOCUS_05810 99853 101295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 101467 102648 gene locus_tag LOCUS_05820 101467 102648 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_05820 102951 103841 gene locus_tag LOCUS_05830 102951 103841 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_05830 103841 105229 gene locus_tag LOCUS_05840 gene gltA 103841 105229 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_05840 105389 105817 gene locus_tag LOCUS_05850 105389 105817 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_05850 105885 106364 gene locus_tag LOCUS_05860 gene rlmH 105885 106364 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053094.1 protein_id gnl|my_center|LOCUS_05860 106820 107095 gene locus_tag LOCUS_05870 106820 107095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 107088 107210 gene locus_tag LOCUS_05880 107088 107210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 107669 107445 gene locus_tag LOCUS_05890 107669 107445 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_05890 107887 108171 gene locus_tag LOCUS_05900 107887 108171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 108566 108901 gene locus_tag LOCUS_05910 108566 108901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 108980 109135 gene locus_tag LOCUS_05920 108980 109135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 109221 109397 gene locus_tag LOCUS_05930 109221 109397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 109375 111837 gene locus_tag LOCUS_05940 109375 111837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 111859 112170 gene locus_tag LOCUS_05950 111859 112170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05950 >Feature sequence006 628 1512 gene locus_tag LOCUS_05960 gene dapA 628 1512 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_05960 1530 2516 gene locus_tag LOCUS_05970 1530 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 2819 2601 gene locus_tag LOCUS_05980 2819 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 3129 3057 gene locus_tag LOCUS_t00030 3129 3057 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3367 3618 gene locus_tag LOCUS_05990 3367 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 3857 4966 gene locus_tag LOCUS_06000 3857 4966 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06000 5282 7534 gene locus_tag LOCUS_06010 gene pflB 5282 7534 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_06010 7689 8420 gene locus_tag LOCUS_06020 gene pflA 7689 8420 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_06020 8453 9625 gene locus_tag LOCUS_06030 8453 9625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 9981 10472 gene locus_tag LOCUS_06040 9981 10472 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861494.1 protein_id gnl|my_center|LOCUS_06040 10457 12679 gene locus_tag LOCUS_06050 10457 12679 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_06050 12676 14511 gene locus_tag LOCUS_06060 12676 14511 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_06060 14772 15731 gene locus_tag LOCUS_06070 gene prmA 14772 15731 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990133.1 protein_id gnl|my_center|LOCUS_06070 15819 16553 gene locus_tag LOCUS_06080 15819 16553 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_06080 16624 17781 gene locus_tag LOCUS_06090 16624 17781 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_06090 17815 18996 gene locus_tag LOCUS_06100 gene thiI 17815 18996 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_06100 19455 19222 gene locus_tag LOCUS_06110 19455 19222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 19661 20989 gene locus_tag LOCUS_06120 gene mtaB 19661 20989 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_06120 21375 21638 gene locus_tag LOCUS_06130 21375 21638 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_06130 21645 22103 gene locus_tag LOCUS_06140 gene ruvX 21645 22103 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_06140 22120 22386 gene locus_tag LOCUS_06150 22120 22386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 22508 24178 gene locus_tag LOCUS_06160 22508 24178 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_06160 24181 24846 gene locus_tag LOCUS_06170 24181 24846 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438166.1 protein_id gnl|my_center|LOCUS_06170 24830 26053 gene locus_tag LOCUS_06180 24830 26053 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_06180 26062 27237 gene locus_tag LOCUS_06190 26062 27237 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584101.1 protein_id gnl|my_center|LOCUS_06190 27367 28221 gene locus_tag LOCUS_06200 27367 28221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06200 28194 29252 gene locus_tag LOCUS_06210 28194 29252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06210 29256 29618 gene locus_tag LOCUS_06220 29256 29618 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889198.1 protein_id gnl|my_center|LOCUS_06220 30450 29833 gene locus_tag LOCUS_06230 gene sigK 30450 29833 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964996.1 protein_id gnl|my_center|LOCUS_06230 30784 32319 gene locus_tag LOCUS_06240 30784 32319 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_06240 32378 33400 gene locus_tag LOCUS_06250 gene dprA 32378 33400 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813280.1 protein_id gnl|my_center|LOCUS_06250 33468 35558 gene locus_tag LOCUS_06260 gene topA 33468 35558 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_06260 35686 36465 gene locus_tag LOCUS_06270 gene codY 35686 36465 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362579.1 protein_id gnl|my_center|LOCUS_06270 36668 36982 gene locus_tag LOCUS_06280 36668 36982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 37218 37505 gene locus_tag LOCUS_06290 37218 37505 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_06290 37643 39268 gene locus_tag LOCUS_06300 gene groL 37643 39268 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435012.1 protein_id gnl|my_center|LOCUS_06300 39468 40922 gene locus_tag LOCUS_06310 gene guaB 39468 40922 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965988.1 protein_id gnl|my_center|LOCUS_06310 41221 41934 gene locus_tag LOCUS_06320 41221 41934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 41995 42507 gene locus_tag LOCUS_06330 41995 42507 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942669.1 protein_id gnl|my_center|LOCUS_06330 42510 43031 gene locus_tag LOCUS_06340 42510 43031 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583237.1 protein_id gnl|my_center|LOCUS_06340 43122 43679 gene locus_tag LOCUS_06350 gene efp 43122 43679 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_06350 43930 44868 gene locus_tag LOCUS_06360 43930 44868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 45124 45196 gene locus_tag LOCUS_t00040 45124 45196 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 45342 47108 gene locus_tag LOCUS_06370 gene argS 45342 47108 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_06370 47139 48311 gene locus_tag LOCUS_06380 47139 48311 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964224.1 protein_id gnl|my_center|LOCUS_06380 48304 49182 gene locus_tag LOCUS_06390 48304 49182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 49354 53889 gene locus_tag LOCUS_06400 gene gltB 49354 53889 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_06400 53902 55401 gene locus_tag LOCUS_06410 53902 55401 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_06410 55639 56820 gene locus_tag LOCUS_06420 55639 56820 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722638.1 protein_id gnl|my_center|LOCUS_06420 57091 56870 gene locus_tag LOCUS_06430 57091 56870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 57350 56988 gene locus_tag LOCUS_06440 57350 56988 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462292.1 protein_id gnl|my_center|LOCUS_06440 57612 58346 gene locus_tag LOCUS_06450 gene rpsB 57612 58346 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_06450 58455 59375 gene locus_tag LOCUS_06460 gene tsf 58455 59375 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_06460 59573 60022 gene locus_tag LOCUS_06470 59573 60022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 60864 60025 gene locus_tag LOCUS_06480 gene pdaA 60864 60025 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438596.1 protein_id gnl|my_center|LOCUS_06480 61019 61810 gene locus_tag LOCUS_06490 61019 61810 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_06490 62846 61977 gene locus_tag LOCUS_06500 62846 61977 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725703.1 protein_id gnl|my_center|LOCUS_06500 63948 62884 gene locus_tag LOCUS_06510 gene aroB 63948 62884 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893310.1 protein_id gnl|my_center|LOCUS_06510 65172 64159 gene locus_tag LOCUS_06520 gene aroF 65172 64159 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_06520 65420 66127 gene locus_tag LOCUS_06530 gene pyrH 65420 66127 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_06530 66165 66716 gene locus_tag LOCUS_06540 gene frr 66165 66716 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_06540 66742 67458 gene locus_tag LOCUS_06550 66742 67458 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424529.1 protein_id gnl|my_center|LOCUS_06550 67451 68263 gene locus_tag LOCUS_06560 67451 68263 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_06560 68405 69553 gene locus_tag LOCUS_06570 68405 69553 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_06570 69577 70611 gene locus_tag LOCUS_06580 gene rseP 69577 70611 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_06580 70689 71963 gene locus_tag LOCUS_06590 gene sleC 70689 71963 CDS product spore cortex-lytic germination protein SleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425119.1 protein_id gnl|my_center|LOCUS_06590 72470 72144 gene locus_tag LOCUS_06600 72470 72144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 72937 74007 gene locus_tag LOCUS_06610 gene carA 72937 74007 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_06610 74007 77210 gene locus_tag LOCUS_06620 gene carB 74007 77210 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_06620 77551 78447 gene locus_tag LOCUS_06630 77551 78447 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_06630 78495 79157 gene locus_tag LOCUS_06640 78495 79157 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_06640 79324 86991 gene locus_tag LOCUS_06650 79324 86991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 87205 88101 gene locus_tag LOCUS_06660 87205 88101 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681080.1 protein_id gnl|my_center|LOCUS_06660 88361 89116 gene locus_tag LOCUS_06670 88361 89116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 89118 89561 gene locus_tag LOCUS_06680 89118 89561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 89522 90754 gene locus_tag LOCUS_06690 89522 90754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 90735 90935 gene locus_tag LOCUS_06700 90735 90935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 90984 92579 gene locus_tag LOCUS_06710 90984 92579 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_06710 92497 93495 gene locus_tag LOCUS_06720 92497 93495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 93655 94791 gene locus_tag LOCUS_06730 gene mglB 93655 94791 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816741.1 protein_id gnl|my_center|LOCUS_06730 94884 96395 gene locus_tag LOCUS_06740 gene mglA 94884 96395 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707761.1 protein_id gnl|my_center|LOCUS_06740 96412 97482 gene locus_tag LOCUS_06750 gene mglC 96412 97482 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016955.1 protein_id gnl|my_center|LOCUS_06750 97528 97869 gene locus_tag LOCUS_06760 97528 97869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 98072 98905 gene locus_tag LOCUS_06770 98072 98905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 99045 100520 gene locus_tag LOCUS_06780 gene malQ 99045 100520 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 protein_id gnl|my_center|LOCUS_06780 101602 100679 gene locus_tag LOCUS_06790 101602 100679 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_06790 101935 102162 gene locus_tag LOCUS_06800 101935 102162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 102159 104204 gene locus_tag LOCUS_06810 gene feoB 102159 104204 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065727.1 protein_id gnl|my_center|LOCUS_06810 >Feature sequence007 554 162 gene locus_tag LOCUS_06820 554 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 681 1571 gene locus_tag LOCUS_06830 681 1571 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421915.1 protein_id gnl|my_center|LOCUS_06830 2111 1626 gene locus_tag LOCUS_06840 2111 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 2422 5712 gene locus_tag LOCUS_06850 2422 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 5727 7010 gene locus_tag LOCUS_06860 5727 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 6985 7752 gene locus_tag LOCUS_06870 6985 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 7987 9414 gene locus_tag LOCUS_06880 gene purF 7987 9414 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461475.1 protein_id gnl|my_center|LOCUS_06880 9453 10892 gene locus_tag LOCUS_06890 gene purB 9453 10892 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_06890 10937 12406 gene locus_tag LOCUS_06900 gene gltX 10937 12406 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_06900 12480 14321 gene locus_tag LOCUS_06910 12480 14321 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_06910 14642 14298 gene locus_tag LOCUS_06920 14642 14298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 14929 16929 gene locus_tag LOCUS_06930 gene glgX 14929 16929 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766232.1 protein_id gnl|my_center|LOCUS_06930 17045 17629 gene locus_tag LOCUS_06940 17045 17629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 18089 17598 gene locus_tag LOCUS_06950 18089 17598 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_06950 18174 18818 gene locus_tag LOCUS_06960 gene phoE 18174 18818 CDS product phosphatase PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233157.1 protein_id gnl|my_center|LOCUS_06960 20600 18933 gene locus_tag LOCUS_06970 20600 18933 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633864.1 protein_id gnl|my_center|LOCUS_06970 20793 22991 gene locus_tag LOCUS_06980 20793 22991 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421678.1 protein_id gnl|my_center|LOCUS_06980 23078 24127 gene locus_tag LOCUS_06990 23078 24127 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405591.1 protein_id gnl|my_center|LOCUS_06990 24186 26243 gene locus_tag LOCUS_07000 24186 26243 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_07000 26334 27008 gene locus_tag LOCUS_07010 26334 27008 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_07010 27040 27846 gene locus_tag LOCUS_07020 27040 27846 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964639.1 protein_id gnl|my_center|LOCUS_07020 28054 28707 gene locus_tag LOCUS_07030 28054 28707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 29231 30334 gene locus_tag LOCUS_07040 gene recA 29231 30334 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_07040 30362 30976 gene locus_tag LOCUS_07050 30362 30976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 31060 32616 gene locus_tag LOCUS_07060 gene rny 31060 32616 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986783.1 protein_id gnl|my_center|LOCUS_07060 32746 33366 gene locus_tag LOCUS_07070 32746 33366 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194850.1 protein_id gnl|my_center|LOCUS_07070 33435 33986 gene locus_tag LOCUS_07080 33435 33986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 35419 34097 gene locus_tag LOCUS_07090 35419 34097 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888874.1 protein_id gnl|my_center|LOCUS_07090 35612 36070 gene locus_tag LOCUS_07100 35612 36070 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_07100 36088 37272 gene locus_tag LOCUS_07110 gene nifS 36088 37272 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_07110 37295 37738 gene locus_tag LOCUS_07120 gene nifU 37295 37738 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 protein_id gnl|my_center|LOCUS_07120 37738 38808 gene locus_tag LOCUS_07130 gene mnmA 37738 38808 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_07130 38805 39620 gene locus_tag LOCUS_07140 38805 39620 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_07140 39828 40841 gene locus_tag LOCUS_07150 gene gap 39828 40841 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_07150 40997 42190 gene locus_tag LOCUS_07160 40997 42190 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_07160 42262 43011 gene locus_tag LOCUS_07170 gene tpiA 42262 43011 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_07170 43249 43013 gene locus_tag LOCUS_07180 43249 43013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 43550 45088 gene locus_tag LOCUS_07190 gene gpmI 43550 45088 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_07190 45406 46116 gene locus_tag LOCUS_07200 45406 46116 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432043.1 protein_id gnl|my_center|LOCUS_07200 46118 47392 gene locus_tag LOCUS_07210 46118 47392 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027623.1 protein_id gnl|my_center|LOCUS_07210 47467 47550 gene locus_tag LOCUS_t00050 47467 47550 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 47767 49503 gene locus_tag LOCUS_07220 47767 49503 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995243.1 protein_id gnl|my_center|LOCUS_07220 49500 51158 gene locus_tag LOCUS_07230 gene cydC 49500 51158 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667625.1 protein_id gnl|my_center|LOCUS_07230 51180 51617 gene locus_tag LOCUS_07240 51180 51617 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237004.1 protein_id gnl|my_center|LOCUS_07240 51623 52609 gene locus_tag LOCUS_07250 51623 52609 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_07250 52732 53427 gene locus_tag LOCUS_07260 52732 53427 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027099.1 protein_id gnl|my_center|LOCUS_07260 54132 53515 gene locus_tag LOCUS_07270 54132 53515 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903260.1 protein_id gnl|my_center|LOCUS_07270 54304 56919 gene locus_tag LOCUS_07280 gene polA 54304 56919 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_07280 56920 57501 gene locus_tag LOCUS_07290 gene coaE 56920 57501 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881297.1 protein_id gnl|my_center|LOCUS_07290 57498 58295 gene locus_tag LOCUS_07300 57498 58295 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048403.1 protein_id gnl|my_center|LOCUS_07300 58320 58592 gene locus_tag LOCUS_07310 58320 58592 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_07310 58638 60002 gene locus_tag LOCUS_07320 58638 60002 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_07320 60028 60894 gene locus_tag LOCUS_07330 60028 60894 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228320.1 protein_id gnl|my_center|LOCUS_07330 62325 60997 gene locus_tag LOCUS_07340 62325 60997 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388463.1 protein_id gnl|my_center|LOCUS_07340 62595 63947 gene locus_tag LOCUS_07350 gene mgtE 62595 63947 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_07350 64089 65084 gene locus_tag LOCUS_07360 gene pta 64089 65084 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_07360 65193 66383 gene locus_tag LOCUS_07370 gene ackA 65193 66383 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_07370 66534 67061 gene locus_tag LOCUS_07380 66534 67061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 67065 67244 gene locus_tag LOCUS_07390 gene rpmF 67065 67244 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_07390 67435 68793 gene locus_tag LOCUS_07400 67435 68793 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_07400 68912 69937 gene locus_tag LOCUS_07410 gene plsX 68912 69937 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_07410 70006 70236 gene locus_tag LOCUS_07420 gene acpP 70006 70236 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_07420 70301 70999 gene locus_tag LOCUS_07430 gene rncS 70301 70999 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_07430 71044 74604 gene locus_tag LOCUS_07440 gene smc 71044 74604 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_07440 74622 75551 gene locus_tag LOCUS_07450 74622 75551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 75579 76802 gene locus_tag LOCUS_07460 gene ilvA 75579 76802 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_07460 78047 76878 gene locus_tag LOCUS_07470 78047 76878 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_07470 78225 79538 gene locus_tag LOCUS_07480 78225 79538 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_07480 79660 80988 gene locus_tag LOCUS_07490 gene der 79660 80988 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_07490 80993 81634 gene locus_tag LOCUS_07500 gene plsY 80993 81634 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931787.1 protein_id gnl|my_center|LOCUS_07500 81680 82699 gene locus_tag LOCUS_07510 81680 82699 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_07510 82960 84432 gene locus_tag LOCUS_07520 gene spoIVA 82960 84432 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_07520 84395 84667 gene locus_tag LOCUS_07530 84395 84667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 84693 85514 gene locus_tag LOCUS_07540 84693 85514 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723600.1 protein_id gnl|my_center|LOCUS_07540 85539 86846 gene locus_tag LOCUS_07550 85539 86846 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_07550 86920 87405 gene locus_tag LOCUS_07560 gene rnhA 86920 87405 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705464.1 protein_id gnl|my_center|LOCUS_07560 88290 87847 gene locus_tag LOCUS_07570 88290 87847 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_07570 89227 88307 gene locus_tag LOCUS_07580 gene pyrB 89227 88307 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_07580 89788 89252 gene locus_tag LOCUS_07590 89788 89252 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_07590 90080 91243 gene locus_tag LOCUS_07600 gene pheA 90080 91243 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_07600 91277 92569 gene locus_tag LOCUS_07610 91277 92569 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_07610 92689 93516 gene locus_tag LOCUS_07620 92689 93516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 95372 93636 gene locus_tag LOCUS_07630 95372 93636 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_07630 95840 96718 gene locus_tag LOCUS_07640 95840 96718 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_07640 96781 97419 gene locus_tag LOCUS_07650 gene gmk 96781 97419 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257738.1 protein_id gnl|my_center|LOCUS_07650 97440 97808 gene locus_tag LOCUS_07660 97440 97808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 97907 99232 gene locus_tag LOCUS_07670 gene rimO 97907 99232 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_07670 99229 99771 gene locus_tag LOCUS_07680 gene pgsA 99229 99771 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_07680 99916 100608 gene locus_tag LOCUS_07690 99916 100608 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_07690 100629 101639 gene locus_tag LOCUS_07700 100629 101639 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence008 297 659 gene locus_tag LOCUS_07710 297 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 673 1125 gene locus_tag LOCUS_07720 673 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 1122 1358 gene locus_tag LOCUS_07730 1122 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 1358 1621 gene locus_tag LOCUS_07740 1358 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 1654 2412 gene locus_tag LOCUS_07750 1654 2412 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821961.1 protein_id gnl|my_center|LOCUS_07750 2552 2809 gene locus_tag LOCUS_07760 2552 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 2890 3120 gene locus_tag LOCUS_07770 2890 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 3257 4090 gene locus_tag LOCUS_07780 3257 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 4094 4384 gene locus_tag LOCUS_07790 4094 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 4653 4853 gene locus_tag LOCUS_07800 4653 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 5033 5269 gene locus_tag LOCUS_07810 5033 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 5294 5563 gene locus_tag LOCUS_07820 5294 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 5577 6104 gene locus_tag LOCUS_07830 5577 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 6563 7888 gene locus_tag LOCUS_07840 6563 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 7981 8760 gene locus_tag LOCUS_07850 7981 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 8820 8894 gene locus_tag LOCUS_t00060 8820 8894 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9216 9293 gene locus_tag LOCUS_t00070 9216 9293 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9562 9744 gene locus_tag LOCUS_07860 9562 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 9741 9992 gene locus_tag LOCUS_07870 9741 9992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 9994 10173 gene locus_tag LOCUS_07880 9994 10173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 10262 10567 gene locus_tag LOCUS_07890 10262 10567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 10574 11770 gene locus_tag LOCUS_07900 10574 11770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 11869 12105 gene locus_tag LOCUS_07910 11869 12105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 12122 13327 gene locus_tag LOCUS_07920 12122 13327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 13340 14437 gene locus_tag LOCUS_07930 13340 14437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 14437 14916 gene locus_tag LOCUS_07940 14437 14916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 14921 16468 gene locus_tag LOCUS_07950 14921 16468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 16661 17491 gene locus_tag LOCUS_07960 16661 17491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 17492 18289 gene locus_tag LOCUS_07970 17492 18289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 18293 21442 gene locus_tag LOCUS_07980 18293 21442 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_07980 21553 21975 gene locus_tag LOCUS_07990 21553 21975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 22656 23525 gene locus_tag LOCUS_08000 22656 23525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 23529 23693 gene locus_tag LOCUS_08010 23529 23693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 23674 23949 gene locus_tag LOCUS_08020 23674 23949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 23953 24126 gene locus_tag LOCUS_08030 23953 24126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 24119 24754 gene locus_tag LOCUS_08040 24119 24754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021681.1 protein_id gnl|my_center|LOCUS_08040 24895 25146 gene locus_tag LOCUS_08050 24895 25146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 25156 25398 gene locus_tag LOCUS_08060 25156 25398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 25382 25573 gene locus_tag LOCUS_08070 25382 25573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 25602 26132 gene locus_tag LOCUS_08080 25602 26132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 26129 26695 gene locus_tag LOCUS_08090 26129 26695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 26695 26901 gene locus_tag LOCUS_08100 26695 26901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 26898 27560 gene locus_tag LOCUS_08110 26898 27560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 27601 28404 gene locus_tag LOCUS_08120 27601 28404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 28606 29688 gene locus_tag LOCUS_08130 28606 29688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 29681 30154 gene locus_tag LOCUS_08140 29681 30154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 30151 30606 gene locus_tag LOCUS_08150 gene dutA 30151 30606 CDS product dUTP diphosphatase DutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245820.1 protein_id gnl|my_center|LOCUS_08150 30790 32436 gene locus_tag LOCUS_08160 30790 32436 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108806778.1 protein_id gnl|my_center|LOCUS_08160 32915 32496 gene locus_tag LOCUS_08170 32915 32496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 33320 32925 gene locus_tag LOCUS_08180 33320 32925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 33524 33336 gene locus_tag LOCUS_08190 33524 33336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 34435 33620 gene locus_tag LOCUS_08200 34435 33620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 35477 34440 gene locus_tag LOCUS_08210 35477 34440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 36379 35549 gene locus_tag LOCUS_08220 36379 35549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 37099 36701 gene locus_tag LOCUS_08230 37099 36701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 37398 37096 gene locus_tag LOCUS_08240 37398 37096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 37864 37403 gene locus_tag LOCUS_08250 37864 37403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 39158 38232 gene locus_tag LOCUS_08260 39158 38232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 39649 39158 gene locus_tag LOCUS_08270 39649 39158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 40550 39660 gene locus_tag LOCUS_08280 40550 39660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 41096 40563 gene locus_tag LOCUS_08290 41096 40563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 41524 41111 gene locus_tag LOCUS_08300 41524 41111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 41894 41529 gene locus_tag LOCUS_08310 41894 41529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 42772 42050 gene locus_tag LOCUS_08320 42772 42050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 45709 42776 gene locus_tag LOCUS_08330 45709 42776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 46496 45714 gene locus_tag LOCUS_08340 46496 45714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 52589 46668 gene locus_tag LOCUS_08350 52589 46668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 53095 52586 gene locus_tag LOCUS_08360 53095 52586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 53681 53046 gene locus_tag LOCUS_08370 53681 53046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 54938 53715 gene locus_tag LOCUS_08380 54938 53715 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882756.1 protein_id gnl|my_center|LOCUS_08380 55566 54940 gene locus_tag LOCUS_08390 55566 54940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 56061 55585 gene locus_tag LOCUS_08400 56061 55585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 56300 56052 gene locus_tag LOCUS_08410 56300 56052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 56782 56471 gene locus_tag LOCUS_08420 56782 56471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 57606 56782 gene locus_tag LOCUS_08430 57606 56782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 58354 57623 gene locus_tag LOCUS_08440 58354 57623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 58838 58335 gene locus_tag LOCUS_08450 58838 58335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 59557 58838 gene locus_tag LOCUS_08460 59557 58838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 59858 59550 gene locus_tag LOCUS_08470 59858 59550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 60303 59869 gene locus_tag LOCUS_08480 60303 59869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 60962 60315 gene locus_tag LOCUS_08490 60962 60315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 62034 61021 gene locus_tag LOCUS_08500 62034 61021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 62579 62061 gene locus_tag LOCUS_08510 62579 62061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 64081 62585 gene locus_tag LOCUS_08520 64081 62585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 64296 64096 gene locus_tag LOCUS_08530 64296 64096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 65858 64362 gene locus_tag LOCUS_08540 65858 64362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 67535 65874 gene locus_tag LOCUS_08550 67535 65874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 68685 67525 gene locus_tag LOCUS_08560 68685 67525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 69035 68715 gene locus_tag LOCUS_08570 69035 68715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 70106 69042 gene locus_tag LOCUS_08580 70106 69042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 70984 70118 gene locus_tag LOCUS_08590 70984 70118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 72290 71280 gene locus_tag LOCUS_08600 72290 71280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 73490 72294 gene locus_tag LOCUS_08610 73490 72294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 74480 73782 gene locus_tag LOCUS_08620 74480 73782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 75143 74865 gene locus_tag LOCUS_08630 75143 74865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 76946 75429 gene locus_tag LOCUS_08640 76946 75429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 77606 77280 gene locus_tag LOCUS_08650 77606 77280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 77897 77607 gene locus_tag LOCUS_08660 77897 77607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 78245 77901 gene locus_tag LOCUS_08670 78245 77901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 78641 78348 gene locus_tag LOCUS_08680 78641 78348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 79356 78907 gene locus_tag LOCUS_08690 79356 78907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 79762 79388 gene locus_tag LOCUS_08700 79762 79388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 79997 79740 gene locus_tag LOCUS_08710 79997 79740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 80336 80007 gene locus_tag LOCUS_08720 80336 80007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 80526 80326 gene locus_tag LOCUS_08730 80526 80326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 80716 80501 gene locus_tag LOCUS_08740 80716 80501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 81010 80777 gene locus_tag LOCUS_08750 81010 80777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 81357 81007 gene locus_tag LOCUS_08760 81357 81007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 81712 81350 gene locus_tag LOCUS_08770 81712 81350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 82173 81709 gene locus_tag LOCUS_08780 82173 81709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 82436 82170 gene locus_tag LOCUS_08790 82436 82170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 82840 82433 gene locus_tag LOCUS_08800 82840 82433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 83070 82837 gene locus_tag LOCUS_08810 83070 82837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 83390 83067 gene locus_tag LOCUS_08820 83390 83067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 83553 83383 gene locus_tag LOCUS_08830 83553 83383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 83897 83553 gene locus_tag LOCUS_08840 83897 83553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 85308 84058 gene locus_tag LOCUS_08850 85308 84058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 86576 87331 gene locus_tag LOCUS_08860 86576 87331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 87842 88585 gene locus_tag LOCUS_08870 87842 88585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 88935 89120 gene locus_tag LOCUS_08880 88935 89120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 89172 89561 gene locus_tag LOCUS_08890 89172 89561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 89691 89885 gene locus_tag LOCUS_08900 89691 89885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 89898 90116 gene locus_tag LOCUS_08910 89898 90116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 90141 90296 gene locus_tag LOCUS_08920 90141 90296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 90430 90621 gene locus_tag LOCUS_08930 90430 90621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 90641 90967 gene locus_tag LOCUS_08940 90641 90967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 90968 91201 gene locus_tag LOCUS_08950 90968 91201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 91198 91551 gene locus_tag LOCUS_08960 91198 91551 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812625.1 protein_id gnl|my_center|LOCUS_08960 91535 91810 gene locus_tag LOCUS_08970 91535 91810 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812628.1 protein_id gnl|my_center|LOCUS_08970 92042 92317 gene locus_tag LOCUS_08980 92042 92317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 92341 92532 gene locus_tag LOCUS_08990 92341 92532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 92547 93320 gene locus_tag LOCUS_09000 92547 93320 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861779.1 protein_id gnl|my_center|LOCUS_09000 93363 93872 gene locus_tag LOCUS_09010 93363 93872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 94028 94687 gene locus_tag LOCUS_09020 94028 94687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 94690 94818 gene locus_tag LOCUS_09030 94690 94818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 94832 95107 gene locus_tag LOCUS_09040 94832 95107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 95121 95804 gene locus_tag LOCUS_09050 95121 95804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 95819 96100 gene locus_tag LOCUS_09060 95819 96100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 96097 96597 gene locus_tag LOCUS_09070 96097 96597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 96597 96959 gene locus_tag LOCUS_09080 96597 96959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 96963 97136 gene locus_tag LOCUS_09090 96963 97136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 97143 97634 gene locus_tag LOCUS_09100 97143 97634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 97638 97913 gene locus_tag LOCUS_09110 97638 97913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 97918 98334 gene locus_tag LOCUS_09120 97918 98334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 98335 98559 gene locus_tag LOCUS_09130 98335 98559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 98480 98665 gene locus_tag LOCUS_09140 98480 98665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 98679 98954 gene locus_tag LOCUS_09150 98679 98954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence009 988 110 gene locus_tag LOCUS_09160 988 110 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485364.1 protein_id gnl|my_center|LOCUS_09160 1652 993 gene locus_tag LOCUS_09170 1652 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 2717 1653 gene locus_tag LOCUS_09180 2717 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 3980 2799 gene locus_tag LOCUS_09190 3980 2799 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021366129.1 protein_id gnl|my_center|LOCUS_09190 4642 3968 gene locus_tag LOCUS_09200 4642 3968 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860834.1 protein_id gnl|my_center|LOCUS_09200 4984 4841 gene locus_tag LOCUS_09210 4984 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 5553 5275 gene locus_tag LOCUS_09220 5553 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 6632 5706 gene locus_tag LOCUS_09230 6632 5706 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 protein_id gnl|my_center|LOCUS_09230 7493 6768 gene locus_tag LOCUS_09240 7493 6768 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966072.1 protein_id gnl|my_center|LOCUS_09240 8396 7686 gene locus_tag LOCUS_09250 8396 7686 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459753.1 protein_id gnl|my_center|LOCUS_09250 8739 8575 gene locus_tag LOCUS_09260 8739 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 9428 10807 gene locus_tag LOCUS_09270 9428 10807 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_09270 11044 12396 gene locus_tag LOCUS_09280 11044 12396 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_09280 14038 12494 gene locus_tag LOCUS_09290 14038 12494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 14406 14038 gene locus_tag LOCUS_09300 14406 14038 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814133.1 protein_id gnl|my_center|LOCUS_09300 15539 14814 gene locus_tag LOCUS_09310 15539 14814 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232924.1 protein_id gnl|my_center|LOCUS_09310 16584 15514 gene locus_tag LOCUS_09320 16584 15514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 17690 16587 gene locus_tag LOCUS_09330 17690 16587 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_09330 19215 17683 gene locus_tag LOCUS_09340 19215 17683 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_09340 20630 19395 gene locus_tag LOCUS_09350 20630 19395 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_09350 21197 24263 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccacgctcccacaaggggagcgac 24734 24444 gene locus_tag LOCUS_09360 gene cas2 24734 24444 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_09360 25848 24817 gene locus_tag LOCUS_09370 gene cas1c 25848 24817 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932802.1 protein_id gnl|my_center|LOCUS_09370 26506 25850 gene locus_tag LOCUS_09380 gene cas4 26506 25850 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_09380 27355 26510 gene locus_tag LOCUS_09390 gene cas7c 27355 26510 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 protein_id gnl|my_center|LOCUS_09390 29228 27348 gene locus_tag LOCUS_09400 gene cas8c 29228 27348 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922511.1 protein_id gnl|my_center|LOCUS_09400 29954 29229 gene locus_tag LOCUS_09410 gene cas5c 29954 29229 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205009051.1 protein_id gnl|my_center|LOCUS_09410 32399 29964 gene locus_tag LOCUS_09420 32399 29964 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263668.1 protein_id gnl|my_center|LOCUS_09420 32684 32514 gene locus_tag LOCUS_09430 32684 32514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 33605 32760 gene locus_tag LOCUS_09440 33605 32760 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943396.1 protein_id gnl|my_center|LOCUS_09440 33906 33619 gene locus_tag LOCUS_09450 33906 33619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 34163 33975 gene locus_tag LOCUS_09460 34163 33975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 34312 34178 gene locus_tag LOCUS_09470 34312 34178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 35860 34466 gene locus_tag LOCUS_09480 gene rlmD 35860 34466 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861959.1 protein_id gnl|my_center|LOCUS_09480 36850 35909 gene locus_tag LOCUS_09490 36850 35909 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_09490 38271 36991 gene locus_tag LOCUS_09500 38271 36991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 38734 41109 gene locus_tag LOCUS_09510 38734 41109 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_09510 41140 41850 gene locus_tag LOCUS_09520 41140 41850 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_09520 41862 43295 gene locus_tag LOCUS_09530 41862 43295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 44804 43449 gene locus_tag LOCUS_09540 44804 43449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 45271 45441 gene locus_tag LOCUS_09550 45271 45441 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_09550 45590 46324 gene locus_tag LOCUS_09560 45590 46324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 47870 46524 gene locus_tag LOCUS_09570 47870 46524 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048440.1 protein_id gnl|my_center|LOCUS_09570 48350 47901 gene locus_tag LOCUS_09580 gene rplI 48350 47901 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_09580 50417 48372 gene locus_tag LOCUS_09590 50417 48372 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_09590 50932 50666 gene locus_tag LOCUS_09600 gene rpsR 50932 50666 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_09600 51430 50981 gene locus_tag LOCUS_09610 gene ssb 51430 50981 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359348.1 protein_id gnl|my_center|LOCUS_09610 51732 51445 gene locus_tag LOCUS_09620 gene rpsF 51732 51445 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_09620 52079 51891 gene locus_tag LOCUS_09630 52079 51891 CDS product DUF951 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226838.1 protein_id gnl|my_center|LOCUS_09630 53230 52082 gene locus_tag LOCUS_09640 53230 52082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 54177 53302 gene locus_tag LOCUS_09650 54177 53302 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593361.1 protein_id gnl|my_center|LOCUS_09650 54383 54311 gene locus_tag LOCUS_t00080 54383 54311 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 54459 54388 gene locus_tag LOCUS_t00090 54459 54388 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 55587 54661 gene locus_tag LOCUS_09660 gene cysK 55587 54661 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393469.1 protein_id gnl|my_center|LOCUS_09660 55738 55666 gene locus_tag LOCUS_t00100 55738 55666 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 55857 55784 gene locus_tag LOCUS_t00110 55857 55784 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 56877 56059 gene locus_tag LOCUS_09670 56877 56059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 58110 56917 gene locus_tag LOCUS_09680 58110 56917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 59494 58247 gene locus_tag LOCUS_09690 59494 58247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 60731 59793 gene locus_tag LOCUS_09700 60731 59793 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_09700 61555 60719 gene locus_tag LOCUS_09710 61555 60719 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_09710 62319 61723 gene locus_tag LOCUS_09720 gene recR 62319 61723 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359478.1 protein_id gnl|my_center|LOCUS_09720 62699 62346 gene locus_tag LOCUS_09730 62699 62346 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_09730 64307 62703 gene locus_tag LOCUS_09740 64307 62703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 65433 64357 gene locus_tag LOCUS_09750 65433 64357 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_09750 68170 65645 gene locus_tag LOCUS_09760 68170 65645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 70846 68186 gene locus_tag LOCUS_09770 70846 68186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 71965 70862 gene locus_tag LOCUS_09780 71965 70862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 72297 73619 gene locus_tag LOCUS_09790 72297 73619 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462038.1 protein_id gnl|my_center|LOCUS_09790 73655 74518 gene locus_tag LOCUS_09800 73655 74518 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430012.1 protein_id gnl|my_center|LOCUS_09800 75210 74614 gene locus_tag LOCUS_09810 75210 74614 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_09810 75918 75379 gene locus_tag LOCUS_09820 75918 75379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 76789 75935 gene locus_tag LOCUS_09830 76789 75935 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797836.1 protein_id gnl|my_center|LOCUS_09830 77190 76897 gene locus_tag LOCUS_09840 77190 76897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 77794 77210 gene locus_tag LOCUS_09850 77794 77210 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_09850 78540 77875 gene locus_tag LOCUS_09860 78540 77875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 79305 79039 gene locus_tag LOCUS_09870 79305 79039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 81154 79385 gene locus_tag LOCUS_09880 81154 79385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 82016 81420 gene locus_tag LOCUS_09890 82016 81420 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896752.1 protein_id gnl|my_center|LOCUS_09890 83535 82123 gene locus_tag LOCUS_09900 83535 82123 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080375.1 protein_id gnl|my_center|LOCUS_09900 84214 83522 gene locus_tag LOCUS_09910 84214 83522 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080380.1 protein_id gnl|my_center|LOCUS_09910 84638 84204 gene locus_tag LOCUS_09920 84638 84204 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392860.1 protein_id gnl|my_center|LOCUS_09920 85007 84651 gene locus_tag LOCUS_09930 85007 84651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 86029 85310 gene locus_tag LOCUS_09940 86029 85310 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722035.1 protein_id gnl|my_center|LOCUS_09940 87530 86022 gene locus_tag LOCUS_09950 87530 86022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 87947 88165 gene locus_tag LOCUS_09960 87947 88165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 88798 88310 gene locus_tag LOCUS_09970 88798 88310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 89571 88807 gene locus_tag LOCUS_09980 89571 88807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 89901 89713 gene locus_tag LOCUS_09990 89901 89713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 90524 90111 gene locus_tag LOCUS_10000 90524 90111 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272575.1 protein_id gnl|my_center|LOCUS_10000 91570 90524 gene locus_tag LOCUS_10010 gene arsB 91570 90524 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462028.1 protein_id gnl|my_center|LOCUS_10010 91890 91585 gene locus_tag LOCUS_10020 91890 91585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 92993 91998 gene locus_tag LOCUS_10030 92993 91998 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462034.1 protein_id gnl|my_center|LOCUS_10030 93449 93120 gene locus_tag LOCUS_10040 93449 93120 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948466.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence010 344 490 gene locus_tag LOCUS_10050 344 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 624 1229 gene locus_tag LOCUS_10060 624 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1400 1954 gene locus_tag LOCUS_10070 1400 1954 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459288.1 protein_id gnl|my_center|LOCUS_10070 1941 2291 gene locus_tag LOCUS_10080 1941 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 2281 2895 gene locus_tag LOCUS_10090 2281 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 2892 3533 gene locus_tag LOCUS_10100 2892 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 3690 3989 gene locus_tag LOCUS_10110 3690 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 4006 9894 gene locus_tag LOCUS_10120 4006 9894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 10318 10770 gene locus_tag LOCUS_10130 10318 10770 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_10130 15327 10993 gene locus_tag LOCUS_10140 15327 10993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 15595 16158 gene locus_tag LOCUS_10150 15595 16158 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424276.1 protein_id gnl|my_center|LOCUS_10150 16348 17745 gene locus_tag LOCUS_10160 16348 17745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 17738 23596 gene locus_tag LOCUS_10170 17738 23596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 24184 27339 gene locus_tag LOCUS_10180 gene ileS 24184 27339 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_10180 27342 29804 gene locus_tag LOCUS_10190 27342 29804 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_10190 29887 30600 gene locus_tag LOCUS_10200 29887 30600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 30719 31720 gene locus_tag LOCUS_10210 gene spoIID 30719 31720 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672623.1 protein_id gnl|my_center|LOCUS_10210 31765 32535 gene locus_tag LOCUS_10220 31765 32535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 32763 33044 gene locus_tag LOCUS_10230 32763 33044 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394408.1 protein_id gnl|my_center|LOCUS_10230 33041 33199 gene locus_tag LOCUS_10240 33041 33199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 33780 33385 gene locus_tag LOCUS_10250 33780 33385 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_10250 34453 33911 gene locus_tag LOCUS_10260 34453 33911 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_10260 34753 35964 gene locus_tag LOCUS_10270 34753 35964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 36518 36727 gene locus_tag LOCUS_10280 36518 36727 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_10280 37605 36874 gene locus_tag LOCUS_10290 37605 36874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 37820 37620 gene locus_tag LOCUS_10300 37820 37620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 38215 38499 gene locus_tag LOCUS_10310 38215 38499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 38643 40502 gene locus_tag LOCUS_10320 38643 40502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 40603 41421 gene locus_tag LOCUS_10330 40603 41421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 41462 43006 gene locus_tag LOCUS_10340 41462 43006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 42999 43487 gene locus_tag LOCUS_10350 42999 43487 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_10350 43718 43927 gene locus_tag LOCUS_10360 43718 43927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 44353 45297 gene locus_tag LOCUS_10370 44353 45297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 45290 46501 gene locus_tag LOCUS_10380 45290 46501 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_10380 46509 47204 gene locus_tag LOCUS_10390 46509 47204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 47267 48568 gene locus_tag LOCUS_10400 47267 48568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 48702 48932 gene locus_tag LOCUS_10410 48702 48932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 48933 50270 gene locus_tag LOCUS_10420 48933 50270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 50366 51163 gene locus_tag LOCUS_10430 50366 51163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 51151 51585 gene locus_tag LOCUS_10440 51151 51585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 51582 52052 gene locus_tag LOCUS_10450 51582 52052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 52055 52894 gene locus_tag LOCUS_10460 52055 52894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 53102 53710 gene locus_tag LOCUS_10470 53102 53710 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254484.1 protein_id gnl|my_center|LOCUS_10470 54445 53714 gene locus_tag LOCUS_10480 54445 53714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 54807 55226 gene locus_tag LOCUS_10490 54807 55226 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723834.1 protein_id gnl|my_center|LOCUS_10490 55231 55797 gene locus_tag LOCUS_10500 gene ylaC 55231 55797 CDS product RNA polymerase sigma factor YlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245485.1 protein_id gnl|my_center|LOCUS_10500 56938 55871 gene locus_tag LOCUS_10510 56938 55871 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_10510 57039 57977 gene locus_tag LOCUS_10520 57039 57977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 58049 58519 gene locus_tag LOCUS_10530 58049 58519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 59068 58826 gene locus_tag LOCUS_10540 59068 58826 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_10540 59514 60569 gene locus_tag LOCUS_10550 59514 60569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 60642 61991 gene locus_tag LOCUS_10560 60642 61991 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435635.1 protein_id gnl|my_center|LOCUS_10560 62030 62701 gene locus_tag LOCUS_10570 62030 62701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 62932 65199 gene locus_tag LOCUS_10580 62932 65199 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_10580 65400 65924 gene locus_tag LOCUS_10590 65400 65924 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896616.1 protein_id gnl|my_center|LOCUS_10590 65976 67994 gene locus_tag LOCUS_10600 65976 67994 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271984.1 protein_id gnl|my_center|LOCUS_10600 68003 68809 gene locus_tag LOCUS_10610 68003 68809 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_10610 68891 69775 gene locus_tag LOCUS_10620 gene rsmA 68891 69775 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_10620 69954 71324 gene locus_tag LOCUS_10630 69954 71324 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017864221.1 protein_id gnl|my_center|LOCUS_10630 71344 72270 gene locus_tag LOCUS_10640 71344 72270 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_10640 72629 83557 gene locus_tag LOCUS_10650 72629 83557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 83840 84655 gene locus_tag LOCUS_10660 83840 84655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 85234 85040 gene locus_tag LOCUS_10670 85234 85040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence011 390 4 gene locus_tag LOCUS_10680 gene spoIIIAD 390 4 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359080.1 protein_id gnl|my_center|LOCUS_10680 616 422 gene locus_tag LOCUS_10690 616 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1148 630 gene locus_tag LOCUS_10700 1148 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 2134 1193 gene locus_tag LOCUS_10710 gene spoIIIAA 2134 1193 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965393.1 protein_id gnl|my_center|LOCUS_10710 4449 2362 gene locus_tag LOCUS_10720 gene pnp 4449 2362 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_10720 5051 4785 gene locus_tag LOCUS_10730 gene rpsO 5051 4785 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419491.1 protein_id gnl|my_center|LOCUS_10730 6087 5185 gene locus_tag LOCUS_10740 gene ribF 6087 5185 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102619.1 protein_id gnl|my_center|LOCUS_10740 7078 6167 gene locus_tag LOCUS_10750 gene truB 7078 6167 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428232.1 protein_id gnl|my_center|LOCUS_10750 8052 7075 gene locus_tag LOCUS_10760 8052 7075 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965110.1 protein_id gnl|my_center|LOCUS_10760 8423 8049 gene locus_tag LOCUS_10770 gene rbfA 8423 8049 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967251.1 protein_id gnl|my_center|LOCUS_10770 11527 8552 gene locus_tag LOCUS_10780 11527 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 11874 11545 gene locus_tag LOCUS_10790 11874 11545 CDS product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286523.1 protein_id gnl|my_center|LOCUS_10790 12133 11855 gene locus_tag LOCUS_10800 12133 11855 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_10800 13324 12155 gene locus_tag LOCUS_10810 gene nusA 13324 12155 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_10810 13944 13438 gene locus_tag LOCUS_10820 13944 13438 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_10820 16362 14119 gene locus_tag LOCUS_10830 gene gyrA 16362 14119 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703396.1 protein_id gnl|my_center|LOCUS_10830 18297 16375 gene locus_tag LOCUS_10840 gene gyrB 18297 16375 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_10840 19571 18402 gene locus_tag LOCUS_10850 19571 18402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 20659 19670 gene locus_tag LOCUS_10860 gene gpr 20659 19670 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430954.1 protein_id gnl|my_center|LOCUS_10860 20831 20649 gene locus_tag LOCUS_10870 20831 20649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 20910 21173 gene locus_tag LOCUS_10880 gene rpsT 20910 21173 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902954.1 protein_id gnl|my_center|LOCUS_10880 23519 21321 gene locus_tag LOCUS_10890 23519 21321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 24189 23491 gene locus_tag LOCUS_10900 24189 23491 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861605.1 protein_id gnl|my_center|LOCUS_10900 25503 24355 gene locus_tag LOCUS_10910 25503 24355 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546519.1 protein_id gnl|my_center|LOCUS_10910 25660 25487 gene locus_tag LOCUS_10920 25660 25487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 26076 25657 gene locus_tag LOCUS_10930 26076 25657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 26666 25995 gene locus_tag LOCUS_10940 26666 25995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 26975 26712 gene locus_tag LOCUS_10950 26975 26712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 34466 27276 gene locus_tag LOCUS_10960 34466 27276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 35739 34597 gene locus_tag LOCUS_10970 35739 34597 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546519.1 protein_id gnl|my_center|LOCUS_10970 36614 35721 gene locus_tag LOCUS_10980 36614 35721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 36922 36614 gene locus_tag LOCUS_10990 36922 36614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 37677 36955 gene locus_tag LOCUS_11000 37677 36955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 39198 38179 gene locus_tag LOCUS_11010 gene ilvC 39198 38179 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_11010 39806 39309 gene locus_tag LOCUS_11020 gene ilvN 39806 39309 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_11020 41150 40134 gene locus_tag LOCUS_11030 gene galE 41150 40134 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_11030 42163 41243 gene locus_tag LOCUS_11040 42163 41243 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_11040 44131 42302 gene locus_tag LOCUS_11050 44131 42302 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460031.1 protein_id gnl|my_center|LOCUS_11050 44564 44331 gene locus_tag LOCUS_11060 44564 44331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 45196 44561 gene locus_tag LOCUS_11070 45196 44561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 46356 45367 gene locus_tag LOCUS_11080 46356 45367 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016441.1 protein_id gnl|my_center|LOCUS_11080 47198 46431 gene locus_tag LOCUS_11090 gene aroD 47198 46431 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897376.1 protein_id gnl|my_center|LOCUS_11090 47371 47559 gene locus_tag LOCUS_11100 47371 47559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 47623 47775 gene locus_tag LOCUS_11110 47623 47775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 47803 48099 gene locus_tag LOCUS_11120 47803 48099 CDS product YmaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986735.1 protein_id gnl|my_center|LOCUS_11120 49309 48413 gene locus_tag LOCUS_11130 49309 48413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 49784 49296 gene locus_tag LOCUS_11140 49784 49296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 50960 49797 gene locus_tag LOCUS_11150 50960 49797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 52500 50974 gene locus_tag LOCUS_11160 52500 50974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 53544 52501 gene locus_tag LOCUS_11170 53544 52501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 54415 53546 gene locus_tag LOCUS_11180 54415 53546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 56914 54419 gene locus_tag LOCUS_11190 56914 54419 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714097.1 protein_id gnl|my_center|LOCUS_11190 57124 56918 gene locus_tag LOCUS_11200 57124 56918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 57525 57196 gene locus_tag LOCUS_11210 57525 57196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 58163 57591 gene locus_tag LOCUS_11220 58163 57591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 58516 58178 gene locus_tag LOCUS_11230 58516 58178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 58887 58513 gene locus_tag LOCUS_11240 58887 58513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905718.1 protein_id gnl|my_center|LOCUS_11240 59045 58887 gene locus_tag LOCUS_11250 59045 58887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 59446 59156 gene locus_tag LOCUS_11260 59446 59156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 60686 59472 gene locus_tag LOCUS_11270 60686 59472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 61447 60692 gene locus_tag LOCUS_11280 61447 60692 CDS product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225426975.1 protein_id gnl|my_center|LOCUS_11280 62784 61438 gene locus_tag LOCUS_11290 62784 61438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 64531 62855 gene locus_tag LOCUS_11300 64531 62855 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225426974.1 protein_id gnl|my_center|LOCUS_11300 64913 64524 gene locus_tag LOCUS_11310 64913 64524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 65383 65051 gene locus_tag LOCUS_11320 65383 65051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 65816 65403 gene locus_tag LOCUS_11330 65816 65403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 66474 65863 gene locus_tag LOCUS_11340 66474 65863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 66982 66497 gene locus_tag LOCUS_11350 66982 66497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 67965 67000 gene locus_tag LOCUS_11360 67965 67000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 68419 68174 gene locus_tag LOCUS_11370 68419 68174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 68854 68420 gene locus_tag LOCUS_11380 68854 68420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 69218 68949 gene locus_tag LOCUS_11390 69218 68949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 69621 69205 gene locus_tag LOCUS_11400 69621 69205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039966.1 protein_id gnl|my_center|LOCUS_11400 70993 69623 gene locus_tag LOCUS_11410 70993 69623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 72272 70983 gene locus_tag LOCUS_11420 72272 70983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 74788 72278 gene locus_tag LOCUS_11430 74788 72278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 75311 74874 gene locus_tag LOCUS_11440 75311 74874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 75844 75488 gene locus_tag LOCUS_11450 75844 75488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 76503 75841 gene locus_tag LOCUS_11460 76503 75841 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422086.1 protein_id gnl|my_center|LOCUS_11460 76672 76511 gene locus_tag LOCUS_11470 76672 76511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 76973 76758 gene locus_tag LOCUS_11480 76973 76758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 77224 76970 gene locus_tag LOCUS_11490 77224 76970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 77555 77202 gene locus_tag LOCUS_11500 77555 77202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 77828 77571 gene locus_tag LOCUS_11510 77828 77571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 78283 78092 gene locus_tag LOCUS_11520 78283 78092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 78450 78830 gene locus_tag LOCUS_11530 78450 78830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 78985 79695 gene locus_tag LOCUS_11540 78985 79695 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262663.1 protein_id gnl|my_center|LOCUS_11540 79797 80639 gene locus_tag LOCUS_11550 79797 80639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 80845 82101 gene locus_tag LOCUS_11560 80845 82101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 >Feature sequence012 299 2701 gene locus_tag LOCUS_11570 gene leuS 299 2701 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108730.1 protein_id gnl|my_center|LOCUS_11570 2999 2787 gene locus_tag LOCUS_11580 2999 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 4921 3104 gene locus_tag LOCUS_11590 4921 3104 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083002.1 protein_id gnl|my_center|LOCUS_11590 6653 4908 gene locus_tag LOCUS_11600 6653 4908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583011.1 protein_id gnl|my_center|LOCUS_11600 7743 6763 gene locus_tag LOCUS_11610 7743 6763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 13236 8368 gene locus_tag LOCUS_11620 13236 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 13742 14728 gene locus_tag LOCUS_11630 13742 14728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 15873 14863 gene locus_tag LOCUS_11640 15873 14863 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831524.1 protein_id gnl|my_center|LOCUS_11640 17147 15945 gene locus_tag LOCUS_11650 17147 15945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 17737 17243 gene locus_tag LOCUS_11660 17737 17243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 19484 17913 gene locus_tag LOCUS_11670 19484 17913 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948684.1 protein_id gnl|my_center|LOCUS_11670 20098 19649 gene locus_tag LOCUS_11680 20098 19649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 20436 20095 gene locus_tag LOCUS_11690 20436 20095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 20708 20433 gene locus_tag LOCUS_11700 20708 20433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 22466 20721 gene locus_tag LOCUS_11710 22466 20721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 22644 22525 gene locus_tag LOCUS_11720 22644 22525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 24163 22724 gene locus_tag LOCUS_11730 24163 22724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 25373 24147 gene locus_tag LOCUS_11740 25373 24147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 25596 25799 gene locus_tag LOCUS_11750 25596 25799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 26657 25926 gene locus_tag LOCUS_11760 26657 25926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 28009 26909 gene locus_tag LOCUS_11770 28009 26909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 32032 28052 gene locus_tag LOCUS_11780 32032 28052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 34158 32029 gene locus_tag LOCUS_11790 34158 32029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 37831 34238 gene locus_tag LOCUS_11800 37831 34238 CDS product tubulin-like doman-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175100.1 protein_id gnl|my_center|LOCUS_11800 39304 37859 gene locus_tag LOCUS_11810 39304 37859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 39614 40165 gene locus_tag LOCUS_11820 39614 40165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 40263 43523 gene locus_tag LOCUS_11830 40263 43523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 44682 43675 gene locus_tag LOCUS_11840 44682 43675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 45212 44658 gene locus_tag LOCUS_11850 gene yfcE 45212 44658 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_11850 46611 45241 gene locus_tag LOCUS_11860 46611 45241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 52054 47129 gene locus_tag LOCUS_11870 52054 47129 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390216.1 protein_id gnl|my_center|LOCUS_11870 52718 52305 gene locus_tag LOCUS_11880 52718 52305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 53897 52830 gene locus_tag LOCUS_11890 53897 52830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 56148 53971 gene locus_tag LOCUS_11900 56148 53971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 56488 56291 gene locus_tag LOCUS_11910 56488 56291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 57405 56515 gene locus_tag LOCUS_11920 gene cas7c 57405 56515 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_11920 59136 57406 gene locus_tag LOCUS_11930 gene cas8c 59136 57406 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602912.1 protein_id gnl|my_center|LOCUS_11930 59801 59133 gene locus_tag LOCUS_11940 gene cas5c 59801 59133 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176707.1 protein_id gnl|my_center|LOCUS_11940 60254 59814 gene locus_tag LOCUS_11950 60254 59814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 60705 60238 gene locus_tag LOCUS_11960 60705 60238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 63085 60971 gene locus_tag LOCUS_11970 63085 60971 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 protein_id gnl|my_center|LOCUS_11970 63740 63549 gene locus_tag LOCUS_11980 63740 63549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 64058 63924 gene locus_tag LOCUS_11990 64058 63924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 64464 64087 gene locus_tag LOCUS_12000 64464 64087 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272757.1 protein_id gnl|my_center|LOCUS_12000 65160 64543 gene locus_tag LOCUS_12010 65160 64543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12010 65555 65259 gene locus_tag LOCUS_12020 65555 65259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12020 66089 65781 gene locus_tag LOCUS_12030 66089 65781 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812923.1 protein_id gnl|my_center|LOCUS_12030 66826 66209 gene locus_tag LOCUS_12040 66826 66209 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774866.1 protein_id gnl|my_center|LOCUS_12040 68608 66857 gene locus_tag LOCUS_12050 68608 66857 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_12050 68911 69441 gene locus_tag LOCUS_12060 68911 69441 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946311.1 protein_id gnl|my_center|LOCUS_12060 69600 70274 gene locus_tag LOCUS_12070 69600 70274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 71219 70353 gene locus_tag LOCUS_12080 gene rsmI 71219 70353 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_12080 71969 71253 gene locus_tag LOCUS_12090 71969 71253 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_12090 72865 71966 gene locus_tag LOCUS_12100 72865 71966 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963624.1 protein_id gnl|my_center|LOCUS_12100 73866 72871 gene locus_tag LOCUS_12110 73866 72871 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_12110 74625 74038 gene locus_tag LOCUS_12120 74625 74038 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963621.1 protein_id gnl|my_center|LOCUS_12120 76075 74618 gene locus_tag LOCUS_12130 76075 74618 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048125.1 protein_id gnl|my_center|LOCUS_12130 76653 76150 gene locus_tag LOCUS_12140 76653 76150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 76881 76735 gene locus_tag LOCUS_12150 76881 76735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 77125 76922 gene locus_tag LOCUS_12160 77125 76922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence013 203 451 gene locus_tag LOCUS_12170 203 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 915 1586 gene locus_tag LOCUS_12180 915 1586 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943659.1 protein_id gnl|my_center|LOCUS_12180 1605 2543 gene locus_tag LOCUS_12190 1605 2543 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272634.1 protein_id gnl|my_center|LOCUS_12190 3355 2675 gene locus_tag LOCUS_12200 3355 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 3762 3911 gene locus_tag LOCUS_12210 3762 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 5394 4678 gene locus_tag LOCUS_12220 5394 4678 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247212.1 protein_id gnl|my_center|LOCUS_12220 6167 5577 gene locus_tag LOCUS_12230 6167 5577 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547369.1 protein_id gnl|my_center|LOCUS_12230 6460 8511 gene locus_tag LOCUS_12240 6460 8511 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423561.1 protein_id gnl|my_center|LOCUS_12240 8641 9681 gene locus_tag LOCUS_12250 8641 9681 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_12250 9703 10284 gene locus_tag LOCUS_12260 9703 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 10281 11312 gene locus_tag LOCUS_12270 10281 11312 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434053.1 protein_id gnl|my_center|LOCUS_12270 12204 11326 gene locus_tag LOCUS_12280 12204 11326 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_12280 12836 12330 gene locus_tag LOCUS_12290 gene nrdG 12836 12330 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905258.1 protein_id gnl|my_center|LOCUS_12290 15059 12870 gene locus_tag LOCUS_12300 gene nrdD 15059 12870 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_12300 15769 17748 gene locus_tag LOCUS_12310 gene thrS 15769 17748 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786086.1 protein_id gnl|my_center|LOCUS_12310 17776 18450 gene locus_tag LOCUS_12320 17776 18450 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_12320 18475 19464 gene locus_tag LOCUS_12330 18475 19464 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_12330 19574 20338 gene locus_tag LOCUS_12340 19574 20338 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173372.1 protein_id gnl|my_center|LOCUS_12340 20335 22371 gene locus_tag LOCUS_12350 20335 22371 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459160.1 protein_id gnl|my_center|LOCUS_12350 22542 23312 gene locus_tag LOCUS_12360 22542 23312 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964972.1 protein_id gnl|my_center|LOCUS_12360 24603 23437 gene locus_tag LOCUS_12370 24603 23437 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_12370 25149 24763 gene locus_tag LOCUS_12380 25149 24763 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949091.1 protein_id gnl|my_center|LOCUS_12380 25428 27530 gene locus_tag LOCUS_12390 25428 27530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12390 27555 28202 gene locus_tag LOCUS_12400 27555 28202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12400 29262 28303 gene locus_tag LOCUS_12410 29262 28303 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_12410 29543 30115 gene locus_tag LOCUS_12420 29543 30115 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_12420 30115 30417 gene locus_tag LOCUS_12430 30115 30417 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546290.1 protein_id gnl|my_center|LOCUS_12430 30419 31600 gene locus_tag LOCUS_12440 30419 31600 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545720.1 protein_id gnl|my_center|LOCUS_12440 31615 32547 gene locus_tag LOCUS_12450 31615 32547 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_12450 34006 32690 gene locus_tag LOCUS_12460 34006 32690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 34301 35419 gene locus_tag LOCUS_12470 34301 35419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12470 35412 36575 gene locus_tag LOCUS_12480 35412 36575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12480 36697 37359 gene locus_tag LOCUS_12490 36697 37359 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_12490 37454 38050 gene locus_tag LOCUS_12500 37454 38050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 38378 42601 gene locus_tag LOCUS_12510 38378 42601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 43445 42789 gene locus_tag LOCUS_12520 43445 42789 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964200.1 protein_id gnl|my_center|LOCUS_12520 44557 43628 gene locus_tag LOCUS_12530 gene arcC 44557 43628 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680441.1 protein_id gnl|my_center|LOCUS_12530 44784 46628 gene locus_tag LOCUS_12540 44784 46628 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583011.1 protein_id gnl|my_center|LOCUS_12540 46621 48357 gene locus_tag LOCUS_12550 46621 48357 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_12550 48611 48838 gene locus_tag LOCUS_12560 48611 48838 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263444.1 protein_id gnl|my_center|LOCUS_12560 48948 49427 gene locus_tag LOCUS_12570 48948 49427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 49520 50293 gene locus_tag LOCUS_12580 49520 50293 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_12580 50295 51500 gene locus_tag LOCUS_12590 50295 51500 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986712.1 protein_id gnl|my_center|LOCUS_12590 51634 51888 gene locus_tag LOCUS_12600 51634 51888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 52120 52569 gene locus_tag LOCUS_12610 gene nrdR 52120 52569 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_12610 52686 53459 gene locus_tag LOCUS_12620 52686 53459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 54504 53560 gene locus_tag LOCUS_12630 54504 53560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 54807 56144 gene locus_tag LOCUS_12640 54807 56144 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_12640 56176 58203 gene locus_tag LOCUS_12650 56176 58203 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460617.1 protein_id gnl|my_center|LOCUS_12650 59042 58281 gene locus_tag LOCUS_12660 59042 58281 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044986.1 protein_id gnl|my_center|LOCUS_12660 59215 60141 gene locus_tag LOCUS_12670 59215 60141 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263217.1 protein_id gnl|my_center|LOCUS_12670 60312 61619 gene locus_tag LOCUS_12680 60312 61619 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_12680 62038 63792 gene locus_tag LOCUS_12690 62038 63792 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_12690 63789 65699 gene locus_tag LOCUS_12700 63789 65699 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_12700 65723 66304 gene locus_tag LOCUS_12710 65723 66304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 66317 67207 gene locus_tag LOCUS_12720 66317 67207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 67225 68088 gene locus_tag LOCUS_12730 67225 68088 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874373.1 protein_id gnl|my_center|LOCUS_12730 68149 70017 gene locus_tag LOCUS_12740 68149 70017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 70163 70792 gene locus_tag LOCUS_12750 70163 70792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 70961 72592 gene locus_tag LOCUS_12760 70961 72592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 72629 73267 gene locus_tag LOCUS_12770 72629 73267 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933367.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence014 1024 554 gene locus_tag LOCUS_12780 1024 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1893 1702 gene locus_tag LOCUS_12790 1893 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 2578 2051 gene locus_tag LOCUS_12800 2578 2051 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462102.1 protein_id gnl|my_center|LOCUS_12800 4631 2739 gene locus_tag LOCUS_12810 4631 2739 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948299.1 protein_id gnl|my_center|LOCUS_12810 5473 4637 gene locus_tag LOCUS_12820 5473 4637 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_12820 7051 5474 gene locus_tag LOCUS_12830 7051 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 7751 7218 gene locus_tag LOCUS_12840 7751 7218 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_12840 8834 8049 gene locus_tag LOCUS_12850 8834 8049 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262273.1 protein_id gnl|my_center|LOCUS_12850 9712 8831 gene locus_tag LOCUS_12860 9712 8831 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 protein_id gnl|my_center|LOCUS_12860 10782 9928 gene locus_tag LOCUS_12870 10782 9928 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459581.1 protein_id gnl|my_center|LOCUS_12870 11415 10807 gene locus_tag LOCUS_12880 11415 10807 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461633.1 protein_id gnl|my_center|LOCUS_12880 15197 11409 gene locus_tag LOCUS_12890 15197 11409 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114994.1 protein_id gnl|my_center|LOCUS_12890 16506 15319 gene locus_tag LOCUS_12900 16506 15319 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733226.1 protein_id gnl|my_center|LOCUS_12900 17926 16541 gene locus_tag LOCUS_12910 17926 16541 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_12910 19488 18061 gene locus_tag LOCUS_12920 19488 18061 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891654.1 protein_id gnl|my_center|LOCUS_12920 20160 19999 gene locus_tag LOCUS_12930 20160 19999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 20777 20400 gene locus_tag LOCUS_12940 20777 20400 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_12940 21060 22412 gene locus_tag LOCUS_12950 21060 22412 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461524.1 protein_id gnl|my_center|LOCUS_12950 22409 23167 gene locus_tag LOCUS_12960 22409 23167 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582439.1 protein_id gnl|my_center|LOCUS_12960 25866 23254 gene locus_tag LOCUS_12970 25866 23254 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949094.1 protein_id gnl|my_center|LOCUS_12970 27528 26194 gene locus_tag LOCUS_12980 gene gdhA 27528 26194 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_12980 28147 27971 gene locus_tag LOCUS_12990 gene rpsU 28147 27971 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_12990 30976 28337 gene locus_tag LOCUS_13000 gene alaS 30976 28337 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986885.1 protein_id gnl|my_center|LOCUS_13000 32770 31256 gene locus_tag LOCUS_13010 32770 31256 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888725.1 protein_id gnl|my_center|LOCUS_13010 35330 32940 gene locus_tag LOCUS_13020 35330 32940 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_13020 35977 35327 gene locus_tag LOCUS_13030 35977 35327 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 protein_id gnl|my_center|LOCUS_13030 36860 35991 gene locus_tag LOCUS_13040 gene metF 36860 35991 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_13040 38359 36911 gene locus_tag LOCUS_13050 gene glgA 38359 36911 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_13050 39296 38508 gene locus_tag LOCUS_13060 gene spo0A 39296 38508 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_13060 40724 39474 gene locus_tag LOCUS_13070 40724 39474 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_13070 40986 43010 gene locus_tag LOCUS_13080 40986 43010 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_13080 43071 45017 gene locus_tag LOCUS_13090 43071 45017 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006774564.1 protein_id gnl|my_center|LOCUS_13090 45649 45197 gene locus_tag LOCUS_13100 45649 45197 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048431.1 protein_id gnl|my_center|LOCUS_13100 47502 45772 gene locus_tag LOCUS_13110 47502 45772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 48889 47525 gene locus_tag LOCUS_13120 48889 47525 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_13120 49336 48902 gene locus_tag LOCUS_13130 gene fabZ 49336 48902 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048424.1 protein_id gnl|my_center|LOCUS_13130 49829 49374 gene locus_tag LOCUS_13140 gene accB 49829 49374 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 protein_id gnl|my_center|LOCUS_13140 51084 49846 gene locus_tag LOCUS_13150 gene fabF 51084 49846 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_13150 51845 51105 gene locus_tag LOCUS_13160 gene fabG 51845 51105 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_13160 52759 51839 gene locus_tag LOCUS_13170 gene fabD 52759 51839 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_13170 53690 52752 gene locus_tag LOCUS_13180 gene fabK 53690 52752 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_13180 53946 53722 gene locus_tag LOCUS_13190 gene acpP 53946 53722 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774381.1 protein_id gnl|my_center|LOCUS_13190 54966 53986 gene locus_tag LOCUS_13200 54966 53986 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_13200 56455 55397 gene locus_tag LOCUS_13210 gene spoIVB 56455 55397 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965372.1 protein_id gnl|my_center|LOCUS_13210 58254 56569 gene locus_tag LOCUS_13220 gene recN 58254 56569 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387037.1 protein_id gnl|my_center|LOCUS_13220 58719 58264 gene locus_tag LOCUS_13230 58719 58264 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_13230 59557 58724 gene locus_tag LOCUS_13240 59557 58724 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_13240 60412 59609 gene locus_tag LOCUS_13250 60412 59609 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_13250 62359 60485 gene locus_tag LOCUS_13260 gene dxs 62359 60485 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_13260 63263 62373 gene locus_tag LOCUS_13270 63263 62373 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_13270 63501 63253 gene locus_tag LOCUS_13280 63501 63253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 64705 63473 gene locus_tag LOCUS_13290 gene xseA 64705 63473 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393024.1 protein_id gnl|my_center|LOCUS_13290 65107 64709 gene locus_tag LOCUS_13300 gene nusB 65107 64709 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722486.1 protein_id gnl|my_center|LOCUS_13300 65620 65231 gene locus_tag LOCUS_13310 65620 65231 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810919.1 protein_id gnl|my_center|LOCUS_13310 67320 65716 gene locus_tag LOCUS_13320 67320 65716 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_13320 68046 67438 gene locus_tag LOCUS_13330 68046 67438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 68667 68074 gene locus_tag LOCUS_13340 68667 68074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 69058 68618 gene locus_tag LOCUS_13350 69058 68618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 <70256 69101 gene locus_tag LOCUS_13360 <70256 69101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003358911.1:stage III sporulation protein AE >Feature sequence015 693 151 gene locus_tag LOCUS_13370 gene sat4 693 151 CDS product streptothricin N-acetyltransferase Sat4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627290.1 protein_id gnl|my_center|LOCUS_13370 1379 690 gene locus_tag LOCUS_13380 1379 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 2961 1462 gene locus_tag LOCUS_13390 gene lysS 2961 1462 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966473.1 protein_id gnl|my_center|LOCUS_13390 3633 3148 gene locus_tag LOCUS_13400 gene greA 3633 3148 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_13400 4792 3833 gene locus_tag LOCUS_13410 gene dusB 4792 3833 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_13410 5603 4833 gene locus_tag LOCUS_13420 5603 4833 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861999.1 protein_id gnl|my_center|LOCUS_13420 5956 5624 gene locus_tag LOCUS_13430 5956 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 6935 5949 gene locus_tag LOCUS_13440 6935 5949 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_13440 9187 7064 gene locus_tag LOCUS_13450 9187 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 10025 9249 gene locus_tag LOCUS_13460 10025 9249 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 protein_id gnl|my_center|LOCUS_13460 10687 10022 gene locus_tag LOCUS_13470 10687 10022 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_13470 12094 10706 gene locus_tag LOCUS_13480 12094 10706 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049163295.1 protein_id gnl|my_center|LOCUS_13480 12857 12165 gene locus_tag LOCUS_13490 12857 12165 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_13490 13917 12850 gene locus_tag LOCUS_13500 13917 12850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 15294 14107 gene locus_tag LOCUS_13510 gene metK 15294 14107 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_13510 17013 15721 gene locus_tag LOCUS_13520 17013 15721 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_13520 17803 17288 gene locus_tag LOCUS_13530 17803 17288 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_13530 18386 17853 gene locus_tag LOCUS_13540 18386 17853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 21598 18662 gene locus_tag LOCUS_13550 21598 18662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 22594 21647 gene locus_tag LOCUS_13560 22594 21647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 23873 22602 gene locus_tag LOCUS_13570 23873 22602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 25437 24085 gene locus_tag LOCUS_13580 25437 24085 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389377.1 protein_id gnl|my_center|LOCUS_13580 26126 25575 gene locus_tag LOCUS_13590 26126 25575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 27800 26145 gene locus_tag LOCUS_13600 27800 26145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 28537 27797 gene locus_tag LOCUS_13610 28537 27797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 28696 28872 gene locus_tag LOCUS_13620 28696 28872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 29844 28933 gene locus_tag LOCUS_13630 29844 28933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 33202 30257 gene locus_tag LOCUS_13640 33202 30257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 33801 33286 gene locus_tag LOCUS_13650 gene trmL 33801 33286 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_13650 35047 33872 gene locus_tag LOCUS_13660 35047 33872 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459619.1 protein_id gnl|my_center|LOCUS_13660 35544 35044 gene locus_tag LOCUS_13670 35544 35044 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_13670 36644 35619 gene locus_tag LOCUS_13680 36644 35619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 38673 36952 gene locus_tag LOCUS_13690 38673 36952 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_13690 39524 39042 gene locus_tag LOCUS_13700 gene tadA 39524 39042 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_13700 39626 40636 gene locus_tag LOCUS_13710 39626 40636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 42045 40645 gene locus_tag LOCUS_13720 42045 40645 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722014.1 protein_id gnl|my_center|LOCUS_13720 43250 42156 gene locus_tag LOCUS_13730 43250 42156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 44654 43656 gene locus_tag LOCUS_13740 44654 43656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13740 45459 44707 gene locus_tag LOCUS_13750 45459 44707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13750 45744 45541 gene locus_tag LOCUS_13760 45744 45541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 46724 45747 gene locus_tag LOCUS_13770 46724 45747 CDS product DUF2935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439363.1 protein_id gnl|my_center|LOCUS_13770 48223 46973 gene locus_tag LOCUS_13780 48223 46973 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765058.1 protein_id gnl|my_center|LOCUS_13780 48801 48463 gene locus_tag LOCUS_13790 48801 48463 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461711.1 protein_id gnl|my_center|LOCUS_13790 49957 49127 gene locus_tag LOCUS_13800 49957 49127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 50586 49954 gene locus_tag LOCUS_13810 50586 49954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 52255 50636 gene locus_tag LOCUS_13820 52255 50636 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861273.1 protein_id gnl|my_center|LOCUS_13820 52960 52346 gene locus_tag LOCUS_13830 52960 52346 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_13830 54322 53006 gene locus_tag LOCUS_13840 54322 53006 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533356.1 protein_id gnl|my_center|LOCUS_13840 55713 54376 gene locus_tag LOCUS_13850 55713 54376 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_13850 56590 55739 gene locus_tag LOCUS_13860 56590 55739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 57672 56590 gene locus_tag LOCUS_13870 57672 56590 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_13870 59441 57819 gene locus_tag LOCUS_13880 gene ptsP 59441 57819 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_13880 59708 59451 gene locus_tag LOCUS_13890 59708 59451 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_13890 60117 60044 gene locus_tag LOCUS_t00120 60117 60044 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 61710 60304 gene locus_tag LOCUS_13900 61710 60304 CDS product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016013.1 protein_id gnl|my_center|LOCUS_13900 61911 61738 gene locus_tag LOCUS_13910 61911 61738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 61989 62438 gene locus_tag LOCUS_13920 61989 62438 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138156903.1 protein_id gnl|my_center|LOCUS_13920 63215 62457 gene locus_tag LOCUS_13930 63215 62457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 63418 63164 gene locus_tag LOCUS_13940 63418 63164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 65038 63548 gene locus_tag LOCUS_13950 65038 63548 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965885.1 protein_id gnl|my_center|LOCUS_13950 65973 65092 gene locus_tag LOCUS_13960 65973 65092 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937986.1 protein_id gnl|my_center|LOCUS_13960 66983 65976 gene locus_tag LOCUS_13970 66983 65976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 68517 67375 gene locus_tag LOCUS_13980 68517 67375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 69522 68545 gene locus_tag LOCUS_13990 69522 68545 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303627.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence016 1430 594 gene locus_tag LOCUS_14000 1430 594 CDS product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173287.1 protein_id gnl|my_center|LOCUS_14000 2228 1449 gene locus_tag LOCUS_14010 2228 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 3551 2253 gene locus_tag LOCUS_14020 3551 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 4060 3551 gene locus_tag LOCUS_14030 4060 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 5220 4129 gene locus_tag LOCUS_14040 5220 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 6130 5243 gene locus_tag LOCUS_14050 6130 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 6616 7089 gene locus_tag LOCUS_14060 6616 7089 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775605.1 protein_id gnl|my_center|LOCUS_14060 7372 8028 gene locus_tag LOCUS_14070 7372 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 8210 8740 gene locus_tag LOCUS_14080 8210 8740 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355209.1 protein_id gnl|my_center|LOCUS_14080 9286 9528 gene locus_tag LOCUS_14090 9286 9528 CDS product DUF3781 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861913.1 protein_id gnl|my_center|LOCUS_14090 9525 9995 gene locus_tag LOCUS_14100 9525 9995 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861914.1 protein_id gnl|my_center|LOCUS_14100 10123 11337 gene locus_tag LOCUS_14110 gene mobT 10123 11337 CDS product MobT family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398284.1 protein_id gnl|my_center|LOCUS_14110 12326 12535 gene locus_tag LOCUS_14120 12326 12535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 12647 14260 gene locus_tag LOCUS_14130 12647 14260 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_14130 15406 14279 gene locus_tag LOCUS_14140 15406 14279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 16907 15408 gene locus_tag LOCUS_14150 16907 15408 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016217.1 protein_id gnl|my_center|LOCUS_14150 19075 16937 gene locus_tag LOCUS_14160 19075 16937 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350638.1 protein_id gnl|my_center|LOCUS_14160 21708 19096 gene locus_tag LOCUS_14170 gene pglZ 21708 19096 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022339.1 protein_id gnl|my_center|LOCUS_14170 24072 21742 gene locus_tag LOCUS_14180 24072 21742 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195651.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14180 24663 24106 gene locus_tag LOCUS_14190 24663 24106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 25714 24683 gene locus_tag LOCUS_14200 25714 24683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 29325 25729 gene locus_tag LOCUS_14210 gene pglX 29325 25729 CDS product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022345.1 protein_id gnl|my_center|LOCUS_14210 33008 29343 gene locus_tag LOCUS_14220 gene brxC 33008 29343 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065383.1 protein_id gnl|my_center|LOCUS_14220 33600 33022 gene locus_tag LOCUS_14230 33600 33022 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065384.1 protein_id gnl|my_center|LOCUS_14230 34204 33602 gene locus_tag LOCUS_14240 34204 33602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 34457 34218 gene locus_tag LOCUS_14250 34457 34218 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_14250 35471 34656 gene locus_tag LOCUS_14260 35471 34656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 36169 35504 gene locus_tag LOCUS_14270 36169 35504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 36841 36173 gene locus_tag LOCUS_14280 36841 36173 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_14280 37569 36940 gene locus_tag LOCUS_14290 37569 36940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 37953 37639 gene locus_tag LOCUS_14300 37953 37639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 39042 38293 gene locus_tag LOCUS_14310 39042 38293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 39292 39032 gene locus_tag LOCUS_14320 39292 39032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 40068 39289 gene locus_tag LOCUS_14330 40068 39289 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 protein_id gnl|my_center|LOCUS_14330 40955 40212 gene locus_tag LOCUS_14340 40955 40212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 41477 41404 gene locus_tag LOCUS_t00130 41477 41404 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 42665 41787 gene locus_tag LOCUS_14350 42665 41787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 43970 42684 gene locus_tag LOCUS_14360 gene serS 43970 42684 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_14360 44533 43985 gene locus_tag LOCUS_14370 44533 43985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 45743 44832 gene locus_tag LOCUS_14380 45743 44832 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_14380 46513 45743 gene locus_tag LOCUS_14390 gene soj 46513 45743 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_14390 47828 47115 gene locus_tag LOCUS_14400 gene rsmG 47828 47115 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048453.1 protein_id gnl|my_center|LOCUS_14400 49798 47906 gene locus_tag LOCUS_14410 gene mnmG 49798 47906 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_14410 51179 49764 gene locus_tag LOCUS_14420 gene mnmE 51179 49764 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359423.1 protein_id gnl|my_center|LOCUS_14420 52325 51396 gene locus_tag LOCUS_14430 52325 51396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 53633 52371 gene locus_tag LOCUS_14440 53633 52371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 53858 53646 gene locus_tag LOCUS_14450 gene yidD 53858 53646 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966997.1 protein_id gnl|my_center|LOCUS_14450 54222 53875 gene locus_tag LOCUS_14460 gene rnpA 54222 53875 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_14460 54423 54289 gene locus_tag LOCUS_14470 gene rpmH 54423 54289 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831901.1 protein_id gnl|my_center|LOCUS_14470 54900 56270 gene locus_tag LOCUS_14480 gene dnaA 54900 56270 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963330.1 protein_id gnl|my_center|LOCUS_14480 56590 57699 gene locus_tag LOCUS_14490 gene dnaN 56590 57699 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_14490 57757 57972 gene locus_tag LOCUS_14500 57757 57972 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222201.1 protein_id gnl|my_center|LOCUS_14500 58055 59140 gene locus_tag LOCUS_14510 gene recF 58055 59140 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 protein_id gnl|my_center|LOCUS_14510 59152 61089 gene locus_tag LOCUS_14520 gene gyrB 59152 61089 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_14520 61168 63735 gene locus_tag LOCUS_14530 gene gyrA 61168 63735 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_14530 63797 64507 gene locus_tag LOCUS_14540 63797 64507 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616577.1 protein_id gnl|my_center|LOCUS_14540 64879 65841 gene locus_tag LOCUS_14550 64879 65841 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_14550 66125 66214 gene locus_tag LOCUS_t00140 66125 66214 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence017 1569 565 gene locus_tag LOCUS_14560 1569 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14560 2926 1784 gene locus_tag LOCUS_14570 2926 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 3411 2923 gene locus_tag LOCUS_14580 3411 2923 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_14580 4299 3412 gene locus_tag LOCUS_14590 4299 3412 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_14590 4757 4473 gene locus_tag LOCUS_14600 4757 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 5564 5172 gene locus_tag LOCUS_14610 gene rpsI 5564 5172 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_14610 6020 5592 gene locus_tag LOCUS_14620 gene rplM 6020 5592 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727703.1 protein_id gnl|my_center|LOCUS_14620 6616 7926 gene locus_tag LOCUS_14630 6616 7926 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_14630 8573 8067 gene locus_tag LOCUS_14640 8573 8067 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_14640 9816 8593 gene locus_tag LOCUS_14650 gene tyrS 9816 8593 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_14650 11115 10363 gene locus_tag LOCUS_14660 gene truA 11115 10363 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_14660 11952 11128 gene locus_tag LOCUS_14670 11952 11128 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_14670 12823 11945 gene locus_tag LOCUS_14680 12823 11945 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_14680 13659 12808 gene locus_tag LOCUS_14690 13659 12808 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226187.1 protein_id gnl|my_center|LOCUS_14690 14232 13711 gene locus_tag LOCUS_14700 14232 13711 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_14700 14564 15676 gene locus_tag LOCUS_14710 gene ugpC 14564 15676 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_14710 15821 16729 gene locus_tag LOCUS_14720 15821 16729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 16775 17275 gene locus_tag LOCUS_14730 16775 17275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 18173 17415 gene locus_tag LOCUS_14740 18173 17415 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_14740 18834 18247 gene locus_tag LOCUS_14750 18834 18247 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_14750 19412 18999 gene locus_tag LOCUS_14760 19412 18999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 20852 19665 gene locus_tag LOCUS_14770 gene spoVE 20852 19665 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_14770 21985 20999 gene locus_tag LOCUS_14780 21985 20999 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053899.1 protein_id gnl|my_center|LOCUS_14780 22235 22319 gene locus_tag LOCUS_t00150 22235 22319 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22616 23071 gene locus_tag LOCUS_14790 22616 23071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 23068 24273 gene locus_tag LOCUS_14800 23068 24273 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814294.1 protein_id gnl|my_center|LOCUS_14800 24278 25651 gene locus_tag LOCUS_14810 24278 25651 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_14810 25930 25860 gene locus_tag LOCUS_t00160 25930 25860 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 26254 26184 gene locus_tag LOCUS_t00170 26254 26184 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 27581 26667 gene locus_tag LOCUS_14820 gene pfkB 27581 26667 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_14820 28568 27597 gene locus_tag LOCUS_14830 28568 27597 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966670.1 protein_id gnl|my_center|LOCUS_14830 29255 28596 gene locus_tag LOCUS_14840 gene rpiA 29255 28596 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964740.1 protein_id gnl|my_center|LOCUS_14840 31204 29282 gene locus_tag LOCUS_14850 31204 29282 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897443.1 protein_id gnl|my_center|LOCUS_14850 32472 31621 gene locus_tag LOCUS_14860 32472 31621 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674857.1 protein_id gnl|my_center|LOCUS_14860 33652 32657 gene locus_tag LOCUS_14870 33652 32657 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459857.1 protein_id gnl|my_center|LOCUS_14870 34750 33947 gene locus_tag LOCUS_14880 34750 33947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 36507 34915 gene locus_tag LOCUS_14890 36507 34915 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_14890 38093 36504 gene locus_tag LOCUS_14900 38093 36504 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_14900 38374 38168 gene locus_tag LOCUS_14910 38374 38168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 38894 38706 gene locus_tag LOCUS_14920 38894 38706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 39552 38914 gene locus_tag LOCUS_14930 39552 38914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14930 40110 39571 gene locus_tag LOCUS_14940 40110 39571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14940 41051 40239 gene locus_tag LOCUS_14950 41051 40239 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817405.1 protein_id gnl|my_center|LOCUS_14950 41826 41062 gene locus_tag LOCUS_14960 41826 41062 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439810.1 protein_id gnl|my_center|LOCUS_14960 42208 41846 gene locus_tag LOCUS_14970 42208 41846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 43554 42343 gene locus_tag LOCUS_14980 43554 42343 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704717.1 protein_id gnl|my_center|LOCUS_14980 44602 43556 gene locus_tag LOCUS_14990 44602 43556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 44997 44818 gene locus_tag LOCUS_15000 44997 44818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 45960 45034 gene locus_tag LOCUS_15010 gene cysK 45960 45034 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_15010 47049 46012 gene locus_tag LOCUS_15020 47049 46012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 47537 47079 gene locus_tag LOCUS_15030 47537 47079 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_15030 48324 47515 gene locus_tag LOCUS_15040 gene moeB 48324 47515 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460729.1 protein_id gnl|my_center|LOCUS_15040 48531 48325 gene locus_tag LOCUS_15050 gene thiS 48531 48325 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945026.1 protein_id gnl|my_center|LOCUS_15050 48868 48554 gene locus_tag LOCUS_15060 gene trxA 48868 48554 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392444.1 protein_id gnl|my_center|LOCUS_15060 49063 48869 gene locus_tag LOCUS_15070 49063 48869 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816171.1 protein_id gnl|my_center|LOCUS_15070 49730 49110 gene locus_tag LOCUS_15080 49730 49110 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460728.1 protein_id gnl|my_center|LOCUS_15080 50180 49746 gene locus_tag LOCUS_15090 50180 49746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15090 50983 50186 gene locus_tag LOCUS_15100 50983 50186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15100 51893 50988 gene locus_tag LOCUS_15110 gene trxB 51893 50988 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_15110 52798 52289 gene locus_tag LOCUS_15120 52798 52289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 53810 52803 gene locus_tag LOCUS_15130 53810 52803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 56411 53847 gene locus_tag LOCUS_15140 56411 53847 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_15140 56747 56412 gene locus_tag LOCUS_15150 56747 56412 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_15150 57979 57104 gene locus_tag LOCUS_15160 57979 57104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 58584 57976 gene locus_tag LOCUS_15170 58584 57976 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426696.1 protein_id gnl|my_center|LOCUS_15170 59713 58697 gene locus_tag LOCUS_15180 59713 58697 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_15180 60415 59939 gene locus_tag LOCUS_15190 60415 59939 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896783.1 protein_id gnl|my_center|LOCUS_15190 60704 60624 gene locus_tag LOCUS_t00180 60704 60624 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 60896 61081 gene locus_tag LOCUS_15200 60896 61081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 61094 61285 gene locus_tag LOCUS_15210 61094 61285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 61477 61405 gene locus_tag LOCUS_t00190 61477 61405 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 61586 61515 gene locus_tag LOCUS_t00200 61586 61515 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 61742 61668 gene locus_tag LOCUS_t00210 61742 61668 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 61822 61747 gene locus_tag LOCUS_t00220 61822 61747 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 61942 61872 gene locus_tag LOCUS_t00230 61942 61872 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 62026 61950 gene locus_tag LOCUS_t00240 62026 61950 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence018 15 326 gene locus_tag LOCUS_15220 15 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 713 2203 gene locus_tag LOCUS_15230 713 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 2325 3089 gene locus_tag LOCUS_15240 gene fabG 2325 3089 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_15240 3204 4874 gene locus_tag LOCUS_15250 3204 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 4871 6199 gene locus_tag LOCUS_15260 4871 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 6168 6797 gene locus_tag LOCUS_15270 gene vraR 6168 6797 CDS product two-component system response regulator VraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830439.1 protein_id gnl|my_center|LOCUS_15270 7054 9834 gene locus_tag LOCUS_15280 7054 9834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 9910 10365 gene locus_tag LOCUS_15290 9910 10365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 10398 12647 gene locus_tag LOCUS_15300 10398 12647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 12674 14131 gene locus_tag LOCUS_15310 12674 14131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 14210 15604 gene locus_tag LOCUS_15320 14210 15604 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_15320 15630 16169 gene locus_tag LOCUS_15330 15630 16169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 16180 17328 gene locus_tag LOCUS_15340 16180 17328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 17344 18438 gene locus_tag LOCUS_15350 17344 18438 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_15350 18452 19747 gene locus_tag LOCUS_15360 18452 19747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 19783 21252 gene locus_tag LOCUS_15370 19783 21252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 21338 23023 gene locus_tag LOCUS_15380 21338 23023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 23065 23529 gene locus_tag LOCUS_15390 23065 23529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 23732 25123 gene locus_tag LOCUS_15400 gene asnS 23732 25123 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_15400 25227 26237 gene locus_tag LOCUS_15410 gene asnA 25227 26237 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_15410 26484 27221 gene locus_tag LOCUS_15420 26484 27221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 27255 27791 gene locus_tag LOCUS_15430 27255 27791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 27763 29517 gene locus_tag LOCUS_15440 27763 29517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107086.1 protein_id gnl|my_center|LOCUS_15440 29530 31026 gene locus_tag LOCUS_15450 gene cps4A 29530 31026 CDS product capsular polysaccharide biosynthesis protein Cps4A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091050.1 protein_id gnl|my_center|LOCUS_15450 31020 31754 gene locus_tag LOCUS_15460 31020 31754 CDS product protein tyrosine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929232.1 protein_id gnl|my_center|LOCUS_15460 31789 32595 gene locus_tag LOCUS_15470 31789 32595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 32612 34000 gene locus_tag LOCUS_15480 32612 34000 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_15480 33987 35522 gene locus_tag LOCUS_15490 33987 35522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 35942 37135 gene locus_tag LOCUS_15500 gene trpE 35942 37135 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546555.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15500 37101 37403 gene locus_tag LOCUS_15510 37101 37403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15510 37400 39004 gene locus_tag LOCUS_15520 37400 39004 CDS product bifunctional anthranilate synthase component II/anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943371.1 protein_id gnl|my_center|LOCUS_15520 39113 39907 gene locus_tag LOCUS_15530 gene trpC 39113 39907 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_15530 39904 40518 gene locus_tag LOCUS_15540 39904 40518 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_15540 40552 41748 gene locus_tag LOCUS_15550 gene trpB 40552 41748 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562635.1 protein_id gnl|my_center|LOCUS_15550 41741 42520 gene locus_tag LOCUS_15560 gene trpA 41741 42520 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_15560 42817 43704 gene locus_tag LOCUS_15570 42817 43704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 46108 43877 gene locus_tag LOCUS_15580 46108 43877 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246684.1 protein_id gnl|my_center|LOCUS_15580 46341 47612 gene locus_tag LOCUS_15590 gene eno 46341 47612 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898301.1 protein_id gnl|my_center|LOCUS_15590 47727 47969 gene locus_tag LOCUS_15600 47727 47969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 48122 50263 gene locus_tag LOCUS_15610 gene rnr 48122 50263 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_15610 50306 50770 gene locus_tag LOCUS_15620 gene smpB 50306 50770 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 protein_id gnl|my_center|LOCUS_15620 51219 58496 gene locus_tag LOCUS_15630 51219 58496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence019 5723 279 gene locus_tag LOCUS_15640 5723 279 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390210.1 protein_id gnl|my_center|LOCUS_15640 11672 5877 gene locus_tag LOCUS_15650 11672 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 17434 11774 gene locus_tag LOCUS_15660 17434 11774 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389627.1 protein_id gnl|my_center|LOCUS_15660 18768 17521 gene locus_tag LOCUS_15670 18768 17521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 19961 18765 gene locus_tag LOCUS_15680 19961 18765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 20513 20588 gene locus_tag LOCUS_t00250 20513 20588 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21909 20827 gene locus_tag LOCUS_15690 gene trpS 21909 20827 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_15690 22750 22055 gene locus_tag LOCUS_15700 22750 22055 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271956.1 protein_id gnl|my_center|LOCUS_15700 23800 22880 gene locus_tag LOCUS_15710 23800 22880 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475716.1 protein_id gnl|my_center|LOCUS_15710 24520 23912 gene locus_tag LOCUS_15720 24520 23912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 26312 24591 gene locus_tag LOCUS_15730 26312 24591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 27266 26436 gene locus_tag LOCUS_15740 27266 26436 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255171.1 protein_id gnl|my_center|LOCUS_15740 27960 27250 gene locus_tag LOCUS_15750 27960 27250 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046916.1 protein_id gnl|my_center|LOCUS_15750 29059 28196 gene locus_tag LOCUS_15760 29059 28196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 30024 29188 gene locus_tag LOCUS_15770 30024 29188 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706548.1 protein_id gnl|my_center|LOCUS_15770 30325 30026 gene locus_tag LOCUS_15780 30325 30026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 30779 30285 gene locus_tag LOCUS_15790 30779 30285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 30982 32133 gene locus_tag LOCUS_15800 30982 32133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 32842 32306 gene locus_tag LOCUS_15810 gene rplQ 32842 32306 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641268.1 protein_id gnl|my_center|LOCUS_15810 34011 33052 gene locus_tag LOCUS_15820 34011 33052 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_15820 34665 34072 gene locus_tag LOCUS_15830 gene rpsD 34665 34072 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_15830 35097 34702 gene locus_tag LOCUS_15840 gene rpsK 35097 34702 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101799.1 protein_id gnl|my_center|LOCUS_15840 35497 35186 gene locus_tag LOCUS_15850 gene rpsM 35497 35186 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_15850 36463 36245 gene locus_tag LOCUS_15860 gene infA 36463 36245 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029884.1 protein_id gnl|my_center|LOCUS_15860 36758 36510 gene locus_tag LOCUS_15870 36758 36510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 37407 36763 gene locus_tag LOCUS_15880 37407 36763 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_15880 38848 37523 gene locus_tag LOCUS_15890 gene secY 38848 37523 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_15890 39288 38848 gene locus_tag LOCUS_15900 gene rplO 39288 38848 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_15900 39496 39314 gene locus_tag LOCUS_15910 gene rpmD 39496 39314 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096577.1 protein_id gnl|my_center|LOCUS_15910 40020 39511 gene locus_tag LOCUS_15920 gene rpsE 40020 39511 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_15920 40404 40036 gene locus_tag LOCUS_15930 gene rplR 40404 40036 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583361.1 protein_id gnl|my_center|LOCUS_15930 40964 40422 gene locus_tag LOCUS_15940 gene rplF 40964 40422 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_15940 41435 41034 gene locus_tag LOCUS_15950 gene rpsH 41435 41034 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_15950 41787 41602 gene locus_tag LOCUS_15960 41787 41602 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288673.1 protein_id gnl|my_center|LOCUS_15960 42338 41799 gene locus_tag LOCUS_15970 gene rplE 42338 41799 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_15970 42675 42361 gene locus_tag LOCUS_15980 gene rplX 42675 42361 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728539.1 protein_id gnl|my_center|LOCUS_15980 43057 42689 gene locus_tag LOCUS_15990 gene rplN 43057 42689 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892852.1 protein_id gnl|my_center|LOCUS_15990 43357 43100 gene locus_tag LOCUS_16000 gene rpsQ 43357 43100 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_16000 43623 43414 gene locus_tag LOCUS_16010 gene rpmC 43623 43414 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722500.1 protein_id gnl|my_center|LOCUS_16010 44044 43607 gene locus_tag LOCUS_16020 gene rplP 44044 43607 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_16020 44700 44044 gene locus_tag LOCUS_16030 gene rpsC 44700 44044 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_16030 45096 44710 gene locus_tag LOCUS_16040 gene rplV 45096 44710 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081826.1 protein_id gnl|my_center|LOCUS_16040 45410 45129 gene locus_tag LOCUS_16050 gene rpsS 45410 45129 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403584.1 protein_id gnl|my_center|LOCUS_16050 46280 45438 gene locus_tag LOCUS_16060 gene rplB 46280 45438 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459099.1 protein_id gnl|my_center|LOCUS_16060 46679 46380 gene locus_tag LOCUS_16070 gene rplW 46679 46380 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_16070 47299 46679 gene locus_tag LOCUS_16080 gene rplD 47299 46679 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_16080 48014 47331 gene locus_tag LOCUS_16090 gene rplC 48014 47331 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_16090 48399 48082 gene locus_tag LOCUS_16100 gene rpsJ 48399 48082 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_16100 55883 48999 gene locus_tag LOCUS_16110 55883 48999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 56254 55913 gene locus_tag LOCUS_16120 56254 55913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence020 451 137 gene locus_tag LOCUS_16130 451 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1881 598 gene locus_tag LOCUS_16140 1881 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 2528 1935 gene locus_tag LOCUS_16150 gene hisB 2528 1935 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964256.1 protein_id gnl|my_center|LOCUS_16150 3835 2543 gene locus_tag LOCUS_16160 gene hisD 3835 2543 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949111.1 protein_id gnl|my_center|LOCUS_16160 4481 3825 gene locus_tag LOCUS_16170 gene hisG 4481 3825 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358779.1 protein_id gnl|my_center|LOCUS_16170 5747 4494 gene locus_tag LOCUS_16180 5747 4494 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964253.1 protein_id gnl|my_center|LOCUS_16180 6360 5827 gene locus_tag LOCUS_16190 gene recU 6360 5827 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460152.1 protein_id gnl|my_center|LOCUS_16190 7337 6360 gene locus_tag LOCUS_16200 7337 6360 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_16200 7933 7352 gene locus_tag LOCUS_16210 7933 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 8723 7962 gene locus_tag LOCUS_16220 8723 7962 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_16220 10639 8720 gene locus_tag LOCUS_16230 10639 8720 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_16230 11319 10645 gene locus_tag LOCUS_16240 11319 10645 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_16240 12020 11313 gene locus_tag LOCUS_16250 12020 11313 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393245.1 protein_id gnl|my_center|LOCUS_16250 13451 12057 gene locus_tag LOCUS_16260 13451 12057 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_16260 14965 13517 gene locus_tag LOCUS_16270 14965 13517 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033065833.1 protein_id gnl|my_center|LOCUS_16270 15474 16121 gene locus_tag LOCUS_16280 15474 16121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 16738 16166 gene locus_tag LOCUS_16290 16738 16166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 17232 16741 gene locus_tag LOCUS_16300 gene coaD 17232 16741 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_16300 17854 17297 gene locus_tag LOCUS_16310 gene rsmD 17854 17297 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900954.1 protein_id gnl|my_center|LOCUS_16310 18162 17956 gene locus_tag LOCUS_16320 18162 17956 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_16320 20382 18322 gene locus_tag LOCUS_16330 gene recG 20382 18322 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244692.1 protein_id gnl|my_center|LOCUS_16330 22164 20506 gene locus_tag LOCUS_16340 22164 20506 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_16340 22537 22178 gene locus_tag LOCUS_16350 22537 22178 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_16350 22791 22976 gene locus_tag LOCUS_16360 gene rpmB 22791 22976 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_16360 23734 23333 gene locus_tag LOCUS_16370 23734 23333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 24791 23775 gene locus_tag LOCUS_16380 24791 23775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 25132 24809 gene locus_tag LOCUS_16390 25132 24809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 26635 25247 gene locus_tag LOCUS_16400 26635 25247 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048310.1 protein_id gnl|my_center|LOCUS_16400 28058 26640 gene locus_tag LOCUS_16410 28058 26640 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963827.1 protein_id gnl|my_center|LOCUS_16410 30657 28072 gene locus_tag LOCUS_16420 30657 28072 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020587.1 protein_id gnl|my_center|LOCUS_16420 31135 30725 gene locus_tag LOCUS_16430 31135 30725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 32264 31263 gene locus_tag LOCUS_16440 gene ruvB 32264 31263 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_16440 32900 32298 gene locus_tag LOCUS_16450 gene ruvA 32900 32298 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_16450 33567 33010 gene locus_tag LOCUS_16460 gene eetB 33567 33010 CDS product flavin-based extracellular electron transfer system protein EetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723627.1 protein_id gnl|my_center|LOCUS_16460 33981 33619 gene locus_tag LOCUS_16470 33981 33619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 34245 35219 gene locus_tag LOCUS_16480 34245 35219 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897671.1 protein_id gnl|my_center|LOCUS_16480 36056 35247 gene locus_tag LOCUS_16490 36056 35247 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_16490 36645 36070 gene locus_tag LOCUS_16500 gene rsxA 36645 36070 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_16500 37356 36661 gene locus_tag LOCUS_16510 37356 36661 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948148.1 protein_id gnl|my_center|LOCUS_16510 37969 37349 gene locus_tag LOCUS_16520 37969 37349 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902280.1 protein_id gnl|my_center|LOCUS_16520 38901 37966 gene locus_tag LOCUS_16530 38901 37966 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_16530 40235 38916 gene locus_tag LOCUS_16540 gene rsxC 40235 38916 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_16540 41598 40513 gene locus_tag LOCUS_16550 41598 40513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16550 42433 41582 gene locus_tag LOCUS_16560 42433 41582 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439450.1 protein_id gnl|my_center|LOCUS_16560 43109 42450 gene locus_tag LOCUS_16570 gene cmk 43109 42450 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786468.1 protein_id gnl|my_center|LOCUS_16570 44379 43150 gene locus_tag LOCUS_16580 44379 43150 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_16580 45359 44460 gene locus_tag LOCUS_16590 45359 44460 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_16590 47238 45451 gene locus_tag LOCUS_16600 47238 45451 CDS product aminopeptidase P family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986733.1 protein_id gnl|my_center|LOCUS_16600 48784 47369 gene locus_tag LOCUS_16610 48784 47369 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_16610 49953 48802 gene locus_tag LOCUS_16620 49953 48802 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_16620 50345 49980 gene locus_tag LOCUS_16630 50345 49980 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_16630 51134 50361 gene locus_tag LOCUS_16640 51134 50361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 52585 51149 gene locus_tag LOCUS_16650 52585 51149 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203341.1 protein_id gnl|my_center|LOCUS_16650 54903 52912 gene locus_tag LOCUS_16660 54903 52912 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence021 209 2860 gene locus_tag LOCUS_16670 gene mutS 209 2860 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_16670 2895 5063 gene locus_tag LOCUS_16680 gene mutL 2895 5063 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378991.1 protein_id gnl|my_center|LOCUS_16680 5064 6020 gene locus_tag LOCUS_16690 gene miaA 5064 6020 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_16690 6081 7415 gene locus_tag LOCUS_16700 6081 7415 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_16700 7477 8703 gene locus_tag LOCUS_16710 7477 8703 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_16710 8690 10294 gene locus_tag LOCUS_16720 8690 10294 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_16720 10393 11079 gene locus_tag LOCUS_16730 gene radC 10393 11079 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360029.1 protein_id gnl|my_center|LOCUS_16730 11158 12027 gene locus_tag LOCUS_16740 11158 12027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 12048 12590 gene locus_tag LOCUS_16750 12048 12590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 12583 15447 gene locus_tag LOCUS_16760 12583 15447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 15491 16282 gene locus_tag LOCUS_16770 gene minD 15491 16282 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816779.1 protein_id gnl|my_center|LOCUS_16770 16313 16522 gene locus_tag LOCUS_16780 16313 16522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 16519 17670 gene locus_tag LOCUS_16790 gene rodA 16519 17670 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_16790 17667 18062 gene locus_tag LOCUS_16800 gene mgsA 17667 18062 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_16800 18046 19023 gene locus_tag LOCUS_16810 18046 19023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 19307 19104 gene locus_tag LOCUS_16820 19307 19104 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948188.1 protein_id gnl|my_center|LOCUS_16820 19418 20869 gene locus_tag LOCUS_16830 19418 20869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 20904 21596 gene locus_tag LOCUS_16840 20904 21596 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_16840 21658 22224 gene locus_tag LOCUS_16850 21658 22224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 22437 23051 gene locus_tag LOCUS_16860 22437 23051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 23076 23981 gene locus_tag LOCUS_16870 23076 23981 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861614.1 protein_id gnl|my_center|LOCUS_16870 24038 24682 gene locus_tag LOCUS_16880 24038 24682 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_16880 24841 30378 gene locus_tag LOCUS_16890 24841 30378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 31239 30502 gene locus_tag LOCUS_16900 31239 30502 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_16900 32396 31332 gene locus_tag LOCUS_16910 32396 31332 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_16910 33238 32819 gene locus_tag LOCUS_16920 33238 32819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 33544 34161 gene locus_tag LOCUS_16930 gene lexA 33544 34161 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_16930 34613 34248 gene locus_tag LOCUS_16940 gene rsfS 34613 34248 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645187.1 protein_id gnl|my_center|LOCUS_16940 35191 34619 gene locus_tag LOCUS_16950 gene yqeK 35191 34619 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_16950 35808 35188 gene locus_tag LOCUS_16960 35808 35188 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674578.1 protein_id gnl|my_center|LOCUS_16960 36228 35938 gene locus_tag LOCUS_16970 gene yhbY 36228 35938 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_16970 37542 36259 gene locus_tag LOCUS_16980 gene obgE 37542 36259 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_16980 37944 37660 gene locus_tag LOCUS_16990 gene rpmA 37944 37660 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916187.1 protein_id gnl|my_center|LOCUS_16990 38282 37950 gene locus_tag LOCUS_17000 38282 37950 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640344.1 protein_id gnl|my_center|LOCUS_17000 38596 38288 gene locus_tag LOCUS_17010 gene rplU 38596 38288 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048023.1 protein_id gnl|my_center|LOCUS_17010 39535 38702 gene locus_tag LOCUS_17020 39535 38702 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_17020 40908 39589 gene locus_tag LOCUS_17030 40908 39589 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_17030 41597 41112 gene locus_tag LOCUS_17040 gene ybaK 41597 41112 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710889.1 protein_id gnl|my_center|LOCUS_17040 42784 41579 gene locus_tag LOCUS_17050 42784 41579 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028844369.1 protein_id gnl|my_center|LOCUS_17050 43503 42793 gene locus_tag LOCUS_17060 43503 42793 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964567.1 protein_id gnl|my_center|LOCUS_17060 45407 43500 gene locus_tag LOCUS_17070 45407 43500 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence022 68 235 gene locus_tag LOCUS_17080 68 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 354 2420 gene locus_tag LOCUS_17090 gene htpG 354 2420 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_17090 3021 2536 gene locus_tag LOCUS_17100 3021 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 3195 3956 gene locus_tag LOCUS_17110 3195 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 3953 4501 gene locus_tag LOCUS_17120 3953 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 4526 5938 gene locus_tag LOCUS_17130 4526 5938 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_17130 5995 7158 gene locus_tag LOCUS_17140 5995 7158 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_17140 7151 7954 gene locus_tag LOCUS_17150 7151 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 7944 9902 gene locus_tag LOCUS_17160 gene ligA 7944 9902 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_17160 10103 11497 gene locus_tag LOCUS_17170 gene clpX 10103 11497 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472282.1 protein_id gnl|my_center|LOCUS_17170 13392 11686 gene locus_tag LOCUS_17180 13392 11686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 13615 14190 gene locus_tag LOCUS_17190 13615 14190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 14239 14727 gene locus_tag LOCUS_17200 14239 14727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 14777 15637 gene locus_tag LOCUS_17210 gene nudC 14777 15637 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102051.1 protein_id gnl|my_center|LOCUS_17210 15796 16644 gene locus_tag LOCUS_17220 15796 16644 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435320.1 protein_id gnl|my_center|LOCUS_17220 17898 16702 gene locus_tag LOCUS_17230 17898 16702 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_17230 18815 18057 gene locus_tag LOCUS_17240 18815 18057 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_17240 19599 18835 gene locus_tag LOCUS_17250 19599 18835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 20059 21432 gene locus_tag LOCUS_17260 20059 21432 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_17260 21710 22285 gene locus_tag LOCUS_17270 21710 22285 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_17270 22400 22939 gene locus_tag LOCUS_17280 22400 22939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 23278 24543 gene locus_tag LOCUS_17290 23278 24543 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387108.1 protein_id gnl|my_center|LOCUS_17290 25300 24596 gene locus_tag LOCUS_17300 25300 24596 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439430.1 protein_id gnl|my_center|LOCUS_17300 27278 25293 gene locus_tag LOCUS_17310 27278 25293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 27572 28918 gene locus_tag LOCUS_17320 27572 28918 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_17320 28966 29628 gene locus_tag LOCUS_17330 28966 29628 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_17330 29646 29801 gene locus_tag LOCUS_17340 29646 29801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 29968 30288 gene locus_tag LOCUS_17350 29968 30288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 30412 30843 gene locus_tag LOCUS_17360 30412 30843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 30947 31708 gene locus_tag LOCUS_17370 gene atpB 30947 31708 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_17370 31837 32115 gene locus_tag LOCUS_17380 31837 32115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 32150 32653 gene locus_tag LOCUS_17390 gene atpF 32150 32653 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393859.1 protein_id gnl|my_center|LOCUS_17390 32650 33189 gene locus_tag LOCUS_17400 32650 33189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 33207 34736 gene locus_tag LOCUS_17410 gene atpA 33207 34736 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421367.1 protein_id gnl|my_center|LOCUS_17410 34757 35623 gene locus_tag LOCUS_17420 gene atpG 34757 35623 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_17420 35657 37051 gene locus_tag LOCUS_17430 gene atpD 35657 37051 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_17430 37064 37465 gene locus_tag LOCUS_17440 37064 37465 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641444.1 protein_id gnl|my_center|LOCUS_17440 37538 37888 gene locus_tag LOCUS_17450 37538 37888 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943036.1 protein_id gnl|my_center|LOCUS_17450 37934 38524 gene locus_tag LOCUS_17460 37934 38524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 38541 39344 gene locus_tag LOCUS_17470 38541 39344 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785293.1 protein_id gnl|my_center|LOCUS_17470 39347 40522 gene locus_tag LOCUS_17480 39347 40522 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861827.1 protein_id gnl|my_center|LOCUS_17480 40969 43569 gene locus_tag LOCUS_17490 gene clpB 40969 43569 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009165978.1 protein_id gnl|my_center|LOCUS_17490 43577 44218 gene locus_tag LOCUS_17500 43577 44218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence023 797 432 gene locus_tag LOCUS_17510 797 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 1191 799 gene locus_tag LOCUS_17520 1191 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 1873 1193 gene locus_tag LOCUS_17530 1873 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 3811 2003 gene locus_tag LOCUS_17540 3811 2003 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861938.1 protein_id gnl|my_center|LOCUS_17540 3948 3811 gene locus_tag LOCUS_17550 3948 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 5855 4404 gene locus_tag LOCUS_17560 5855 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 6231 5845 gene locus_tag LOCUS_17570 6231 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 6583 7770 gene locus_tag LOCUS_17580 6583 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 10478 7851 gene locus_tag LOCUS_17590 gene ppdK 10478 7851 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_17590 12109 10619 gene locus_tag LOCUS_17600 12109 10619 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657823.1 protein_id gnl|my_center|LOCUS_17600 12257 12075 gene locus_tag LOCUS_17610 12257 12075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 13640 12270 gene locus_tag LOCUS_17620 13640 12270 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_17620 15288 13897 gene locus_tag LOCUS_17630 15288 13897 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_17630 16136 15381 gene locus_tag LOCUS_17640 gene recO 16136 15381 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230055.1 protein_id gnl|my_center|LOCUS_17640 17067 16156 gene locus_tag LOCUS_17650 gene era 17067 16156 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964607.1 protein_id gnl|my_center|LOCUS_17650 20045 17073 gene locus_tag LOCUS_17660 20045 17073 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_17660 21243 20299 gene locus_tag LOCUS_17670 21243 20299 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966723.1 protein_id gnl|my_center|LOCUS_17670 28643 21429 gene locus_tag LOCUS_17680 28643 21429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 29882 28947 gene locus_tag LOCUS_17690 29882 28947 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143966.1 protein_id gnl|my_center|LOCUS_17690 30817 29879 gene locus_tag LOCUS_17700 30817 29879 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929426.1 protein_id gnl|my_center|LOCUS_17700 31667 30882 gene locus_tag LOCUS_17710 31667 30882 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055304.1 protein_id gnl|my_center|LOCUS_17710 32341 31664 gene locus_tag LOCUS_17720 32341 31664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 33159 32323 gene locus_tag LOCUS_17730 33159 32323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 35299 33569 gene locus_tag LOCUS_17740 gene ade 35299 33569 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476052.1 protein_id gnl|my_center|LOCUS_17740 35391 35463 gene locus_tag LOCUS_t00260 35391 35463 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 35780 35601 gene locus_tag LOCUS_17750 35780 35601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 36624 35728 gene locus_tag LOCUS_17760 36624 35728 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_17760 37563 36718 gene locus_tag LOCUS_17770 gene pgeF 37563 36718 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_17770 38016 37666 gene locus_tag LOCUS_17780 38016 37666 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686873.1 protein_id gnl|my_center|LOCUS_17780 38892 38125 gene locus_tag LOCUS_17790 38892 38125 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369352.1 protein_id gnl|my_center|LOCUS_17790 39430 38885 gene locus_tag LOCUS_17800 gene lepB 39430 38885 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_17800 40291 39446 gene locus_tag LOCUS_17810 gene ylqF 40291 39446 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_17810 41028 40288 gene locus_tag LOCUS_17820 41028 40288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 41585 41238 gene locus_tag LOCUS_17830 gene rplS 41585 41238 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419350.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence024 103 1257 gene locus_tag LOCUS_17840 103 1257 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681116.1 protein_id gnl|my_center|LOCUS_17840 1254 3695 gene locus_tag LOCUS_17850 1254 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 4298 3789 gene locus_tag LOCUS_17860 4298 3789 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_17860 4887 5933 gene locus_tag LOCUS_17870 4887 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 6000 7598 gene locus_tag LOCUS_17880 6000 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 7558 8892 gene locus_tag LOCUS_17890 7558 8892 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_17890 8984 9994 gene locus_tag LOCUS_17900 8984 9994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 10149 10421 gene locus_tag LOCUS_17910 10149 10421 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905402.1 protein_id gnl|my_center|LOCUS_17910 10517 10756 gene locus_tag LOCUS_17920 10517 10756 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287407.1 protein_id gnl|my_center|LOCUS_17920 10886 11170 gene locus_tag LOCUS_17930 10886 11170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 11183 11524 gene locus_tag LOCUS_17940 11183 11524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 11625 11963 gene locus_tag LOCUS_17950 11625 11963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 12099 13505 gene locus_tag LOCUS_17960 12099 13505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 13603 15027 gene locus_tag LOCUS_17970 gene tilS 13603 15027 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048376.1 protein_id gnl|my_center|LOCUS_17970 15011 15538 gene locus_tag LOCUS_17980 gene hpt 15011 15538 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_17980 15568 17391 gene locus_tag LOCUS_17990 gene ftsH 15568 17391 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966478.1 protein_id gnl|my_center|LOCUS_17990 17537 19585 gene locus_tag LOCUS_18000 17537 19585 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403141.1 protein_id gnl|my_center|LOCUS_18000 19609 21516 gene locus_tag LOCUS_18010 gene metG 19609 21516 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_18010 22591 26136 gene locus_tag LOCUS_18020 22591 26136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 26527 26895 gene locus_tag LOCUS_18030 26527 26895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 27009 27206 gene locus_tag LOCUS_18040 27009 27206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 27246 27557 gene locus_tag LOCUS_18050 27246 27557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 27707 28987 gene locus_tag LOCUS_18060 27707 28987 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476101.1 protein_id gnl|my_center|LOCUS_18060 29237 30067 gene locus_tag LOCUS_18070 29237 30067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 30064 30660 gene locus_tag LOCUS_18080 30064 30660 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700389.1 protein_id gnl|my_center|LOCUS_18080 30678 31751 gene locus_tag LOCUS_18090 30678 31751 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476099.1 protein_id gnl|my_center|LOCUS_18090 31764 32891 gene locus_tag LOCUS_18100 31764 32891 CDS product EpsG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208052.1 protein_id gnl|my_center|LOCUS_18100 32915 33874 gene locus_tag LOCUS_18110 32915 33874 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905212.1 protein_id gnl|my_center|LOCUS_18110 33891 34778 gene locus_tag LOCUS_18120 33891 34778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 34795 35904 gene locus_tag LOCUS_18130 34795 35904 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225909.1 protein_id gnl|my_center|LOCUS_18130 35901 36962 gene locus_tag LOCUS_18140 gene lsgC 35901 36962 CDS product lipooligosaccharide biosynthesis family 4 glycosyltransferase LsgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694187.1 protein_id gnl|my_center|LOCUS_18140 36977 37552 gene locus_tag LOCUS_18150 36977 37552 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257514.1 protein_id gnl|my_center|LOCUS_18150 37778 38764 gene locus_tag LOCUS_18160 37778 38764 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362087.1 protein_id gnl|my_center|LOCUS_18160 38800 39768 gene locus_tag LOCUS_18170 38800 39768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 39923 40255 gene locus_tag LOCUS_18180 39923 40255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 40505 41161 gene locus_tag LOCUS_18190 40505 41161 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461004.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence025 1551 205 gene locus_tag LOCUS_18200 1551 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 2175 1606 gene locus_tag LOCUS_18210 gene scpB 2175 1606 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_18210 3018 2218 gene locus_tag LOCUS_18220 3018 2218 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986419.1 protein_id gnl|my_center|LOCUS_18220 4000 3122 gene locus_tag LOCUS_18230 4000 3122 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888897.1 protein_id gnl|my_center|LOCUS_18230 4713 4003 gene locus_tag LOCUS_18240 gene deoC 4713 4003 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949107.1 protein_id gnl|my_center|LOCUS_18240 6021 4795 gene locus_tag LOCUS_18250 6021 4795 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 protein_id gnl|my_center|LOCUS_18250 6943 6107 gene locus_tag LOCUS_18260 6943 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 7384 8109 gene locus_tag LOCUS_18270 7384 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 8860 8252 gene locus_tag LOCUS_18280 8860 8252 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948614.1 protein_id gnl|my_center|LOCUS_18280 9552 9091 gene locus_tag LOCUS_18290 9552 9091 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_18290 10954 9713 gene locus_tag LOCUS_18300 10954 9713 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291561.1 protein_id gnl|my_center|LOCUS_18300 11290 11060 gene locus_tag LOCUS_18310 11290 11060 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905235.1 protein_id gnl|my_center|LOCUS_18310 11507 11298 gene locus_tag LOCUS_18320 11507 11298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 13140 11731 gene locus_tag LOCUS_18330 13140 11731 CDS product virulence-associated E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001668899.1 protein_id gnl|my_center|LOCUS_18330 13693 13076 gene locus_tag LOCUS_18340 13693 13076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 14973 13753 gene locus_tag LOCUS_18350 14973 13753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 15794 15486 gene locus_tag LOCUS_18360 15794 15486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 19296 15808 gene locus_tag LOCUS_18370 19296 15808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 22470 19297 gene locus_tag LOCUS_18380 22470 19297 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_18380 23274 22666 gene locus_tag LOCUS_18390 23274 22666 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_18390 23736 23428 gene locus_tag LOCUS_18400 23736 23428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 24127 24933 gene locus_tag LOCUS_18410 24127 24933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 25459 24989 gene locus_tag LOCUS_18420 25459 24989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 26603 25710 gene locus_tag LOCUS_18430 26603 25710 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861925.1 protein_id gnl|my_center|LOCUS_18430 27187 26621 gene locus_tag LOCUS_18440 27187 26621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 27629 27258 gene locus_tag LOCUS_18450 27629 27258 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_18450 28384 28175 gene locus_tag LOCUS_18460 28384 28175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 30114 28537 gene locus_tag LOCUS_18470 30114 28537 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775555.1 protein_id gnl|my_center|LOCUS_18470 31802 30111 gene locus_tag LOCUS_18480 31802 30111 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_18480 33495 31804 gene locus_tag LOCUS_18490 33495 31804 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_18490 33852 33604 gene locus_tag LOCUS_18500 33852 33604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 34216 33833 gene locus_tag LOCUS_18510 34216 33833 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_18510 35238 34765 gene locus_tag LOCUS_18520 35238 34765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 36035 35604 gene locus_tag LOCUS_18530 36035 35604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 36250 36032 gene locus_tag LOCUS_18540 36250 36032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 36708 36394 gene locus_tag LOCUS_18550 36708 36394 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435155.1 protein_id gnl|my_center|LOCUS_18550 37244 36870 gene locus_tag LOCUS_18560 37244 36870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 37817 37245 gene locus_tag LOCUS_18570 37817 37245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 38287 38048 gene locus_tag LOCUS_18580 38287 38048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 38512 38300 gene locus_tag LOCUS_18590 38512 38300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 39774 38527 gene locus_tag LOCUS_18600 39774 38527 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_18600 39967 40707 gene locus_tag LOCUS_18610 39967 40707 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922199.1 protein_id gnl|my_center|LOCUS_18610 40775 41005 gene locus_tag LOCUS_18620 40775 41005 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438035.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence026 1325 1161 gene locus_tag LOCUS_18630 1325 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 2279 1365 gene locus_tag LOCUS_18640 2279 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 2968 2276 gene locus_tag LOCUS_18650 2968 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 3157 4644 gene locus_tag LOCUS_18660 3157 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 5014 4799 gene locus_tag LOCUS_18670 5014 4799 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985621.1 protein_id gnl|my_center|LOCUS_18670 8065 5315 gene locus_tag LOCUS_18680 8065 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 15478 8147 gene locus_tag LOCUS_18690 15478 8147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 15790 15482 gene locus_tag LOCUS_18700 15790 15482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 16964 15864 gene locus_tag LOCUS_18710 16964 15864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 23480 17184 gene locus_tag LOCUS_18720 23480 17184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 24196 23549 gene locus_tag LOCUS_18730 24196 23549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 24405 24247 gene locus_tag LOCUS_18740 24405 24247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 26023 24470 gene locus_tag LOCUS_18750 26023 24470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 26627 26274 gene locus_tag LOCUS_18760 26627 26274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 27311 26775 gene locus_tag LOCUS_18770 27311 26775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 28254 27355 gene locus_tag LOCUS_18780 28254 27355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 28601 28323 gene locus_tag LOCUS_18790 28601 28323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 30846 29002 gene locus_tag LOCUS_18800 30846 29002 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_18800 32312 30849 gene locus_tag LOCUS_18810 32312 30849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 33740 32313 gene locus_tag LOCUS_18820 33740 32313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 34056 33703 gene locus_tag LOCUS_18830 34056 33703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 36853 34037 gene locus_tag LOCUS_18840 36853 34037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 39440 36984 gene locus_tag LOCUS_18850 39440 36984 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_18850 39786 39322 gene locus_tag LOCUS_18860 39786 39322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 40049 39810 gene locus_tag LOCUS_18870 40049 39810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence027 445 224 gene locus_tag LOCUS_18880 445 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 7831 614 gene locus_tag LOCUS_18890 7831 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 8117 7983 gene locus_tag LOCUS_18900 8117 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 8153 8491 gene locus_tag LOCUS_18910 8153 8491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 8533 9333 gene locus_tag LOCUS_18920 8533 9333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 11694 9538 gene locus_tag LOCUS_18930 11694 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 12912 11770 gene locus_tag LOCUS_18940 12912 11770 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460082.1 protein_id gnl|my_center|LOCUS_18940 13191 17813 gene locus_tag LOCUS_18950 13191 17813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 19186 17972 gene locus_tag LOCUS_18960 19186 17972 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986227.1 protein_id gnl|my_center|LOCUS_18960 19794 19183 gene locus_tag LOCUS_18970 19794 19183 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948833.1 protein_id gnl|my_center|LOCUS_18970 20015 20359 gene locus_tag LOCUS_18980 20015 20359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 21241 20468 gene locus_tag LOCUS_18990 21241 20468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 22042 21422 gene locus_tag LOCUS_19000 22042 21422 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281989.1 protein_id gnl|my_center|LOCUS_19000 23164 22169 gene locus_tag LOCUS_19010 23164 22169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 24460 23438 gene locus_tag LOCUS_19020 24460 23438 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476131.1 protein_id gnl|my_center|LOCUS_19020 24929 24741 gene locus_tag LOCUS_19030 24929 24741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 25848 25018 gene locus_tag LOCUS_19040 25848 25018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 28291 25940 gene locus_tag LOCUS_19050 28291 25940 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_19050 28890 28330 gene locus_tag LOCUS_19060 28890 28330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 29086 28934 gene locus_tag LOCUS_19070 29086 28934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 30739 29618 gene locus_tag LOCUS_19080 30739 29618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 31202 30768 gene locus_tag LOCUS_19090 31202 30768 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966983.1 protein_id gnl|my_center|LOCUS_19090 31539 31195 gene locus_tag LOCUS_19100 31539 31195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 32091 32249 gene locus_tag LOCUS_19110 32091 32249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 32832 32338 gene locus_tag LOCUS_19120 32832 32338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 33332 32838 gene locus_tag LOCUS_19130 33332 32838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 33541 33332 gene locus_tag LOCUS_19140 33541 33332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435950.1 protein_id gnl|my_center|LOCUS_19140 34096 33887 gene locus_tag LOCUS_19150 34096 33887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 34343 34089 gene locus_tag LOCUS_19160 34343 34089 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476650.1 protein_id gnl|my_center|LOCUS_19160 35874 34666 gene locus_tag LOCUS_19170 35874 34666 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_19170 36359 36144 gene locus_tag LOCUS_19180 36359 36144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 36780 36391 gene locus_tag LOCUS_19190 36780 36391 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967147.1 protein_id gnl|my_center|LOCUS_19190 37472 36792 gene locus_tag LOCUS_19200 37472 36792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 37757 37536 gene locus_tag LOCUS_19210 37757 37536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 38211 37837 gene locus_tag LOCUS_19220 38211 37837 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476578.1 protein_id gnl|my_center|LOCUS_19220 >Feature sequence028 800 3328 gene locus_tag LOCUS_19230 800 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 3325 3795 gene locus_tag LOCUS_19240 gene tagD 3325 3795 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905633.1 protein_id gnl|my_center|LOCUS_19240 4175 4525 gene locus_tag LOCUS_19250 4175 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 5127 7043 gene locus_tag LOCUS_19260 5127 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 7329 7478 gene locus_tag LOCUS_19270 7329 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 7934 8137 gene locus_tag LOCUS_19280 7934 8137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 8286 10736 gene locus_tag LOCUS_19290 8286 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 10706 11551 gene locus_tag LOCUS_19300 10706 11551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 11541 12743 gene locus_tag LOCUS_19310 gene lysA 11541 12743 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880764.1 protein_id gnl|my_center|LOCUS_19310 12724 12999 gene locus_tag LOCUS_19320 12724 12999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 13172 14140 gene locus_tag LOCUS_19330 13172 14140 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870054.1 protein_id gnl|my_center|LOCUS_19330 14146 15015 gene locus_tag LOCUS_19340 gene nadE 14146 15015 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496806.1 protein_id gnl|my_center|LOCUS_19340 15017 16456 gene locus_tag LOCUS_19350 15017 16456 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392341.1 protein_id gnl|my_center|LOCUS_19350 16425 17393 gene locus_tag LOCUS_19360 16425 17393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231350.1 protein_id gnl|my_center|LOCUS_19360 17646 17855 gene locus_tag LOCUS_19370 17646 17855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 17867 18088 gene locus_tag LOCUS_19380 17867 18088 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360987.1 protein_id gnl|my_center|LOCUS_19380 18194 20368 gene locus_tag LOCUS_19390 gene feoB 18194 20368 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_19390 20424 20561 gene locus_tag LOCUS_19400 20424 20561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 20552 21058 gene locus_tag LOCUS_19410 20552 21058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 21598 23046 gene locus_tag LOCUS_19420 21598 23046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 23163 24953 gene locus_tag LOCUS_19430 23163 24953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 25096 25677 gene locus_tag LOCUS_19440 25096 25677 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389803.1 protein_id gnl|my_center|LOCUS_19440 26492 25716 gene locus_tag LOCUS_19450 26492 25716 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016757.1 protein_id gnl|my_center|LOCUS_19450 26608 26817 gene locus_tag LOCUS_19460 26608 26817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 26922 27635 gene locus_tag LOCUS_19470 26922 27635 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889773.1 protein_id gnl|my_center|LOCUS_19470 27628 29223 gene locus_tag LOCUS_19480 27628 29223 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861453.1 protein_id gnl|my_center|LOCUS_19480 29198 29425 gene locus_tag LOCUS_19490 29198 29425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 29418 30077 gene locus_tag LOCUS_19500 29418 30077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 30086 30523 gene locus_tag LOCUS_19510 30086 30523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 30751 32355 gene locus_tag LOCUS_19520 gene pckA 30751 32355 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_19520 32632 37593 gene locus_tag LOCUS_19530 32632 37593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence029 104 430 gene locus_tag LOCUS_19540 104 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 702 1085 gene locus_tag LOCUS_19550 702 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 1878 2315 gene locus_tag LOCUS_19560 1878 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 2801 3073 gene locus_tag LOCUS_19570 2801 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 4746 3424 gene locus_tag LOCUS_19580 4746 3424 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490912.1 protein_id gnl|my_center|LOCUS_19580 6307 4769 gene locus_tag LOCUS_19590 gene asnB 6307 4769 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860775.1 protein_id gnl|my_center|LOCUS_19590 8019 6493 gene locus_tag LOCUS_19600 8019 6493 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_19600 8938 8138 gene locus_tag LOCUS_19610 8938 8138 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_19610 9382 8963 gene locus_tag LOCUS_19620 9382 8963 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_19620 10700 9402 gene locus_tag LOCUS_19630 10700 9402 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_19630 11226 10687 gene locus_tag LOCUS_19640 11226 10687 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_19640 13045 11306 gene locus_tag LOCUS_19650 gene iorA 13045 11306 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_19650 14783 13149 gene locus_tag LOCUS_19660 14783 13149 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_19660 15803 14901 gene locus_tag LOCUS_19670 15803 14901 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002932053.1 protein_id gnl|my_center|LOCUS_19670 15965 17659 gene locus_tag LOCUS_19680 15965 17659 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860825.1 protein_id gnl|my_center|LOCUS_19680 17741 18370 gene locus_tag LOCUS_19690 17741 18370 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965980.1 protein_id gnl|my_center|LOCUS_19690 23057 18459 gene locus_tag LOCUS_19700 23057 18459 CDS product lamin tail domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053545967.1 protein_id gnl|my_center|LOCUS_19700 23885 23208 gene locus_tag LOCUS_19710 23885 23208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 24863 24093 gene locus_tag LOCUS_19720 24863 24093 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_19720 25492 24890 gene locus_tag LOCUS_19730 25492 24890 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_19730 26607 25561 gene locus_tag LOCUS_19740 gene hydE 26607 25561 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048412.1 protein_id gnl|my_center|LOCUS_19740 27394 26732 gene locus_tag LOCUS_19750 27394 26732 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356305.1 protein_id gnl|my_center|LOCUS_19750 28178 27420 gene locus_tag LOCUS_19760 28178 27420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 29887 28292 gene locus_tag LOCUS_19770 29887 28292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 30651 29893 gene locus_tag LOCUS_19780 30651 29893 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815845.1 protein_id gnl|my_center|LOCUS_19780 31367 30690 gene locus_tag LOCUS_19790 31367 30690 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154147.1 protein_id gnl|my_center|LOCUS_19790 32007 31348 gene locus_tag LOCUS_19800 32007 31348 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384107.1 protein_id gnl|my_center|LOCUS_19800 32821 32261 gene locus_tag LOCUS_19810 gene pdxT 32821 32261 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113516.1 protein_id gnl|my_center|LOCUS_19810 33698 32823 gene locus_tag LOCUS_19820 gene pdxS 33698 32823 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813582.1 protein_id gnl|my_center|LOCUS_19820 35058 33859 gene locus_tag LOCUS_19830 35058 33859 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948998.1 protein_id gnl|my_center|LOCUS_19830 35939 35133 gene locus_tag LOCUS_19840 35939 35133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19840 >Feature sequence030 158 310 gene locus_tag LOCUS_19850 158 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 300 635 gene locus_tag LOCUS_19860 300 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 625 1767 gene locus_tag LOCUS_19870 625 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 1865 2098 gene locus_tag LOCUS_19880 1865 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 2175 2435 gene locus_tag LOCUS_19890 2175 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 2622 4052 gene locus_tag LOCUS_19900 2622 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 4070 4444 gene locus_tag LOCUS_19910 4070 4444 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_19910 4539 5384 gene locus_tag LOCUS_19920 4539 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 5381 6076 gene locus_tag LOCUS_19930 5381 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 6080 7264 gene locus_tag LOCUS_19940 6080 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 7956 8120 gene locus_tag LOCUS_19950 7956 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 8352 8693 gene locus_tag LOCUS_19960 8352 8693 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263753.1 protein_id gnl|my_center|LOCUS_19960 8929 9600 gene locus_tag LOCUS_19970 8929 9600 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673992.1 protein_id gnl|my_center|LOCUS_19970 9745 10248 gene locus_tag LOCUS_19980 9745 10248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19980 10273 12486 gene locus_tag LOCUS_19990 10273 12486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19990 12470 12679 gene locus_tag LOCUS_20000 12470 12679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 12806 13072 gene locus_tag LOCUS_20010 12806 13072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 13005 15299 gene locus_tag LOCUS_20020 13005 15299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20020 15447 16673 gene locus_tag LOCUS_20030 15447 16673 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_20030 16805 17143 gene locus_tag LOCUS_20040 16805 17143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 17353 17541 gene locus_tag LOCUS_20050 17353 17541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 17548 17703 gene locus_tag LOCUS_20060 17548 17703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 17741 19570 gene locus_tag LOCUS_20070 gene ftsH 17741 19570 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_20070 19567 20109 gene locus_tag LOCUS_20080 19567 20109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 20155 20412 gene locus_tag LOCUS_20090 20155 20412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 20664 21227 gene locus_tag LOCUS_20100 20664 21227 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294657.1 protein_id gnl|my_center|LOCUS_20100 24612 21382 gene locus_tag LOCUS_20110 gene carB 24612 21382 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_20110 25095 26387 gene locus_tag LOCUS_20120 gene guaA 25095 26387 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764094.1 protein_id gnl|my_center|LOCUS_20120 27043 26588 gene locus_tag LOCUS_20130 27043 26588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 27221 27415 gene locus_tag LOCUS_20140 27221 27415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 27418 28533 gene locus_tag LOCUS_20150 27418 28533 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_20150 28523 28843 gene locus_tag LOCUS_20160 28523 28843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 28968 30035 gene locus_tag LOCUS_20170 28968 30035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 30101 30340 gene locus_tag LOCUS_20180 30101 30340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 30532 30759 gene locus_tag LOCUS_20190 30532 30759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 31045 32466 gene locus_tag LOCUS_20200 31045 32466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 32471 32845 gene locus_tag LOCUS_20210 32471 32845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 33102 33761 gene locus_tag LOCUS_20220 33102 33761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 33774 34397 gene locus_tag LOCUS_20230 33774 34397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 34553 34801 gene locus_tag LOCUS_20240 34553 34801 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812819.1 protein_id gnl|my_center|LOCUS_20240 34803 35102 gene locus_tag LOCUS_20250 34803 35102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence031 1334 396 gene locus_tag LOCUS_20260 1334 396 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138390504.1 protein_id gnl|my_center|LOCUS_20260 2433 1543 gene locus_tag LOCUS_20270 2433 1543 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583874.1 protein_id gnl|my_center|LOCUS_20270 2825 3589 gene locus_tag LOCUS_20280 gene srtB 2825 3589 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242427.1 protein_id gnl|my_center|LOCUS_20280 3603 6722 gene locus_tag LOCUS_20290 3603 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 7607 6882 gene locus_tag LOCUS_20300 7607 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20300 8362 7628 gene locus_tag LOCUS_20310 8362 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20310 8620 8447 gene locus_tag LOCUS_20320 8620 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 8930 8730 gene locus_tag LOCUS_20330 8930 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 9690 9280 gene locus_tag LOCUS_20340 9690 9280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 10707 10078 gene locus_tag LOCUS_20350 10707 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 12437 11019 gene locus_tag LOCUS_20360 12437 11019 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986504.1 protein_id gnl|my_center|LOCUS_20360 12732 12421 gene locus_tag LOCUS_20370 12732 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 14367 13246 gene locus_tag LOCUS_20380 14367 13246 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775575.1 protein_id gnl|my_center|LOCUS_20380 14751 14467 gene locus_tag LOCUS_20390 14751 14467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 15123 14893 gene locus_tag LOCUS_20400 15123 14893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 15210 15581 gene locus_tag LOCUS_20410 15210 15581 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890862.1 protein_id gnl|my_center|LOCUS_20410 15641 16540 gene locus_tag LOCUS_20420 15641 16540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 16799 16590 gene locus_tag LOCUS_20430 16799 16590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 17033 16911 gene locus_tag LOCUS_20440 17033 16911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 18502 17216 gene locus_tag LOCUS_20450 18502 17216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 19199 18495 gene locus_tag LOCUS_20460 19199 18495 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313094.1 protein_id gnl|my_center|LOCUS_20460 19367 19945 gene locus_tag LOCUS_20470 19367 19945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 19956 21152 gene locus_tag LOCUS_20480 19956 21152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 21155 22594 gene locus_tag LOCUS_20490 21155 22594 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287129.1 protein_id gnl|my_center|LOCUS_20490 22607 23320 gene locus_tag LOCUS_20500 22607 23320 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426165.1 protein_id gnl|my_center|LOCUS_20500 24800 23433 gene locus_tag LOCUS_20510 24800 23433 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861101.1 protein_id gnl|my_center|LOCUS_20510 25090 24767 gene locus_tag LOCUS_20520 gene mobC 25090 24767 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861100.1 protein_id gnl|my_center|LOCUS_20520 25290 25709 gene locus_tag LOCUS_20530 25290 25709 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244448.1 protein_id gnl|my_center|LOCUS_20530 25753 26127 gene locus_tag LOCUS_20540 25753 26127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 26324 27169 gene locus_tag LOCUS_20550 26324 27169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 28196 27261 gene locus_tag LOCUS_20560 28196 27261 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681808.1 protein_id gnl|my_center|LOCUS_20560 28375 28704 gene locus_tag LOCUS_20570 28375 28704 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965858.1 protein_id gnl|my_center|LOCUS_20570 28774 29397 gene locus_tag LOCUS_20580 28774 29397 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287965.1 protein_id gnl|my_center|LOCUS_20580 30482 29556 gene locus_tag LOCUS_20590 30482 29556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 30673 30500 gene locus_tag LOCUS_20600 30673 30500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 31450 30818 gene locus_tag LOCUS_20610 31450 30818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 31436 31924 gene locus_tag LOCUS_20620 31436 31924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 32026 32349 gene locus_tag LOCUS_20630 32026 32349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 32578 32796 gene locus_tag LOCUS_20640 32578 32796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 32932 33174 gene locus_tag LOCUS_20650 32932 33174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence032 108 299 gene locus_tag LOCUS_20660 108 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 343 522 gene locus_tag LOCUS_20670 343 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 536 817 gene locus_tag LOCUS_20680 536 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 780 980 gene locus_tag LOCUS_20690 780 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 1079 1339 gene locus_tag LOCUS_20700 1079 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 1323 4553 gene locus_tag LOCUS_20710 1323 4553 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 protein_id gnl|my_center|LOCUS_20710 4653 5306 gene locus_tag LOCUS_20720 4653 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 5306 5797 gene locus_tag LOCUS_20730 5306 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 5812 7791 gene locus_tag LOCUS_20740 5812 7791 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555499.1 protein_id gnl|my_center|LOCUS_20740 7805 10855 gene locus_tag LOCUS_20750 7805 10855 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202280.1 protein_id gnl|my_center|LOCUS_20750 10874 14275 gene locus_tag LOCUS_20760 10874 14275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 14329 14562 gene locus_tag LOCUS_20770 14329 14562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 14660 17128 gene locus_tag LOCUS_20780 14660 17128 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163262492.1 protein_id gnl|my_center|LOCUS_20780 17148 20171 gene locus_tag LOCUS_20790 17148 20171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 20192 21985 gene locus_tag LOCUS_20800 20192 21985 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109303.1 protein_id gnl|my_center|LOCUS_20800 22014 22610 gene locus_tag LOCUS_20810 22014 22610 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109982.1 protein_id gnl|my_center|LOCUS_20810 22571 23749 gene locus_tag LOCUS_20820 22571 23749 CDS product HNH endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986608.1 protein_id gnl|my_center|LOCUS_20820 23727 24119 gene locus_tag LOCUS_20830 23727 24119 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860652.1 protein_id gnl|my_center|LOCUS_20830 24131 24862 gene locus_tag LOCUS_20840 24131 24862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 24859 25200 gene locus_tag LOCUS_20850 24859 25200 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963739.1 protein_id gnl|my_center|LOCUS_20850 25202 25843 gene locus_tag LOCUS_20860 25202 25843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942932.1 protein_id gnl|my_center|LOCUS_20860 25856 27079 gene locus_tag LOCUS_20870 25856 27079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 27188 27865 gene locus_tag LOCUS_20880 27188 27865 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_20880 27887 28219 gene locus_tag LOCUS_20890 27887 28219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 28232 28780 gene locus_tag LOCUS_20900 28232 28780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 28777 30147 gene locus_tag LOCUS_20910 28777 30147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 30268 31248 gene locus_tag LOCUS_20920 30268 31248 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837604.1 protein_id gnl|my_center|LOCUS_20920 31255 32523 gene locus_tag LOCUS_20930 31255 32523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence033 841 107 gene locus_tag LOCUS_20940 841 107 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416671.1 protein_id gnl|my_center|LOCUS_20940 2541 838 gene locus_tag LOCUS_20950 2541 838 CDS product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425530.1 protein_id gnl|my_center|LOCUS_20950 3395 2538 gene locus_tag LOCUS_20960 3395 2538 CDS product putative 2-aminoethylphosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006189.1 protein_id gnl|my_center|LOCUS_20960 3813 5270 gene locus_tag LOCUS_20970 3813 5270 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_20970 8109 5923 gene locus_tag LOCUS_20980 8109 5923 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296412.1 protein_id gnl|my_center|LOCUS_20980 8331 9173 gene locus_tag LOCUS_20990 8331 9173 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_20990 9358 9825 gene locus_tag LOCUS_21000 9358 9825 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016571.1 protein_id gnl|my_center|LOCUS_21000 10622 10002 gene locus_tag LOCUS_21010 10622 10002 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435157.1 protein_id gnl|my_center|LOCUS_21010 11344 10634 gene locus_tag LOCUS_21020 11344 10634 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_21020 12117 11359 gene locus_tag LOCUS_21030 12117 11359 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_21030 13199 12120 gene locus_tag LOCUS_21040 13199 12120 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_21040 14093 13209 gene locus_tag LOCUS_21050 14093 13209 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_21050 15340 14165 gene locus_tag LOCUS_21060 15340 14165 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_21060 16094 15495 gene locus_tag LOCUS_21070 16094 15495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 16334 16131 gene locus_tag LOCUS_21080 16334 16131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 20956 16502 gene locus_tag LOCUS_21090 20956 16502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 21659 20949 gene locus_tag LOCUS_21100 21659 20949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 23285 21666 gene locus_tag LOCUS_21110 23285 21666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101579180.1 protein_id gnl|my_center|LOCUS_21110 24431 23451 gene locus_tag LOCUS_21120 24431 23451 CDS product DUF2220 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233576.1 protein_id gnl|my_center|LOCUS_21120 24637 24443 gene locus_tag LOCUS_21130 24637 24443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 24861 24637 gene locus_tag LOCUS_21140 24861 24637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 25151 25705 gene locus_tag LOCUS_21150 25151 25705 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924525.1 protein_id gnl|my_center|LOCUS_21150 25719 26705 gene locus_tag LOCUS_21160 gene bioB 25719 26705 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_21160 26936 27574 gene locus_tag LOCUS_21170 gene upp 26936 27574 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515974.1 protein_id gnl|my_center|LOCUS_21170 28950 27691 gene locus_tag LOCUS_21180 gene uraA 28950 27691 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667891.1 protein_id gnl|my_center|LOCUS_21180 29855 29109 gene locus_tag LOCUS_21190 gene yaaA 29855 29109 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458998.1 protein_id gnl|my_center|LOCUS_21190 30307 29855 gene locus_tag LOCUS_21200 gene bcp 30307 29855 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence034 2041 251 gene locus_tag LOCUS_21210 gene aspS 2041 251 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965567.1 protein_id gnl|my_center|LOCUS_21210 3393 2143 gene locus_tag LOCUS_21220 gene hisS 3393 2143 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_21220 4823 3384 gene locus_tag LOCUS_21230 4823 3384 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048077.1 protein_id gnl|my_center|LOCUS_21230 5490 4870 gene locus_tag LOCUS_21240 5490 4870 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_21240 7803 5497 gene locus_tag LOCUS_21250 7803 5497 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_21250 9620 7908 gene locus_tag LOCUS_21260 gene recJ 9620 7908 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943623.1 protein_id gnl|my_center|LOCUS_21260 12034 9773 gene locus_tag LOCUS_21270 gene secDF 12034 9773 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749795.1 protein_id gnl|my_center|LOCUS_21270 13446 12031 gene locus_tag LOCUS_21280 gene scfB 13446 12031 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_21280 13709 13566 gene locus_tag LOCUS_21290 gene scfA 13709 13566 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_21290 14180 13794 gene locus_tag LOCUS_21300 14180 13794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 14835 14290 gene locus_tag LOCUS_21310 gene spoVT 14835 14290 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_21310 15056 15697 gene locus_tag LOCUS_21320 gene eutD 15056 15697 CDS product ethanolamine utilization phosphate acetyltransferase EutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357516.1 protein_id gnl|my_center|LOCUS_21320 15833 16279 gene locus_tag LOCUS_21330 15833 16279 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_21330 16284 17213 gene locus_tag LOCUS_21340 16284 17213 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546354.1 protein_id gnl|my_center|LOCUS_21340 18053 17310 gene locus_tag LOCUS_21350 gene tsaA 18053 17310 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_21350 22790 18162 gene locus_tag LOCUS_21360 22790 18162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 23335 22952 gene locus_tag LOCUS_21370 23335 22952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 25146 23464 gene locus_tag LOCUS_21380 25146 23464 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_21380 26211 25636 gene locus_tag LOCUS_21390 26211 25636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 27303 26212 gene locus_tag LOCUS_21400 27303 26212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 27611 27309 gene locus_tag LOCUS_21410 27611 27309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 27921 27625 gene locus_tag LOCUS_21420 27921 27625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 29789 28161 gene locus_tag LOCUS_21430 29789 28161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 30056 29802 gene locus_tag LOCUS_21440 30056 29802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 30346 30053 gene locus_tag LOCUS_21450 30346 30053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 30674 30375 gene locus_tag LOCUS_21460 30674 30375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence035 161 664 gene locus_tag LOCUS_21470 161 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 2276 843 gene locus_tag LOCUS_21480 gene gatB 2276 843 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_21480 3793 2282 gene locus_tag LOCUS_21490 gene gatA 3793 2282 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_21490 4101 3808 gene locus_tag LOCUS_21500 gene gatC 4101 3808 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_21500 5417 4242 gene locus_tag LOCUS_21510 5417 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 6907 5576 gene locus_tag LOCUS_21520 gene aspS 6907 5576 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948698.1 protein_id gnl|my_center|LOCUS_21520 8902 7391 gene locus_tag LOCUS_21530 8902 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 9152 8919 gene locus_tag LOCUS_21540 gene acpP 9152 8919 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154310.1 protein_id gnl|my_center|LOCUS_21540 10644 9241 gene locus_tag LOCUS_21550 10644 9241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 11591 10641 gene locus_tag LOCUS_21560 11591 10641 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722331.1 protein_id gnl|my_center|LOCUS_21560 11928 11602 gene locus_tag LOCUS_21570 11928 11602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 12213 12842 gene locus_tag LOCUS_21580 12213 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 14232 13039 gene locus_tag LOCUS_21590 14232 13039 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_21590 15470 14250 gene locus_tag LOCUS_21600 15470 14250 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305385.1 protein_id gnl|my_center|LOCUS_21600 16435 15482 gene locus_tag LOCUS_21610 gene ftsX 16435 15482 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_21610 17111 16425 gene locus_tag LOCUS_21620 gene ftsE 17111 16425 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_21620 18292 17201 gene locus_tag LOCUS_21630 18292 17201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 19209 18493 gene locus_tag LOCUS_21640 19209 18493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 19561 19373 gene locus_tag LOCUS_21650 19561 19373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 19881 19696 gene locus_tag LOCUS_21660 19881 19696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 20885 20010 gene locus_tag LOCUS_21670 20885 20010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 21811 20972 gene locus_tag LOCUS_21680 21811 20972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 22131 21808 gene locus_tag LOCUS_21690 22131 21808 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_21690 22547 22278 gene locus_tag LOCUS_21700 22547 22278 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229490.1 protein_id gnl|my_center|LOCUS_21700 26205 22549 gene locus_tag LOCUS_21710 gene addA 26205 22549 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861079.1 protein_id gnl|my_center|LOCUS_21710 29613 26206 gene locus_tag LOCUS_21720 gene addB 29613 26206 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence036 616 891 gene locus_tag LOCUS_21730 616 891 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666876.1 protein_id gnl|my_center|LOCUS_21730 888 1289 gene locus_tag LOCUS_21740 888 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956671.1 protein_id gnl|my_center|LOCUS_21740 1691 1515 gene locus_tag LOCUS_21750 1691 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 1901 1719 gene locus_tag LOCUS_21760 1901 1719 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405297.1 protein_id gnl|my_center|LOCUS_21760 2460 1891 gene locus_tag LOCUS_21770 2460 1891 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_21770 2650 2429 gene locus_tag LOCUS_21780 2650 2429 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607016.1 protein_id gnl|my_center|LOCUS_21780 3069 2701 gene locus_tag LOCUS_21790 3069 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 4807 3134 gene locus_tag LOCUS_21800 4807 3134 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_21800 5325 4819 gene locus_tag LOCUS_21810 gene ybeY 5325 4819 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047996.1 protein_id gnl|my_center|LOCUS_21810 6335 5322 gene locus_tag LOCUS_21820 6335 5322 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_21820 7632 6310 gene locus_tag LOCUS_21830 gene yqfD 7632 6310 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047998.1 protein_id gnl|my_center|LOCUS_21830 8027 7689 gene locus_tag LOCUS_21840 8027 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 9396 8092 gene locus_tag LOCUS_21850 9396 8092 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986425.1 protein_id gnl|my_center|LOCUS_21850 10140 9430 gene locus_tag LOCUS_21860 10140 9430 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814285.1 protein_id gnl|my_center|LOCUS_21860 10479 10273 gene locus_tag LOCUS_21870 10479 10273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 13934 10470 gene locus_tag LOCUS_21880 13934 10470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 14239 15213 gene locus_tag LOCUS_21890 14239 15213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 16068 15331 gene locus_tag LOCUS_21900 16068 15331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 16229 16957 gene locus_tag LOCUS_21910 16229 16957 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368777.1 protein_id gnl|my_center|LOCUS_21910 16947 17258 gene locus_tag LOCUS_21920 16947 17258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 17735 17274 gene locus_tag LOCUS_21930 17735 17274 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454155.1 protein_id gnl|my_center|LOCUS_21930 18515 17763 gene locus_tag LOCUS_21940 18515 17763 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_21940 19049 18636 gene locus_tag LOCUS_21950 19049 18636 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_21950 19741 19082 gene locus_tag LOCUS_21960 19741 19082 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965791.1 protein_id gnl|my_center|LOCUS_21960 20216 19743 gene locus_tag LOCUS_21970 gene ribH 20216 19743 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230892.1 protein_id gnl|my_center|LOCUS_21970 21480 20269 gene locus_tag LOCUS_21980 21480 20269 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905673.1 protein_id gnl|my_center|LOCUS_21980 22171 21515 gene locus_tag LOCUS_21990 22171 21515 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_21990 23356 22268 gene locus_tag LOCUS_22000 gene ribD 23356 22268 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905672.1 protein_id gnl|my_center|LOCUS_22000 29261 23712 gene locus_tag LOCUS_22010 29261 23712 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390242.1 protein_id gnl|my_center|LOCUS_22010 29813 29340 gene locus_tag LOCUS_22020 29813 29340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 >Feature sequence037 1118 33 gene locus_tag LOCUS_22030 1118 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 2069 1143 gene locus_tag LOCUS_22040 2069 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 3549 2317 gene locus_tag LOCUS_22050 gene rlmD 3549 2317 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 protein_id gnl|my_center|LOCUS_22050 4378 3560 gene locus_tag LOCUS_22060 4378 3560 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_22060 4694 4518 gene locus_tag LOCUS_22070 4694 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 5396 4827 gene locus_tag LOCUS_22080 5396 4827 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678780.1 protein_id gnl|my_center|LOCUS_22080 7752 5431 gene locus_tag LOCUS_22090 7752 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 7894 7757 gene locus_tag LOCUS_22100 7894 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 8693 8181 gene locus_tag LOCUS_22110 8693 8181 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567165.1 protein_id gnl|my_center|LOCUS_22110 9175 8693 gene locus_tag LOCUS_22120 9175 8693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 10394 9744 gene locus_tag LOCUS_22130 gene trmB 10394 9744 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239385.1 protein_id gnl|my_center|LOCUS_22130 10655 10963 gene locus_tag LOCUS_22140 10655 10963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 10966 12012 gene locus_tag LOCUS_22150 10966 12012 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868882.1 protein_id gnl|my_center|LOCUS_22150 12009 13958 gene locus_tag LOCUS_22160 12009 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 13980 14414 gene locus_tag LOCUS_22170 13980 14414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 14414 14722 gene locus_tag LOCUS_22180 14414 14722 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_22180 14736 15323 gene locus_tag LOCUS_22190 14736 15323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 15316 17082 gene locus_tag LOCUS_22200 15316 17082 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_22200 17098 18483 gene locus_tag LOCUS_22210 17098 18483 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_22210 18505 19122 gene locus_tag LOCUS_22220 18505 19122 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_22220 20342 19221 gene locus_tag LOCUS_22230 20342 19221 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546519.1 protein_id gnl|my_center|LOCUS_22230 21213 20326 gene locus_tag LOCUS_22240 21213 20326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 21683 21405 gene locus_tag LOCUS_22250 21683 21405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 25454 21693 gene locus_tag LOCUS_22260 25454 21693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 25777 25535 gene locus_tag LOCUS_22270 25777 25535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 26063 25887 gene locus_tag LOCUS_22280 26063 25887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 27375 26227 gene locus_tag LOCUS_22290 27375 26227 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_22290 >Feature sequence038 2277 163 gene locus_tag LOCUS_22300 2277 163 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_22300 3347 2484 gene locus_tag LOCUS_22310 gene fba 3347 2484 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_22310 4377 3628 gene locus_tag LOCUS_22320 4377 3628 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203367.1 protein_id gnl|my_center|LOCUS_22320 5949 4516 gene locus_tag LOCUS_22330 gene nagE 5949 4516 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705424.1 protein_id gnl|my_center|LOCUS_22330 6518 6036 gene locus_tag LOCUS_22340 6518 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 7796 6744 gene locus_tag LOCUS_22350 7796 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 8905 7793 gene locus_tag LOCUS_22360 gene nagA 8905 7793 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292242.1 protein_id gnl|my_center|LOCUS_22360 9794 9060 gene locus_tag LOCUS_22370 gene nagB 9794 9060 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_22370 10342 10271 gene locus_tag LOCUS_t00270 10342 10271 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11363 10428 gene locus_tag LOCUS_22380 11363 10428 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563760.1 protein_id gnl|my_center|LOCUS_22380 11661 11404 gene locus_tag LOCUS_22390 11661 11404 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_22390 12617 11658 gene locus_tag LOCUS_22400 gene whiA 12617 11658 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357358.1 protein_id gnl|my_center|LOCUS_22400 13523 12645 gene locus_tag LOCUS_22410 gene rapZ 13523 12645 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_22410 14450 13545 gene locus_tag LOCUS_22420 gene murB 14450 13545 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_22420 14742 16118 gene locus_tag LOCUS_22430 14742 16118 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_22430 16317 16407 gene locus_tag LOCUS_t00280 16317 16407 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 16582 17355 gene locus_tag LOCUS_22440 16582 17355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 18897 17554 gene locus_tag LOCUS_22450 gene glmM 18897 17554 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 protein_id gnl|my_center|LOCUS_22450 19557 19114 gene locus_tag LOCUS_22460 gene rpiB 19557 19114 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721856.1 protein_id gnl|my_center|LOCUS_22460 20636 19710 gene locus_tag LOCUS_22470 20636 19710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288609.1 protein_id gnl|my_center|LOCUS_22470 21363 20836 gene locus_tag LOCUS_22480 21363 20836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 21573 22448 gene locus_tag LOCUS_22490 21573 22448 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_22490 22464 23372 gene locus_tag LOCUS_22500 22464 23372 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912466.1 protein_id gnl|my_center|LOCUS_22500 25247 23625 gene locus_tag LOCUS_22510 25247 23625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 25785 25228 gene locus_tag LOCUS_22520 25785 25228 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222261.1 protein_id gnl|my_center|LOCUS_22520 26633 25989 gene locus_tag LOCUS_22530 26633 25989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 27268 27020 gene locus_tag LOCUS_22540 27268 27020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 >Feature sequence039 529 125 gene locus_tag LOCUS_22550 529 125 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966983.1 protein_id gnl|my_center|LOCUS_22550 1287 874 gene locus_tag LOCUS_22560 1287 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 1956 1507 gene locus_tag LOCUS_22570 1956 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 3735 2113 gene locus_tag LOCUS_22580 gene tndX 3735 2113 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_22580 4013 3822 gene locus_tag LOCUS_22590 4013 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 5001 4057 gene locus_tag LOCUS_22600 gene mobV 5001 4057 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122374.1 protein_id gnl|my_center|LOCUS_22600 5206 6009 gene locus_tag LOCUS_22610 5206 6009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 6048 6953 gene locus_tag LOCUS_22620 gene cas1 6048 6953 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002797819.1 protein_id gnl|my_center|LOCUS_22620 6950 7255 gene locus_tag LOCUS_22630 gene cas2 6950 7255 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475522.1 protein_id gnl|my_center|LOCUS_22630 7498 7989 gene locus_tag LOCUS_22640 7498 7989 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_22640 8086 8012 gene locus_tag LOCUS_t00290 8086 8012 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 8185 8112 gene locus_tag LOCUS_t00300 8185 8112 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8833 8696 gene locus_tag LOCUS_22650 8833 8696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 12948 9586 gene locus_tag LOCUS_22660 12948 9586 CDS product DUF5011 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389333.1 protein_id gnl|my_center|LOCUS_22660 13633 12983 gene locus_tag LOCUS_22670 13633 12983 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026234.1 protein_id gnl|my_center|LOCUS_22670 14288 13626 gene locus_tag LOCUS_22680 gene rpe 14288 13626 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965037.1 protein_id gnl|my_center|LOCUS_22680 15234 14353 gene locus_tag LOCUS_22690 gene rsgA 15234 14353 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_22690 17318 15234 gene locus_tag LOCUS_22700 gene pknB 17318 15234 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986841.1 protein_id gnl|my_center|LOCUS_22700 18065 17331 gene locus_tag LOCUS_22710 18065 17331 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723065.1 protein_id gnl|my_center|LOCUS_22710 19117 18062 gene locus_tag LOCUS_22720 gene rlmN 19117 18062 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986842.1 protein_id gnl|my_center|LOCUS_22720 20488 19130 gene locus_tag LOCUS_22730 gene rsmB 20488 19130 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_22730 21182 20481 gene locus_tag LOCUS_22740 21182 20481 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287139.1 protein_id gnl|my_center|LOCUS_22740 22172 21219 gene locus_tag LOCUS_22750 gene fmt 22172 21219 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_22750 22676 22173 gene locus_tag LOCUS_22760 gene def 22676 22173 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_22760 24919 22691 gene locus_tag LOCUS_22770 gene priA 24919 22691 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_22770 26394 24925 gene locus_tag LOCUS_22780 26394 24925 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_22780 27197 26652 gene locus_tag LOCUS_22790 27197 26652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence040 187 260 gene locus_tag LOCUS_t00310 187 260 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 333 863 gene locus_tag LOCUS_22800 333 863 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965853.1 protein_id gnl|my_center|LOCUS_22800 886 1605 gene locus_tag LOCUS_22810 886 1605 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186843528.1 protein_id gnl|my_center|LOCUS_22810 1623 2174 gene locus_tag LOCUS_22820 1623 2174 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_22820 2225 2659 gene locus_tag LOCUS_22830 2225 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 2703 3551 gene locus_tag LOCUS_22840 2703 3551 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_22840 3588 4082 gene locus_tag LOCUS_22850 3588 4082 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966286.1 protein_id gnl|my_center|LOCUS_22850 4036 5154 gene locus_tag LOCUS_22860 4036 5154 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020082.1 protein_id gnl|my_center|LOCUS_22860 5145 5849 gene locus_tag LOCUS_22870 5145 5849 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059649.1 protein_id gnl|my_center|LOCUS_22870 5846 6676 gene locus_tag LOCUS_22880 5846 6676 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_22880 6878 8596 gene locus_tag LOCUS_22890 gene ilvB 6878 8596 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458814.1 protein_id gnl|my_center|LOCUS_22890 8597 9199 gene locus_tag LOCUS_22900 gene ilvN 8597 9199 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006862451.1 protein_id gnl|my_center|LOCUS_22900 9327 10352 gene locus_tag LOCUS_22910 9327 10352 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_22910 11362 10514 gene locus_tag LOCUS_22920 11362 10514 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964664.1 protein_id gnl|my_center|LOCUS_22920 13516 11384 gene locus_tag LOCUS_22930 gene ptsG 13516 11384 CDS product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948935.1 protein_id gnl|my_center|LOCUS_22930 14127 15293 gene locus_tag LOCUS_22940 14127 15293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 15348 17192 gene locus_tag LOCUS_22950 15348 17192 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680980.1 protein_id gnl|my_center|LOCUS_22950 17201 18034 gene locus_tag LOCUS_22960 17201 18034 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_22960 18061 18951 gene locus_tag LOCUS_22970 gene hslO 18061 18951 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_22970 18948 20870 gene locus_tag LOCUS_22980 18948 20870 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_22980 21471 21091 gene locus_tag LOCUS_22990 21471 21091 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385301.1 protein_id gnl|my_center|LOCUS_22990 21865 23013 gene locus_tag LOCUS_23000 21865 23013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 23373 23303 gene locus_tag LOCUS_t00320 23373 23303 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 24292 23651 gene locus_tag LOCUS_23010 24292 23651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 24485 24991 gene locus_tag LOCUS_23020 24485 24991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 25110 25185 gene locus_tag LOCUS_t00330 25110 25185 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 25210 25419 gene locus_tag LOCUS_23030 25210 25419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 >Feature sequence041 143 3505 gene locus_tag LOCUS_23040 143 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 3570 4424 gene locus_tag LOCUS_23050 3570 4424 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964728.1 protein_id gnl|my_center|LOCUS_23050 5792 4458 gene locus_tag LOCUS_23060 5792 4458 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_23060 5971 7041 gene locus_tag LOCUS_23070 5971 7041 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_23070 7399 7710 gene locus_tag LOCUS_23080 7399 7710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 8967 8248 gene locus_tag LOCUS_23090 8967 8248 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949104.1 protein_id gnl|my_center|LOCUS_23090 9425 9619 gene locus_tag LOCUS_23100 9425 9619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 9621 10265 gene locus_tag LOCUS_23110 gene thiF 9621 10265 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858442.1 protein_id gnl|my_center|LOCUS_23110 10324 11097 gene locus_tag LOCUS_23120 10324 11097 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 protein_id gnl|my_center|LOCUS_23120 11108 12373 gene locus_tag LOCUS_23130 gene thiH 11108 12373 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 protein_id gnl|my_center|LOCUS_23130 12417 12968 gene locus_tag LOCUS_23140 12417 12968 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852949.1 protein_id gnl|my_center|LOCUS_23140 12968 13615 gene locus_tag LOCUS_23150 gene thiE 12968 13615 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078223.1 protein_id gnl|my_center|LOCUS_23150 13616 14428 gene locus_tag LOCUS_23160 gene thiD 13616 14428 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_23160 14794 14612 gene locus_tag LOCUS_23170 14794 14612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 14980 15714 gene locus_tag LOCUS_23180 14980 15714 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_23180 15773 16069 gene locus_tag LOCUS_23190 15773 16069 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_23190 16789 16178 gene locus_tag LOCUS_23200 16789 16178 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964199.1 protein_id gnl|my_center|LOCUS_23200 17086 19389 gene locus_tag LOCUS_23210 gene pcrA 17086 19389 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357577.1 protein_id gnl|my_center|LOCUS_23210 19523 19774 gene locus_tag LOCUS_23220 19523 19774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 19913 21559 gene locus_tag LOCUS_23230 gene rlmD 19913 21559 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434581.1 protein_id gnl|my_center|LOCUS_23230 21590 21961 gene locus_tag LOCUS_23240 21590 21961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 23750 22041 gene locus_tag LOCUS_23250 23750 22041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence042 340 119 gene locus_tag LOCUS_23260 340 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 1365 532 gene locus_tag LOCUS_23270 1365 532 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860782.1 protein_id gnl|my_center|LOCUS_23270 2078 1362 gene locus_tag LOCUS_23280 2078 1362 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860781.1 protein_id gnl|my_center|LOCUS_23280 2484 2101 gene locus_tag LOCUS_23290 2484 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 3405 2488 gene locus_tag LOCUS_23300 3405 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 3635 4525 gene locus_tag LOCUS_23310 3635 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 4641 5714 gene locus_tag LOCUS_23320 4641 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 5758 6444 gene locus_tag LOCUS_23330 5758 6444 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211250.1 protein_id gnl|my_center|LOCUS_23330 6546 7433 gene locus_tag LOCUS_23340 6546 7433 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_23340 7452 8084 gene locus_tag LOCUS_23350 7452 8084 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459715.1 protein_id gnl|my_center|LOCUS_23350 8131 8802 gene locus_tag LOCUS_23360 8131 8802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 8894 9895 gene locus_tag LOCUS_23370 8894 9895 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182588488.1 protein_id gnl|my_center|LOCUS_23370 9926 10468 gene locus_tag LOCUS_23380 9926 10468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 10492 11358 gene locus_tag LOCUS_23390 10492 11358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23390 11361 11864 gene locus_tag LOCUS_23400 11361 11864 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582689.1 protein_id gnl|my_center|LOCUS_23400 11949 12503 gene locus_tag LOCUS_23410 11949 12503 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_23410 14001 12694 gene locus_tag LOCUS_23420 14001 12694 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085938409.1 protein_id gnl|my_center|LOCUS_23420 13940 14092 gene locus_tag LOCUS_23430 13940 14092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 14874 14143 gene locus_tag LOCUS_23440 gene nagB 14874 14143 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_23440 15153 15842 gene locus_tag LOCUS_23450 15153 15842 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706813.1 protein_id gnl|my_center|LOCUS_23450 15905 16822 gene locus_tag LOCUS_23460 15905 16822 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281520.1 protein_id gnl|my_center|LOCUS_23460 16872 18377 gene locus_tag LOCUS_23470 16872 18377 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430454.1 protein_id gnl|my_center|LOCUS_23470 18396 18845 gene locus_tag LOCUS_23480 18396 18845 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890423.1 protein_id gnl|my_center|LOCUS_23480 18939 19820 gene locus_tag LOCUS_23490 18939 19820 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894437.1 protein_id gnl|my_center|LOCUS_23490 19859 20695 gene locus_tag LOCUS_23500 19859 20695 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972486.1 protein_id gnl|my_center|LOCUS_23500 20743 21894 gene locus_tag LOCUS_23510 gene nagA 20743 21894 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902854.1 protein_id gnl|my_center|LOCUS_23510 21938 22525 gene locus_tag LOCUS_23520 21938 22525 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721280.1 protein_id gnl|my_center|LOCUS_23520 22724 22912 gene locus_tag LOCUS_23530 22724 22912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 >Feature sequence043 2642 1590 gene locus_tag LOCUS_23540 2642 1590 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868132.1 protein_id gnl|my_center|LOCUS_23540 2843 4300 gene locus_tag LOCUS_23550 2843 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 4956 5429 gene locus_tag LOCUS_23560 4956 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 6532 5456 gene locus_tag LOCUS_23570 gene metK 6532 5456 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183137.1 protein_id gnl|my_center|LOCUS_23570 9414 6949 gene locus_tag LOCUS_23580 9414 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 9960 9421 gene locus_tag LOCUS_23590 9960 9421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 10631 10113 gene locus_tag LOCUS_23600 10631 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 11290 10637 gene locus_tag LOCUS_23610 11290 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 12704 11340 gene locus_tag LOCUS_23620 12704 11340 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 protein_id gnl|my_center|LOCUS_23620 13106 12717 gene locus_tag LOCUS_23630 13106 12717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 13355 13107 gene locus_tag LOCUS_23640 13355 13107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 14371 13304 gene locus_tag LOCUS_23650 14371 13304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 14776 14390 gene locus_tag LOCUS_23660 14776 14390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 15170 14769 gene locus_tag LOCUS_23670 15170 14769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 15557 15219 gene locus_tag LOCUS_23680 15557 15219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 17554 15569 gene locus_tag LOCUS_23690 17554 15569 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 protein_id gnl|my_center|LOCUS_23690 18216 17635 gene locus_tag LOCUS_23700 18216 17635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 19634 18339 gene locus_tag LOCUS_23710 19634 18339 CDS product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144597911.1 protein_id gnl|my_center|LOCUS_23710 20353 19631 gene locus_tag LOCUS_23720 20353 19631 CDS product AP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114369828.1 protein_id gnl|my_center|LOCUS_23720 20836 20354 gene locus_tag LOCUS_23730 20836 20354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 21140 20817 gene locus_tag LOCUS_23740 21140 20817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 21715 21206 gene locus_tag LOCUS_23750 21715 21206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 22620 21925 gene locus_tag LOCUS_23760 22620 21925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence044 2728 764 gene locus_tag LOCUS_23770 gene glgB 2728 764 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_23770 2850 2677 gene locus_tag LOCUS_23780 2850 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 3956 2955 gene locus_tag LOCUS_23790 3956 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 4423 3995 gene locus_tag LOCUS_23800 4423 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 6323 4434 gene locus_tag LOCUS_23810 6323 4434 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011178617.1 protein_id gnl|my_center|LOCUS_23810 6993 6391 gene locus_tag LOCUS_23820 gene thrH 6993 6391 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_23820 8219 7254 gene locus_tag LOCUS_23830 8219 7254 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_23830 10099 8258 gene locus_tag LOCUS_23840 10099 8258 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258398.1 protein_id gnl|my_center|LOCUS_23840 11516 10176 gene locus_tag LOCUS_23850 11516 10176 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028321.1 protein_id gnl|my_center|LOCUS_23850 12501 11641 gene locus_tag LOCUS_23860 12501 11641 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_23860 13373 12501 gene locus_tag LOCUS_23870 13373 12501 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 protein_id gnl|my_center|LOCUS_23870 14765 13389 gene locus_tag LOCUS_23880 14765 13389 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582923.1 protein_id gnl|my_center|LOCUS_23880 15023 16075 gene locus_tag LOCUS_23890 15023 16075 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582922.1 protein_id gnl|my_center|LOCUS_23890 16257 17063 gene locus_tag LOCUS_23900 16257 17063 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_23900 17226 17912 gene locus_tag LOCUS_23910 17226 17912 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303625.1 protein_id gnl|my_center|LOCUS_23910 17927 18712 gene locus_tag LOCUS_23920 gene yecC 17927 18712 CDS product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096023.1 protein_id gnl|my_center|LOCUS_23920 20224 18857 gene locus_tag LOCUS_23930 20224 18857 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_23930 22223 20718 gene locus_tag LOCUS_23940 22223 20718 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence045 132 377 gene locus_tag LOCUS_23950 132 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 653 1411 gene locus_tag LOCUS_23960 653 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 1408 1806 gene locus_tag LOCUS_23970 1408 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 1773 2285 gene locus_tag LOCUS_23980 1773 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 2308 2853 gene locus_tag LOCUS_23990 2308 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 2954 3682 gene locus_tag LOCUS_24000 2954 3682 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994066.1 protein_id gnl|my_center|LOCUS_24000 3975 4610 gene locus_tag LOCUS_24010 3975 4610 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476288.1 protein_id gnl|my_center|LOCUS_24010 4746 5273 gene locus_tag LOCUS_24020 4746 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 5408 6328 gene locus_tag LOCUS_24030 5408 6328 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018365292.1 protein_id gnl|my_center|LOCUS_24030 6325 6978 gene locus_tag LOCUS_24040 6325 6978 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450361.1 protein_id gnl|my_center|LOCUS_24040 6982 7614 gene locus_tag LOCUS_24050 6982 7614 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548076.1 protein_id gnl|my_center|LOCUS_24050 7630 7824 gene locus_tag LOCUS_24060 7630 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 7870 8061 gene locus_tag LOCUS_24070 7870 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 8608 9345 gene locus_tag LOCUS_24080 8608 9345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 9345 9569 gene locus_tag LOCUS_24090 9345 9569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 9880 10086 gene locus_tag LOCUS_24100 9880 10086 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_24100 10110 12065 gene locus_tag LOCUS_24110 10110 12065 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861177.1 protein_id gnl|my_center|LOCUS_24110 12076 15486 gene locus_tag LOCUS_24120 12076 15486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 15494 17410 gene locus_tag LOCUS_24130 15494 17410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 17413 18993 gene locus_tag LOCUS_24140 17413 18993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 18999 19835 gene locus_tag LOCUS_24150 18999 19835 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057477.1 protein_id gnl|my_center|LOCUS_24150 19838 22147 gene locus_tag LOCUS_24160 19838 22147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 >Feature sequence046 916 422 gene locus_tag LOCUS_24170 916 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 1665 943 gene locus_tag LOCUS_24180 1665 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2704 1856 gene locus_tag LOCUS_24190 2704 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 3819 2701 gene locus_tag LOCUS_24200 3819 2701 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202566.1 protein_id gnl|my_center|LOCUS_24200 4926 3823 gene locus_tag LOCUS_24210 4926 3823 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_24210 5190 4975 gene locus_tag LOCUS_24220 5190 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 5317 5138 gene locus_tag LOCUS_24230 5317 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 7706 5604 gene locus_tag LOCUS_24240 7706 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 8324 7719 gene locus_tag LOCUS_24250 8324 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 9637 8330 gene locus_tag LOCUS_24260 9637 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 9851 10009 gene locus_tag LOCUS_24270 9851 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 10938 10546 gene locus_tag LOCUS_24280 10938 10546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 11775 10999 gene locus_tag LOCUS_24290 11775 10999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 13016 11769 gene locus_tag LOCUS_24300 13016 11769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 13248 13099 gene locus_tag LOCUS_24310 13248 13099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 14588 13341 gene locus_tag LOCUS_24320 14588 13341 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202157.1 protein_id gnl|my_center|LOCUS_24320 16811 15741 gene locus_tag LOCUS_24330 16811 15741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 18114 16816 gene locus_tag LOCUS_24340 18114 16816 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_24340 18743 18129 gene locus_tag LOCUS_24350 18743 18129 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_24350 19917 18802 gene locus_tag LOCUS_24360 19917 18802 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202263.1 protein_id gnl|my_center|LOCUS_24360 20519 20016 gene locus_tag LOCUS_24370 20519 20016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 20409 20750 gene locus_tag LOCUS_24380 20409 20750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 21790 21230 gene locus_tag LOCUS_24390 21790 21230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence047 <1 1624 gene locus_tag LOCUS_24400 <1 1624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000140873.1:50S ribosomal protein L7/L12-serine acetyltransferase 2715 1681 gene locus_tag LOCUS_24410 2715 1681 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926333.1 protein_id gnl|my_center|LOCUS_24410 3642 3821 gene locus_tag LOCUS_24420 3642 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 6127 4226 gene locus_tag LOCUS_24430 6127 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 6742 6233 gene locus_tag LOCUS_24440 6742 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 7445 6834 gene locus_tag LOCUS_24450 7445 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 8265 7783 gene locus_tag LOCUS_24460 8265 7783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416123.1 protein_id gnl|my_center|LOCUS_24460 8673 8419 gene locus_tag LOCUS_24470 8673 8419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 9731 9087 gene locus_tag LOCUS_24480 9731 9087 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973373.1 protein_id gnl|my_center|LOCUS_24480 10112 10774 gene locus_tag LOCUS_24490 10112 10774 CDS product division plane positioning ATPase MipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516230.1 protein_id gnl|my_center|LOCUS_24490 10872 11153 gene locus_tag LOCUS_24500 10872 11153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 11178 12155 gene locus_tag LOCUS_24510 11178 12155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 12508 12152 gene locus_tag LOCUS_24520 gene ddp1 12508 12152 CDS product DNA distortion polypeptide 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001549898.1 protein_id gnl|my_center|LOCUS_24520 13091 12648 gene locus_tag LOCUS_24530 13091 12648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074389.1 protein_id gnl|my_center|LOCUS_24530 13937 13095 gene locus_tag LOCUS_24540 13937 13095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 14695 13958 gene locus_tag LOCUS_24550 14695 13958 CDS product replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032309853.1 protein_id gnl|my_center|LOCUS_24550 16019 16270 gene locus_tag LOCUS_24560 16019 16270 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213183.1 protein_id gnl|my_center|LOCUS_24560 16260 16541 gene locus_tag LOCUS_24570 gene relE 16260 16541 CDS product type II toxin-antitoxin system mRNA interferase RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323025.1 protein_id gnl|my_center|LOCUS_24570 16687 17010 gene locus_tag LOCUS_24580 16687 17010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 17055 17300 gene locus_tag LOCUS_24590 17055 17300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 17290 17505 gene locus_tag LOCUS_24600 17290 17505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 17598 17927 gene locus_tag LOCUS_24610 17598 17927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 17970 18149 gene locus_tag LOCUS_24620 17970 18149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 18187 18399 gene locus_tag LOCUS_24630 18187 18399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012599846.1 protein_id gnl|my_center|LOCUS_24630 18396 18668 gene locus_tag LOCUS_24640 18396 18668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001363158.1 protein_id gnl|my_center|LOCUS_24640 18994 19539 gene locus_tag LOCUS_24650 gene ddp1 18994 19539 CDS product DNA distortion polypeptide 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001549911.1 protein_id gnl|my_center|LOCUS_24650 19542 20708 gene locus_tag LOCUS_24660 19542 20708 CDS product MOBP family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001549912.1 protein_id gnl|my_center|LOCUS_24660 21509 21721 gene locus_tag LOCUS_24670 21509 21721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 >Feature sequence048 <1 585 gene locus_tag LOCUS_24680 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861114.1:ATP-binding protein 620 1423 gene locus_tag LOCUS_24690 620 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 1453 3270 gene locus_tag LOCUS_24700 1453 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 3472 3678 gene locus_tag LOCUS_24710 3472 3678 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_24710 3694 4701 gene locus_tag LOCUS_24720 3694 4701 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109063.1 protein_id gnl|my_center|LOCUS_24720 4698 9371 gene locus_tag LOCUS_24730 4698 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 9358 9726 gene locus_tag LOCUS_24740 9358 9726 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191027.1 protein_id gnl|my_center|LOCUS_24740 9723 11756 gene locus_tag LOCUS_24750 9723 11756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262810.1 protein_id gnl|my_center|LOCUS_24750 11737 12033 gene locus_tag LOCUS_24760 11737 12033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 12079 13062 gene locus_tag LOCUS_24770 12079 13062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 13075 13548 gene locus_tag LOCUS_24780 13075 13548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 13631 14371 gene locus_tag LOCUS_24790 13631 14371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 14460 14972 gene locus_tag LOCUS_24800 14460 14972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 14987 15388 gene locus_tag LOCUS_24810 14987 15388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 15390 16535 gene locus_tag LOCUS_24820 15390 16535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 16546 17130 gene locus_tag LOCUS_24830 16546 17130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 17192 18247 gene locus_tag LOCUS_24840 17192 18247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 18283 19392 gene locus_tag LOCUS_24850 18283 19392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 19389 20111 gene locus_tag LOCUS_24860 19389 20111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence049 228 425 gene locus_tag LOCUS_24870 228 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 425 1495 gene locus_tag LOCUS_24880 425 1495 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_24880 1502 1837 gene locus_tag LOCUS_24890 1502 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 2597 2145 gene locus_tag LOCUS_24900 2597 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 2602 2943 gene locus_tag LOCUS_24910 2602 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 3039 3293 gene locus_tag LOCUS_24920 3039 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 3235 3417 gene locus_tag LOCUS_24930 3235 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 3654 4889 gene locus_tag LOCUS_24940 gene mobV 3654 4889 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119405.1 protein_id gnl|my_center|LOCUS_24940 5062 5367 gene locus_tag LOCUS_24950 5062 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 5547 5759 gene locus_tag LOCUS_24960 5547 5759 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_24960 5774 7669 gene locus_tag LOCUS_24970 5774 7669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 7683 9695 gene locus_tag LOCUS_24980 7683 9695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 9722 11632 gene locus_tag LOCUS_24990 9722 11632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 11592 12677 gene locus_tag LOCUS_25000 11592 12677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 12604 13416 gene locus_tag LOCUS_25010 12604 13416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 14315 13788 gene locus_tag LOCUS_25020 14315 13788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 14653 14841 gene locus_tag LOCUS_25030 14653 14841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395994.1 protein_id gnl|my_center|LOCUS_25030 14842 15927 gene locus_tag LOCUS_25040 14842 15927 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_25040 15917 16252 gene locus_tag LOCUS_25050 15917 16252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 16389 17363 gene locus_tag LOCUS_25060 16389 17363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 17651 18904 gene locus_tag LOCUS_25070 gene mobV 17651 18904 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122374.1 protein_id gnl|my_center|LOCUS_25070 18914 19291 gene locus_tag LOCUS_25080 18914 19291 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_25080 19404 19808 gene locus_tag LOCUS_25090 19404 19808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 19798 20160 gene locus_tag LOCUS_25100 19798 20160 CDS product DUF4180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403459.1 protein_id gnl|my_center|LOCUS_25100 20318 20599 gene locus_tag LOCUS_25110 20318 20599 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461958.1 protein_id gnl|my_center|LOCUS_25110 20709 21722 gene locus_tag LOCUS_25120 20709 21722 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462034.1 protein_id gnl|my_center|LOCUS_25120 >Feature sequence050 1746 1360 gene locus_tag LOCUS_25130 1746 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 4544 1749 gene locus_tag LOCUS_25140 4544 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 5150 4590 gene locus_tag LOCUS_25150 5150 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 5596 5147 gene locus_tag LOCUS_25160 5596 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 6114 5608 gene locus_tag LOCUS_25170 6114 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 6570 6115 gene locus_tag LOCUS_25180 6570 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 6992 6567 gene locus_tag LOCUS_25190 6992 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 7383 7003 gene locus_tag LOCUS_25200 7383 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 7753 7385 gene locus_tag LOCUS_25210 7753 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 8808 7771 gene locus_tag LOCUS_25220 8808 7771 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989953.1 protein_id gnl|my_center|LOCUS_25220 9398 8811 gene locus_tag LOCUS_25230 9398 8811 CDS product phage scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003769956.1 protein_id gnl|my_center|LOCUS_25230 9722 9579 gene locus_tag LOCUS_25240 9722 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 11491 9719 gene locus_tag LOCUS_25250 11491 9719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 12825 11497 gene locus_tag LOCUS_25260 12825 11497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 14529 12886 gene locus_tag LOCUS_25270 14529 12886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 16235 14775 gene locus_tag LOCUS_25280 16235 14775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222614.1 protein_id gnl|my_center|LOCUS_25280 17286 16852 gene locus_tag LOCUS_25290 17286 16852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 17659 17294 gene locus_tag LOCUS_25300 17659 17294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 17843 17607 gene locus_tag LOCUS_25310 17843 17607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 18000 17836 gene locus_tag LOCUS_25320 18000 17836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 18484 18032 gene locus_tag LOCUS_25330 18484 18032 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109521.1 protein_id gnl|my_center|LOCUS_25330 18619 18494 gene locus_tag LOCUS_25340 18619 18494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 19070 18633 gene locus_tag LOCUS_25350 19070 18633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 20266 19067 gene locus_tag LOCUS_25360 20266 19067 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 protein_id gnl|my_center|LOCUS_25360 20913 20449 gene locus_tag LOCUS_25370 20913 20449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 21252 20920 gene locus_tag LOCUS_25380 21252 20920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 21525 21256 gene locus_tag LOCUS_25390 21525 21256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence051 210 506 gene locus_tag LOCUS_25400 210 506 CDS product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916156.1 protein_id gnl|my_center|LOCUS_25400 528 3281 gene locus_tag LOCUS_25410 528 3281 CDS product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012599839.1 protein_id gnl|my_center|LOCUS_25410 3292 4050 gene locus_tag LOCUS_25420 3292 4050 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744204.1 protein_id gnl|my_center|LOCUS_25420 4051 4278 gene locus_tag LOCUS_25430 4051 4278 CDS product EexN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835348.1 protein_id gnl|my_center|LOCUS_25430 4288 5421 gene locus_tag LOCUS_25440 4288 5421 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513454.1 protein_id gnl|my_center|LOCUS_25440 5666 6379 gene locus_tag LOCUS_25450 5666 6379 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394613.1 protein_id gnl|my_center|LOCUS_25450 6384 7313 gene locus_tag LOCUS_25460 6384 7313 CDS product TrbG/VirB9 family P-type conjugative transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783376.1 protein_id gnl|my_center|LOCUS_25460 7310 8515 gene locus_tag LOCUS_25470 gene virB10 7310 8515 CDS product VirB10/TraB/TrbI family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139137.1 protein_id gnl|my_center|LOCUS_25470 8517 9548 gene locus_tag LOCUS_25480 gene virB11 8517 9548 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058469.1 protein_id gnl|my_center|LOCUS_25480 9551 11386 gene locus_tag LOCUS_25490 9551 11386 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032309849.1 protein_id gnl|my_center|LOCUS_25490 11383 11796 gene locus_tag LOCUS_25500 11383 11796 CDS product cag pathogenicity island Cag12 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722607.1 protein_id gnl|my_center|LOCUS_25500 11793 12095 gene locus_tag LOCUS_25510 11793 12095 CDS product TrbM/KikA/MpfK family conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820911.1 protein_id gnl|my_center|LOCUS_25510 12256 12402 gene locus_tag LOCUS_25520 12256 12402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 12406 12981 gene locus_tag LOCUS_25530 12406 12981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 12986 15139 gene locus_tag LOCUS_25540 12986 15139 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235749.1 protein_id gnl|my_center|LOCUS_25540 15136 15342 gene locus_tag LOCUS_25550 gene hha 15136 15342 CDS product hemolysin expression modulator Hha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850859.1 protein_id gnl|my_center|LOCUS_25550 15358 15822 gene locus_tag LOCUS_25560 15358 15822 CDS product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293140.1 protein_id gnl|my_center|LOCUS_25560 15877 16284 gene locus_tag LOCUS_25570 15877 16284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 17561 18613 gene locus_tag LOCUS_25580 17561 18613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 18610 19464 gene locus_tag LOCUS_25590 18610 19464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 19720 20400 gene locus_tag LOCUS_25600 19720 20400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 >Feature sequence052 319 528 gene locus_tag LOCUS_25610 319 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 590 1042 gene locus_tag LOCUS_25620 590 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 1483 1163 gene locus_tag LOCUS_25630 1483 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 2781 2209 gene locus_tag LOCUS_25640 2781 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 3003 2812 gene locus_tag LOCUS_25650 3003 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 3698 3078 gene locus_tag LOCUS_25660 3698 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 4440 3700 gene locus_tag LOCUS_25670 gene srtB 4440 3700 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989918.1 protein_id gnl|my_center|LOCUS_25670 5597 4590 gene locus_tag LOCUS_25680 5597 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 6231 5680 gene locus_tag LOCUS_25690 gene lepB 6231 5680 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014635236.1 protein_id gnl|my_center|LOCUS_25690 6523 6215 gene locus_tag LOCUS_25700 6523 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 10494 6541 gene locus_tag LOCUS_25710 10494 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 11523 10684 gene locus_tag LOCUS_25720 gene xerD 11523 10684 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547075.1 protein_id gnl|my_center|LOCUS_25720 11763 12077 gene locus_tag LOCUS_25730 11763 12077 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813967.1 protein_id gnl|my_center|LOCUS_25730 12465 12217 gene locus_tag LOCUS_25740 12465 12217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 13767 12805 gene locus_tag LOCUS_25750 13767 12805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 15030 13825 gene locus_tag LOCUS_25760 15030 13825 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287705.1 protein_id gnl|my_center|LOCUS_25760 16406 15186 gene locus_tag LOCUS_25770 16406 15186 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287705.1 protein_id gnl|my_center|LOCUS_25770 16721 16491 gene locus_tag LOCUS_25780 16721 16491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 17688 17275 gene locus_tag LOCUS_25790 17688 17275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 18542 18165 gene locus_tag LOCUS_25800 18542 18165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 19223 18654 gene locus_tag LOCUS_25810 19223 18654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 >Feature sequence053 1763 1368 gene locus_tag LOCUS_25820 1763 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 2107 1808 gene locus_tag LOCUS_25830 2107 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 2449 2117 gene locus_tag LOCUS_25840 2449 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 2986 2714 gene locus_tag LOCUS_25850 2986 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 3873 2983 gene locus_tag LOCUS_25860 3873 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 5682 3886 gene locus_tag LOCUS_25870 5682 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 8436 5683 gene locus_tag LOCUS_25880 8436 5683 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_25880 8797 8414 gene locus_tag LOCUS_25890 8797 8414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 9653 8820 gene locus_tag LOCUS_25900 9653 8820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 10040 9672 gene locus_tag LOCUS_25910 10040 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 10244 10041 gene locus_tag LOCUS_25920 10244 10041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 10706 10296 gene locus_tag LOCUS_25930 10706 10296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 11820 10720 gene locus_tag LOCUS_25940 11820 10720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 12581 11898 gene locus_tag LOCUS_25950 12581 11898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 13371 12562 gene locus_tag LOCUS_25960 13371 12562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 14179 13352 gene locus_tag LOCUS_25970 14179 13352 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837256.1 protein_id gnl|my_center|LOCUS_25970 16093 14195 gene locus_tag LOCUS_25980 16093 14195 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068613.1 protein_id gnl|my_center|LOCUS_25980 18720 16090 gene locus_tag LOCUS_25990 18720 16090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 >Feature sequence054 721 2139 gene locus_tag LOCUS_26000 721 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 4381 2720 gene locus_tag LOCUS_26010 4381 2720 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788903.1 protein_id gnl|my_center|LOCUS_26010 5428 6822 gene locus_tag LOCUS_26020 gene mgtE 5428 6822 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062407.1 protein_id gnl|my_center|LOCUS_26020 7110 8411 gene locus_tag LOCUS_26030 gene thiC 7110 8411 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047970.1 protein_id gnl|my_center|LOCUS_26030 8413 9507 gene locus_tag LOCUS_26040 8413 9507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 9523 10179 gene locus_tag LOCUS_26050 9523 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 10353 10838 gene locus_tag LOCUS_26060 10353 10838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 10945 11661 gene locus_tag LOCUS_26070 10945 11661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 11791 12969 gene locus_tag LOCUS_26080 11791 12969 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_26080 13087 13512 gene locus_tag LOCUS_26090 gene tsaE 13087 13512 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966123.1 protein_id gnl|my_center|LOCUS_26090 13539 14744 gene locus_tag LOCUS_26100 13539 14744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 14877 15116 gene locus_tag LOCUS_26110 14877 15116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 15233 16108 gene locus_tag LOCUS_26120 15233 16108 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_26120 16111 17139 gene locus_tag LOCUS_26130 gene tsaD 16111 17139 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_26130 17182 17886 gene locus_tag LOCUS_26140 gene ispD 17182 17886 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048363.1 protein_id gnl|my_center|LOCUS_26140 18011 18097 gene locus_tag LOCUS_t00340 18011 18097 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18254 18344 gene locus_tag LOCUS_t00350 18254 18344 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence055 566 120 gene locus_tag LOCUS_26150 gene dtd 566 120 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922691.1 protein_id gnl|my_center|LOCUS_26150 768 1094 gene locus_tag LOCUS_26160 768 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 1163 1861 gene locus_tag LOCUS_26170 1163 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 1928 3595 gene locus_tag LOCUS_26180 1928 3595 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_26180 3689 5131 gene locus_tag LOCUS_26190 3689 5131 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891874.1 protein_id gnl|my_center|LOCUS_26190 5715 5356 gene locus_tag LOCUS_26200 5715 5356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 5879 7447 gene locus_tag LOCUS_26210 gene cls 5879 7447 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638280.1 protein_id gnl|my_center|LOCUS_26210 7667 8950 gene locus_tag LOCUS_26220 7667 8950 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837602.1 protein_id gnl|my_center|LOCUS_26220 9229 9011 gene locus_tag LOCUS_26230 9229 9011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 9427 9942 gene locus_tag LOCUS_26240 9427 9942 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434936.1 protein_id gnl|my_center|LOCUS_26240 9955 10683 gene locus_tag LOCUS_26250 9955 10683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 10768 11118 gene locus_tag LOCUS_26260 10768 11118 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963842.1 protein_id gnl|my_center|LOCUS_26260 11321 11518 gene locus_tag LOCUS_26270 11321 11518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 11460 12851 gene locus_tag LOCUS_26280 11460 12851 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_26280 12854 13786 gene locus_tag LOCUS_26290 gene metA 12854 13786 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_26290 13883 14395 gene locus_tag LOCUS_26300 13883 14395 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049186.1 protein_id gnl|my_center|LOCUS_26300 14505 15872 gene locus_tag LOCUS_26310 14505 15872 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392886.1 protein_id gnl|my_center|LOCUS_26310 15996 16865 gene locus_tag LOCUS_26320 15996 16865 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359214.1 protein_id gnl|my_center|LOCUS_26320 18378 17020 gene locus_tag LOCUS_26330 18378 17020 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930606.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence056 145 732 gene locus_tag LOCUS_26340 145 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 833 1192 gene locus_tag LOCUS_26350 833 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 1268 1774 gene locus_tag LOCUS_26360 1268 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 2015 2368 gene locus_tag LOCUS_26370 2015 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 2769 3032 gene locus_tag LOCUS_26380 2769 3032 CDS product CD3324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986726.1 protein_id gnl|my_center|LOCUS_26380 3161 3790 gene locus_tag LOCUS_26390 3161 3790 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108273.1 protein_id gnl|my_center|LOCUS_26390 3839 4093 gene locus_tag LOCUS_26400 3839 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 4577 5395 gene locus_tag LOCUS_26410 4577 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 5424 5741 gene locus_tag LOCUS_26420 5424 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 5937 6131 gene locus_tag LOCUS_26430 5937 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 6128 6820 gene locus_tag LOCUS_26440 6128 6820 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018062.1 protein_id gnl|my_center|LOCUS_26440 6817 7758 gene locus_tag LOCUS_26450 6817 7758 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247675.1 protein_id gnl|my_center|LOCUS_26450 7845 8756 gene locus_tag LOCUS_26460 7845 8756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221097.1 protein_id gnl|my_center|LOCUS_26460 8762 9469 gene locus_tag LOCUS_26470 8762 9469 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902926.1 protein_id gnl|my_center|LOCUS_26470 9482 10339 gene locus_tag LOCUS_26480 9482 10339 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254622.1 protein_id gnl|my_center|LOCUS_26480 10682 10870 gene locus_tag LOCUS_26490 10682 10870 CDS product cysteine-rich KTR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001803271.1 protein_id gnl|my_center|LOCUS_26490 11413 11048 gene locus_tag LOCUS_26500 11413 11048 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368681.1 protein_id gnl|my_center|LOCUS_26500 12269 12703 gene locus_tag LOCUS_26510 12269 12703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 12690 12938 gene locus_tag LOCUS_26520 12690 12938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 12916 13725 gene locus_tag LOCUS_26530 12916 13725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 14787 13834 gene locus_tag LOCUS_26540 14787 13834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 15217 14825 gene locus_tag LOCUS_26550 15217 14825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 15276 15530 gene locus_tag LOCUS_26560 15276 15530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 15503 16366 gene locus_tag LOCUS_26570 15503 16366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 16379 16582 gene locus_tag LOCUS_26580 16379 16582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 17292 17720 gene locus_tag LOCUS_26590 17292 17720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 >Feature sequence057 203 457 gene locus_tag LOCUS_26600 203 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 898 1659 gene locus_tag LOCUS_26610 898 1659 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262039.1 protein_id gnl|my_center|LOCUS_26610 1966 2217 gene locus_tag LOCUS_26620 1966 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 2724 2287 gene locus_tag LOCUS_26630 2724 2287 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288290.1 protein_id gnl|my_center|LOCUS_26630 2846 3844 gene locus_tag LOCUS_26640 2846 3844 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_26640 3846 4388 gene locus_tag LOCUS_26650 3846 4388 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107760.1 protein_id gnl|my_center|LOCUS_26650 4391 4642 gene locus_tag LOCUS_26660 4391 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 4646 5431 gene locus_tag LOCUS_26670 4646 5431 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_26670 5517 5987 gene locus_tag LOCUS_26680 5517 5987 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_26680 6003 6368 gene locus_tag LOCUS_26690 6003 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 6584 6306 gene locus_tag LOCUS_26700 6584 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 7078 6698 gene locus_tag LOCUS_26710 7078 6698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 7398 7733 gene locus_tag LOCUS_26720 7398 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 7735 8127 gene locus_tag LOCUS_26730 7735 8127 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478297.1 protein_id gnl|my_center|LOCUS_26730 8151 8588 gene locus_tag LOCUS_26740 8151 8588 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966983.1 protein_id gnl|my_center|LOCUS_26740 8610 8861 gene locus_tag LOCUS_26750 8610 8861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 9152 9364 gene locus_tag LOCUS_26760 9152 9364 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_26760 9413 9733 gene locus_tag LOCUS_26770 9413 9733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 9730 10266 gene locus_tag LOCUS_26780 9730 10266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 10277 13291 gene locus_tag LOCUS_26790 10277 13291 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948376.1 protein_id gnl|my_center|LOCUS_26790 13288 13737 gene locus_tag LOCUS_26800 gene mutT 13288 13737 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_26800 13796 14380 gene locus_tag LOCUS_26810 13796 14380 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263037.1 protein_id gnl|my_center|LOCUS_26810 14353 15537 gene locus_tag LOCUS_26820 14353 15537 CDS product HNH endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986608.1 protein_id gnl|my_center|LOCUS_26820 15566 16135 gene locus_tag LOCUS_26830 15566 16135 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680597.1 protein_id gnl|my_center|LOCUS_26830 16537 16737 gene locus_tag LOCUS_26840 16537 16737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 16777 17202 gene locus_tag LOCUS_26850 16777 17202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 17243 17476 gene locus_tag LOCUS_26860 17243 17476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 17539 17745 gene locus_tag LOCUS_26870 17539 17745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 >Feature sequence058 371 1957 gene locus_tag LOCUS_26880 371 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 1845 2759 gene locus_tag LOCUS_26890 1845 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 3046 3618 gene locus_tag LOCUS_26900 3046 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 4342 4106 gene locus_tag LOCUS_26910 4342 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 5265 4888 gene locus_tag LOCUS_26920 5265 4888 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476321.1 protein_id gnl|my_center|LOCUS_26920 5504 5262 gene locus_tag LOCUS_26930 5504 5262 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115145.1 protein_id gnl|my_center|LOCUS_26930 5904 5548 gene locus_tag LOCUS_26940 5904 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 6334 5924 gene locus_tag LOCUS_26950 6334 5924 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705736.1 protein_id gnl|my_center|LOCUS_26950 6726 6334 gene locus_tag LOCUS_26960 6726 6334 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963739.1 protein_id gnl|my_center|LOCUS_26960 7422 6736 gene locus_tag LOCUS_26970 7422 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 7884 7426 gene locus_tag LOCUS_26980 7884 7426 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966110.1 protein_id gnl|my_center|LOCUS_26980 8118 7903 gene locus_tag LOCUS_26990 8118 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 9276 8128 gene locus_tag LOCUS_27000 9276 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 9963 9277 gene locus_tag LOCUS_27010 9963 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 13216 9965 gene locus_tag LOCUS_27020 13216 9965 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804172.1 protein_id gnl|my_center|LOCUS_27020 15077 13236 gene locus_tag LOCUS_27030 15077 13236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 16272 15070 gene locus_tag LOCUS_27040 16272 15070 CDS product DUF6361 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804170.1 protein_id gnl|my_center|LOCUS_27040 17711 16293 gene locus_tag LOCUS_27050 17711 16293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 >Feature sequence059 65 247 gene locus_tag LOCUS_27060 65 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 2350 269 gene locus_tag LOCUS_27070 2350 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 2711 3010 gene locus_tag LOCUS_27080 2711 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 3016 3198 gene locus_tag LOCUS_27090 3016 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 3201 3578 gene locus_tag LOCUS_27100 3201 3578 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_27100 3765 3983 gene locus_tag LOCUS_27110 3765 3983 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985621.1 protein_id gnl|my_center|LOCUS_27110 4000 6591 gene locus_tag LOCUS_27120 4000 6591 CDS product adenine/cytosine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895775.1 protein_id gnl|my_center|LOCUS_27120 6601 7824 gene locus_tag LOCUS_27130 6601 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664224.1 protein_id gnl|my_center|LOCUS_27130 7837 8340 gene locus_tag LOCUS_27140 7837 8340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 8383 10962 gene locus_tag LOCUS_27150 8383 10962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964262.1 protein_id gnl|my_center|LOCUS_27150 10983 12257 gene locus_tag LOCUS_27160 10983 12257 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_27160 13016 13333 gene locus_tag LOCUS_27170 13016 13333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 13335 13694 gene locus_tag LOCUS_27180 13335 13694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 13916 14812 gene locus_tag LOCUS_27190 13916 14812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 14802 15050 gene locus_tag LOCUS_27200 14802 15050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 15051 16748 gene locus_tag LOCUS_27210 gene tndX 15051 16748 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_27210 17772 17239 gene locus_tag LOCUS_27220 17772 17239 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740920.1 protein_id gnl|my_center|LOCUS_27220 >Feature sequence060 40 198 gene locus_tag LOCUS_27230 40 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 236 1162 gene locus_tag LOCUS_27240 gene pyrF 236 1162 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_27240 1189 1971 gene locus_tag LOCUS_27250 gene pyrK 1189 1971 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983358.1 protein_id gnl|my_center|LOCUS_27250 1971 2873 gene locus_tag LOCUS_27260 1971 2873 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_27260 2907 3584 gene locus_tag LOCUS_27270 gene pyrE 2907 3584 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_27270 3688 3837 gene locus_tag LOCUS_27280 3688 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 3865 4347 gene locus_tag LOCUS_27290 3865 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 4316 4918 gene locus_tag LOCUS_27300 4316 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 4956 7028 gene locus_tag LOCUS_27310 4956 7028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 7021 7608 gene locus_tag LOCUS_27320 gene purE 7021 7608 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_27320 7647 8678 gene locus_tag LOCUS_27330 gene purM 7647 8678 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262439.1 protein_id gnl|my_center|LOCUS_27330 8672 9298 gene locus_tag LOCUS_27340 gene purN 8672 9298 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_27340 9346 10617 gene locus_tag LOCUS_27350 gene purD 9346 10617 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_27350 10823 11131 gene locus_tag LOCUS_27360 10823 11131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 11326 12336 gene locus_tag LOCUS_27370 11326 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 12367 12564 gene locus_tag LOCUS_27380 12367 12564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 12564 12746 gene locus_tag LOCUS_27390 12564 12746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 12806 13156 gene locus_tag LOCUS_27400 12806 13156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 13190 13363 gene locus_tag LOCUS_27410 13190 13363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 13795 14427 gene locus_tag LOCUS_27420 13795 14427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 14880 14632 gene locus_tag LOCUS_27430 14880 14632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 15120 15440 gene locus_tag LOCUS_27440 15120 15440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 16615 16094 gene locus_tag LOCUS_27450 16615 16094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 >Feature sequence061 1381 734 gene locus_tag LOCUS_27460 1381 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 2438 1635 gene locus_tag LOCUS_27470 2438 1635 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_27470 4034 2535 gene locus_tag LOCUS_27480 gene glpK 4034 2535 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_27480 5646 4384 gene locus_tag LOCUS_27490 5646 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 6498 6121 gene locus_tag LOCUS_27500 6498 6121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 7130 6750 gene locus_tag LOCUS_27510 7130 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 7357 7163 gene locus_tag LOCUS_27520 7357 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 7938 7477 gene locus_tag LOCUS_27530 7938 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 8364 8582 gene locus_tag LOCUS_27540 8364 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 12507 8968 gene locus_tag LOCUS_27550 gene nifJ 12507 8968 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_27550 12683 12492 gene locus_tag LOCUS_27560 12683 12492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 13661 12756 gene locus_tag LOCUS_27570 gene lgt 13661 12756 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897834.1 protein_id gnl|my_center|LOCUS_27570 14771 13674 gene locus_tag LOCUS_27580 gene ychF 14771 13674 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_27580 15985 14855 gene locus_tag LOCUS_27590 15985 14855 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861856.1 protein_id gnl|my_center|LOCUS_27590 16285 16085 gene locus_tag LOCUS_27600 16285 16085 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905235.1 protein_id gnl|my_center|LOCUS_27600 >Feature sequence062 226 966 gene locus_tag LOCUS_27610 226 966 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963967.1 protein_id gnl|my_center|LOCUS_27610 957 1568 gene locus_tag LOCUS_27620 957 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 1771 4326 gene locus_tag LOCUS_27630 1771 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 4563 8483 gene locus_tag LOCUS_27640 4563 8483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 8748 12866 gene locus_tag LOCUS_27650 8748 12866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 13463 13678 gene locus_tag LOCUS_27660 13463 13678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 13982 13662 gene locus_tag LOCUS_27670 13982 13662 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435155.1 protein_id gnl|my_center|LOCUS_27670 14260 15237 gene locus_tag LOCUS_27680 14260 15237 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013877237.1 protein_id gnl|my_center|LOCUS_27680 15449 16168 gene locus_tag LOCUS_27690 15449 16168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence063 738 1598 gene locus_tag LOCUS_27700 738 1598 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_27700 2511 1606 gene locus_tag LOCUS_27710 gene trxB 2511 1606 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_27710 3329 2535 gene locus_tag LOCUS_27720 gene proC 3329 2535 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360723.1 protein_id gnl|my_center|LOCUS_27720 3640 3371 gene locus_tag LOCUS_27730 3640 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 4011 3661 gene locus_tag LOCUS_27740 4011 3661 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_27740 4388 4636 gene locus_tag LOCUS_27750 4388 4636 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_27750 4739 6160 gene locus_tag LOCUS_27760 gene hydG 4739 6160 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_27760 6197 7459 gene locus_tag LOCUS_27770 gene hydF 6197 7459 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964958.1 protein_id gnl|my_center|LOCUS_27770 8772 7525 gene locus_tag LOCUS_27780 8772 7525 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244568.1 protein_id gnl|my_center|LOCUS_27780 10348 8765 gene locus_tag LOCUS_27790 10348 8765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 11147 10341 gene locus_tag LOCUS_27800 11147 10341 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242701.1 protein_id gnl|my_center|LOCUS_27800 12466 11144 gene locus_tag LOCUS_27810 12466 11144 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728820.1 protein_id gnl|my_center|LOCUS_27810 12806 13606 gene locus_tag LOCUS_27820 12806 13606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 13875 14060 gene locus_tag LOCUS_27830 13875 14060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 14274 14990 gene locus_tag LOCUS_27840 14274 14990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 16023 15070 gene locus_tag LOCUS_27850 16023 15070 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964264.1 protein_id gnl|my_center|LOCUS_27850 >Feature sequence064 690 46 gene locus_tag LOCUS_27860 690 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 917 702 gene locus_tag LOCUS_27870 917 702 CDS product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610321.1 protein_id gnl|my_center|LOCUS_27870 1411 992 gene locus_tag LOCUS_27880 1411 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 3352 1532 gene locus_tag LOCUS_27890 3352 1532 CDS product reverse transcriptase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461915.1 protein_id gnl|my_center|LOCUS_27890 4320 3946 gene locus_tag LOCUS_27900 4320 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 6227 4878 gene locus_tag LOCUS_27910 6227 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 6777 6160 gene locus_tag LOCUS_27920 6777 6160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 8447 6843 gene locus_tag LOCUS_27930 8447 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 9052 8747 gene locus_tag LOCUS_27940 9052 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 10446 9136 gene locus_tag LOCUS_27950 10446 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 11762 10515 gene locus_tag LOCUS_27960 11762 10515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 12991 11759 gene locus_tag LOCUS_27970 gene dcm 12991 11759 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963014.1 protein_id gnl|my_center|LOCUS_27970 13215 12988 gene locus_tag LOCUS_27980 13215 12988 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_27980 13773 13483 gene locus_tag LOCUS_27990 13773 13483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 14044 13766 gene locus_tag LOCUS_28000 14044 13766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 14438 14139 gene locus_tag LOCUS_28010 14438 14139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 14730 14449 gene locus_tag LOCUS_28020 14730 14449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 15095 14748 gene locus_tag LOCUS_28030 15095 14748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 15261 15106 gene locus_tag LOCUS_28040 15261 15106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 16160 15264 gene locus_tag LOCUS_28050 16160 15264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 >Feature sequence065 1512 364 gene locus_tag LOCUS_28060 1512 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 2000 1509 gene locus_tag LOCUS_28070 2000 1509 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_28070 2880 2083 gene locus_tag LOCUS_28080 2880 2083 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860782.1 protein_id gnl|my_center|LOCUS_28080 3689 2877 gene locus_tag LOCUS_28090 3689 2877 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860781.1 protein_id gnl|my_center|LOCUS_28090 4626 3703 gene locus_tag LOCUS_28100 4626 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 5011 4619 gene locus_tag LOCUS_28110 5011 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 5422 5024 gene locus_tag LOCUS_28120 gene ssb 5422 5024 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184663868.1 protein_id gnl|my_center|LOCUS_28120 5835 5437 gene locus_tag LOCUS_28130 5835 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 6360 6049 gene locus_tag LOCUS_28140 6360 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 7267 6338 gene locus_tag LOCUS_28150 7267 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 8042 7257 gene locus_tag LOCUS_28160 8042 7257 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_28160 8899 8327 gene locus_tag LOCUS_28170 8899 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 9063 9491 gene locus_tag LOCUS_28180 gene tnpA 9063 9491 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966797.1 protein_id gnl|my_center|LOCUS_28180 10034 9597 gene locus_tag LOCUS_28190 10034 9597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 10384 10169 gene locus_tag LOCUS_28200 10384 10169 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004613735.1 protein_id gnl|my_center|LOCUS_28200 11564 10623 gene locus_tag LOCUS_28210 11564 10623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 12318 11551 gene locus_tag LOCUS_28220 12318 11551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 13561 12578 gene locus_tag LOCUS_28230 13561 12578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 13970 13542 gene locus_tag LOCUS_28240 13970 13542 CDS product holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721755.1 protein_id gnl|my_center|LOCUS_28240 14223 14044 gene locus_tag LOCUS_28250 14223 14044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 14567 15430 gene locus_tag LOCUS_28260 14567 15430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 >Feature sequence066 869 1207 gene locus_tag LOCUS_28270 869 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 1369 3081 gene locus_tag LOCUS_28280 1369 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 3167 3367 gene locus_tag LOCUS_28290 3167 3367 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438035.1 protein_id gnl|my_center|LOCUS_28290 4132 3434 gene locus_tag LOCUS_28300 4132 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 4316 5563 gene locus_tag LOCUS_28310 4316 5563 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_28310 5597 5842 gene locus_tag LOCUS_28320 5597 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 6229 6777 gene locus_tag LOCUS_28330 6229 6777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 6931 7353 gene locus_tag LOCUS_28340 6931 7353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 7357 8340 gene locus_tag LOCUS_28350 7357 8340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 9018 9572 gene locus_tag LOCUS_28360 9018 9572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 9684 9851 gene locus_tag LOCUS_28370 9684 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 9946 10920 gene locus_tag LOCUS_28380 9946 10920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 10904 11767 gene locus_tag LOCUS_28390 10904 11767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 11821 12057 gene locus_tag LOCUS_28400 11821 12057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 12392 13816 gene locus_tag LOCUS_28410 12392 13816 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868284.1 protein_id gnl|my_center|LOCUS_28410 14097 14564 gene locus_tag LOCUS_28420 14097 14564 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966110.1 protein_id gnl|my_center|LOCUS_28420 14894 15166 gene locus_tag LOCUS_28430 14894 15166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 >Feature sequence067 370 149 gene locus_tag LOCUS_28440 370 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 1215 400 gene locus_tag LOCUS_28450 1215 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 1424 1987 gene locus_tag LOCUS_28460 1424 1987 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_28460 3316 2030 gene locus_tag LOCUS_28470 3316 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 4443 3580 gene locus_tag LOCUS_28480 4443 3580 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888619.1 protein_id gnl|my_center|LOCUS_28480 5608 4475 gene locus_tag LOCUS_28490 gene metK 5608 4475 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_28490 7093 5738 gene locus_tag LOCUS_28500 7093 5738 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_28500 7734 7150 gene locus_tag LOCUS_28510 7734 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 9749 7974 gene locus_tag LOCUS_28520 9749 7974 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_28520 10484 9903 gene locus_tag LOCUS_28530 10484 9903 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_28530 11502 10582 gene locus_tag LOCUS_28540 11502 10582 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_28540 12134 12520 gene locus_tag LOCUS_28550 12134 12520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 12498 14174 gene locus_tag LOCUS_28560 12498 14174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 14171 14599 gene locus_tag LOCUS_28570 14171 14599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 14484 15131 gene locus_tag LOCUS_28580 14484 15131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 >Feature sequence068 6891 76 gene locus_tag LOCUS_28590 6891 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 7174 6941 gene locus_tag LOCUS_28600 7174 6941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 7501 7190 gene locus_tag LOCUS_28610 7501 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 11897 7647 gene locus_tag LOCUS_28620 11897 7647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 12643 12179 gene locus_tag LOCUS_28630 12643 12179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 13112 12654 gene locus_tag LOCUS_28640 13112 12654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 13893 13069 gene locus_tag LOCUS_28650 gene soj 13893 13069 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_28650 14475 14966 gene locus_tag LOCUS_28660 14475 14966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 >Feature sequence069 503 45 gene locus_tag LOCUS_28670 503 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 815 1390 gene locus_tag LOCUS_28680 gene lexA 815 1390 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965137.1 protein_id gnl|my_center|LOCUS_28680 1521 2246 gene locus_tag LOCUS_28690 1521 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 2808 3389 gene locus_tag LOCUS_28700 2808 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 3487 4050 gene locus_tag LOCUS_28710 3487 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 4040 4243 gene locus_tag LOCUS_28720 4040 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 4344 4550 gene locus_tag LOCUS_28730 4344 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 4594 4821 gene locus_tag LOCUS_28740 4594 4821 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905235.1 protein_id gnl|my_center|LOCUS_28740 4787 5071 gene locus_tag LOCUS_28750 4787 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 5085 6338 gene locus_tag LOCUS_28760 5085 6338 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006906966.1 protein_id gnl|my_center|LOCUS_28760 7397 7239 gene locus_tag LOCUS_28770 7397 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 7570 8682 gene locus_tag LOCUS_28780 7570 8682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 8930 10423 gene locus_tag LOCUS_28790 8930 10423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 10430 11830 gene locus_tag LOCUS_28800 10430 11830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 11916 12335 gene locus_tag LOCUS_28810 11916 12335 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439566.1 protein_id gnl|my_center|LOCUS_28810 12464 13840 gene locus_tag LOCUS_28820 12464 13840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 14082 14249 gene locus_tag LOCUS_28830 14082 14249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 14361 14831 gene locus_tag LOCUS_28840 14361 14831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 >Feature sequence070 760 368 gene locus_tag LOCUS_28850 760 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 1292 891 gene locus_tag LOCUS_28860 1292 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 1657 1337 gene locus_tag LOCUS_28870 1657 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 3108 1660 gene locus_tag LOCUS_28880 3108 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398313.1 protein_id gnl|my_center|LOCUS_28880 3821 3120 gene locus_tag LOCUS_28890 3821 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 4510 3836 gene locus_tag LOCUS_28900 4510 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 5032 4520 gene locus_tag LOCUS_28910 5032 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 6077 5088 gene locus_tag LOCUS_28920 6077 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 6641 6090 gene locus_tag LOCUS_28930 6641 6090 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_28930 9742 6644 gene locus_tag LOCUS_28940 9742 6644 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_28940 10731 9841 gene locus_tag LOCUS_28950 10731 9841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 11969 10731 gene locus_tag LOCUS_28960 11969 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 13740 11962 gene locus_tag LOCUS_28970 13740 11962 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918506.1 protein_id gnl|my_center|LOCUS_28970 13967 13761 gene locus_tag LOCUS_28980 13967 13761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 14582 14184 gene locus_tag LOCUS_28990 14582 14184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 >Feature sequence071 699 1196 gene locus_tag LOCUS_29000 699 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 1492 1683 gene locus_tag LOCUS_29010 1492 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 1920 6725 gene locus_tag LOCUS_29020 1920 6725 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390216.1 protein_id gnl|my_center|LOCUS_29020 7025 8200 gene locus_tag LOCUS_29030 7025 8200 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423769.1 protein_id gnl|my_center|LOCUS_29030 8277 8891 gene locus_tag LOCUS_29040 8277 8891 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357527.1 protein_id gnl|my_center|LOCUS_29040 8888 9424 gene locus_tag LOCUS_29050 8888 9424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 9548 14245 gene locus_tag LOCUS_29060 9548 14245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 >Feature sequence072 185 1591 gene locus_tag LOCUS_29070 185 1591 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_29070 1961 3022 gene locus_tag LOCUS_29080 1961 3022 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861257.1 protein_id gnl|my_center|LOCUS_29080 4558 4397 gene locus_tag LOCUS_29090 4558 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 5880 4675 gene locus_tag LOCUS_29100 5880 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 6637 5870 gene locus_tag LOCUS_29110 6637 5870 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_29110 8031 6634 gene locus_tag LOCUS_29120 8031 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 8396 8049 gene locus_tag LOCUS_29130 8396 8049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 9712 8357 gene locus_tag LOCUS_29140 9712 8357 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388520.1 protein_id gnl|my_center|LOCUS_29140 10095 9712 gene locus_tag LOCUS_29150 10095 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 10259 10486 gene locus_tag LOCUS_29160 10259 10486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 11020 10844 gene locus_tag LOCUS_29170 11020 10844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 11482 12063 gene locus_tag LOCUS_29180 11482 12063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 12334 13344 gene locus_tag LOCUS_29190 12334 13344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 13492 14070 gene locus_tag LOCUS_29200 gene lexA 13492 14070 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_29200 >Feature sequence073 <1 578 gene locus_tag LOCUS_29210 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000030761.1:3-deoxy-manno-octulosonate cytidylyltransferase 575 2602 gene locus_tag LOCUS_29220 575 2602 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579517.1 protein_id gnl|my_center|LOCUS_29220 2700 3842 gene locus_tag LOCUS_29230 2700 3842 CDS product capsular biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161835.1 protein_id gnl|my_center|LOCUS_29230 5221 3992 gene locus_tag LOCUS_29240 5221 3992 CDS product alpha-2,8-polysialyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575410.1 protein_id gnl|my_center|LOCUS_29240 6359 5211 gene locus_tag LOCUS_29250 6359 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197086.1 protein_id gnl|my_center|LOCUS_29250 7527 6352 gene locus_tag LOCUS_29260 gene neuC 7527 6352 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723250.1 protein_id gnl|my_center|LOCUS_29260 8780 7524 gene locus_tag LOCUS_29270 8780 7524 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259306.1 protein_id gnl|my_center|LOCUS_29270 9820 8780 gene locus_tag LOCUS_29280 gene neuB 9820 8780 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066002.1 protein_id gnl|my_center|LOCUS_29280 10440 9817 gene locus_tag LOCUS_29290 10440 9817 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038461.1 protein_id gnl|my_center|LOCUS_29290 11149 10490 gene locus_tag LOCUS_29300 11149 10490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590258.1 protein_id gnl|my_center|LOCUS_29300 11922 11146 gene locus_tag LOCUS_29310 11922 11146 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124301.1 protein_id gnl|my_center|LOCUS_29310 13516 12980 gene locus_tag LOCUS_29320 gene yghD 13516 12980 CDS product GspM family type II secretion system protein YghD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942785.1 protein_id gnl|my_center|LOCUS_29320 >Feature sequence074 311 490 gene locus_tag LOCUS_29330 311 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 1107 1337 gene locus_tag LOCUS_29340 1107 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 1479 1667 gene locus_tag LOCUS_29350 1479 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 2171 1779 gene locus_tag LOCUS_29360 2171 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 2338 2523 gene locus_tag LOCUS_29370 2338 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 2540 2881 gene locus_tag LOCUS_29380 2540 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 2907 3161 gene locus_tag LOCUS_29390 2907 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 3191 3826 gene locus_tag LOCUS_29400 3191 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 3916 4113 gene locus_tag LOCUS_29410 3916 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 4094 4297 gene locus_tag LOCUS_29420 4094 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 4383 4556 gene locus_tag LOCUS_29430 4383 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 5222 4536 gene locus_tag LOCUS_29440 5222 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 5362 6099 gene locus_tag LOCUS_29450 5362 6099 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_29450 6103 7194 gene locus_tag LOCUS_29460 6103 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 7224 7484 gene locus_tag LOCUS_29470 7224 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 7521 7862 gene locus_tag LOCUS_29480 7521 7862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 8276 9532 gene locus_tag LOCUS_29490 8276 9532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 9675 11195 gene locus_tag LOCUS_29500 9675 11195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 11660 12145 gene locus_tag LOCUS_29510 11660 12145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 12418 12969 gene locus_tag LOCUS_29520 12418 12969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 >Feature sequence075 655 218 gene locus_tag LOCUS_29530 655 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 1206 691 gene locus_tag LOCUS_29540 1206 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 2446 1199 gene locus_tag LOCUS_29550 2446 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 2631 3032 gene locus_tag LOCUS_29560 2631 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 3032 3802 gene locus_tag LOCUS_29570 gene srtB 3032 3802 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242427.1 protein_id gnl|my_center|LOCUS_29570 3820 4314 gene locus_tag LOCUS_29580 3820 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 4329 6083 gene locus_tag LOCUS_29590 4329 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 6600 6148 gene locus_tag LOCUS_29600 6600 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 6827 7162 gene locus_tag LOCUS_29610 6827 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 7318 7533 gene locus_tag LOCUS_29620 7318 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 7720 7929 gene locus_tag LOCUS_29630 7720 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 8055 8252 gene locus_tag LOCUS_29640 8055 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 8303 9832 gene locus_tag LOCUS_29650 8303 9832 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_29650 10088 10522 gene locus_tag LOCUS_29660 10088 10522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 10541 11542 gene locus_tag LOCUS_29670 10541 11542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 11605 11937 gene locus_tag LOCUS_29680 11605 11937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 12090 12323 gene locus_tag LOCUS_29690 12090 12323 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381076.1 protein_id gnl|my_center|LOCUS_29690 >Feature sequence076 1039 92 gene locus_tag LOCUS_29700 1039 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 2325 1099 gene locus_tag LOCUS_29710 2325 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 3090 2338 gene locus_tag LOCUS_29720 3090 2338 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438367.1 protein_id gnl|my_center|LOCUS_29720 3978 3241 gene locus_tag LOCUS_29730 gene truA 3978 3241 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596150.1 protein_id gnl|my_center|LOCUS_29730 4641 3985 gene locus_tag LOCUS_29740 4641 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 5518 4694 gene locus_tag LOCUS_29750 5518 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 6330 5518 gene locus_tag LOCUS_29760 6330 5518 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531216.1 protein_id gnl|my_center|LOCUS_29760 7318 6380 gene locus_tag LOCUS_29770 7318 6380 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083141.1 protein_id gnl|my_center|LOCUS_29770 8961 7417 gene locus_tag LOCUS_29780 8961 7417 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017097.1 protein_id gnl|my_center|LOCUS_29780 11273 9117 gene locus_tag LOCUS_29790 11273 9117 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947999.1 protein_id gnl|my_center|LOCUS_29790 12256 11363 gene locus_tag LOCUS_29800 12256 11363 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023177.1 protein_id gnl|my_center|LOCUS_29800 12579 12968 gene locus_tag LOCUS_29810 12579 12968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 >Feature sequence077 116 778 gene locus_tag LOCUS_29820 116 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 1686 784 gene locus_tag LOCUS_29830 1686 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 1868 1689 gene locus_tag LOCUS_29840 1868 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 2359 1871 gene locus_tag LOCUS_29850 2359 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 3860 2406 gene locus_tag LOCUS_29860 3860 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 6306 3841 gene locus_tag LOCUS_29870 6306 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 9743 6303 gene locus_tag LOCUS_29880 9743 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 12315 9757 gene locus_tag LOCUS_29890 12315 9757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 >Feature sequence078 508 107 gene locus_tag LOCUS_29900 gene tnpB 508 107 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004312010.1 protein_id gnl|my_center|LOCUS_29900 790 512 gene locus_tag LOCUS_29910 790 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 1003 1455 gene locus_tag LOCUS_29920 1003 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29920 1973 2809 gene locus_tag LOCUS_29930 1973 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29930 3017 2823 gene locus_tag LOCUS_29940 3017 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 3169 3906 gene locus_tag LOCUS_29950 3169 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 4034 4381 gene locus_tag LOCUS_29960 4034 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 4445 5170 gene locus_tag LOCUS_29970 4445 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 5482 6819 gene locus_tag LOCUS_29980 5482 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 6913 7350 gene locus_tag LOCUS_29990 6913 7350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 8449 7481 gene locus_tag LOCUS_30000 8449 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 8857 8705 gene locus_tag LOCUS_30010 8857 8705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30010 9429 8854 gene locus_tag LOCUS_30020 9429 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30020 11129 9465 gene locus_tag LOCUS_30030 gene istA 11129 9465 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_30030 11343 11561 gene locus_tag LOCUS_30040 11343 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 >Feature sequence079 803 1087 gene locus_tag LOCUS_30050 803 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 1121 1408 gene locus_tag LOCUS_30060 1121 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 1445 4891 gene locus_tag LOCUS_30070 1445 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 5556 6092 gene locus_tag LOCUS_30080 5556 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 6331 6732 gene locus_tag LOCUS_30090 6331 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 6887 8617 gene locus_tag LOCUS_30100 6887 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 9253 8705 gene locus_tag LOCUS_30110 9253 8705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 9325 9771 gene locus_tag LOCUS_30120 9325 9771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 9761 10264 gene locus_tag LOCUS_30130 9761 10264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 >Feature sequence080 158 2005 gene locus_tag LOCUS_30140 158 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 2018 5278 gene locus_tag LOCUS_30150 2018 5278 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804172.1 protein_id gnl|my_center|LOCUS_30150 5283 5918 gene locus_tag LOCUS_30160 5283 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 5934 6665 gene locus_tag LOCUS_30170 5934 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 6698 7447 gene locus_tag LOCUS_30180 6698 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 7460 8527 gene locus_tag LOCUS_30190 7460 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 8540 9238 gene locus_tag LOCUS_30200 8540 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 9389 10495 gene locus_tag LOCUS_30210 9389 10495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 >Feature sequence081 143 997 gene locus_tag LOCUS_30220 143 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 1273 2127 gene locus_tag LOCUS_30230 gene bla 1273 2127 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231385.1 protein_id gnl|my_center|LOCUS_30230 3897 2329 gene locus_tag LOCUS_30240 3897 2329 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_30240 5561 3882 gene locus_tag LOCUS_30250 5561 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 5771 5610 gene locus_tag LOCUS_30260 5771 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 6156 5764 gene locus_tag LOCUS_30270 6156 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 6345 6509 gene locus_tag LOCUS_30280 6345 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 7194 6562 gene locus_tag LOCUS_30290 7194 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 7919 7506 gene locus_tag LOCUS_30300 7919 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 >Feature sequence082 260 637 gene locus_tag LOCUS_30310 260 637 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_30310 758 2152 gene locus_tag LOCUS_30320 758 2152 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_30320 2166 2996 gene locus_tag LOCUS_30330 2166 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 2999 3487 gene locus_tag LOCUS_30340 2999 3487 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249319.1 protein_id gnl|my_center|LOCUS_30340 3484 4377 gene locus_tag LOCUS_30350 3484 4377 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813616.1 protein_id gnl|my_center|LOCUS_30350 4863 5123 gene locus_tag LOCUS_30360 4863 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 5358 6074 gene locus_tag LOCUS_30370 5358 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 6092 6331 gene locus_tag LOCUS_30380 6092 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 6646 6993 gene locus_tag LOCUS_30390 6646 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30390 7705 7848 gene locus_tag LOCUS_30400 7705 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 >Feature sequence083 409 681 gene locus_tag LOCUS_30410 409 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 761 2170 gene locus_tag LOCUS_30420 761 2170 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917061.1 protein_id gnl|my_center|LOCUS_30420 2163 2981 gene locus_tag LOCUS_30430 2163 2981 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_30430 2978 3295 gene locus_tag LOCUS_30440 2978 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 3812 4093 gene locus_tag LOCUS_30450 3812 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 4066 4782 gene locus_tag LOCUS_30460 4066 4782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461283.1 protein_id gnl|my_center|LOCUS_30460 4797 7151 gene locus_tag LOCUS_30470 4797 7151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 7540 7845 gene locus_tag LOCUS_30480 7540 7845 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890712.1 protein_id gnl|my_center|LOCUS_30480 7830 8381 gene locus_tag LOCUS_30490 7830 8381 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_30490 8415 8837 gene locus_tag LOCUS_30500 8415 8837 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_30500 >Feature sequence084 128 454 gene locus_tag LOCUS_30510 128 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 438 1106 gene locus_tag LOCUS_30520 438 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 1478 1173 gene locus_tag LOCUS_30530 1478 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 2531 1689 gene locus_tag LOCUS_30540 2531 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30540 2821 2498 gene locus_tag LOCUS_30550 gene mobC 2821 2498 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861100.1 protein_id gnl|my_center|LOCUS_30550 2896 3075 gene locus_tag LOCUS_30560 2896 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 4939 3482 gene locus_tag LOCUS_30570 4939 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 5114 5740 gene locus_tag LOCUS_30580 5114 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 6106 5813 gene locus_tag LOCUS_30590 6106 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 6694 6140 gene locus_tag LOCUS_30600 6694 6140 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092482714.1 protein_id gnl|my_center|LOCUS_30600 7224 6772 gene locus_tag LOCUS_30610 7224 6772 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986684.1 protein_id gnl|my_center|LOCUS_30610 7419 8663 gene locus_tag LOCUS_30620 7419 8663 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_30620 8684 8962 gene locus_tag LOCUS_30630 8684 8962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 >Feature sequence085 829 275 gene locus_tag LOCUS_30640 829 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 1197 889 gene locus_tag LOCUS_30650 1197 889 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018366816.1 protein_id gnl|my_center|LOCUS_30650 1445 1200 gene locus_tag LOCUS_30660 1445 1200 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812819.1 protein_id gnl|my_center|LOCUS_30660 2456 1608 gene locus_tag LOCUS_30670 2456 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 2630 3988 gene locus_tag LOCUS_30680 2630 3988 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004118145.1 protein_id gnl|my_center|LOCUS_30680 4561 4959 gene locus_tag LOCUS_30690 4561 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 5289 5792 gene locus_tag LOCUS_30700 5289 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 5806 7968 gene locus_tag LOCUS_30710 5806 7968 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111154492.1 protein_id gnl|my_center|LOCUS_30710 7974 8744 gene locus_tag LOCUS_30720 7974 8744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 >Feature sequence086 <1 1048 gene locus_tag LOCUS_30730 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010774229.1:DEAD/DEAH box helicase family protein 1157 2107 gene locus_tag LOCUS_30740 1157 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 2115 3080 gene locus_tag LOCUS_30750 2115 3080 CDS product DUF3991 and toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368706.1 protein_id gnl|my_center|LOCUS_30750 3077 3481 gene locus_tag LOCUS_30760 3077 3481 CDS product DUF3846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272736.1 protein_id gnl|my_center|LOCUS_30760 3618 3752 gene locus_tag LOCUS_30770 3618 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 3745 4086 gene locus_tag LOCUS_30780 3745 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 4077 5447 gene locus_tag LOCUS_30790 4077 5447 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102364993.1 protein_id gnl|my_center|LOCUS_30790 5431 6237 gene locus_tag LOCUS_30800 5431 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 6243 7127 gene locus_tag LOCUS_30810 6243 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 7140 7343 gene locus_tag LOCUS_30820 7140 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 7330 8712 gene locus_tag LOCUS_30830 7330 8712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 >Feature sequence087 2245 221 gene locus_tag LOCUS_30840 2245 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 3610 3080 gene locus_tag LOCUS_30850 3610 3080 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965782.1 protein_id gnl|my_center|LOCUS_30850 4449 3646 gene locus_tag LOCUS_30860 4449 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 4884 4471 gene locus_tag LOCUS_30870 4884 4471 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438867.1 protein_id gnl|my_center|LOCUS_30870 5306 5070 gene locus_tag LOCUS_30880 5306 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 5215 5616 gene locus_tag LOCUS_30890 5215 5616 CDS product cysteine-rich VLP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861105.1 protein_id gnl|my_center|LOCUS_30890 5682 6395 gene locus_tag LOCUS_30900 5682 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 6373 6771 gene locus_tag LOCUS_30910 6373 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 6740 7045 gene locus_tag LOCUS_30920 6740 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 8024 7107 gene locus_tag LOCUS_30930 8024 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 8433 8107 gene locus_tag LOCUS_30940 8433 8107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 >Feature sequence088 255 959 gene locus_tag LOCUS_30950 gene cysE 255 959 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_30950 946 2352 gene locus_tag LOCUS_30960 gene cysS 946 2352 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_30960 2337 2810 gene locus_tag LOCUS_30970 2337 2810 CDS product ribonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860630.1 protein_id gnl|my_center|LOCUS_30970 2875 3675 gene locus_tag LOCUS_30980 gene rlmB 2875 3675 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_30980 3682 4386 gene locus_tag LOCUS_30990 gene sigH 3682 4386 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966312.1 protein_id gnl|my_center|LOCUS_30990 5046 4459 gene locus_tag LOCUS_31000 5046 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 5333 5064 gene locus_tag LOCUS_31010 5333 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 5574 7214 gene locus_tag LOCUS_31020 5574 7214 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746428.1 protein_id gnl|my_center|LOCUS_31020 7218 7901 gene locus_tag LOCUS_31030 7218 7901 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598666.1 protein_id gnl|my_center|LOCUS_31030 8149 8077 gene locus_tag LOCUS_t00360 8149 8077 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence089 406 119 gene locus_tag LOCUS_31040 406 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 693 1187 gene locus_tag LOCUS_31050 693 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31050 1184 2257 gene locus_tag LOCUS_31060 1184 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31060 2331 3635 gene locus_tag LOCUS_31070 2331 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 3830 4069 gene locus_tag LOCUS_31080 3830 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399633.1 protein_id gnl|my_center|LOCUS_31080 4082 4450 gene locus_tag LOCUS_31090 4082 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114894.1 protein_id gnl|my_center|LOCUS_31090 4536 4748 gene locus_tag LOCUS_31100 4536 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 4945 5829 gene locus_tag LOCUS_31110 4945 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 5865 8048 gene locus_tag LOCUS_31120 5865 8048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31120 >Feature sequence090 959 105 gene locus_tag LOCUS_31130 gene trmD 959 105 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_31130 1464 961 gene locus_tag LOCUS_31140 gene rimM 1464 961 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889030.1 protein_id gnl|my_center|LOCUS_31140 1877 1647 gene locus_tag LOCUS_31150 1877 1647 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392483.1 protein_id gnl|my_center|LOCUS_31150 2146 1901 gene locus_tag LOCUS_31160 gene rpsP 2146 1901 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_31160 3560 2205 gene locus_tag LOCUS_31170 gene ffh 3560 2205 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_31170 3912 3562 gene locus_tag LOCUS_31180 3912 3562 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393779.1 protein_id gnl|my_center|LOCUS_31180 5041 4007 gene locus_tag LOCUS_31190 5041 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 5338 5574 gene locus_tag LOCUS_31200 5338 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 5959 5765 gene locus_tag LOCUS_31210 5959 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 6101 6637 gene locus_tag LOCUS_31220 6101 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 6727 7011 gene locus_tag LOCUS_31230 6727 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 7148 7933 gene locus_tag LOCUS_31240 gene truA 7148 7933 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430279.1 protein_id gnl|my_center|LOCUS_31240 >Feature sequence091 1153 944 gene locus_tag LOCUS_31250 1153 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 1717 1229 gene locus_tag LOCUS_31260 1717 1229 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_31260 2299 1742 gene locus_tag LOCUS_31270 2299 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 2650 2345 gene locus_tag LOCUS_31280 2650 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 3850 2756 gene locus_tag LOCUS_31290 3850 2756 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368732.1 protein_id gnl|my_center|LOCUS_31290 4741 3875 gene locus_tag LOCUS_31300 4741 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 5537 4731 gene locus_tag LOCUS_31310 gene soj 5537 4731 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516114.1 protein_id gnl|my_center|LOCUS_31310 5901 5509 gene locus_tag LOCUS_31320 5901 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 6984 5905 gene locus_tag LOCUS_31330 6984 5905 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_31330 7184 6987 gene locus_tag LOCUS_31340 7184 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 7399 7181 gene locus_tag LOCUS_31350 7399 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 7619 7392 gene locus_tag LOCUS_31360 7619 7392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 >Feature sequence092 803 5773 gene locus_tag LOCUS_31370 803 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 5770 7206 gene locus_tag LOCUS_31380 5770 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 7236 7517 gene locus_tag LOCUS_31390 7236 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31390 >Feature sequence093 289 89 gene locus_tag LOCUS_31400 289 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 1293 286 gene locus_tag LOCUS_31410 1293 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 1561 1343 gene locus_tag LOCUS_31420 1561 1343 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205227.1 protein_id gnl|my_center|LOCUS_31420 3285 1705 gene locus_tag LOCUS_31430 3285 1705 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_31430 3701 3288 gene locus_tag LOCUS_31440 3701 3288 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510187.1 protein_id gnl|my_center|LOCUS_31440 4524 3706 gene locus_tag LOCUS_31450 4524 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31450 5258 4521 gene locus_tag LOCUS_31460 5258 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31460 5656 5321 gene locus_tag LOCUS_31470 5656 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 6675 5677 gene locus_tag LOCUS_31480 6675 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 7200 6706 gene locus_tag LOCUS_31490 7200 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 7659 7255 gene locus_tag LOCUS_31500 7659 7255 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439566.1 protein_id gnl|my_center|LOCUS_31500 >Feature sequence094 32 220 gene locus_tag LOCUS_31510 32 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 236 535 gene locus_tag LOCUS_31520 236 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 760 1371 gene locus_tag LOCUS_31530 760 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 1368 4691 gene locus_tag LOCUS_31540 1368 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 5287 6531 gene locus_tag LOCUS_31550 5287 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 6629 7381 gene locus_tag LOCUS_31560 6629 7381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 >Feature sequence095 1879 77 gene locus_tag LOCUS_31570 1879 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 2560 1883 gene locus_tag LOCUS_31580 2560 1883 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861403.1 protein_id gnl|my_center|LOCUS_31580 3701 2670 gene locus_tag LOCUS_31590 3701 2670 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861402.1 protein_id gnl|my_center|LOCUS_31590 4381 3698 gene locus_tag LOCUS_31600 4381 3698 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861401.1 protein_id gnl|my_center|LOCUS_31600 5082 4813 gene locus_tag LOCUS_31610 5082 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 5591 5172 gene locus_tag LOCUS_31620 5591 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 5882 6790 gene locus_tag LOCUS_31630 5882 6790 CDS product glutathione synthetase ATP-binding domain-like superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070843.1 protein_id gnl|my_center|LOCUS_31630 6814 7506 gene locus_tag LOCUS_31640 6814 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 >Feature sequence096 402 169 gene locus_tag LOCUS_31650 402 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 839 408 gene locus_tag LOCUS_31660 839 408 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989664.1 protein_id gnl|my_center|LOCUS_31660 3528 1318 gene locus_tag LOCUS_31670 3528 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 4285 3518 gene locus_tag LOCUS_31680 4285 3518 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860752.1 protein_id gnl|my_center|LOCUS_31680 5409 4396 gene locus_tag LOCUS_31690 5409 4396 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_31690 6077 5406 gene locus_tag LOCUS_31700 6077 5406 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024933199.1 protein_id gnl|my_center|LOCUS_31700 6258 6064 gene locus_tag LOCUS_31710 6258 6064 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905249.1 protein_id gnl|my_center|LOCUS_31710 6402 6770 gene locus_tag LOCUS_31720 6402 6770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 7013 7342 gene locus_tag LOCUS_31730 gene mobC 7013 7342 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861100.1 protein_id gnl|my_center|LOCUS_31730 >Feature sequence097 <1 718 gene locus_tag LOCUS_31740 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460406.1:ATP-binding protein 718 1335 gene locus_tag LOCUS_31750 718 1335 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263264.1 protein_id gnl|my_center|LOCUS_31750 1397 1549 gene locus_tag LOCUS_31760 1397 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 1589 2317 gene locus_tag LOCUS_31770 1589 2317 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101571.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31770 2321 2494 gene locus_tag LOCUS_31780 2321 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31780 2539 5844 gene locus_tag LOCUS_31790 2539 5844 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941424.1 protein_id gnl|my_center|LOCUS_31790 6058 7248 gene locus_tag LOCUS_31800 6058 7248 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372834.1 protein_id gnl|my_center|LOCUS_31800 >Feature sequence098 41 220 gene locus_tag LOCUS_31810 41 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 202 372 gene locus_tag LOCUS_31820 202 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 476 1207 gene locus_tag LOCUS_31830 476 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 1274 2257 gene locus_tag LOCUS_31840 1274 2257 CDS product IS5-like element ISVch5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019370.1 protein_id gnl|my_center|LOCUS_31840 2570 2394 gene locus_tag LOCUS_31850 2570 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 3597 2902 gene locus_tag LOCUS_31860 3597 2902 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522871.1 protein_id gnl|my_center|LOCUS_31860 4728 3601 gene locus_tag LOCUS_31870 4728 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 5731 4730 gene locus_tag LOCUS_31880 5731 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 6651 5728 gene locus_tag LOCUS_31890 6651 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 7144 6641 gene locus_tag LOCUS_31900 7144 6641 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_31900 >Feature sequence099 262 768 gene locus_tag LOCUS_31910 262 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 834 1841 gene locus_tag LOCUS_31920 834 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 2570 2271 gene locus_tag LOCUS_31930 2570 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 2696 2851 gene locus_tag LOCUS_31940 2696 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 3280 2957 gene locus_tag LOCUS_31950 3280 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 3802 4080 gene locus_tag LOCUS_31960 3802 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 4444 6816 gene locus_tag LOCUS_31970 4444 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 >Feature sequence100 1273 134 gene locus_tag LOCUS_31980 1273 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 1890 1342 gene locus_tag LOCUS_31990 gene ispF 1890 1342 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_31990 2658 1897 gene locus_tag LOCUS_32000 2658 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 2839 2765 gene locus_tag LOCUS_t00370 2839 2765 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2931 2857 gene locus_tag LOCUS_t00380 2931 2857 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6849 3094 gene locus_tag LOCUS_32010 6849 3094 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_32010 >Feature sequence101 2890 2546 gene locus_tag LOCUS_32020 2890 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 3672 3977 gene locus_tag LOCUS_32030 3672 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 >Feature sequence102 645 493 gene locus_tag LOCUS_32040 645 493 CDS product DUF1391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379548.1 protein_id gnl|my_center|LOCUS_32040 1440 964 gene locus_tag LOCUS_32050 gene racR 1440 964 CDS product DNA-binding transcriptional repressor RacR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948454.1 protein_id gnl|my_center|LOCUS_32050 1565 1888 gene locus_tag LOCUS_32060 1565 1888 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711018.1 protein_id gnl|my_center|LOCUS_32060 1872 2297 gene locus_tag LOCUS_32070 1872 2297 CDS product toxin YdaT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000693943.1 protein_id gnl|my_center|LOCUS_32070 2320 3288 gene locus_tag LOCUS_32080 2320 3288 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095671.1 protein_id gnl|my_center|LOCUS_32080 3295 4041 gene locus_tag LOCUS_32090 3295 4041 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788751.1 protein_id gnl|my_center|LOCUS_32090 4063 4833 gene locus_tag LOCUS_32100 4063 4833 CDS product DUF1627 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450992.1 protein_id gnl|my_center|LOCUS_32100 4849 5262 gene locus_tag LOCUS_32110 4849 5262 CDS product DUF977 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151233.1 protein_id gnl|my_center|LOCUS_32110 6387 5614 gene locus_tag LOCUS_32120 6387 5614 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160654.1 protein_id gnl|my_center|LOCUS_32120 >Feature sequence103 1025 495 gene locus_tag LOCUS_32130 1025 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 2485 1319 gene locus_tag LOCUS_32140 2485 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 4175 2508 gene locus_tag LOCUS_32150 4175 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 5246 4305 gene locus_tag LOCUS_32160 5246 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 6671 5331 gene locus_tag LOCUS_32170 6671 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 >Feature sequence104 357 1001 gene locus_tag LOCUS_32180 357 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32180 1604 1828 gene locus_tag LOCUS_32190 1604 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 2243 3436 gene locus_tag LOCUS_32200 2243 3436 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450494.1 protein_id gnl|my_center|LOCUS_32200 4073 4939 gene locus_tag LOCUS_32210 4073 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32210 5076 5462 gene locus_tag LOCUS_32220 5076 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001312830.1 protein_id gnl|my_center|LOCUS_32220 5697 6638 gene locus_tag LOCUS_32230 5697 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071996.1 protein_id gnl|my_center|LOCUS_32230 >Feature sequence105 94 411 gene locus_tag LOCUS_32240 94 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 500 781 gene locus_tag LOCUS_32250 500 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 896 1225 gene locus_tag LOCUS_32260 896 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 1382 1615 gene locus_tag LOCUS_32270 1382 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 1791 2405 gene locus_tag LOCUS_32280 1791 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 2440 2634 gene locus_tag LOCUS_32290 2440 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 2654 2866 gene locus_tag LOCUS_32300 2654 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 2923 4320 gene locus_tag LOCUS_32310 2923 4320 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057658.1 protein_id gnl|my_center|LOCUS_32310 4354 4890 gene locus_tag LOCUS_32320 4354 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 4904 5392 gene locus_tag LOCUS_32330 4904 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 5408 6025 gene locus_tag LOCUS_32340 5408 6025 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071130048.1 protein_id gnl|my_center|LOCUS_32340 6059 6391 gene locus_tag LOCUS_32350 6059 6391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 6403 6642 gene locus_tag LOCUS_32360 6403 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 >Feature sequence106 952 1206 gene locus_tag LOCUS_32370 952 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 1273 1905 gene locus_tag LOCUS_32380 1273 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32380 2088 1876 gene locus_tag LOCUS_32390 2088 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 2920 2417 gene locus_tag LOCUS_32400 2920 2417 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_32400 3982 3326 gene locus_tag LOCUS_32410 3982 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207502.1 protein_id gnl|my_center|LOCUS_32410 5235 3988 gene locus_tag LOCUS_32420 5235 3988 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478434.1 protein_id gnl|my_center|LOCUS_32420 6616 5660 gene locus_tag LOCUS_32430 6616 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 >Feature sequence107 905 633 gene locus_tag LOCUS_32440 905 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 5078 1152 gene locus_tag LOCUS_32450 gene espP 5078 1152 CDS product serine protease autotransporter EspP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034100.1 protein_id gnl|my_center|LOCUS_32450 5931 5797 gene locus_tag LOCUS_32460 5931 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 6247 5957 gene locus_tag LOCUS_32470 6247 5957 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815479.1 protein_id gnl|my_center|LOCUS_32470 6491 6237 gene locus_tag LOCUS_32480 6491 6237 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175264.1 protein_id gnl|my_center|LOCUS_32480 >Feature sequence108 50 289 gene locus_tag LOCUS_32490 50 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 1264 344 gene locus_tag LOCUS_32500 1264 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 1400 1969 gene locus_tag LOCUS_32510 1400 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 1980 3731 gene locus_tag LOCUS_32520 1980 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 3833 4030 gene locus_tag LOCUS_32530 3833 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 4115 5530 gene locus_tag LOCUS_32540 4115 5530 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861441.1 protein_id gnl|my_center|LOCUS_32540 6048 6413 gene locus_tag LOCUS_32550 6048 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 >Feature sequence109 20 1354 gene locus_tag LOCUS_32560 20 1354 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861101.1 protein_id gnl|my_center|LOCUS_32560 1476 2069 gene locus_tag LOCUS_32570 1476 2069 CDS product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 protein_id gnl|my_center|LOCUS_32570 2066 2911 gene locus_tag LOCUS_32580 2066 2911 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287519.1 protein_id gnl|my_center|LOCUS_32580 2930 3325 gene locus_tag LOCUS_32590 2930 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 3451 4095 gene locus_tag LOCUS_32600 3451 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 5898 4546 gene locus_tag LOCUS_32610 5898 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 6455 5895 gene locus_tag LOCUS_32620 6455 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 >Feature sequence110 406 1323 gene locus_tag LOCUS_32630 406 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 1341 2588 gene locus_tag LOCUS_32640 1341 2588 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 protein_id gnl|my_center|LOCUS_32640 2585 3649 gene locus_tag LOCUS_32650 2585 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 3646 4194 gene locus_tag LOCUS_32660 3646 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 4204 5376 gene locus_tag LOCUS_32670 4204 5376 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107242.1 protein_id gnl|my_center|LOCUS_32670 5389 6579 gene locus_tag LOCUS_32680 5389 6579 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203512.1 protein_id gnl|my_center|LOCUS_32680 >Feature sequence111 2 145 gene locus_tag LOCUS_32690 2 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 420 623 gene locus_tag LOCUS_32700 420 623 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985621.1 protein_id gnl|my_center|LOCUS_32700 658 3000 gene locus_tag LOCUS_32710 658 3000 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229101.1 protein_id gnl|my_center|LOCUS_32710 3003 4523 gene locus_tag LOCUS_32720 3003 4523 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775649.1 protein_id gnl|my_center|LOCUS_32720 4520 6001 gene locus_tag LOCUS_32730 4520 6001 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187233.1 protein_id gnl|my_center|LOCUS_32730 6011 6460 gene locus_tag LOCUS_32740 6011 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 >Feature sequence112 <1 1054 gene locus_tag LOCUS_32750 <1 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000053628.1:type VI secretion system tip protein VgrG 1170 2207 gene locus_tag LOCUS_32760 1170 2207 CDS product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019587.1 protein_id gnl|my_center|LOCUS_32760 2200 3639 gene locus_tag LOCUS_32770 2200 3639 CDS product DUF4150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528852.1 protein_id gnl|my_center|LOCUS_32770 3614 3904 gene locus_tag LOCUS_32780 3614 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513317.1 protein_id gnl|my_center|LOCUS_32780 4162 4341 gene locus_tag LOCUS_32790 4162 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32790 4441 4926 gene locus_tag LOCUS_32800 4441 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32800 5155 5658 gene locus_tag LOCUS_32810 5155 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227714.1 protein_id gnl|my_center|LOCUS_32810 5728 6240 gene locus_tag LOCUS_32820 5728 6240 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001331864.1 protein_id gnl|my_center|LOCUS_32820 >Feature sequence113 104 886 gene locus_tag LOCUS_32830 104 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 899 2164 gene locus_tag LOCUS_32840 899 2164 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592994.1 protein_id gnl|my_center|LOCUS_32840 2424 3065 gene locus_tag LOCUS_32850 2424 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 3393 4166 gene locus_tag LOCUS_32860 3393 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32860 4168 4557 gene locus_tag LOCUS_32870 4168 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 5517 6431 gene locus_tag LOCUS_32880 5517 6431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 >Feature sequence114 1089 154 gene locus_tag LOCUS_32890 1089 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 2570 1122 gene locus_tag LOCUS_32900 2570 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 3453 2587 gene locus_tag LOCUS_32910 3453 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 4279 3437 gene locus_tag LOCUS_32920 4279 3437 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32920 6406 4637 gene locus_tag LOCUS_32930 6406 4637 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_32930 >Feature sequence115 118 1005 gene locus_tag LOCUS_32940 118 1005 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129898.1 protein_id gnl|my_center|LOCUS_32940 2495 1242 gene locus_tag LOCUS_32950 2495 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 2890 2486 gene locus_tag LOCUS_32960 2890 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 3349 2903 gene locus_tag LOCUS_32970 3349 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 4824 3529 gene locus_tag LOCUS_32980 4824 3529 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288357.1 protein_id gnl|my_center|LOCUS_32980 5540 4911 gene locus_tag LOCUS_32990 5540 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 5716 5946 gene locus_tag LOCUS_33000 5716 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 6093 6407 gene locus_tag LOCUS_33010 6093 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 >Feature sequence116 1351 356 gene locus_tag LOCUS_33020 1351 356 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122014502.1 protein_id gnl|my_center|LOCUS_33020 1590 2174 gene locus_tag LOCUS_33030 1590 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 2674 2171 gene locus_tag LOCUS_33040 2674 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 4169 2664 gene locus_tag LOCUS_33050 4169 2664 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_33050 4470 4258 gene locus_tag LOCUS_33060 4470 4258 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_33060 5204 4878 gene locus_tag LOCUS_33070 5204 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 5369 5842 gene locus_tag LOCUS_33080 5369 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 5875 6441 gene locus_tag LOCUS_33090 5875 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 >Feature sequence117 2035 2274 gene locus_tag LOCUS_33100 2035 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 >Feature sequence118 1013 723 gene locus_tag LOCUS_33110 1013 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 5596 5429 gene locus_tag LOCUS_33120 5596 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 >Feature sequence119 53 1537 gene locus_tag LOCUS_33130 53 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 1962 1645 gene locus_tag LOCUS_33140 1962 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 2777 1959 gene locus_tag LOCUS_33150 2777 1959 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_33150 3102 2770 gene locus_tag LOCUS_33160 3102 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 4070 3042 gene locus_tag LOCUS_33170 4070 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33170 4663 4256 gene locus_tag LOCUS_33180 4663 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 4990 5298 gene locus_tag LOCUS_33190 4990 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 5374 5694 gene locus_tag LOCUS_33200 5374 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 5691 6038 gene locus_tag LOCUS_33210 5691 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 >Feature sequence120 1468 95 gene locus_tag LOCUS_33220 1468 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 2063 1443 gene locus_tag LOCUS_33230 2063 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 2285 3388 gene locus_tag LOCUS_33240 2285 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 3412 3642 gene locus_tag LOCUS_33250 3412 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 3727 4902 gene locus_tag LOCUS_33260 3727 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 5627 5058 gene locus_tag LOCUS_33270 5627 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 5970 5770 gene locus_tag LOCUS_33280 5970 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 >Feature sequence121 1167 616 gene locus_tag LOCUS_33290 1167 616 CDS product RteC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304269.1 protein_id gnl|my_center|LOCUS_33290 1857 1444 gene locus_tag LOCUS_33300 1857 1444 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291474.1 protein_id gnl|my_center|LOCUS_33300 3461 2139 gene locus_tag LOCUS_33310 3461 2139 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065539461.1 protein_id gnl|my_center|LOCUS_33310 5772 3454 gene locus_tag LOCUS_33320 5772 3454 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291467.1 protein_id gnl|my_center|LOCUS_33320 >Feature sequence122 2054 1164 gene locus_tag LOCUS_33330 2054 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 2199 2921 gene locus_tag LOCUS_33340 2199 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 2881 3222 gene locus_tag LOCUS_33350 2881 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 3231 4646 gene locus_tag LOCUS_33360 3231 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 4652 5401 gene locus_tag LOCUS_33370 4652 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 5343 5855 gene locus_tag LOCUS_33380 5343 5855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 >Feature sequence123 <1 508 gene locus_tag LOCUS_33390 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000535948.1:carboxylate/amino acid/amine transporter 1851 712 gene locus_tag LOCUS_33400 1851 712 CDS product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705962.1 protein_id gnl|my_center|LOCUS_33400 2630 3199 gene locus_tag LOCUS_33410 2630 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33410 3196 3612 gene locus_tag LOCUS_33420 3196 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33420 3625 4146 gene locus_tag LOCUS_33430 3625 4146 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091409.1 protein_id gnl|my_center|LOCUS_33430 4139 5446 gene locus_tag LOCUS_33440 4139 5446 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566798.1 protein_id gnl|my_center|LOCUS_33440 5987 5598 gene locus_tag LOCUS_33450 5987 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 >Feature sequence124 552 1130 gene locus_tag LOCUS_33460 552 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 1123 1383 gene locus_tag LOCUS_33470 1123 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 1490 1741 gene locus_tag LOCUS_33480 1490 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 1728 2429 gene locus_tag LOCUS_33490 1728 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 2419 2625 gene locus_tag LOCUS_33500 2419 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 2638 4101 gene locus_tag LOCUS_33510 2638 4101 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861441.1 protein_id gnl|my_center|LOCUS_33510 4841 5203 gene locus_tag LOCUS_33520 4841 5203 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860652.1 protein_id gnl|my_center|LOCUS_33520 5352 5783 gene locus_tag LOCUS_33530 5352 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 >Feature sequence125 236 514 gene locus_tag LOCUS_33540 236 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 1100 1606 gene locus_tag LOCUS_33550 1100 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 1599 2144 gene locus_tag LOCUS_33560 1599 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 2157 2504 gene locus_tag LOCUS_33570 2157 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 2501 3865 gene locus_tag LOCUS_33580 2501 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 4098 4601 gene locus_tag LOCUS_33590 4098 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 5540 4899 gene locus_tag LOCUS_33600 5540 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 5896 5537 gene locus_tag LOCUS_33610 5896 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 >Feature sequence126 97 1959 gene locus_tag LOCUS_33620 97 1959 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_33620 2026 2256 gene locus_tag LOCUS_33630 2026 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 2272 3516 gene locus_tag LOCUS_33640 2272 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 3526 4161 gene locus_tag LOCUS_33650 3526 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 4076 5398 gene locus_tag LOCUS_33660 4076 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 5673 5825 gene locus_tag LOCUS_33670 5673 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 >Feature sequence127 229 1020 gene locus_tag LOCUS_33680 229 1020 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023395.1 protein_id gnl|my_center|LOCUS_33680 1092 1982 gene locus_tag LOCUS_33690 1092 1982 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964780.1 protein_id gnl|my_center|LOCUS_33690 1979 2476 gene locus_tag LOCUS_33700 1979 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 3083 3712 gene locus_tag LOCUS_33710 3083 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 5192 3843 gene locus_tag LOCUS_33720 5192 3843 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_33720 5805 5185 gene locus_tag LOCUS_33730 5805 5185 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_33730 >Feature sequence128 2 340 gene locus_tag LOCUS_33740 2 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 684 1745 gene locus_tag LOCUS_33750 gene wcaM 684 1745 CDS product colanic acid biosynthesis protein WcaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116047.1 protein_id gnl|my_center|LOCUS_33750 1920 2813 gene locus_tag LOCUS_33760 gene galF 1920 2813 CDS product UTP--glucose-1-phosphate uridylyltransferase GalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183060.1 protein_id gnl|my_center|LOCUS_33760 3194 4279 gene locus_tag LOCUS_33770 gene wecB 3194 4279 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866686.1 protein_id gnl|my_center|LOCUS_33770 4601 4386 gene locus_tag LOCUS_33780 4601 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 4483 5424 gene locus_tag LOCUS_33790 4483 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 >Feature sequence129 1119 2330 gene locus_tag LOCUS_33800 1119 2330 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188697727.1 protein_id gnl|my_center|LOCUS_33800 2332 2730 gene locus_tag LOCUS_33810 2332 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 2727 3155 gene locus_tag LOCUS_33820 2727 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 3268 4392 gene locus_tag LOCUS_33830 3268 4392 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_33830 5091 4483 gene locus_tag LOCUS_33840 5091 4483 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459566.1 protein_id gnl|my_center|LOCUS_33840 5763 5101 gene locus_tag LOCUS_33850 5763 5101 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459567.1 protein_id gnl|my_center|LOCUS_33850 >Feature sequence130 1280 198 gene locus_tag LOCUS_33860 1280 198 CDS product CfaE/CblD family pilus tip adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351324.1 protein_id gnl|my_center|LOCUS_33860 3961 1277 gene locus_tag LOCUS_33870 3961 1277 CDS product TcfC E-set like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358674.1 protein_id gnl|my_center|LOCUS_33870 4554 4054 gene locus_tag LOCUS_33880 4554 4054 CDS product CS1 type fimbrial major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755097.1 protein_id gnl|my_center|LOCUS_33880 5225 4584 gene locus_tag LOCUS_33890 5225 4584 CDS product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225866.1 protein_id gnl|my_center|LOCUS_33890 >Feature sequence131 351 88 gene locus_tag LOCUS_33900 351 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 777 631 gene locus_tag LOCUS_33910 777 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 1253 807 gene locus_tag LOCUS_33920 1253 807 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461668.1 protein_id gnl|my_center|LOCUS_33920 2257 1325 gene locus_tag LOCUS_33930 gene cysK 2257 1325 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_33930 2831 2418 gene locus_tag LOCUS_33940 2831 2418 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460328.1 protein_id gnl|my_center|LOCUS_33940 3900 3070 gene locus_tag LOCUS_33950 3900 3070 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965994.1 protein_id gnl|my_center|LOCUS_33950 4101 3922 gene locus_tag LOCUS_33960 4101 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 5702 4236 gene locus_tag LOCUS_33970 5702 4236 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_33970 >Feature sequence132 144 219 gene locus_tag LOCUS_t00390 144 219 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 247 320 gene locus_tag LOCUS_t00400 247 320 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 332 415 gene locus_tag LOCUS_t00410 332 415 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 463 535 gene locus_tag LOCUS_t00420 463 535 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 548 622 gene locus_tag LOCUS_t00430 548 622 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 642 716 gene locus_tag LOCUS_t00440 642 716 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 984 1682 gene locus_tag LOCUS_33980 984 1682 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706813.1 protein_id gnl|my_center|LOCUS_33980 1782 2714 gene locus_tag LOCUS_33990 1782 2714 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281520.1 protein_id gnl|my_center|LOCUS_33990 2735 4240 gene locus_tag LOCUS_34000 2735 4240 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430454.1 protein_id gnl|my_center|LOCUS_34000 4267 4440 gene locus_tag LOCUS_34010 4267 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 4644 5534 gene locus_tag LOCUS_34020 4644 5534 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150277.1 protein_id gnl|my_center|LOCUS_34020 >Feature sequence133 76 222 gene locus_tag LOCUS_34030 76 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 222 377 gene locus_tag LOCUS_34040 222 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 1259 471 gene locus_tag LOCUS_34050 1259 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 1848 1567 gene locus_tag LOCUS_34060 1848 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 3052 1838 gene locus_tag LOCUS_34070 3052 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 3653 3057 gene locus_tag LOCUS_34080 3653 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 4332 3583 gene locus_tag LOCUS_34090 4332 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 4488 4342 gene locus_tag LOCUS_34100 4488 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 4816 4631 gene locus_tag LOCUS_34110 4816 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 4940 4866 gene locus_tag LOCUS_t00450 4940 4866 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5114 4926 gene locus_tag LOCUS_34120 5114 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 5394 5158 gene locus_tag LOCUS_34130 5394 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 >Feature sequence134 <1 1225 gene locus_tag LOCUS_34140 <1 1225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861101.1:relaxase/mobilization nuclease domain-containing protein 1494 2423 gene locus_tag LOCUS_34150 1494 2423 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_34150 2407 4146 gene locus_tag LOCUS_34160 2407 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 4413 4189 gene locus_tag LOCUS_34170 4413 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 5547 4780 gene locus_tag LOCUS_34180 5547 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 >Feature sequence135 758 294 gene locus_tag LOCUS_34190 758 294 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861118.1 protein_id gnl|my_center|LOCUS_34190 1806 829 gene locus_tag LOCUS_34200 1806 829 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_34200 2042 1827 gene locus_tag LOCUS_34210 2042 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 2359 2736 gene locus_tag LOCUS_34220 2359 2736 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_34220 3530 3207 gene locus_tag LOCUS_34230 3530 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 3852 3559 gene locus_tag LOCUS_34240 3852 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 5060 3840 gene locus_tag LOCUS_34250 5060 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 >Feature sequence136 980 624 gene locus_tag LOCUS_34260 980 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 1621 1022 gene locus_tag LOCUS_34270 1621 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 2028 1777 gene locus_tag LOCUS_34280 2028 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 3297 2596 gene locus_tag LOCUS_34290 3297 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 4432 3533 gene locus_tag LOCUS_34300 4432 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 4577 4810 gene locus_tag LOCUS_34310 4577 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 >Feature sequence137 1888 743 gene locus_tag LOCUS_34320 1888 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 3021 1879 gene locus_tag LOCUS_34330 3021 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 3671 3946 gene locus_tag LOCUS_34340 3671 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 3953 5317 gene locus_tag LOCUS_34350 3953 5317 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102364993.1 protein_id gnl|my_center|LOCUS_34350 >Feature sequence138 1 339 gene locus_tag LOCUS_34360 1 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 403 726 gene locus_tag LOCUS_34370 403 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 846 2261 gene locus_tag LOCUS_34380 846 2261 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461040.1 protein_id gnl|my_center|LOCUS_34380 2341 2886 gene locus_tag LOCUS_34390 2341 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 3533 3138 gene locus_tag LOCUS_34400 3533 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34400 4459 3455 gene locus_tag LOCUS_34410 4459 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34410 4830 5165 gene locus_tag LOCUS_34420 4830 5165 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423377.1 protein_id gnl|my_center|LOCUS_34420 >Feature sequence139 245 1573 gene locus_tag LOCUS_34430 245 1573 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460717.1 protein_id gnl|my_center|LOCUS_34430 2297 1875 gene locus_tag LOCUS_34440 2297 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 2514 2290 gene locus_tag LOCUS_34450 2514 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 4229 2520 gene locus_tag LOCUS_34460 4229 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 4831 4466 gene locus_tag LOCUS_34470 4831 4466 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682305.1 protein_id gnl|my_center|LOCUS_34470 5069 4812 gene locus_tag LOCUS_34480 5069 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 >Feature sequence140 321 88 gene locus_tag LOCUS_34490 321 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 654 325 gene locus_tag LOCUS_34500 654 325 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461784.1 protein_id gnl|my_center|LOCUS_34500 898 719 gene locus_tag LOCUS_34510 898 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 1203 826 gene locus_tag LOCUS_34520 1203 826 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_34520 2537 1218 gene locus_tag LOCUS_34530 2537 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 2947 2726 gene locus_tag LOCUS_34540 2947 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 3365 3126 gene locus_tag LOCUS_34550 3365 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 4498 3431 gene locus_tag LOCUS_34560 4498 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 4946 4623 gene locus_tag LOCUS_34570 4946 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 5153 4971 gene locus_tag LOCUS_34580 5153 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 >Feature sequence141 405 758 gene locus_tag LOCUS_34590 gene emrE 405 758 CDS product SMR family multidrug efflux protein EmrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070440.1 protein_id gnl|my_center|LOCUS_34590 874 1425 gene locus_tag LOCUS_34600 gene ybcL 874 1425 CDS product Raf kinase inhibitor-like protein YbcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313946.1 protein_id gnl|my_center|LOCUS_34600 1435 2232 gene locus_tag LOCUS_34610 1435 2232 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879821.1 protein_id gnl|my_center|LOCUS_34610 3816 2734 gene locus_tag LOCUS_34620 3816 2734 CDS product porin OmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737290.1 protein_id gnl|my_center|LOCUS_34620 4998 4330 gene locus_tag LOCUS_34630 4998 4330 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334612.1 protein_id gnl|my_center|LOCUS_34630 >Feature sequence142 740 345 gene locus_tag LOCUS_34640 740 345 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230281.1 protein_id gnl|my_center|LOCUS_34640 1584 871 gene locus_tag LOCUS_34650 gene bdcA 1584 871 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500727.1 protein_id gnl|my_center|LOCUS_34650 1655 2248 gene locus_tag LOCUS_34660 1655 2248 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256656.1 protein_id gnl|my_center|LOCUS_34660 2393 2845 gene locus_tag LOCUS_34670 gene tabA 2393 2845 CDS product toxin-antitoxin biofilm protein TabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583470.1 protein_id gnl|my_center|LOCUS_34670 2968 4527 gene locus_tag LOCUS_34680 gene yjgL 2968 4527 CDS product protein YjgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036434.1 protein_id gnl|my_center|LOCUS_34680 <5135 4628 gene locus_tag LOCUS_34690 <5135 4628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000012907.1:ornithine carbamoyltransferase >Feature sequence143 716 504 gene locus_tag LOCUS_34700 716 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 1304 729 gene locus_tag LOCUS_34710 1304 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 1711 1373 gene locus_tag LOCUS_34720 1711 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 3451 2480 gene locus_tag LOCUS_34730 3451 2480 CDS product ParB/RepB/Spo0J family plasmid partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817028.1 protein_id gnl|my_center|LOCUS_34730 4617 3451 gene locus_tag LOCUS_34740 gene sopA 4617 3451 CDS product plasmid-partitioning protein SopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772446.1 protein_id gnl|my_center|LOCUS_34740 >Feature sequence144 317 1483 gene locus_tag LOCUS_34750 317 1483 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_34750 1545 1949 gene locus_tag LOCUS_34760 1545 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 2045 2755 gene locus_tag LOCUS_34770 2045 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 3600 2764 gene locus_tag LOCUS_34780 3600 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 3856 3629 gene locus_tag LOCUS_34790 3856 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 4076 4441 gene locus_tag LOCUS_34800 4076 4441 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004313943.1 protein_id gnl|my_center|LOCUS_34800 >Feature sequence145 187 1551 gene locus_tag LOCUS_34810 187 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 1551 2765 gene locus_tag LOCUS_34820 1551 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 2768 3154 gene locus_tag LOCUS_34830 2768 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 3175 3684 gene locus_tag LOCUS_34840 3175 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 3855 4052 gene locus_tag LOCUS_34850 3855 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 4772 4143 gene locus_tag LOCUS_34860 4772 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 >Feature sequence146 252 130 gene locus_tag LOCUS_34870 252 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 1042 2181 gene locus_tag LOCUS_34880 1042 2181 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475608.1 protein_id gnl|my_center|LOCUS_34880 2438 2364 gene locus_tag LOCUS_t00460 2438 2364 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2544 2473 gene locus_tag LOCUS_t00470 2544 2473 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4025 2811 gene locus_tag LOCUS_34890 4025 2811 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_34890 4910 4065 gene locus_tag LOCUS_34900 gene dapF 4910 4065 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_34900 >Feature sequence147 145 537 gene locus_tag LOCUS_34910 145 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 558 923 gene locus_tag LOCUS_34920 558 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 991 1827 gene locus_tag LOCUS_34930 991 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 2012 2377 gene locus_tag LOCUS_34940 2012 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 2370 4718 gene locus_tag LOCUS_34950 2370 4718 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_34950 >Feature sequence148 540 2318 gene locus_tag LOCUS_34960 540 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 2315 3034 gene locus_tag LOCUS_34970 2315 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 3567 3794 gene locus_tag LOCUS_34980 3567 3794 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272156.1 protein_id gnl|my_center|LOCUS_34980 3787 4146 gene locus_tag LOCUS_34990 3787 4146 CDS product cysteine-rich VLP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861105.1 protein_id gnl|my_center|LOCUS_34990 4261 4458 gene locus_tag LOCUS_35000 4261 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 >Feature sequence149 399 70 gene locus_tag LOCUS_35010 399 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 735 598 gene locus_tag LOCUS_35020 735 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 2308 740 gene locus_tag LOCUS_35030 2308 740 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861938.1 protein_id gnl|my_center|LOCUS_35030 3398 2754 gene locus_tag LOCUS_35040 3398 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35040 3556 3413 gene locus_tag LOCUS_35050 3556 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 4253 3528 gene locus_tag LOCUS_35060 4253 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35060 4516 4349 gene locus_tag LOCUS_35070 4516 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 >Feature sequence150 284 48 gene locus_tag LOCUS_35080 284 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 568 356 gene locus_tag LOCUS_35090 568 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 688 1866 gene locus_tag LOCUS_35100 688 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 3260 2187 gene locus_tag LOCUS_35110 3260 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 4036 3302 gene locus_tag LOCUS_35120 4036 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 4306 4094 gene locus_tag LOCUS_35130 4306 4094 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_35130 >Feature sequence151 2234 2395 gene locus_tag LOCUS_35140 2234 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 3047 2439 gene locus_tag LOCUS_35150 3047 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894741.1 protein_id gnl|my_center|LOCUS_35150 3225 3040 gene locus_tag LOCUS_35160 3225 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 3579 4052 gene locus_tag LOCUS_35170 3579 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35170 >Feature sequence152 975 121 gene locus_tag LOCUS_35180 975 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 1240 1034 gene locus_tag LOCUS_35190 1240 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 1695 2348 gene locus_tag LOCUS_35200 1695 2348 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616807.1 protein_id gnl|my_center|LOCUS_35200 2441 2698 gene locus_tag LOCUS_35210 gene pemI 2441 2698 CDS product type II toxin-antitoxin system antitoxin PemI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557619.1 protein_id gnl|my_center|LOCUS_35210 2700 3032 gene locus_tag LOCUS_35220 2700 3032 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439434.1 protein_id gnl|my_center|LOCUS_35220 3542 3147 gene locus_tag LOCUS_35230 3542 3147 CDS product plasmid partitioning/stability family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445931.1 protein_id gnl|my_center|LOCUS_35230 4501 3542 gene locus_tag LOCUS_35240 4501 3542 CDS product plasmid segregation protein ParM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921952.1 protein_id gnl|my_center|LOCUS_35240 >Feature sequence153 633 319 gene locus_tag LOCUS_35250 633 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 2092 641 gene locus_tag LOCUS_35260 2092 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 2331 2089 gene locus_tag LOCUS_35270 2331 2089 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_35270 <4812 2827 gene locus_tag LOCUS_35280 <4812 2827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861112.1:CHAP domain-containing protein >Feature sequence154 410 1957 gene locus_tag LOCUS_35290 gene guaA 410 1957 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_35290 3331 2801 gene locus_tag LOCUS_35300 3331 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 3512 3700 gene locus_tag LOCUS_35310 3512 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 3700 4650 gene locus_tag LOCUS_35320 3700 4650 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_35320 >Feature sequence155 608 387 gene locus_tag LOCUS_35330 608 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 877 608 gene locus_tag LOCUS_35340 877 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 1200 880 gene locus_tag LOCUS_35350 1200 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 2076 1213 gene locus_tag LOCUS_35360 2076 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35360 2955 2086 gene locus_tag LOCUS_35370 2955 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 3395 2973 gene locus_tag LOCUS_35380 3395 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 3878 3399 gene locus_tag LOCUS_35390 3878 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 4315 3875 gene locus_tag LOCUS_35400 4315 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 >Feature sequence156 973 1758 gene locus_tag LOCUS_35410 973 1758 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029046.1 protein_id gnl|my_center|LOCUS_35410 2358 2579 gene locus_tag LOCUS_35420 2358 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 2618 2857 gene locus_tag LOCUS_35430 2618 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 3172 4620 gene locus_tag LOCUS_35440 3172 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 >Feature sequence157 <1 1374 gene locus_tag LOCUS_35450 <1 1374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003429485.1:DNA-directed RNA polymerase subunit beta' 2484 1486 gene locus_tag LOCUS_35460 2484 1486 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002392183.1 protein_id gnl|my_center|LOCUS_35460 2840 3856 gene locus_tag LOCUS_35470 gene ptcA 2840 3856 CDS product putrescine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130905.1 protein_id gnl|my_center|LOCUS_35470 3883 4395 gene locus_tag LOCUS_35480 3883 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 >Feature sequence158 531 713 gene locus_tag LOCUS_35490 531 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 637 1467 gene locus_tag LOCUS_35500 637 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 1607 2797 gene locus_tag LOCUS_35510 1607 2797 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372834.1 protein_id gnl|my_center|LOCUS_35510 3861 3217 gene locus_tag LOCUS_35520 3861 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 4477 3875 gene locus_tag LOCUS_35530 4477 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 >Feature sequence159 <1 1101 gene locus_tag LOCUS_35540 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817202.1:FAD-dependent oxidoreductase note possible pseudo, frameshifted 1098 1259 gene locus_tag LOCUS_35550 1098 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 2037 1378 gene locus_tag LOCUS_35560 2037 1378 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_35560 2172 3092 gene locus_tag LOCUS_35570 2172 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 3103 3510 gene locus_tag LOCUS_35580 3103 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 3630 3830 gene locus_tag LOCUS_35590 3630 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 >Feature sequence160 149 1003 gene locus_tag LOCUS_35600 149 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 1174 1605 gene locus_tag LOCUS_35610 1174 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 2410 1592 gene locus_tag LOCUS_35620 2410 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 3895 3119 gene locus_tag LOCUS_35630 3895 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 4470 4321 gene locus_tag LOCUS_35640 4470 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 >Feature sequence161 350 1705 gene locus_tag LOCUS_35650 gene glmM 350 1705 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521474.1 protein_id gnl|my_center|LOCUS_35650 1785 2126 gene locus_tag LOCUS_35660 1785 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 2325 2146 gene locus_tag LOCUS_35670 2325 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 3996 2719 gene locus_tag LOCUS_35680 3996 2719 CDS product IS110-like element ISDha12 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808714.1 protein_id gnl|my_center|LOCUS_35680 >Feature sequence162 1 1665 gene locus_tag LOCUS_35690 1 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 1726 2766 gene locus_tag LOCUS_35700 gene prfB 1726 2766 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096001716.1 protein_id gnl|my_center|LOCUS_35700 3236 3736 gene locus_tag LOCUS_35710 3236 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35710 >Feature sequence163 97 417 gene locus_tag LOCUS_35720 97 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 1253 540 gene locus_tag LOCUS_35730 1253 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 1975 1361 gene locus_tag LOCUS_35740 1975 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 2949 2014 gene locus_tag LOCUS_35750 2949 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 3782 2964 gene locus_tag LOCUS_35760 3782 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 4015 3779 gene locus_tag LOCUS_35770 4015 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 >Feature sequence164 1869 91 gene locus_tag LOCUS_35780 1869 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 1978 1850 gene locus_tag LOCUS_35790 1978 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 2731 2015 gene locus_tag LOCUS_35800 2731 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 3288 2746 gene locus_tag LOCUS_35810 3288 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 4188 3301 gene locus_tag LOCUS_35820 4188 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 >Feature sequence165 287 949 gene locus_tag LOCUS_35830 287 949 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016732.1 protein_id gnl|my_center|LOCUS_35830 967 1500 gene locus_tag LOCUS_35840 967 1500 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547298.1 protein_id gnl|my_center|LOCUS_35840 1516 1953 gene locus_tag LOCUS_35850 1516 1953 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673332.1 protein_id gnl|my_center|LOCUS_35850 1955 2560 gene locus_tag LOCUS_35860 1955 2560 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948953.1 protein_id gnl|my_center|LOCUS_35860 2647 2787 gene locus_tag LOCUS_35870 2647 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 4122 2953 gene locus_tag LOCUS_35880 4122 2953 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_35880 >Feature sequence166 581 285 gene locus_tag LOCUS_35890 581 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 861 703 gene locus_tag LOCUS_35900 861 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 1477 881 gene locus_tag LOCUS_35910 1477 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 2192 1854 gene locus_tag LOCUS_35920 2192 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 3122 2295 gene locus_tag LOCUS_35930 3122 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 3801 3373 gene locus_tag LOCUS_35940 3801 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 >Feature sequence167 1194 121 gene locus_tag LOCUS_35950 1194 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 2195 1317 gene locus_tag LOCUS_35960 2195 1317 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_35960 2913 2302 gene locus_tag LOCUS_35970 2913 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 3648 2929 gene locus_tag LOCUS_35980 3648 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 4138 3638 gene locus_tag LOCUS_35990 4138 3638 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_35990 >Feature sequence168 39 182 gene locus_tag LOCUS_36000 39 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 187 345 gene locus_tag LOCUS_36010 187 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 368 652 gene locus_tag LOCUS_36020 368 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 697 858 gene locus_tag LOCUS_36030 697 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 1056 805 gene locus_tag LOCUS_36040 1056 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 1505 1212 gene locus_tag LOCUS_36050 1505 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 1879 3123 gene locus_tag LOCUS_36060 1879 3123 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163760282.1 protein_id gnl|my_center|LOCUS_36060 3126 3929 gene locus_tag LOCUS_36070 3126 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 >Feature sequence169 848 2824 gene locus_tag LOCUS_36080 848 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 3605 3447 gene locus_tag LOCUS_36090 3605 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 >Feature sequence170 590 2134 gene locus_tag LOCUS_36100 gene istA 590 2134 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_36100 2134 2928 gene locus_tag LOCUS_36110 gene istB 2134 2928 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_36110 2925 3113 gene locus_tag LOCUS_36120 2925 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 3905 4036 gene locus_tag LOCUS_36130 3905 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 >Feature sequence171 102 662 gene locus_tag LOCUS_36140 102 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 655 876 gene locus_tag LOCUS_36150 655 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 974 1207 gene locus_tag LOCUS_36160 974 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 1229 1441 gene locus_tag LOCUS_36170 1229 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 1457 1690 gene locus_tag LOCUS_36180 1457 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 1703 1954 gene locus_tag LOCUS_36190 1703 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 1967 3226 gene locus_tag LOCUS_36200 1967 3226 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006906966.1 protein_id gnl|my_center|LOCUS_36200 3386 3871 gene locus_tag LOCUS_36210 3386 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 >Feature sequence172 1287 349 gene locus_tag LOCUS_36220 gene hypT 1287 349 CDS product hypochlorite stress DNA-binding transcriptional regulator HypT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789104.1 protein_id gnl|my_center|LOCUS_36220 1439 1287 gene locus_tag LOCUS_36230 1439 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 1638 2357 gene locus_tag LOCUS_36240 1638 2357 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677245.1 protein_id gnl|my_center|LOCUS_36240 2423 3721 gene locus_tag LOCUS_36250 2423 3721 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262203.1 protein_id gnl|my_center|LOCUS_36250 >Feature sequence173 1454 21 gene locus_tag LOCUS_36260 1454 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 2184 1570 gene locus_tag LOCUS_36270 2184 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 2861 2196 gene locus_tag LOCUS_36280 2861 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 3616 3305 gene locus_tag LOCUS_36290 3616 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 3888 3763 gene locus_tag LOCUS_36300 3888 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 >Feature sequence174 <1 817 gene locus_tag LOCUS_36310 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860792.1:DEAD/DEAH box helicase family protein 1123 1710 gene locus_tag LOCUS_36320 1123 1710 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402394.1 protein_id gnl|my_center|LOCUS_36320 3114 1963 gene locus_tag LOCUS_36330 3114 1963 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138390504.1 protein_id gnl|my_center|LOCUS_36330 3970 3107 gene locus_tag LOCUS_36340 3970 3107 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_36340 >Feature sequence175 517 248 gene locus_tag LOCUS_36350 517 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 965 597 gene locus_tag LOCUS_36360 965 597 CDS product DUF2528 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065374.1 protein_id gnl|my_center|LOCUS_36360 1609 1160 gene locus_tag LOCUS_36370 1609 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 1919 1668 gene locus_tag LOCUS_36380 1919 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394299.1 protein_id gnl|my_center|LOCUS_36380 2260 1928 gene locus_tag LOCUS_36390 2260 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 3210 2557 gene locus_tag LOCUS_36400 3210 2557 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872385.1 protein_id gnl|my_center|LOCUS_36400 3328 3543 gene locus_tag LOCUS_36410 3328 3543 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067727.1 protein_id gnl|my_center|LOCUS_36410 3700 3927 gene locus_tag LOCUS_36420 3700 3927 CDS product lambda phage CII family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251072.1 protein_id gnl|my_center|LOCUS_36420 >Feature sequence176 445 263 gene locus_tag LOCUS_36430 445 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 744 475 gene locus_tag LOCUS_36440 744 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 1003 737 gene locus_tag LOCUS_36450 1003 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 1434 1832 gene locus_tag LOCUS_36460 1434 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648588.1 protein_id gnl|my_center|LOCUS_36460 1847 2833 gene locus_tag LOCUS_36470 1847 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 2890 3555 gene locus_tag LOCUS_36480 2890 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 >Feature sequence177 448 2124 gene locus_tag LOCUS_36490 448 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 >Feature sequence178 97 285 gene locus_tag LOCUS_36500 gene dicB 97 285 CDS product cell division inhibition protein DicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449175.1 protein_id gnl|my_center|LOCUS_36500 282 470 gene locus_tag LOCUS_36510 282 470 CDS product DUF1482 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199485.1 protein_id gnl|my_center|LOCUS_36510 566 3037 gene locus_tag LOCUS_36520 566 3037 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034474.1 protein_id gnl|my_center|LOCUS_36520 >Feature sequence179 2018 762 gene locus_tag LOCUS_36530 2018 762 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006906966.1 protein_id gnl|my_center|LOCUS_36530 2239 2030 gene locus_tag LOCUS_36540 2239 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 2561 2349 gene locus_tag LOCUS_36550 2561 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 2917 2564 gene locus_tag LOCUS_36560 2917 2564 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_36560 3542 2973 gene locus_tag LOCUS_36570 3542 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 3723 3875 gene locus_tag LOCUS_36580 3723 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 >Feature sequence180 439 308 gene locus_tag LOCUS_36590 439 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 >Feature sequence181 826 638 gene locus_tag LOCUS_36600 826 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 2215 950 gene locus_tag LOCUS_36610 gene mobV 2215 950 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122833.1 protein_id gnl|my_center|LOCUS_36610 3418 2396 gene locus_tag LOCUS_36620 3418 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 3590 3399 gene locus_tag LOCUS_36630 3590 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 >Feature sequence182 1225 2445 gene locus_tag LOCUS_36640 1225 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 2445 3248 gene locus_tag LOCUS_36650 2445 3248 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417458.1 protein_id gnl|my_center|LOCUS_36650 3260 3649 gene locus_tag LOCUS_36660 3260 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 >Feature sequence183 203 2461 gene locus_tag LOCUS_36670 203 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 2492 2824 gene locus_tag LOCUS_36680 2492 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 2821 3636 gene locus_tag LOCUS_36690 2821 3636 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459342.1 protein_id gnl|my_center|LOCUS_36690 >Feature sequence184 209 913 gene locus_tag LOCUS_36700 209 913 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_36700 929 3496 gene locus_tag LOCUS_36710 929 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 >Feature sequence185 1136 195 gene locus_tag LOCUS_36720 1136 195 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641267.1 protein_id gnl|my_center|LOCUS_36720 1422 1246 gene locus_tag LOCUS_36730 1422 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 1804 1439 gene locus_tag LOCUS_36740 gene rpsM 1804 1439 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090785.1 protein_id gnl|my_center|LOCUS_36740 2605 1958 gene locus_tag LOCUS_36750 2605 1958 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_36750 3757 2627 gene locus_tag LOCUS_36760 gene secY 3757 2627 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359350.1 protein_id gnl|my_center|LOCUS_36760 >Feature sequence186 355 483 gene locus_tag LOCUS_36770 355 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 619 1665 gene locus_tag LOCUS_36780 619 1665 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 protein_id gnl|my_center|LOCUS_36780 2166 2387 gene locus_tag LOCUS_36790 2166 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 2549 3484 gene locus_tag LOCUS_36800 2549 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 >Feature sequence187 378 515 gene locus_tag LOCUS_36810 378 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 1412 564 gene locus_tag LOCUS_36820 1412 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 2126 1548 gene locus_tag LOCUS_36830 2126 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 <3738 2148 gene locus_tag LOCUS_36840 <3738 2148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243665.1:tRNA nuclease WapA >Feature sequence188 <1 1320 gene locus_tag LOCUS_36850 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022343.1:helix-turn-helix domain-containing protein 1370 1549 gene locus_tag LOCUS_36860 1370 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 2338 1889 gene locus_tag LOCUS_36870 2338 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 2519 2713 gene locus_tag LOCUS_36880 2519 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 2716 3666 gene locus_tag LOCUS_36890 2716 3666 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_36890 >Feature sequence189 2122 2634 gene locus_tag LOCUS_36900 2122 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 2797 3543 gene locus_tag LOCUS_36910 gene fabG 2797 3543 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_36910 >Feature sequence190 1154 1573 gene locus_tag LOCUS_36920 1154 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 2660 2259 gene locus_tag LOCUS_36930 2660 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 >Feature sequence191 436 92 gene locus_tag LOCUS_36940 436 92 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380304.1 protein_id gnl|my_center|LOCUS_36940 740 558 gene locus_tag LOCUS_36950 740 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 1513 668 gene locus_tag LOCUS_36960 1513 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 3562 1760 gene locus_tag LOCUS_36970 3562 1760 CDS product IS1182-like element IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284571.1 protein_id gnl|my_center|LOCUS_36970 >Feature sequence192 518 1525 gene locus_tag LOCUS_36980 518 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 1522 2973 gene locus_tag LOCUS_36990 1522 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 3505 3140 gene locus_tag LOCUS_37000 3505 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 >Feature sequence193 1138 86 gene locus_tag LOCUS_37010 1138 86 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764768.1 protein_id gnl|my_center|LOCUS_37010 1316 1122 gene locus_tag LOCUS_37020 1316 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37020 2050 1313 gene locus_tag LOCUS_37030 2050 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37030 3281 2040 gene locus_tag LOCUS_37040 3281 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 >Feature sequence194 856 263 gene locus_tag LOCUS_37050 856 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 1963 3456 gene locus_tag LOCUS_37060 1963 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 >Feature sequence195 229 1350 gene locus_tag LOCUS_37070 229 1350 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188697727.1 protein_id gnl|my_center|LOCUS_37070 2346 3377 gene locus_tag LOCUS_37080 2346 3377 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003321939.1 protein_id gnl|my_center|LOCUS_37080 >Feature sequence196 41 1030 gene locus_tag LOCUS_37090 41 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 1056 1205 gene locus_tag LOCUS_37100 1056 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 1371 3014 gene locus_tag LOCUS_37110 1371 3014 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051765.1 protein_id gnl|my_center|LOCUS_37110 >Feature sequence197 447 2654 gene locus_tag LOCUS_37120 gene katG 447 2654 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209433.1 protein_id gnl|my_center|LOCUS_37120 2698 3087 gene locus_tag LOCUS_37130 2698 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 >Feature sequence198 152 730 gene locus_tag LOCUS_37140 152 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 1024 839 gene locus_tag LOCUS_37150 1024 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 2264 1275 gene locus_tag LOCUS_37160 gene rlmN 2264 1275 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583788.1 protein_id gnl|my_center|LOCUS_37160 2522 2746 gene locus_tag LOCUS_37170 2522 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 2809 3171 gene locus_tag LOCUS_37180 2809 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 >Feature sequence199 820 239 gene locus_tag LOCUS_37190 820 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 1679 918 gene locus_tag LOCUS_37200 gene istB 1679 918 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967409.1 protein_id gnl|my_center|LOCUS_37200 3238 1676 gene locus_tag LOCUS_37210 gene istA 3238 1676 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_37210 >Feature sequence200 347 673 gene locus_tag LOCUS_37220 347 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 700 903 gene locus_tag LOCUS_37230 700 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 900 1958 gene locus_tag LOCUS_37240 900 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 2169 2333 gene locus_tag LOCUS_37250 2169 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 2387 2632 gene locus_tag LOCUS_37260 2387 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 3075 2683 gene locus_tag LOCUS_37270 3075 2683 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_37270 3260 3078 gene locus_tag LOCUS_37280 3260 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 >Feature sequence201 393 85 gene locus_tag LOCUS_37290 393 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 878 393 gene locus_tag LOCUS_37300 878 393 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_37300 1140 913 gene locus_tag LOCUS_37310 1140 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 1460 1179 gene locus_tag LOCUS_37320 1460 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 1857 1471 gene locus_tag LOCUS_37330 1857 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 2427 1912 gene locus_tag LOCUS_37340 2427 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 <3350 2439 gene locus_tag LOCUS_37350 <3350 2439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288806.1:ParB/RepB/Spo0J family partition protein >Feature sequence202 65 1045 gene locus_tag LOCUS_37360 65 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 1048 1896 gene locus_tag LOCUS_37370 1048 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 2010 3122 gene locus_tag LOCUS_37380 2010 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 >Feature sequence203 248 619 gene locus_tag LOCUS_37390 248 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 609 971 gene locus_tag LOCUS_37400 gene tnpB 609 971 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748682.1 protein_id gnl|my_center|LOCUS_37400 1262 2881 gene locus_tag LOCUS_37410 1262 2881 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461096.1 protein_id gnl|my_center|LOCUS_37410 >Feature sequence204 514 128 gene locus_tag LOCUS_37420 514 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 825 2393 gene locus_tag LOCUS_37430 825 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 >Feature sequence205 698 321 gene locus_tag LOCUS_37440 698 321 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_37440 2743 623 gene locus_tag LOCUS_37450 2743 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 >Feature sequence206 <1 609 gene locus_tag LOCUS_37460 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002324544.1:site-specific resolvase TndX note possible pseudo, frameshifted 678 1247 gene locus_tag LOCUS_37470 678 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 1606 2214 gene locus_tag LOCUS_37480 1606 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 2308 2481 gene locus_tag LOCUS_37490 2308 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 2826 3086 gene locus_tag LOCUS_37500 2826 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 >Feature sequence207 2145 1375 gene locus_tag LOCUS_37510 2145 1375 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435927.1 protein_id gnl|my_center|LOCUS_37510 2615 2142 gene locus_tag LOCUS_37520 2615 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 2760 3182 gene locus_tag LOCUS_37530 2760 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 >Feature sequence208 101 2257 gene locus_tag LOCUS_37540 101 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 2323 2769 gene locus_tag LOCUS_37550 2323 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 >Feature sequence209 2037 151 gene locus_tag LOCUS_37560 gene ltrA 2037 151 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109539.1 protein_id gnl|my_center|LOCUS_37560 3038 3163 gene locus_tag LOCUS_37570 3038 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 >Feature sequence210 >Feature sequence211 1246 1088 gene locus_tag LOCUS_37580 1246 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 2133 2014 gene locus_tag LOCUS_37590 2133 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 2317 2487 gene locus_tag LOCUS_37600 2317 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 >Feature sequence212 1150 1362 gene locus_tag LOCUS_37610 1150 1362 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905235.1 protein_id gnl|my_center|LOCUS_37610 1378 2646 gene locus_tag LOCUS_37620 1378 2646 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291561.1 protein_id gnl|my_center|LOCUS_37620 >Feature sequence213 1116 100 gene locus_tag LOCUS_37630 1116 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 1238 2266 gene locus_tag LOCUS_37640 1238 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 2640 2395 gene locus_tag LOCUS_37650 2640 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 >Feature sequence214 564 1148 gene locus_tag LOCUS_37660 564 1148 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361110.1 protein_id gnl|my_center|LOCUS_37660 1610 1173 gene locus_tag LOCUS_37670 1610 1173 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705176.1 protein_id gnl|my_center|LOCUS_37670 2673 2425 gene locus_tag LOCUS_37680 2673 2425 CDS product DinI-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217553.1 protein_id gnl|my_center|LOCUS_37680 >Feature sequence215 446 1162 gene locus_tag LOCUS_37690 446 1162 CDS product replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222008.1 protein_id gnl|my_center|LOCUS_37690 1774 2850 gene locus_tag LOCUS_37700 1774 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 >Feature sequence216 1420 950 gene locus_tag LOCUS_37710 1420 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 2598 1414 gene locus_tag LOCUS_37720 2598 1414 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103065.1 protein_id gnl|my_center|LOCUS_37720 >Feature sequence217 1678 1121 gene locus_tag LOCUS_37730 1678 1121 CDS product LexA family transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848748.1 protein_id gnl|my_center|LOCUS_37730 1886 2086 gene locus_tag LOCUS_37740 1886 2086 CDS product YdaS family helix-turn-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649477.1 protein_id gnl|my_center|LOCUS_37740 2130 2681 gene locus_tag LOCUS_37750 gene ymfL 2130 2681 CDS product protein YmfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515848.1 protein_id gnl|my_center|LOCUS_37750 >Feature sequence218 385 534 gene locus_tag LOCUS_37760 385 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 570 2420 gene locus_tag LOCUS_37770 570 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 >Feature sequence219 2186 654 gene locus_tag LOCUS_37780 gene miaB 2186 654 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_37780 2394 2176 gene locus_tag LOCUS_37790 2394 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 3056 2865 gene locus_tag LOCUS_37800 3056 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 >Feature sequence220 2399 2241 gene locus_tag LOCUS_37810 2399 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 >Feature sequence221 745 407 gene locus_tag LOCUS_37820 745 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 1063 758 gene locus_tag LOCUS_37830 gene trxA 1063 758 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_37830 1729 1169 gene locus_tag LOCUS_37840 1729 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 2606 2061 gene locus_tag LOCUS_37850 2606 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 >Feature sequence222 1182 1039 gene locus_tag LOCUS_37860 1182 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 >Feature sequence223 394 987 gene locus_tag LOCUS_37870 gene rclC 394 987 CDS product reactive chlorine species resistance protein RclC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298546.1 protein_id gnl|my_center|LOCUS_37870 2016 1147 gene locus_tag LOCUS_37880 2016 1147 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295799.1 protein_id gnl|my_center|LOCUS_37880 >Feature sequence224 944 816 gene locus_tag LOCUS_37890 944 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 1652 1774 gene locus_tag LOCUS_37900 1652 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 >Feature sequence225 237 1781 gene locus_tag LOCUS_37910 gene istA 237 1781 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083940014.1 protein_id gnl|my_center|LOCUS_37910 1774 2547 gene locus_tag LOCUS_37920 gene istB 1774 2547 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459339.1 protein_id gnl|my_center|LOCUS_37920 2540 2782 gene locus_tag LOCUS_37930 2540 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 >Feature sequence226 553 1143 gene locus_tag LOCUS_37940 553 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 1761 2864 gene locus_tag LOCUS_37950 1761 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 >Feature sequence227 1087 389 gene locus_tag LOCUS_37960 gene nleD 1087 389 CDS product T3SS effector zinc metalloprotease NleD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247925.1 protein_id gnl|my_center|LOCUS_37960 2466 1591 gene locus_tag LOCUS_37970 gene ospB 2466 1591 CDS product type III secretion system effector OspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463140.1 protein_id gnl|my_center|LOCUS_37970 2656 2522 gene locus_tag LOCUS_37980 2656 2522 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303980.1 protein_id gnl|my_center|LOCUS_37980 >Feature sequence228 707 1054 gene locus_tag LOCUS_37990 707 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 1051 1434 gene locus_tag LOCUS_38000 1051 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 1875 2087 gene locus_tag LOCUS_38010 1875 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 2129 2653 gene locus_tag LOCUS_38020 2129 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 >Feature sequence229 507 1394 gene locus_tag LOCUS_38030 507 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 1387 2547 gene locus_tag LOCUS_38040 1387 2547 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138390504.1 protein_id gnl|my_center|LOCUS_38040 >Feature sequence230 229 399 gene locus_tag LOCUS_38050 229 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 537 1925 gene locus_tag LOCUS_38060 537 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 1922 2095 gene locus_tag LOCUS_38070 1922 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 2802 2182 gene locus_tag LOCUS_38080 2802 2182 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016701.1 protein_id gnl|my_center|LOCUS_38080 >Feature sequence231 103 282 gene locus_tag LOCUS_38090 103 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 854 360 gene locus_tag LOCUS_38100 854 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 1583 2386 gene locus_tag LOCUS_38110 1583 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 2349 2735 gene locus_tag LOCUS_38120 2349 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 >Feature sequence232 699 2489 gene locus_tag LOCUS_38130 699 2489 CDS product reverse transcriptase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461915.1 protein_id gnl|my_center|LOCUS_38130 >Feature sequence233 934 1314 gene locus_tag LOCUS_38140 934 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 1376 1960 gene locus_tag LOCUS_38150 1376 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 2358 2675 gene locus_tag LOCUS_38160 2358 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 >Feature sequence234 839 681 gene locus_tag LOCUS_38170 839 681 CDS product DUF3927 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216636.1 protein_id gnl|my_center|LOCUS_38170 1641 925 gene locus_tag LOCUS_38180 1641 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299184.1 protein_id gnl|my_center|LOCUS_38180 2544 1921 gene locus_tag LOCUS_38190 2544 1921 CDS product antitermination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235461.1 protein_id gnl|my_center|LOCUS_38190 >Feature sequence235 557 261 gene locus_tag LOCUS_38200 557 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 709 1389 gene locus_tag LOCUS_38210 709 1389 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855686.1 protein_id gnl|my_center|LOCUS_38210 1469 1813 gene locus_tag LOCUS_38220 1469 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38220 1859 2338 gene locus_tag LOCUS_38230 1859 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38230 >Feature sequence236 711 1346 gene locus_tag LOCUS_38240 711 1346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571333.1 protein_id gnl|my_center|LOCUS_38240 1424 1762 gene locus_tag LOCUS_38250 1424 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 1978 2580 gene locus_tag LOCUS_38260 gene lexA 1978 2580 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_38260 >Feature sequence237 1475 1338 gene locus_tag LOCUS_38270 1475 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 >Feature sequence238 238 2556 gene locus_tag LOCUS_38280 238 2556 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291467.1 protein_id gnl|my_center|LOCUS_38280 >Feature sequence239 353 709 gene locus_tag LOCUS_38290 gene spoVAE 353 709 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_38290 732 1070 gene locus_tag LOCUS_38300 732 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 1393 1214 gene locus_tag LOCUS_38310 1393 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 2019 1450 gene locus_tag LOCUS_38320 2019 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 >Feature sequence240 2114 1950 gene locus_tag LOCUS_38330 2114 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 >Feature sequence241 <1 739 gene locus_tag LOCUS_38340 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002355976.1:AAA family ATPase 696 1631 gene locus_tag LOCUS_38350 696 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 1643 2158 gene locus_tag LOCUS_38360 1643 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 >Feature sequence242 1792 758 gene locus_tag LOCUS_38370 1792 758 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140241.1 protein_id gnl|my_center|LOCUS_38370 >Feature sequence243 638 2032 gene locus_tag LOCUS_38380 638 2032 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226375.1 protein_id gnl|my_center|LOCUS_38380 2422 2216 gene locus_tag LOCUS_38390 2422 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 >Feature sequence244 300 839 gene locus_tag LOCUS_38400 300 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 2101 1583 gene locus_tag LOCUS_38410 2101 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 >Feature sequence245 140 469 gene locus_tag LOCUS_38420 140 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 466 978 gene locus_tag LOCUS_38430 466 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 >Feature sequence246 892 86 gene locus_tag LOCUS_38440 892 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 1583 1774 gene locus_tag LOCUS_38450 1583 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 2158 2322 gene locus_tag LOCUS_38460 2158 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38460 >Feature sequence247 605 1048 gene locus_tag LOCUS_38470 605 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 1488 2120 gene locus_tag LOCUS_38480 1488 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 >Feature sequence248 182 1888 gene locus_tag LOCUS_38490 182 1888 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090936308.1 protein_id gnl|my_center|LOCUS_38490 1903 2136 gene locus_tag LOCUS_38500 1903 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 2136 2411 gene locus_tag LOCUS_38510 2136 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 >Feature sequence249 475 245 gene locus_tag LOCUS_38520 475 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 1969 557 gene locus_tag LOCUS_38530 1969 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 2203 2036 gene locus_tag LOCUS_38540 2203 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 >Feature sequence250 239 469 gene locus_tag LOCUS_38550 239 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 450 761 gene locus_tag LOCUS_38560 450 761 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396712.1 protein_id gnl|my_center|LOCUS_38560 1140 1991 gene locus_tag LOCUS_38570 1140 1991 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_38570 2011 2349 gene locus_tag LOCUS_38580 2011 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 >Feature sequence251 86 355 gene locus_tag LOCUS_38590 86 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 623 405 gene locus_tag LOCUS_38600 623 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 1082 759 gene locus_tag LOCUS_38610 1082 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 1946 1131 gene locus_tag LOCUS_38620 1946 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 >Feature sequence252 2382 1186 gene locus_tag LOCUS_38630 2382 1186 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287705.1 protein_id gnl|my_center|LOCUS_38630 >Feature sequence253 >Feature sequence254 827 612 gene locus_tag LOCUS_38640 827 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 1110 961 gene locus_tag LOCUS_38650 1110 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 1677 1186 gene locus_tag LOCUS_38660 1677 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 1943 1710 gene locus_tag LOCUS_38670 1943 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 2167 1970 gene locus_tag LOCUS_38680 2167 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 >Feature sequence255 227 385 gene locus_tag LOCUS_38690 227 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 521 748 gene locus_tag LOCUS_38700 521 748 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885335.1 protein_id gnl|my_center|LOCUS_38700 796 1257 gene locus_tag LOCUS_38710 796 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 2162 1341 gene locus_tag LOCUS_38720 2162 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 >Feature sequence256 >Feature sequence257 438 569 gene locus_tag LOCUS_38730 438 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 752 2224 gene locus_tag LOCUS_38740 752 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 >Feature sequence258 480 785 gene locus_tag LOCUS_38750 480 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 820 1620 gene locus_tag LOCUS_38760 820 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 1657 2172 gene locus_tag LOCUS_38770 1657 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 >Feature sequence259 662 114 gene locus_tag LOCUS_38780 662 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 2067 733 gene locus_tag LOCUS_38790 gene glnA 2067 733 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_38790 >Feature sequence260 970 140 gene locus_tag LOCUS_38800 970 140 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072850.1 protein_id gnl|my_center|LOCUS_38800 1458 1075 gene locus_tag LOCUS_38810 gene yhhH 1458 1075 CDS product protein YhhH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271686.1 protein_id gnl|my_center|LOCUS_38810 >Feature sequence261 131 922 gene locus_tag LOCUS_38820 131 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 >Feature sequence262 1072 29 gene locus_tag LOCUS_38830 1072 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 1893 1126 gene locus_tag LOCUS_38840 1893 1126 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116438533.1 protein_id gnl|my_center|LOCUS_38840 >Feature sequence263 1157 2094 gene locus_tag LOCUS_r00010 1157 2094 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 59 percent of the 16S ribosomal RNA >Feature sequence264 185 370 gene locus_tag LOCUS_38850 185 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 408 1634 gene locus_tag LOCUS_38860 408 1634 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610375.1 protein_id gnl|my_center|LOCUS_38860 2105 2230 gene locus_tag LOCUS_38870 2105 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 >Feature sequence265 1646 1482 gene locus_tag LOCUS_38880 1646 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 >Feature sequence266 140 1441 gene locus_tag LOCUS_38890 140 1441 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_38890 1918 1640 gene locus_tag LOCUS_38900 1918 1640 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613391.1 protein_id gnl|my_center|LOCUS_38900 2174 1902 gene locus_tag LOCUS_38910 2174 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 >Feature sequence267 211 38 gene locus_tag LOCUS_38920 211 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 628 822 gene locus_tag LOCUS_38930 628 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 >Feature sequence268 816 265 gene locus_tag LOCUS_38940 816 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 1106 777 gene locus_tag LOCUS_38950 gene mobC 1106 777 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861100.1 protein_id gnl|my_center|LOCUS_38950 1648 1292 gene locus_tag LOCUS_38960 1648 1292 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861099.1 protein_id gnl|my_center|LOCUS_38960 2047 2232 gene locus_tag LOCUS_38970 2047 2232 CDS product cysteine-rich KTR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012962334.1 protein_id gnl|my_center|LOCUS_38970 >Feature sequence269 665 273 gene locus_tag LOCUS_38980 665 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 1045 1425 gene locus_tag LOCUS_38990 1045 1425 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_38990 1750 2202 gene locus_tag LOCUS_39000 1750 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 >Feature sequence270 1354 1076 gene locus_tag LOCUS_39010 1354 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007252.1 protein_id gnl|my_center|LOCUS_39010 <2240 1646 gene locus_tag LOCUS_39020 <2240 1646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014966189.1:RHS element core protein >Feature sequence271 523 1740 gene locus_tag LOCUS_39030 523 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 1740 1979 gene locus_tag LOCUS_39040 1740 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 >Feature sequence272 1599 70 gene locus_tag LOCUS_39050 1599 70 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_39050 2087 1596 gene locus_tag LOCUS_39060 2087 1596 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_39060 >Feature sequence273 207 854 gene locus_tag LOCUS_39070 207 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 1089 1895 gene locus_tag LOCUS_39080 1089 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 1978 2118 gene locus_tag LOCUS_39090 1978 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 >Feature sequence274 1652 750 gene locus_tag LOCUS_39100 1652 750 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002448.1 protein_id gnl|my_center|LOCUS_39100 2175 1861 gene locus_tag LOCUS_39110 2175 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 >Feature sequence275 1316 969 gene locus_tag LOCUS_39120 1316 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 >Feature sequence276 1266 1018 gene locus_tag LOCUS_39130 1266 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 >Feature sequence277 418 89 gene locus_tag LOCUS_39140 418 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 570 836 gene locus_tag LOCUS_39150 570 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 960 1109 gene locus_tag LOCUS_39160 960 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 1563 1835 gene locus_tag LOCUS_39170 1563 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 >Feature sequence278 622 254 gene locus_tag LOCUS_39180 622 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 1412 726 gene locus_tag LOCUS_39190 1412 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 2117 1695 gene locus_tag LOCUS_39200 2117 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 >Feature sequence279 213 1607 gene locus_tag LOCUS_39210 213 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 1767 2063 gene locus_tag LOCUS_39220 1767 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 >Feature sequence280 92 508 gene locus_tag LOCUS_39230 92 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 531 740 gene locus_tag LOCUS_39240 531 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 754 1836 gene locus_tag LOCUS_39250 754 1836 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759897.1 protein_id gnl|my_center|LOCUS_39250 >Feature sequence281 1721 240 gene locus_tag LOCUS_39260 1721 240 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076996129.1 protein_id gnl|my_center|LOCUS_39260 >Feature sequence282 237 88 gene locus_tag LOCUS_39270 237 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 469 347 gene locus_tag LOCUS_39280 469 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 794 1753 gene locus_tag LOCUS_39290 794 1753 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963142.1 protein_id gnl|my_center|LOCUS_39290 >Feature sequence283 225 76 gene locus_tag LOCUS_39300 225 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 1442 321 gene locus_tag LOCUS_39310 1442 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 >Feature sequence284 1461 862 gene locus_tag LOCUS_39320 1461 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 2009 1458 gene locus_tag LOCUS_39330 2009 1458 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762480.1 protein_id gnl|my_center|LOCUS_39330 >Feature sequence285 <1 809 gene locus_tag LOCUS_39340 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007869717.1:50S ribosome-binding GTPase 821 1606 gene locus_tag LOCUS_39350 821 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 2045 1827 gene locus_tag LOCUS_39360 2045 1827 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703404.1 protein_id gnl|my_center|LOCUS_39360 >Feature sequence286 1479 52 gene locus_tag LOCUS_39370 1479 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 1691 1506 gene locus_tag LOCUS_39380 1691 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 1947 1639 gene locus_tag LOCUS_39390 1947 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 >Feature sequence287 1199 1348 gene locus_tag LOCUS_39400 1199 1348 CDS product Hok/Gef family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012368889.1 protein_id gnl|my_center|LOCUS_39400 1632 1889 gene locus_tag LOCUS_39410 gene repA 1632 1889 CDS product replication regulatory protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083845.1 protein_id gnl|my_center|LOCUS_39410 >Feature sequence288 650 1834 gene locus_tag LOCUS_39420 650 1834 CDS product IS630-like element ISMsm5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894950.1 protein_id gnl|my_center|LOCUS_39420 >Feature sequence289 548 1777 gene locus_tag LOCUS_39430 548 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 >Feature sequence290 281 90 gene locus_tag LOCUS_39440 281 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 703 1212 gene locus_tag LOCUS_39450 703 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39450 1218 1385 gene locus_tag LOCUS_39460 1218 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39460 1419 1760 gene locus_tag LOCUS_39470 1419 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39470 >Feature sequence291 1499 213 gene locus_tag LOCUS_39480 1499 213 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063648.1 protein_id gnl|my_center|LOCUS_39480 1787 1533 gene locus_tag LOCUS_39490 gene xisR 1787 1533 CDS product excisionase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193437.1 protein_id gnl|my_center|LOCUS_39490 1940 1806 gene locus_tag LOCUS_39500 1940 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030156.1 protein_id gnl|my_center|LOCUS_39500 >Feature sequence292 1030 233 gene locus_tag LOCUS_39510 1030 233 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905232.1 protein_id gnl|my_center|LOCUS_39510 1196 1023 gene locus_tag LOCUS_39520 1196 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 1779 1156 gene locus_tag LOCUS_39530 1779 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 >Feature sequence293